Obesity Medicine 32 (2022) 100414

Contents lists available at ScienceDirect

Obesity Medicine
journal homepage: www.elsevier.com/locate/obmed

Synbiotics intake improves disturbed metabolism in a rat model of

high fat diet-induced obesity; A potential role of adipose
tissue browning
Hala M. Mahmoud a, Reem M. Sallam b, a, *, Christeen Medhat Ayad Henin a,
Amr S. Moustafa a, Reham Hussein Mohamed c, Magda I. Mohamad a
a
Medical Biochemistry and Molecular Biology, Faculty of Medicine, Ain Shams University. Cairo, Egypt
b
Basic Medical Sciences, Faculty of Medicine, Galala University, Suez, Egypt
c
Clinical Pharmacology Department, Faculty of Medicine, Ain Shams University. Cairo, Egypt

A R T I C L E I N F O A B S T R A C T

Keywords: Background: Browning of white adipose tissue (WAT) is currently considered a potential thera­
Obesity peutic approach to treat or prevent diet-induced obesity. Synbiotics have protective effects
High fat diet against diet-induced obesity; however, its role in adipose tissue browning has been less
Adipose tissue browning investigated.
Synbiotics Aim of the work: to study the possible effect of synbiotics intake on browning of WAT in obese rats.
FGF21
Material and methods: Twenty-four adult male Wistar rats were randomly divided into four groups;
UCP-1
normal diet (ND) control group, high fat diet (HFD) group, ND group receiving synbiotics, and
PGC1α
PPARγ HFD group receiving synbiotics. After eight weeks, all rats were sacrificed; and samples (blood,
WAT, brown adipose tissue, and liver) were collected. Lipid profile, liver enzymes, fasting
glucose, and fasting insulin levels were measured. The expression of browning-related genes:
uncoupler protein-1 (UCP-1), peroxisome proliferator-activated receptor gamma coactivator 1-
alpha (PGC1α), and peroxisome proliferator-activated receptors gamma (PPARγ) were
measured by real-time polymerase chain reaction (PCR) in adipose tissues. Fibroblast growth
factor 21 (FGF21) protein level was measured in serum, adipose and liver tissues, and FGF21
receptor expression was performed by real-time PCR in adipose tissues.
Results: ynbiotics intake was associated with improvement in lipid profile, liver enzymes, and
insulin sensitivity in HFD rats. Moreover, the intake was associated with higher gene expression
of brown adipocyte-specific markers. As for the FGF21 and its receptor, intriguing results were
obtained that needs further in-depth studies.
Conclusion: synbiotics might protect against diet-induced obesity through induction of thermo­
genic genes resulting in brown-like adipocyte phenotype in WAT.

1. Introduction
Obesity and its associated co-morbidities present a great challenge to global health (Khandekar et al., 2011; Cox et al., 2015; Deng
et al., 2016). It is considered a multifactorial disease of pandemic dimensions that is accompanied by metabolic disturbances, including

* Corresponding author. Basic Medical Sciences, Faculty of Medicine, Galala University, Suez, Egypt.
E-mail address: reem-sallam@gu.edu.eg (R.M. Sallam).

https://doi.org/10.1016/j.obmed.2022.100414
Received 15 October 2021; Received in revised form 16 April 2022; Accepted 18 April 2022
Available online 22 April 2022
2451-8476/© 2022 Elsevier Ltd. All rights reserved.
H.M. Mahmoud et al. Obesity Medicine 32 (2022) 100414

