DETECTION OF dfrG AND dfrA GENES BY

MULTIPLEX PCR IN CLINICAL ISOLATES OF

TRIMETHOPRIM RESISTANCE MRSA

A Dissertation
Submitted to the Department of Microbiology
St. Xavier’s college
(Affiliated to Tribhuvan University)
In Partial Fulfillment of the Requirements for the Award of the
Degree of Master of Science in Microbiology
(Medical)

By
MADHU SUDHAN JOSHI
T.U. Regd. No.5-2-61-146-2012
Symbol No. 778/073MB
2022
©Tribhuvan University
 RECOMMENDATION

This is to certify that Mr. Madhu Sudhan Joshi has completed

this dissertation work entitled “DETECTION OF dfrG AND dfrA
GENES BY MULTIPLEX PCR IN CLINICAL ISOLATES
OF TRIMETHOPRIM RESISTANCE MRSA” as a partial
fulfillment of the requirements of M. Sc. Degree in Microbiology
(Medical) under my supervision. To my knowledge this work has
not been submitted for any other degree.

……………………….
………………………
Ms. Aruna Khanal Mr. Anil Kumar Sah
Lecturer Research Officer
Department of Microbiology Annapurna Research
St. Xavier’s College Center (ARC)
Maitighar, Kathmandu Maitighar, Kathmandu
Nepal Nepal

ii
Date: …………………………
CERTIFICATE OF APPROVAL

On the recommendation of Ms. Aruna Khanal and Mr. Anil

Kumar Sah, this dissertation work of Mr. Madhu Sudhan Joshi
entitled “DETECTION OF dfrG AND dfrA GENES BY
MULTIPLEX PCR IN CLINICAL ISOLATES OF
TRIMETHOPRIM RESISTANCE MRSA”, has been approved
for the examination and is submitted to the Tribhuvan University in
Partial fulfillment of the requirements for M.Sc. degree in
Microbiology (Medical).

……………………….
Mrs. Pramila Parajuli
Head
Department of Microbiology
St. Xavier’s College,
Maitighar, Kathmandu,
Nepal

iii
Date: ………………………
BOARD OF EXAMINERS

iv
 ACKNOWLEDGEMENTS

First and foremost, I offer my sincerest gratitude to the internal supervisor Ms.
Aruna Khanal, lecturer, Department of Microbiology, St. Xavier’s College
for her continuous guidance, valuable suggestions and great support in the
completion of my thesis work. I am equally grateful to my external supervisor
Mr. Anil Kumar Sah, research officer, Annapurna Research Center (ARC)
for his guidance and support during the study period.

I am very thankful to Ms. Pramila Parajuli, HOD, Department of

Microbiology, St. Xavier’s College and all the respected teachers and staffs of
Department of Microbiology, St. Xavier’s College for their kind support,
timely advice and constant encouragement throughout the period of
dissertation.

I want to convey my thankfulness to Mr. Anil Singh Baniya (lab in-charge of

ANIAS), Mr. Santosh Khanal (staff of ANIAS) and also all other staff at
ANIAS and ARC for help and co-operation during this entire work period. My
sincere thanks and appreciation are forwarded to all the participated patients,
who were the core part of this study.

Finally, I admire my parents, friends and colleagues for their continuous silent
support, co-operation, inspiration and encouragement during the entire study
period, without all of which I would not have come this far.

………………………..
Madhu Sudhan Joshi

v
Date ……………………….