but not limited to, disturbed glucose and lipid homeostasis with increasing risk for type 2 diabetes mellitus, hypertension, and car­
diovascular diseases. (Calle and Kaaks, 2004; Mischke et al., 2018; Ahmad and Zawatia, 2021). Epidemiological data demonstrates
that obesity is also a risk factor for developing several types of cancers (Khandekar et al., 2011; Deng et al., 2016). Despite these
evidence-based findings describing obesity as a major, yet preventable, risk factor for the development of these life-threatening
conditions, most weight reduction approaches have proven ineffective in the long term (Gallagher and LeRoith, 2015; John and
Mullin, 2016).
In its simplest definition, obesity is considered a state of increased body weight –above certain cut-off values-due to excess
deposition of body fat in the adipose tissues. Two main types of adipose tissue, white and brown, have been recognized in human and
mammals (Prakash et al., 2020). White adipose tissue (WAT) is the main triacylglycerol (TAG) storage depot that is referred to in times
of energy needs. However, excess fat accumulation in WAT could accelerate chronic inflammation and mitochondrial dysfunction (Yin
et al., 2014; Kunath and Klöting, 2016). Brown adipose tissue (BAT), on the other hand, is considered a metabolically healthier tissue
when compared to WAT. BAT is morphologically and functionally different from WAT in several ways. For instance, BAT is rich in
mitochondria and vasculature, is fuelled by mitochondrial oxidation, and dissipates chemical energy as heat through uncoupling
protein-1 (UCP-1). Due to its thermogenic property, BAT acts as a potential therapeutic target in treating obesity and associated
comorbidities (Dodangeh and Dodangeh, 2020). The clear-cut distinction between WAT and BAT can be breached, and browning
becomes a term that specifies the process by which some adipocytes within WAT depot acquire properties of brown adipocytes (and
hence are called “beige” or “brite” adipocytes). Because BAT can disperse stored energy as heat, several researchers are exploring
means to promote BAT-like features in WAT, aiming at a better control for the obesity pandemic (Wu et al., 2013; Bartelt and Heeren,
2014; Zhou et al., 2019). At the molecular level, WAT browning is an intricate process, inducible and mediated by the interplay of
several genes. For instance; UCP-1, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1α), peroxisome
proliferator-activated receptor gamma (PPARγ), lipoxin A4; as well as the fibroblast growth factor 21 (FGF21) were all reported to be
related to the browning process (Chen et al., 2018; Saha et al., 2020; Wang et al., 2021).
In recent years, obesity has been demonstrated to associate with altered composition and function of human gut microbiota
(Tagliabue and Elli, 2013). In addition, studies performed on animal models with a genetic tendency for obesity have supported the
impact of gut microbiota composition on weight gain and host adiposity (Armougom et al., 2009; Jumpertz et al., 2011; Claesson et al.,
2012).
Mechanistic studies have demonstrated that gut microbiota can influence the energy balance equation in the host through various
ways; namely, utilization of diet-induced energy, controlling of energy expenditure, and regulation of energy storage (Jumpertz et al.,
2011). Hence, it becomes plausible to assume that weight loss and/or obesity prevention can be achieved through manipulating the gut
microbiota. In fact, modulating gut microbiota composition, either by consuming live bacteria (probiotics), nutrients for gut micro­
biota (prebiotics), or both (synbiotics), are emerging as potential strategies for obesity prevention and/or management Davis (2016);
Gérard (2016); (Gibson and Roberfroid, 1995; Davis, 2016).
Although probiotics may improve host intestinal microbial balance, this improvement is likely to be transient and limited. In
contrast, prebiotics stimulate the growth and/or activity of one or limited number of bacterial species already resident in the colon, and
thus influence host health. By combining pro- and pre-biotics, the concept of synbiotics is proposed to characterize some colonic foods
with interesting nutritional properties that make these compounds candidates for classification as health-enhancing functional food
ingredients (Gibson and Roberfroid, 1995; Kojima et al., 2016).
Mechanistically, the impact of gut microbiota on adipocytes’ phenotype, specifically on WAT browning, is a recent area of research
with interesting outcomes, although still incompletely understood (Li et al., 2019; Reynés et al., 2019). For instance, it is recently
published that microbiota depletion impaired the thermogenic capacity of BAT by blunting the increase in the expression of UCP-1 and
reducing the browning process of WAT (Li et al., 2019).
In the current work, we will explore the effects of synbiotics intake on adipose tissue browning in high fat diet (HFD)-rat model of
obesity. We will investigate the potential effect of synbiotics on the expression of browning-related genes: UCP-1, PGC1α, and PPARγ;
as well as on FGF21. We hypothesize that the intake of synbiotics improves the metabolic profile of HFD-induced obesity and induces
browning of adipose tissue.

2. Material and methods

The present study was approved by the Research Ethics Committee of the Faculty of Medicine, Ain Shams University (FMASU-REC).

2.1. Animals
Twenty-four adult male Wistar rats (180–200 g) were obtained from the animal house of the Faculty of Medicine in Ain Shams
University (Abbassia, Cairo, Egypt). Rats were housed in stainless-steel cages with mesh wire cover (three rats/cage). The animals were
maintained at a room temperature (22 ± 2 ◦ C), relative humidity of 55 ± 5%, 12 h light/dark cycle at 5:00 a.m.–5:00 p.m., and good
ventilation. The cages were cleaned daily. Rat chow was purchased from Meladco for Animal Food (El-Obour, Qalyubia, Egypt). Pellets
and tap water were available ad libitum. Rats were allowed for one week acclimatization period before any intervention.

2.2. Experimental study

2.2.1. Animal groups
Rats were randomly divided into four groups, (6 animals in each group):

2
H.M. Mahmoud et al. Obesity Medicine 32 (2022) 100414

1 Normal diet (ND); “control” group: Animals were supplied with normal chow diet (carbohydrates 48.5%, protein 21%, fat 3%,
calcium 0.8%, phosphorus 0.4%, fiber 5%, moisture 13%, and ash 8%, as a percentage of total kcal).
2 High-fat-diet (HFD); group: Animals were supplied with high-fat-diet formula (10% lard, 1.25% cholesterol, 0.5% bile salts, 10%
egg yolk powder, and 78.75% standard diet (Su et al., 2016).
3 Normal diet with synbiotics: Animals were supplied with normal chow diet and synbiotics.
4 High-fat-diet with synbiotics: Animals were supplied with high-fat-diet and synbiotics.

2.2.2. Synbiotics administration protocol

Probiotics: A pool of probiotics included Bifidobacterium longum, Lactobacillus acidophilus, Bifidobacterium lactis, Lactobacillus
rhamnosus, Bifidobacterium breve, Lactobacillus casei, Lactobacillus salivarius, and Lactobacillus plantarum (Healthy Origins®, USA)
was given daily for 8 weeks (30 × 109 CFU of each strain). Solutions of the probiotic strains were freshly prepared daily in sterile water
in order to provide a daily dose of 1 × 109 CFU to each rat. Probiotics were given to treated groups through oral gavage administration
(Holowacz et al., 2018). ND and HFD groups received daily the vehicle (sterile water) in addition to their corresponding food.
Prebiotics: Natural prebiotics dietary supplement (Now foods®, USA), is certified organic inulin (FOS: Fructooligosaccharides)
pure powder having very low glycemic index. According to the manufacturer, it does not contain yeast, wheat, soy, fish, shellfish,
peanuts, egg, artificial flavors, artificial colours, preservations, tree nut ingredients or milk. Each rat received 50 mg inulin/day by oral
gavage (it was reconstituted in 1 ml sterile water for 10 min at 37 ◦ C, to ensure full dissolution) (Abhari et al., 2015).

2.2.3. Estimation of Lee adiposity index

The Lee adiposity index was calculated by dividing the cube root of body weight (g) by naso-anal length (cm) and multiplying the
result by 1000 (Lee, 1929).

2.2.4. Biochemical and molecular studies

2.2.4.1. Samples collection. At the end of the 8th week, the rats were anaesthetized with urethane 2.4 gm/kg intra peritoneal and were
sacrificed by decapitation. Blood samples were collected in test tubes through cardiac puncture and centrifuged at 3000 rpm for 15 min
to obtain serum for biochemical estimation. The liver and adipose tissues were rapidly dissected and stored at − 80 ◦ C for further
molecular and biochemical analyses. Regarding adipose tissues sampling, white subcutaneous (SC) was dissected from epididymal
sites. Visceral (VAT) was dissected from mesenteric and perirenal sites. In addition, brown adipose tissues were obtained from
interscapular areas (Waldén et al., 2012).
2.2.4.2. Measurements of lipid profile, liver enzymes, fasting glucose, and fasting insulin. Quantitative measurement of lipid profile
(namely, TAG, total cholesterol, and HDL-cholesterol); liver enzymes (alanine aminotransferase (ALT) and aspartate aminotransferase
(AST) (BioMed-diagnostics, Germany) in serum samples were performed. LDL-cholesterol was calculated using Friedewald formula
(Friedewald et al., 1972). Alternative to invasive procedures as intraperitoneal glucose tolerance test (IPTT) and insulin tolerance test
(ITT), fasting glucose and insulin levels were measured using commercially available kits. As an index of insulin resistance, homeo­
stasis model assessment of insulin resistance (HOMA-IR) was calculated, using the formula: [HOMA-IR = fasting glucose (mmol/L) ×
fasting insulin (μU/ml)/22.5] (Matthews et al., 1985).
2.2.4.3. Gene expression analysis for UCP-1, PGC1α, PPARγ and FGF21 receptor, by real-time quantitative polymerase chain reaction (RT-
qPCR). Total RNA from adipose tissues was purified using GeneJET RNA Purification Kit, cat no. K0731 (Thermo Fisher Scientific Inc.,
Germany), according to the manufacturer’s protocol. Complementary DNA (cDNA) was synthesized by reverse transcription reaction
using RevertAid first strand cDNA Synthesis Kit, cat no. K1622 (Thermo Fisher Scientific Inc., Germany).
The quantification of relative expression of the candidate genes, including UCP-1, PGC1α, PPARγ and FGF21 receptor, was per­
formed using Thermo Scientific Maxima SYBR® Green qPCR Master Mix (2X), with ROX Solution, (Thermo Scientific, Lithuania,
catalog number: K0251). The 2− ΔΔCt method was adopted for the analysis of gene expression levels and ACTB was used as an
endogenous reference control for normalization purposes (Livak and Schmittgen, 2001). The primers were provided by QuantiTect®
Primer Assay, (Thermofisher; Table 1).
2.2.4.4. Measurements of FGF21 protein. FGF21 protein level was measured by enzyme-linked immunosorbent assay (ELISA) in serum
and tissues (liver and adipose tissue) following the manufacturer’s instructions (cat.no. E-EL-R2408 Rat FGF21, Elabscience
Biotechnology, USA).

2.3. Statistical analysis

Statistical analysis was performed by SPSS for Windows software (IBM Corp. Released 2011. IBM SPSS Statistics for Windows,
Version 22.0. Armonk, NY: IBM Corp.) Results were represented as mean ± SD. The comparison between the study groups was

Table 1
Primers’ sequences of the studied genes.

Gene Forward primer Reverse primer

UCP- 1 TAGCAGGAAATCAGAATCAT AAGTGGCAAGGGAGGTCATC

PGC1α GCACCAGAAAACAGCTCCAA TTGCCATCCCGTAGTTCACT
PPARγ TGATATCGACCAGCTGAACC GTCCTCCAGCTGTTCGCCA
FGF21R AGAGACCAGCTGTGATGA CGCGTGACCAAAGTGGCC
β-Actin TCTTCCAGCCTTCCTTCCTG CAATGCCTGGGTACATGGTG

3
H.M. Mahmoud et al. Obesity Medicine 32 (2022) 100414

analysed using ANOVA post hoc test. The level of statistical significance was set at p-value < 0.05.

3. Results
A Synbiotics’ intake: Potential association with adiposity body measurements and biochemical metabolic changes:

3.1. Synbiotics’ intake is not associated with a significant change in either body weight or Lee adiposity index
As shown in Fig. 1-A, there was a significant increase in the body weight in HFD group compared to the ND group that started at the
5th week until the end of the study (p < 0.05); while no significant differences between HFD group and HFD-Syn (p > 0.05).
Furthermore, no significant differences between different study groups regarding Lee adiposity index (p > 0.05; Fig. 1-B).