ABSTRACT

Methicillin Resistant Staphylococcus aureus, an opportunistic gram-positive

bacterium is the leading cause of healthcare associated infections worldwide.
Co-Trimoxazole is a combined sulfonamide antifolate compound of
Trimethoprim and Sulfamethoxazole, that obstructing folic acid synthesis in
the bacteria. Co-Trimoxazoles resistance was mainly due to the production of
dihydrofolate reductase enzyme that are encoded by dfrB, dfrA (dfrS1), dfrG,
dfrK genes. Total of 822 non-repeated clinical samples were processed using
standard microbiological techniques. The colonies grown were identified on
the basis of colony morphology, Gram's stain and biochemical tests (Bergey’s
Manual). Antimicrobial susceptibility test was performed by modified Kirby-
Bauer disc diffusion technique and Trimethoprim resistance MRSA were
observed using the Co-Trimoxazole antibiotics (CLSI Guideline 2020). DNA
was extracted by using CTAB DNA extraction method, dfrG and dfrA genes
were detected by using polymerase chain reaction method. Out of total 822
clinical samples, 328 (39.90%) samples showed growth where 78 (24%) were
positive for S. aureus. Among that 41 (53%) were MRSA, out of which 19
(46.35%) were Co-Trimoxazole resistant. Out of 78 S. aureus, the highest
percentage of isolates 28 (35.89%) was obtained from pus followed by blood
19 (24.34%). Out of 41 MRSA, 10 (24.39%) were observed in male patients
of age group 61-75 years and 8 (19.52%) were observed in female patients of
age group 46-60 years. The higher prevalence of isolates was found in general
ward among hospital units. In Trimethoprim Resistance MRSA, Vancomycin
(100%) is found more effective and followed by Linezolid (78.95%). MDR
pattern of S. aureus, MRSA and Co-Trimoxazole resistant MRSA were found
to be 43 (55.12%), 26 (63.41%) and 19 (100%), respectively which showed,
there was significant association (p=0.001). Among 19 Trimethoprim
resistance MRSA, 14 (73.68%) and 6 (31.58%) were found to be positive for
dfrG gene and dfrA gene, respectively.

vi
Keywords: Staphylococcus aureus, MRSA, Trimethoprim resistance MRSA,
Co-Trimoxazole antibiotic, dfrG gene and dfrA gene.

TABLE OF CONTANTS

TITLE PAGE i
RECOMMENDATION ii
CERTIFICATE OF APPROVAL iii
BOARD OF EXAMINERS iv
ACKNOWLEDGEMENTS v
ABSTRACT vi
TABLE OF CONTENTS vii-ix
LIST OF TABLES x
LIST OF FIGURES xi
LIST OF PHOTOGRAPHS xii
LIST OF APPENDICES xiii
ABBREVIATIONS xiv-xv
CHAPTER I: INTRODUCTION AND OBJECTIVES 1-5
1.1 Background 1-4
1.2 Objectives 5
1.2.1 General objective 5
1.2.2 Specific Objectives 5
CHAPTER II: LITERATURE REVIEW 6-13
2.1 History 6-7
2.2 Epidemiology 7-8
2.3 Prevalence 8-11
2.4 Pathogenesis 11-13
CHAPTER III: MATERIALS AND METHODS 14-19
3.1 Materials and equipments 14
3.2 Methodology 14
3.2.1 Research design 14
3.2.1.1 Study site 14
3.2.1.2 Study population and sample size 14-15

vii
3.2.1.3 Inclusion criteria 15
3.2.1.4 Exclusion criteria 15
3.2.2 Sample processing 15
3.2.2.1 Microscopic examination 15
3.2.2.2 Culture and Identification 15-16
3.2.2.3 Antibiotic susceptibility test 16
3.2.2.4 Screening for MRSA isolates 16
3.2.2.5 Screening for Trimethoprim resistant MRSA isolates 16
3.2.2.6 Preservation of Trimethoprim resistant MRSA isolates 17
3.2.2.7 Revival of the preserved culture 17
3.2.2.8 Genomic DNA extraction 17
3.2.2.9 PCR amplification of dfrG gene and dfrA gene 17-18
3.2.2.10 Detection of PCR products by gel electrophoresis 18
3.3 Quality control 18
3.4 Data analysis 19
CHAPTER IV: RESULTS 20-31
4.1 Growth profile 20
4.2 The distribution of S. aureus isolates in clinical samples 21
4.3 Antibiotic susceptibility pattern of Staphylococcus aureus 22
4.4 Prevalence of Methicillin resistant S. aureus 23
4.5 Association of growth of MRSA with age and gender of patients 24
4.6 Antibiotic susceptibility of Trimethoprim resistance MRSA isolates 25
4.7 Prevalence of Trimethoprim resistance MRSA isolates 26
4.8 Distribution of Trimethoprim resistance MRSA isolates among clinical
samples 27
4.9 Distribution of S. aureus, MRSA and Trimethoprim resistance MRSA
among hospital unites 28
4.10 MDR pattern S. aureus, MRSA and Trimethoprim resistance MRSA of
isolates 29
4.11 Prevalence of dfrG and dfrA genes among Trimethoprim resistance
MRSA isolates 30
4.12 Prevalence of dfrG and dfrA genes among the clinical samples 31
CHAPTER V: DISCUSSION 32-36
CHAPTER VI:CONCLUSIONS AND RECOMMENDATIONS 37-38
viii
6.1 Conclusions 37
6.2 Recommendations 38
REFERENCES 39-51
APPENDICES i-xxi