3.2. Synbiotics’ intake is associated with improved lipid profile and liver enzymes in rats receiving HFD
Considering lipid profile and liver enzymes, there was significant increase in rats receiving HFD compared to ND group (p < 0.05).
Interestingly, synbiotics intake improved lipid profile and liver enzymes (namely it reduced TAG, LDL-C and liver enzymes, and
increased HDL-C) in rats receiving HFD along with synbiotics (p < 0.05). No significant differences in the previous measures were
detected between ND rats and ND-Syn (p > 0.05) (Table 2).

3.3. Synbiotics’ intake is associated with improved fasting glucose level and insulin sensitivity in rats receiving HFD
Fasting glucose and insulin levels and HOMA-IR index were significantly elevated in rats receiving HFD compared to those
receiving normal diet (p < 0.000). Synbiotics intake in HFD group significantly reduced fasting glucose levels and improved insulin
resistance provoked by HFD (Table 3).
B Synbiotics’ intake: Potential association with the expression of browning-related genes:

3.4. Synbiotics’ intake is associated with beneficial effects on the expression of UCP-1 in different types of adipose tissues
Although the expression of UCP-1 in different types of adipose tissues was not affected by HFD intake; synbiotics’ intake was
associated with significant up regulation in UCP-1 expression in both WAT (SC and VAT) and BAT isolated from rats in the HFD-Syn
group compared to HFD group (Fig. 2, A-C).

3.5. Synbiotics’ intake is associated with induction of PGC1α, and PPARγ genes’ expression in adipose tissue
The expression of PGC1α was significantly inhibited in SC and VAT white adipose tissue in HFD rats. Similarly, PPARγ expression
was down regulated in VAT. Synbiotics intake along with HFD increased the gene expression of PGC1α in the SC and VAT tissues; at the
same time synbiotics was associated with induced expression of PPARγ in BAT (Fig. 2, D-I).

3.6. Synbiotics’ intake is associated with improved FGF21 levels in WAT and liver of rats receiving HFD
There was significant increase in FGF21 protein concentration in WAT (both SC and VAT) as well as in liver in HFD group (Fig. 3B

Fig. 1. Body weight (A) and Lee index (B) of studied groups. ND; normal-diet, ND + Syn; normal-diet with synbiotics, HFD; high fat-diet, HFD + Syn; high fat-diet with
synbiotics. Fig. 1-A Data are presented as mean (n = 6/group), Fig. 1-B data are presented as mean ± SD. ANOVA post hoc test was used. p-value <0.05 is considered
significant. * Significant difference in HFD groups in comparison with ND group.

4
H.M. Mahmoud et al. Obesity Medicine 32 (2022) 100414

Table 2
Lipid profile and liver enzymes in different study groups.

ND ND + SYN HFD HFD + SYN F-value p-value

TAG (mg/ml) 82.4 ± 8.6 73.7 ± 1.7 130.2 ± 15.5 106.6 ± 11.8 15.79 0.001*§
Total Cholesterol (mg/ml) 123.45 ± 1.91 120.76 ± 1.02 203.32 ± 26.1 176.66 ± 16.03 17.221 0.001*
LDL-C(mg/ml) 45.7 ± 6 40.7 ± 0.68 143.6 ± 24.3 108.7 ± 20.7 23.3 0.000*§
HDL-C(mg/ml) 61.3 ± 9.7 65.4 ± 1.8 33.7 ± 4.1 48.4 ± 3.1 34 0.001*§
ALT(IU/L) 15 ± 4.2 14.7 ± 1.5 48 ± 10.4 27.8 ± 6.4 15.6 0.000*§
AST(IU/L) 22.5 ± 2 22 ± 2 51.3 ± 8.4 39.3 ± 3 22.9 0.000*§

ND: normal diet; ND + Syn: normal diet with synbiotics; HFD: high fat diet; HDF + Syn: high fat diet with synbiotics; TAG: triacylglycerol; HDL-C: high density
lipoprotein-cholesterol; LDL-C: low density lipoprotein-cholesterol; ALT: Alanine Aminotransferase; AST: Aspartic Aminotransferase. Data are presented as mean ± SD
(n = 6/group). ANOVA post hoc test was used. p-value was significant if < 0.05. *Significant difference in HFD group in comparison with ND group. § Significant
difference in HFD + Syn group in comparison with HFD group.

Table 3
Fasting glucose, fasting insulin levels, and HOMA-IR in different studied groups.

ND ND + Syn HFD HFD + Syn F-value P-value

Fasting glucose (mg/dl) 72 ± 4.24 81.7 ± 9.8 161 ± 11.7 110.6 ± 9.2 56.6 0.000*§
Fasting insulin (μIU/L) 9.5 ± 0.85 8.9 ± 0.35 14.7 ± 2.83 12.3 ± 1.3 7.38 0.007*
HOMA-IR 1.65 ± 0.07 1.83 ± 0.25 5.77 ± 0.86 3.34 ± 0.15 48.55 0.000*§

Groups’ abbreviations are as described in the legend of Table 2. HOMA-IR; homeostasis model assessment-insulin resistance. Data are presented as mean ± SD (n = 6/
group). ANOVA post hoc test was used. p-value <0.05 is considered significant. *Significant difference in HFD group in comparison with ND group. § Significant
difference in HFD + Syn group in comparison with HFD group.

and C, and E). However, this was not accompanied with corresponding increase in the circulating level of FGF21 (Fig. 3, A). In parallel,
there was up regulation in FGF21 receptor expression in all types of adipose tissues in rats on HFD (p < 0.05; Fig. 3F–H). On the other
hand, synbiotics’ intake in HFD group increased the protein concentration of FGF21 in serum (Fig. 3-A), all adipose tissues and in liver
in comparison to HFD group (p < 0.05; Fig. 3B–E). It is also observed that synbiotics administration was accompanied with down-
regulation of FGF21 receptor in different types of adipose tissues (Fig. 3, F–H).

4. Discussion
One of the most promising targets in the therapeutics of obesity and metabolic diseases relies on activation of energy expenditure.
Brown adipose tissue is a particularly appealing target for increasing energy expenditure as it transforms chemical energy into heat.
Besides classical brown adipose tissue, our understanding of the inducible thermogenic adipose tissue -known as beige or brite-has
been steadily increasing (Wu et al., 2013).
Cells of the beige adipose tissue can be targeted with both pharmacological and nutritional activators. Pharmacological approaches
include the use of PPARα agonist, adrenergic receptor stimulation, thyroid hormone administration, irisin and FGF21 inducers. Most of
these mediators act through the induction of PGC1α and the consequent mitochondrial biogenesis and UCP-1 induction (Bargut et al.,
2017).
In the current study, high-fat-diet-induced obesity rat model was obtained, as manifested by increased body weight, and known
obesity-associated metabolic changes. The latter included hyperglycaemia, hyperinsulinemia, insulin resistance, dyslipidaemia, and
fatty liver associated-liver enzymes’ profile.
In our model, we investigated the potential beneficial effects of synbiotics administration by assessing the obesity-associated
biochemical changes in the rats’ groups that received synbiotics, either in combination with normal diet or HFD. We concluded
that synbiotics was associated with improved lipid profile, liver function and glucose homeostasis. In other words, our results support
the hypothesis that synbiotics’ intake was able to alleviate the disrupted biochemical markers and insulin resistance. This is in
agreement with other research groups (Mattace Raso et al., 2014; Alard et al., 2016; Bagarolli et al., 2017; Mischke et al., 2018; Gu
et al., 2021).
To test our hypothesis that browning of adipose tissue is a probable mechanism through which synbiotics’ intake protects against
HFD-induced metabolic disturbance, we assessed the gene expression level of UCP1, the marker of brown adipose tissue. Similar to
other published data (Kawabe et al., 2019; Gu et al., 2021), there was no apparent effect of HFD on UCP-1 gene expression. This is in
contrast to other researchers’ findings (Mao et al., 2018). Nonetheless, we demonstrate that synbiotics was associated with up
regulated UCP-1 expression in all examined adipose tissues. Previously, other types of functional food showed consistent effect on
UCP-1 expression in HFD-induced obesity (Wang et al., 2015). This indicates that adipose tissue remodelling is a possible explanation
for the metabolic effects of synbiotics. The expression of PGC1α was in support to this interpretation, where we noticed that in WAT,
while HFD was associated with lowered PGC1α mRNA expression, synbiotics intake was associated with significantly elevated
expression (with increasing trend that did not reach significance in BAT). Several published works agree with our findings. For
instance, various nutrients, functional foods, chemicals and pharmacological drugs were demonstrated to enhance WAT browning via
increasing the expression of brown–specific genes in HFD rats (Distel et al., 2012; Rachid et al., 2015; Kwan et al., 2017; Guo et al.,
2019; Lyu et al., 2019; Gu et al., 2021; Jeddi et al., 2021).

5
H.M. Mahmoud et al. Obesity Medicine 32 (2022) 100414

Fig. 2. Effects of synbiotics’ intake on adipose tissues gene expression of UCP-1 (A–C), PGC1α (D–F), and PPARγ (G–I). Abbreviations, number of rats/group and data
presentation are as described in Fig. 1 legend. Statistical significance labels: *Significant difference in HFD group in comparison with ND group, § Significant difference
in HFD + Syn group in comparison with HFD group.

Considering PPARγ, one of the main transcriptional regulators of adipogenesis, this study assesses its possible role in browning as
was recently implied in the literature. For instance, Wang et al. reported that PPARγ can induce the formation of brite adipocytes in
WAT (Wang et al., 2016). Additionally, genome-wide binding analyses revealed that PPARγ binds to many brown fat–specific genes in
BAT. Furthermore, synthetic PPARγ activators was able to induce mitochondrial biogenesis and brown fat–selective genes in adipo­
cytes (Seale, 2015). We investigated the effect of synbiotics on the expression of PPAR-γ in adipose tissue. Results demonstrated that in
WAT (mainly visceral), HFD decreases the PPAR-γ mRNA expression, with a trend decrease in BAT. Synbiotics intake significantly
elevated PPAR-γ mRNA expression in BAT (with increasing trend that did not reach significance in WAT). This differential effect could
be attributed to the probiotics strains used in the current study; and needs future investigation (Park et al., 2019).

6
H.M. Mahmoud et al. Obesity Medicine 32 (2022) 100414

Fig. 3. (A–H)Effects of synbiotics intake on FGF21 protein in serum (A) and in tissues (B–E); and on FGF21 receptor gene fold expression in adipose tissue (F–H).
Abbreviations, number of rats/group, data presentation, statistical significance value are as described in Fig. 1 legend. * Significant difference in HFD group in
comparison with ND group. § Significant difference in HFD + Synbiotics group in comparison with HFD group.