ix
 LIST OF TABLES

Table 1: The distribution of S. aureus isolates in clinical samples

Table 2: Antibiotic susceptibility pattern of Staphylococcus aureus
Table 3: Association of growth of MRSA with age and gender of
patients
Table 4: Antibiotic susceptibility test of Trimethoprim resistance MRSA
isolates
Table 5: Distribution of Trimethoprim resistance MRSA isolates in
clinical samples
Table 6: MDR pattern S. aureus, MRSA and Trimethoprim resistance
MRSA
Table 7: Prevalence of dfrG and dfrA genes among Trimethoprim
resistance MRSA isolates
Table 8: Prevalence of dfrG and dfrA genes among the clinical samples

x
 LIST OF FIGURES

Figure 1: Flowchart showing laboratory diagnosis

Figure 2: Pie chart showing growth profile in clinical isolates
Figure 3: Prevalence of Methicillin resistance Staphylococcus aureus
Figure 4: Prevalence of Trimethoprim resistance MRSA isolates
Figure 5: Bar graph showing distribution of S. aureus, MRSA and
Trimethoprim resistance MRSA isolates among hospital units

xi
 LIST OF PHOTOGRAPHS

Photograph 1: Colonies of S. aureus on mannitol salt Agar

Photograph 2: Slide and tube coagulase test
Photograph 3: Screening of Trimethoprim resistance MRSA
Photograph 4: Gel electrophoresis of PCR amplicons of dfrG and dfrA
gene

xii
 LIST OF APPENDICES

APPENDIX I: List of materials and equipments

APPENDIX II: Composition and preparation of different culture media
APPENDIX III: Composition and preparation of different staining and
test reagents
APPENDIX IV: Detailed procedures of different tests
APPENDIX V: Sample collection protocol
APPENDIX VI: Zone interpretation chart of CLSI for S. aureus
APPENDIX VII: Composition and method of preparation of different
reagents for genomic DNA extraction and gel
electrophoresis
APPENDIX VIII: DNA extraction and PCR protocol
APPENDIX IX: Ethical approval letter from NHRC

xiii
 ABBREVIATIONS

ARC Annapurna Research Center

ANIAS Annapurna Neurological Institute and Allied Sciences
MSA Mannitol Salt Agar
NA Nutrient Agar
NB Nutrient Broth
MDR Multi Drug Resistant
MHA Mueller Hinton Agar
DHFR Dihydrofolate Reductase
dfrG Dihydrofolate Reductase G gene
dfrA Dihydrofolate Reductase A gene
PCR Polymerase Chain Reaction
MRSA Methicillin Resistant Staphylococcus aureus
TRMRSA Trimethoprim Resistance MRSA
CLSI Clinical Laboratory Standard Institute
CDC Centers for Disease Control and Prevention
AST Antimicrobial Susceptibility Test
ATCC American Type Culture Collection Center for Disease Control
DNTPs Deoxy Nucleotide 5’-Triphosphates
EDTA Ethylenediamine Tetra Acetic Acid
TE Tris-EDTA Buffer
TAE Tris-Acetate EDTA Buffer
Rpm Rotation Per Minute
SDS Sodium Dodecyl Sulphate
CTAB Cetyl Trimethylammonium Bromide
EtBr Ethidium Bromide
ICU Intensive Care Unit
OPD Out Patient Department
ER Emergency Room
TMP Trimethoprim

xiv
COT Co-Trimoxazole
SMX Sulfamethoxazole
SXT Trimethoprim/Sulfamethoxazole
SCCmec Staphylococcal Cassette Chromosome mec
PBPs Penicillin Binding Proteins
MGEs Main Genetic Elements
DHPS Dihydropteroate Synthase
PABA Para-amino Benzoic Acid
DHPP Dehydropterin Pyrophosphate
NADP Nicotinamide Adenine Dinucleotide Phosphate

xv
 CHAPTER I
INTRODUCTION AND OBJECTIVES

1.1 Background

Staphylococcus aureus is Gram positive, coagulase positive, catalase positive,

non-motile, non-spore forming facultative anaerobes belonging to the family
Staphylococcaceae. They divide in more than one plane to form grapes like
cluster (Lakhundi and Zhang 2018). Methicillin-resistant S. aureus was first
discovered by Jevons in 1961 from the UK. Methicillin resistant S. aureus is a
major cause of hospital-associated infections. It is generally believed that the
spread of MRSA resulted from the worldwide dissemination of a few highly
epidemic clones (Shittu et al 2009).