FGF21 is a pleiotropic hormone-like protein and a metabolic regulator of glucose and lipid metabolism (Wang et al., 2008; Zhang
et al., 2008). Therefore, the potential role of FGF21 and its receptor in the hypothesized synbiotics-induced browning effect was
assessed. Preliminary results were obtained that need further investigation in future studies. While synbiotics intake increased the
circulating level of FGF21 similar to findings from other researchers (Hale et al., 2012), more arguable results of this adipokine/he­
patokine and its receptor were obtained in the studied tissues. FGF21 was up regulated in WAT, and in liver of HFD group. Based on the
metabolic role of FGF21, we suggest that this increase is a mechanism by which the body tries to correct the disturbed metabolism, for
instance, to better consume the expected high level of free fatty acids delivered to the liver from the adipose tissues, and to improve the
adipose tissue metabolism in HFD rats. Apparently, in our model this compensatory mechanism was not successful, as manifested by
the persistent metabolic disturbances in the HFD group. To address the question of the potential anti-obesity role provided by syn­
biotics’ intake, we assessed the FGF21 and its receptors in the HFD + Syn group. To our surprise, the synbiotics intake was associated
with higher tissue levels of FGF21, and with lower gene expression level of FGF21 receptor; i.e. no corresponding increase in the gene
expression of FGF21R in adipose tissue. This comes in agreement with results from other groups (Mattace Raso et al., 2014). What
synbiotics’ intake has provided, is further increase in the concentration of FGF21 in adipose tissues without a parallel increase in the
gene expression of its receptor. A possible explanation for this FGF21R results, may resides in the fact that we assessed only the FGF21
receptor and not its co-receptor (β klotho). It should be noted that full response to FGF21 signalling is not yet-fully-understood (Wang
et al., 2008; Zhang et al., 2008).
The association of different brown adipose-specific genes with reported changes was demonstrated in the current work, sup­
porting the findings of other researchers. Liu et al. demonstrated that PGC1α can induce uncoupling proteins as UCP-1 and control
mitochondrial biogenesis and respiration (Liu et al., 2020). In addition, adipose-derived FGF21 regulates the browning process via the
increased expression of UCP-1 and other genes associated with the function of the brown/beige adipocytes. Interestingly, Wang and
co-workers reported that FGF21 gene expression is induced by PPARγ (Wang et al., 2008). These findings emphasize on the pleiotropic
nature of FGF21 and the complexity of the WAT browning process. Collectively, synbiotics intake is associated with induction of the

7
H.M. Mahmoud et al. Obesity Medicine 32 (2022) 100414

brown fat-like phenotype by activating the expression of brown adipocyte-specific markers.

5. Conclusion
Herein, we demonstrated that administration of synbiotics to HFD rats improves lipid profile, liver enzymes, and insulin sensitivity
that are perturbed by HFD. In addition, synbiotics induce the brown fat-like phenotype by activating the expressions of brown
adipocyte-specific markers, such as UCP-1, PGC1α, and PPARγ. Further results of the current work support the involvement of FGF21
pathway in the synbiotics-induced browning process. However, future studies are mandatory to increase our understanding of such
intricate process. These findings put forward a possible role of synbiotics as a potential, promising therapeutic approach for the
treatment of diet-induced obesity.

CRediT authorship contribution statement

Hala M. Mahmoud: Conceptualization, Methodology, Writing – original draft, Writing – review & editing. Reem M. Sallam:
Conceptualization, Supervision, Project administration, Writing – original draft, Writing – review & editing. Christeen Medhat Ayad
Henin: Methodology, Writing – review & editing. Amr S. Moustafa: Supervision, Formal analysis, Writing – review & editing. Reham
Hussein Mohamed: Methodology. Magda I. Mohamad: Supervision, Methodology, Writing – review & editing.

Declaration of competing interest

The authors of this work have no conflict of interest.

Acknowledgment
The authors would like to acknowledge the staff of the Animal House of the Faculty of Medicine in Ain Shams University (Abbassia,
Cairo, Egypt).