S. aureus genome consisting of a circular chromosome of approximately 2,800

base pairs and additional prophages, plasmids, and transposons. Genes
governing virulence and antibiotic resistance reside on both the chromosome
and extrachromosomal elements, and these genes are transferred between
staphylococcal strains or other bacterial species via extrachromosomal
elements. Humans are a natural reservoir of Staphylococcus aureus with
colonies 25% to 30% in healthy adults (Kluytmans and Verbrugh 1997).

Methicillin-resistant Staphylococcus aureus has been considered the prototype

of multi-resistant nosocomial pathogens of strain of Staphylococcus aureus
(Grundmann et al 2006). Methicillin Resistant Staphylococcus aureus
(MRSA), an opportunistic gram-positive bacterium is the leading cause of
healthcare associated infections as well as invasive systemic infections.
MRSA infections can be divided into hospital-associated (HA-MRSA)
infections and community-associated (CA-MRSA) infections (Navratna et al
2010). MRSA is defined as zone of inhibition less than or equal to 21 mm on
MHA with 30 μg Cefoxitin disc seeded with growth suspension of S. aureus
isolates adjusted to 0.5 McFarland standards (Dilnissa et al 2016).
S. aureus attached to host tissues beyond the mucosal surface or skin is
thought to trigger virulence genes. During infection pro-inflammatory
signaling lead to activation of neutrophil and macrophage. S. aureus has been
found to survive well both inside and outside of host cells. S. aureus must
overcome opsonization by complement and antibodies, which directly or
indirectly leads to killing of S. aureus (David et al 2010). S. aureus avoids
opsonophagocytic by expressing on its surface capsule, leucocidins, clumping
factor A, immune modulatory factors and number of complement inhibitors,
all of which inactivate or prevent host opsonin’s from binding or targeting the
bacterium for destruction. Other virulence mechanisms of clinical significance
include biofilm formation which allows S. aureus to resists host defenses or
antibiotics (Liu et al 2009). S. aureus causes many disease-like wound
infections, furunculosis, pneumonia, meningitis, osteomyelitis, endocarditis,
septicemia, urinary tract infections and soft tissue infections (Hassoun et al
2017).

Virulence factors, genes responsible directly for host adaptation and toxins of
S. aureus are located in Main Genetic Elements (MGEs). Staphylococcus
aureus contains many types of Main Genetic Elements (MGEs) such as
plasmids, transposons, insertion sequences, bacteriophages, pathogenicity
islands, and staphylococcal cassette chromosomes (Malachowa et al 2010).
Sulfonamides are modest antagonist P-aminobenzoic Acid (PABA) that inhibit
the bacterial growth (Brown 1992). Sulfonamides are antimicrobial drugs with
a broad spectrum of action, effective against Gram-positive and certain Gram-
negative bacteria, it targets the enzyme Dihydropteroate Synthase (DHPS) that
catalyzes a key step in microbial folate biosynthesis (Capasso and Supuran
2020).

Trimethoprim resistance S. aureus was first reported in 1980s and was found
to be due to plasmid-mediated production dihydrofolate reductase that
encoded dfrS1gene and additional Dihydrofolate Reductase (DHFR) that
encoded by the dfrB gene on the chromosome. Co-Trimoxazole is a
combination of Trimethoprim and Sulfamethoxazole and is in a class of
medications called sulfonamides. Co-Trimoxazole is recommended for
2
uncomplicated urinary tract infections, travelers’ diarrhea, respiratory tract
infections and skin and soft tissue infections caused by MRSA (Sekiguchi et al
2005).

Co-Trimoxazole is a fixed-dose combination of the antifolate compounds

Trimethoprim and Sulfamethoxazole, which act synergistically by inhibiting
distinct steps in the bacterial folic acid synthesis. In the 1990s, two primary
resistance mechanisms were identified as conferring clinical TMP resistance
(TMPR), first point mutations in the endogenous TMP sensitive (TMPS)
chromosomal DHFR gene dfrB and the other acquisition of an innately
resistant DHFR enzyme and dfrA gene (dfrS1) (Aires de sousa and Dionisio
2016). Recently, two additional plasmid-encoded DHFR resistance genes dfrG
and dfrK started appearing in MRSA infections. In dfrB gene of S. aureus,
mutation occurs at position 98 (F98Y) confers Trimethoprim resistance. Three
such genes (dfrA (dfrS1), dfrG and dfrK) have been identified in S. aureus of
human origin (Nurjadi et al 2014).

Co-Trimoxazoles (COT) inhibits Dihydrofolate Reductase, which catalyses

the formation of tetrahydrofolate from dihydrofolate. Co-Trimoxazoles are the
diaminopyrimidine antimicrobial drug shows broad spectrum antibacterial
activity (Clarke et al 2019). The dfrG gene share 39.8% sequence identity with
dfrA gene. The dfrG and dfrA genes containing S. aureus strains showed high
level antifolate resistance with MIC values >1000 μg/mL and 250 μg/mL,
respectively (Reeve et al 2019). Dihydrofolate reductase is an essential
enzyme in most pathogenic bacteria and the clinical success of Trimethoprim
confirms DHFR as an important chemotherapeutic target (Caspers et al 2009).
Co-Trimoxazole is valuable for the empirical antibiotic treatment of skin and
soft tissue infections (SSTIs) caused by Community-Associated Methicillin-
Resistant S. aureus (Chua et al 2011).

Co-Trimoxazole is a broad-spectrum antibiotic that inhibit bacterial

dihydrofolate reductase (DHFR) enzyme and used as treatment against
infections caused by Methicillin-Resistant Staphylococcus aureus (MRSA).
Methicillin Resistant Staphylococcus aureus (MRSA) strains are prevalent
3
bacterial pathogens causing both health care and community-associated
infections. There are only very few researches carried out on this alarming
subject in Nepal. So, this study is expected to provide prevalence of
dihydrofolate reductase enzyme coding genes of MRSA in Nepal.

The aim of this study is to investigate the detection of dfrG and dfrA genes by
multiplex PCR in clinical isolates of Trimethoprim resistant MRSA at the
microbiology laboratory of the Annapurna hospital and Annapurna research
center in Nepal. MRSA is now a global concern because of its adapting
character. Antibiotic resistivity pattern is increasing rapidly day by day. This
study helps to the selection of antibiotics for Trimethoprim resistant MRSA.
Thus, the results of the study assume to provide better control measures of the
infections associated with Trimethoprim resistant MRSA as well as facilitate
epidemiologists to understand the nature of Trimethoprim resistant MRSA.

4
1.2 Objectives

1.2.1 General objective

To detect dfrG and dfrA genes by multiplex PCR in clinical isolates of

Trimethoprim resistance MRSA.

1.2.2 Specific Objectives

I. To isolate and identify Staphylococcus aureus from clinical samples.

II. To determine antibiotic sensitivity pattern by using Kriby Bauer disc
diffusion method.
III. To screen and identify MRSA by using Cefoxitin antibiotic.
IV. To screen and identify Trimethoprim resistance MRSA by using Co-
Trimoxazole antibiotic.
V. To extract DNA of Trimethoprim resistance MRSA by using phenol
chloroform method.
VI. To perform multiplex PCR for the detection of dfrG and dfrA genes of
Trimethoprim resistance MRSA.

5
 CHAPTER II
LITERATURE REVIEW
2.1 History

The term Staphylococcus genus was given first by Alexander Ogston in 1882,
and was isolated from a surgical wound infection. Then Rosenbach separated
the genus into the species S. aureus and S. albus in 1884 (Lakhundi and Zhang
2018). In 1942, the first Penicillin resistant Staphylococcus aureus isolate was
described in a hospital of US and after month same strains were also observed
in the community (Deurenberg and Stobberingh 2008). Methicillin (2, 6-
Dimethoxyphenyl Penicillin) is semi-synthetic second-generation β-lactam
antibiotic, was presented in the UK in 1959 to avoid rising Penicillin
resistance in S. aureus, related with the accomplishment of a β-lactamase
enzyme (Harkins et al 2017). Nowadays, the great majority of S. aureus
strains are β-lactamase producers and Penicillin has almost become useless
(Deurenberg et al 2007).

Methicillin is unaffected by the action of β-lactamase produced by Penicillin

Binding Protein 2 (PBP2) used by bacteria to cross-link the peptide (D-alanyl-
alanine) mandatory for peptidoglycan synthesis (Jr et al 2016). Methicillin was
approved for clinical use in 1961; unfortunately, in less than a year, a report
described resistance of S. aureus isolates to Methicillin. In the 1970s,
Methicillin-Resistant S. aureus (MRSA) has become the main cause of
nosocomial infection worldwide (Deurenberg et al 2007). In 1961, first
Methicillin resistance Staphylococcus aureus isolates were observed in United
Kingdom and were soon recovered from other European countries (Enright et
al 2002).