References
Ahmad, M.N., Zawatia, A.A., 2021. Current prospects of metabolically healthy obesity. Obesity Medicine 25, 100361. https://doi.org/10.1016/J.
OBMED.2021.100361. Elsevier.
Alard, J., et al., 2016. Beneficial metabolic effects of selected probiotics on diet-induced obesity and insulin resistance in mice are associated with improvement of
dysbiotic gut microbiota. Environ. Microbiol. https://doi.org/10.1111/1462-2920.13181.
Armougom, F., et al., 2009. Monitoring bacterial community of human gut microbiota reveals an increase in Lactobacillus in obese patients and Methanogens in
anorexic patients. PLoS One. https://doi.org/10.1371/journal.pone.0007125.
Bagarolli, R.A., et al., 2017. Probiotics modulate gut microbiota and improve insulin sensitivity in DIO mice. JNB (J. Nutr. Biochem.). https://doi.org/10.1016/j.
jnutbio.2017.08.006.
Bargut, T.C.L., et al., 2017. Browning of white adipose tissue: lessons from experimental models. Horm. Mol. Biol. Clin. Invest. https://doi.org/10.1515/hmbci-2016-
0051.
Bartelt, A., Heeren, J., 2014. Adipose tissue browning and metabolic health. Nat. Rev. Endocrinol. https://doi.org/10.1038/nrendo.2013.204.
Calle, E.E., Kaaks, R., 2004. Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat. Rev. Cancer. https://doi.org/10.1038/
nrc1408.
Chen, L.H., et al., 2018. Antiobesity effect of Lactobacillus reuteri 263 associated with energy metabolism remodeling of white adipose tissue in high-energy-diet-fed
rats. JNB (J. Nutr. Biochem.). https://doi.org/10.1016/j.jnutbio.2017.11.004.
Claesson, M.J., et al., 2012. Gut microbiota composition correlates with diet and health in the elderly. Nature. https://doi.org/10.1038/nature11319.
Cox, A.J., West, N.P., Cripps, A.W., 2015. Obesity, inflammation, and the gut microbiota. Lancet Diabetes Endocrinol. https://doi.org/10.1016/S2213-8587(14)
70134-2.
Davis, C.D., 2016. The gut microbiome and its role in obesity. Nutr. Today 51 (4), 167–174. https://doi.org/10.1097/NT.0000000000000167.
Deng, T., et al., 2016. Obesity, inflammation, and cancer. Annu. Rev. Pathol. https://doi.org/10.1146/annurev-pathol-012615-044359.
Distel, E., et al., 2012. Early induction of a brown-like phenotype by rosiglitazone in the epicardial adipose tissue of fatty Zucker rats. Biochimie. https://doi.org/
10.1016/j.biochi.2012.04.014.
Dodangeh, Milad, Dodangeh, Masoud, 2020. Metabolic regulation and the anti-obesity perspectives of brown adipose tissue (BAT); a systematic review. Obesity
Medicine 17, 100163. https://doi.org/10.1016/J.OBMED.2019.100163. Elsevier.
Friedewald, W.T., Levy, R.I., Fredrickson, D.S., 1972. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative
ultracentrifuge. Clin. Chem. https://doi.org/10.1093/clinchem/18.6.499.
Gallagher, E.J., LeRoith, D., 2015. Obesity and diabetes: the increased risk of cancer and cancer-related mortality. Physiol. Rev. https://doi.org/10.1152/
physrev.00030.2014.
Gérard, P., 2016. Gut microbiota and obesity. Cell. Mol. Life Sci. https://doi.org/10.1007/s00018-015-2061-5.
Gibson, G.R., Roberfroid, M.B., 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. https://doi.org/10.1093/
jn/125.6.1401.
Gu, Y., et al., 2021. Lactobacillus plantarum dy-1 fermented barley extraction activates white adipocyte browning in high-fat diet-induced obese rats. J. Food
Biochem. https://doi.org/10.1111/jfbc.13680.
Guo, Y.Y., et al., 2019. Taurine-mediated browning of white adipose tissue is involved in its anti-obesity effect in mice. J. Biol. Chem. https://doi.org/10.1074/jbc.
RA119.009936.
Hale, C., et al., 2012. Lack of overt FGF21 resistance in two mouse models of obesity and insulin resistance. Endocrinology. https://doi.org/10.1210/en.2010-1262.
Holowacz, S., et al., 2018. Lactobacillus salivarius LA307 and Lactobacillus rhamnosus LA305 attenuate skin inflammation in mice’, Beneficial microbes. Wageningen
Academic Publishers 9 (2), 299–309.
Jeddi, S., et al., 2021. Long-term nitrate administration increases expression of browning genes in epididymal adipose tissue of male type 2 diabetic rats. Gene.
https://doi.org/10.1016/j.gene.2020.145155.
John, G.K., Mullin, G.E., 2016. The gut microbiome and obesity. Curr. Oncol. Rep. https://doi.org/10.1007/s11912-016-0528-7.
Jumpertz, R., et al., 2011. Energy-balance studies reveal associations between gut microbes, caloric load, and nutrient absorption in humans. Am. J. Clin. Nutr.
https://doi.org/10.3945/ajcn.110.010132.
Kawabe, Y., et al., 2019. ACE2 exerts anti-obesity effect via stimulating brown adipose tissue and induction of browning in white adipose tissue. Am. J. Physiol.
Endocrinol. Metab. https://doi.org/10.1152/AJPENDO.00311.2019.

8
H.M. Mahmoud et al. Obesity Medicine 32 (2022) 100414

Khandekar, M.J., Cohen, P., Spiegelman, B.M., 2011. Molecular mechanisms of cancer development in obesity. Nat. Rev. Cancer. https://doi.org/10.1038/nrc3174.
Kojima, Y., et al., 2016. Combining prebiotics and probiotics to develop novel synbiotics that suppress oral pathogens. J. Oral Biosci. https://doi.org/10.1016/j.
job.2015.08.004.
Kunath, A., Klöting, N., 2016. Adipocyte biology and obesity-mediated adipose tissue remodeling. Obesity Medicine 4, 15–20. https://doi.org/10.1016/J.
OBMED.2016.10.001. Elsevier.
Kwan, H.Y., et al., 2017. Cinnamon induces browning in subcutaneous adipocytes. Sci. Rep. https://doi.org/10.1038/s41598-017-02263-5.
Lee, M.O., 1929. Determination OF the surface area OF the white rat with its application to the expression OF metabolic results. American Journal of Physiology-
Legacy Content. https://doi.org/10.1152/ajplegacy.1929.89.1.24.
Li, B., et al., 2019. Microbiota depletion impairs thermogenesis of Brown adipose tissue and browning of white adipose tissue. Cell Rep. 26 (10), 2720–2737. https://
doi.org/10.1016/j.celrep.2019.02.015 e5.
Liu, Z., et al., 2020. Resveratrol-induced brown fat-like phenotype in 3T3-L1 adipocytes partly via mTOR pathway. Food Nutr. Res. https://doi.org/10.29219/fnr.
v64.3656.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. https://doi.org/
10.1006/meth.2001.1262.
Lyu, H.J., et al., 2019. Dihydromyricetin promoted browning of subscapular adipose tissues in obese mice fed with high-fat diet via activating AMPK-PGC1 a-Sirtl
signaling pathway. Chin. Pharmacol. Bull. https://doi.org/10.3969/j.issn.1001-1978.2019.12.013.
Mao, L., et al., 2018. Long-chain polyunsaturated fatty acids and extensively hydrolyzed casein-induced browning in a Ucp-1 reporter mouse model of obesity. Food
Funct. https://doi.org/10.1039/c7fo01835e.
Matthews, D R, et al., 1985. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man.
Diabetologia 28 (7), 412–419. https://doi.org/10.1007/BF00280883.
Mischke, M., et al., 2018. Specific synbiotics in early life protect against diet-induced obesity in adult mice. Diabetes Obes. Metabol. https://doi.org/10.1111/
dom.13240.
Park, S.S., et al., 2019. Lactobacillus amylovorus KU4 ameliorates diet-induced obesity in mice by promoting adipose browning through PPARγ signaling’, Scientific
Reports. Nature Research 9 (1). https://doi.org/10.1038/s41598-019-56817-w.
Prakash, S., et al., 2020. Sitagliptin mitigates oxidative stress and up-regulates mitochondrial biogenesis markers in Brown adipose tissues of high-fat diet fed obese
mice through AMPK phosphorylation. Obesity Medicine 19, 100265. https://doi.org/10.1016/J.OBMED.2020.100265. Elsevier.
Rachid, T.L., et al., 2015. Fenofibrate (PPARalpha agonist) induces beige cell formation in subcutaneous white adipose tissue from diet-induced male obese mice. Mol.
Cell. Endocrinol. https://doi.org/10.1016/j.mce.2014.12.027.
Mattace Raso, G., et al., 2014. Effects of a Lactobacillus paracasei B21060 based synbiotic on steatosis, insulin signaling and toll-like receptor expression in rats fed a
high-fat diet. JNB (J. Nutr. Biochem.) 25 (1), 81–90. https://doi.org/10.1016/j.jnutbio.2013.09.006. Elsevier Inc.
Reynés, B., et al., 2019. Regulation of adaptive thermogenesis and browning by prebiotics and postbiotics. Front. Physiol. https://doi.org/10.3389/fphys.2018.01908.
Saha, P.K., et al., 2020. miR-30a targets gene networks that promote browning of human and mouse adipocytes. Am. J. Physiol. Endocrinol. Metab. https://doi.org/
10.1152/ajpendo.00045.2020.
Seale, P., 2015. Transcriptional regulatory circuits controlling brown fat development and activation. Diabetes 64 (7), 2369–2375. https://doi.org/10.2337/db15-
0203.
Su, M, et al., 2016. Acetylshikonin from Zicao Prevents Obesity in Rats on a High-Fat Diet by Inhibiting Lipid Accumulation and Inducing Lipolysis. PLoS One 11 (1).
https://doi.org/10.1371/journal.pone.0146884.
Waldén, T.B., et al., 2012. Recruited vs. nonrecruited molecular signatures of brown, “brite,” and white adipose tissues. Am. J. Physiol. Endocrinol. Metab. 302 (1)
https://doi.org/10.1152/ajpendo.00249.2011.
Wang, H., Qiang, L., Farmer, S.R., 2008. Identification of a domain within peroxisome proliferator-activated receptor γ regulating expression of a group of genes
containing fibroblast growth factor 21 that are selectively repressed by SIRT1 in adipocytes. Mol. Cell Biol. https://doi.org/10.1128/mcb.00992-07.
Wang, S., et al., 2015. Resveratrol induces brown-like adipocyte formation in white fat through activation of AMP-activated protein kinase (AMPK) α1. Int. J. Obes.
https://doi.org/10.1038/ijo.2015.23.
Wang, H., et al., 2016. Browning of white adipose tissue with roscovitine induces a distinct population of UCP1+ adipocytes. Cell Metabol. https://doi.org/10.1016/j.
cmet.2016.10.005.
Wang, Q., et al., 2021. Lipoxin A4 promotes adipogenic differentiation and browning of mouse embryonic fibroblasts. In: Vitro Cellular and Developmental Biology -
Animal. https://doi.org/10.1007/s11626-021-00617-y.
Wu, J., Cohen, P., Spiegelman, B.M., 2013. Adaptive thermogenesis in adipocytes: is beige the new brown? Genes Dev. https://doi.org/10.1101/gad.211649.112.
Yin, X., et al., 2014. Adipocyte mitochondrial function is reduced in human obesity independent of fat cell size. J. Clin. Endocrinol. Metab. 99 (2), E209–E216. Oxford
University Press.
Zhang, X., et al., 2008. Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes. https://doi.
org/10.2337/db07-1476.
Zhou, L., et al., 2019. Deciphering the anti-obesity benefits of resveratrol: the “gut microbiota-adipose tissue” axis. Front. Endocrinol. https://doi.org/10.3389/
fendo.2019.00413.