Sulfonamides were discovered in 1932 and put into clinical use in 1935
(Brown 1992). Co-Trimoxazole is a collective sulfonamide antifolate
compounds of Trimethoprim and Sulfamethoxazole in the ratio of 1:5.
Sulfonamide is first successfully manufactured and selectively toxic
antimicrobial drug, belong to the group of bacteriostatic agents (Angelis et al

6
2011). Trimethoprim (TMP) was first used for the treatment of infections in
humans in 1962, and it was registered for clinical use in 1968. In 1976, the
Co-Trimoxazoles (TMP-SMX) combination was launched from United
Kingdom, S. aureus isolates fully resistant to SXT were firstly identified in the
1980s (Skold et al 2001). DHFR inhibitors are classified into two categories
that is lipophilic (Trimethoprim and Iclaprim) and classical (Methotrexate and
Pemetrexed) (Goldberg et al 2010). The wide resistance to TMP-SMX in S.
aureus began to arise in 1980s (Dale et al 1995). The Trimethoprim resistance
gene, dfrG was first reported in isolates from Thailand hospital in Chiang Mai
and was later reported as abundant in sub-Saharan Africa (Nurjadi et al 2014).
After know the resistance mechanisms of dfrB gene, firstly plasmid-encoded
TMP resistance gene dfrA (S1 DHFR) from a clinical isolate of S. aureus has
been described (Reeve et al 2016). Initial studies of clinical isolates showed
that the accumulation of point mutations in establishing mutation as a
principal mode of Trimethoprim resistance (Coque et al 1999).

2.2 Epidemiology

The frequency of MRSA continues to grow in hospital-associated setting and

more recently, in community-setting in United States and then globally. In
Europe considerable geographic variation exists in the incidence of MRSA
with only 0.5% in Iceland and 44% in Greece (Boucher and Corey 2008). The
first case of MRSA infection was reported at Australia in 1965 (Givney et al
1998). Another study reported in US hospitals in between 2005 to 2008
MRSA infection found that the proportion was 55% HA-MRSA and 45% CA-
MRSA (Klein et al 2007). Several strains of HA-MRSA eventually spread
across the globe with a strong prevalence in North America, South America,
Europe and Asia (Diekema et al 2012). In the late 1980s MRSA rates in
teaching hospitals reached 14% in Australia, while in United States they
increased from 8% to 22% (Stryjewski and Corey 2014).

MRSA prevalence exhibits a great variation in Europe with high resistant in

southern countries in comparisons to northern. In 2014, the percentage of

7
invasive MRSA isolates in Europe ranged from 0.9% in Netherlands to 56% in
Romania (Hassoun et al 2017). Methicillin-Resistant Staphylococcus aureus is
a well-known public health problem that emerged shortly after the
introduction of Methicillin, Nafcillin, and Oxacillin antibiotics
(Waitayangkoon et al 2020). MRSA infections can be caused by either
healthcare-associated (HA) MRSA or community associated (CA) MRSA.
However, CA-MRSA is phenotypically and genotypically different from HA-
MRSA (Kumburu et al 2018).

In Asia, high prevalence of MRSA infection was observed in several

countries, including Japan, Korea, Taiwan and Vietnam with the proportion
greater than 70% (Shrestha et al 2021). A study conducted by Amorim et al
(2007) reported that in Europe, Trimethoprim-Sulfamethoxazole (SXT)
resistance has reached 12.5% to 67% (Amorim et al 2007). Similarly, another
study reported in Sweden and Belgium, prevalence of Trimethoprim-
Sulfamethoxazole resistance was found highest based on their total study
population per country (Heijer et al 2013). Although resistance to
Trimethoprim among clinical S. aureus isolates were observed rare in North
America and high level of resistance (Co-Trimoxazole) was observed among
MRSA isolates in Latin America (up to 100%) compared to the Brazilian
clone (Talan et al 2011). A study conducted by Aries de-Suosa (2016)
reported that high levels of SXT resistance among MRSA isolates were
observed in South America as well as in the Asiatic continent namely in
Taiwan (89%) and China (21%) (Aries de-Suosa and Dionisio 2016).
Similarly, another study reported dfrG gene was the predominant
Trimethoprim-resistance DHFRs gene in MRSA strains isolated from Africa,
South Asia and South-East Asia (Chua et al 2010).

2.3 Prevalence

SXT resistance rates among MRSA vary considerably depending on the

location, as well as the time period (Aries-de-Sousa and De-Lencastre 2003).
A study conducted in tertiary care Hospital at Kathmandu, Nepal total of

8
16789 specimens were processed, 270 isolates were found to be
Staphylococcus aureus. Out of which 25.1% (68) were MRSA, out of that
30.8% was resistant to Co-Trimoxazole (Adhikari et al 2017). A study
conducted by Raut et al (2017) reported (6.71%) 133 S. aureus were isolated
from 1981 clinical samples, among 133 S. aureus isolates, 34 (39.1%) were
MRSA, among them 95 (71.4%) was resistant to Co-Trimoxazole (Raut et al
2017).

Out of total 114137 clinical samples, 1804 (1.58%) S. aureus isolates were
reported, from which 57% resistant to Methicillin, among them (71%) was
Co-Trimoxazole resistant (Pradhan et al 2021). Another study showed, from
510 S. aureus samples, 20.2% MRSA were observed, among them 36.8% was
resistant to Co-Trimoxazole (Bhatt et al 2015). A study conducted by
Ghebremedhin et al (2009) showed, out of total 346 S. aureus isolates, 70
(20.23%) MRSA were observed, out of that 23.21% were resistant to Co-
Trimoxazole (Ghebremedhin et al 2009). A cross sectional study conducted at
Bhairawaha, where out of 204 health care workers HCWs, 32 (15.7%) S.
aureus were observed, among them, 7 (21.9%) was MRSA, out of that (28.6
%) were resistant to Co-Trimoxazole (Khanal et al 2015).

A study conducted from April 2015 to March 2016 by Khanal et al (2018), he

reported that out of 142 S. aureus, 30 (21.1%) were Methicillin resistance
Staphylococcus aureus, out of that 70% were resistant to Co-Trimoxazole
(Khanal et al 2018). A study done by Shahi et al (2018) reported out of total
754 samples, 109 (14.4%) isolates were confirmed as S. aureus and among
them 36 (33%) MRSA were observed (Shahi et al 2018). A study done by
Dibah et al (2014) (From July to December 2011) reported from 41 S. aureus
strains, 19 (46.3%) were MRSA, out of that 2 (10.5%) were Co-Trimoxazole
resistance (Dibah et al 2014). In the year 2008 study done by Kumari et al
reported that out of a total of 750 Staphylococcus aureus strains, 196 (26.14%)
were found to be Methicillin-resistant (Kumari et al 2008).

The study carried out by Karki et al (2019) reported that out of the 570 clinical
samples, 19.3% (110) S. aureus isolates were found to be positive, among
9
them 26.4% reported MRSA. Similarly, according to the study carried out by
Kandel et al (2020) reported that out of total 153 bacterial positive growth
isolates, 39 (25.5%) were S. aureus, out of that 18 (46%) observed MRSA, out
of them 15 (83.3%) were resistance to Co-Trimoxazole (Kandel et al 2020). A
cross sectional study conducted by Sapkota et al (2020) revealed 666 bacteria
isolated from clinical samples, among positive bacterial growth, 133 (19.96%)
Staphylococcus aureus isolates were observed, out of them 94 (70.64%)
resistant to Methicillin, among them 42.55% was found to be Co-Trimozaxole
resistance (Sapkota et al 2020).

Among total 830 pus-wound swab samples processed, 364 (43.9%) were
culture positive, out of which 76 (20.9%) S. aureus was isolated. Among 76 S.
aureus, 36 (47.4%) were MRSA, out of which 10 (27.8%) were resistant to
Co-Trimoxazole (COT) (Belbase et al 2017). Total of 300 Staphylococcus.
aureus isolates, 26% Methicillin Resistant Staphylococcus aureus was found,
among them 64% showed resistant to Co-Trimoxazole (Baral et al 2011). A
study done by Maharjan et al (2021) observed out of 270 pus/wound swab
samples, 139 (51.48%) were found to be culture positive, out of 139 culture
positive cases, 105 (75.5%) isolates were S. aureus, among them 55% (58)
were found to be MRSA, out of which 18(31.04%) were resistant to Co-
Trimoxazole (Maharjan et al 2021).

In the year 2019, study done by Kengne et al (2019) reported 201(80.4%)

Methicillin resistance Staphylococcus aureus from 250 S. aureus isolate, out
of 201 MRSA isolates, 89% was found to be Co-Trimoxazole resistant
(Kengne et al 2019). A cross-sectional observational study was conducted by
Rossato et al (2020) using 217 MRSA isolates obtained between January 2014
and January 2019, out of them 13.8% (30) MRSA were resistant to
Trimethoprim-Sulfamethoxazole, out of that 13.3% and 100% carried dfrA
and dfrG genes, respectively (Rossato et al 2020).

Similar observation done by Jr et al (2016) reported 236 S. aureus isolates out

of which 108 (45.76 %) were found to be MRSA. Among them, 22 (20.37%)
was resistant Co-Trimoxazole (Jr et al 2016). In the year 2006, Rajaduraipandi
10
et al reported that out of 906 strains of S. aureus isolated from clinical and
carrier samples, 250 (31.1%) and 39 (37.9%) were found to be methicillin
resistant respectively, among 250 MRSA strains, 63.2% were resistant to Co-
Trimoxazole and among 39 MRSA strains, 35.9% were resistant to Co-
Trimoxazole (Rajaduraipandi et al 2006).

A study done by Nurjadi et al (2015) reported that out of total 196

Staphylococcus aureus isolates, 12% (23/196) isolates were MRSA, out of
them 17% (4/23) were resistant to Co-Trimoxazole (Nurjadi et al 2015). In the
year 2018, study done by Kumburu et al reported out of 30 S. aureus isolates,
16(53.3%) were resistance to Trimethoprim-Sulfamethoxazole (Kumburu et al
2018). A study done by Coelho et al (2017) reported that from 122 MRSA
isolates, 58 (61%) resistance to Trimethoprim, out of which (78%) harbored
dfrG gene and (19%) harbored dfrA genes (Coelho et al 2017).

Among 783 isolates of S. aureus, 301 (38.44%) were methicillin-resistant, out

of which 95.68% were resistant to Co-Trimoxazole (Tiwari et al 2008).
Another study also reported that out of total 95 S. aureus isolates, 32/95
(32.6%) were SXT resistant, out of them (23) 72% were harbored dfrG gene
and (9) 28% were harbored dfrA gene (Nurjadi et al 2021). A study done by
Nurjadi et al (2014) reported from 598 S. aureus isolates, 32 (5.35%) isolates
of MRSA were identified. Out of these 24 (75%) were resistant to SXT
(Nurjadi et al 2014). A study conducted by Nurjadi et al (2021) reported from
242 S. aureus isolates, only two isolates showed high-level SXT resistant (no
inhibition zone) and both isolates harbored dfrG gene and dfrA gene (Nurjadi
et al 2021).

2.4 Pathogenesis

Staphylococcus aureus is a both commensal organism and versatile pathogen

capable of causing a wide range of human diseases. The transmission routes of
MRSA are healthcare facilities, direct contact with infected individuals,
indirect contact through contaminated hands of healthcare workers (David and

11
Daum 2010). Initial exposure of Staphylococcus aureus to host tissues in the
mucosal surface of the host. S. aureus peptidoglycan and lipoprotein are
sensed by host pattern recognition by local immune cell activation, neutrophil
and macrophage recruitment (Liu et al 2010).

It colonizes axillae, groin, gastrointestinal tract and main ecological niche is

anterior nares. S. aureus express various surface proteins like collagen
binding protein, coagulase, extra cellular fibrinogen and adherence proteins
are the cell surface proteins of S. aureus facilitate adherence to host tissues
(Kong et al 2016). S. aureus produce virulence factors such as Protein A, PVL
and alpha-hemolysin are implicated in evading the host defense, and
metalloproteases, Proteases, nucleases, phospholipase C, staphylokinase and
lipases, help in tissue invasion. Also, it produces Enterotoxins, Toxic shock
syndrome toxin-1 and exfoliative toxins A and B cause toxins-mediated
syndrome are associated with increment to pathogenesis of MRSA (Gordon
and Lowy 2008).

The antibacterial action of beta-lactam antibiotics is mediated by inactivation

of Penicillin-Binding Proteins (PBPs), which are the critical enzymes involved
in the final stages of bacterial cell wall synthesis. Beta-lactams cannot inactive
PBP2a. Therefore, even in presence of beta-lactam antibiotic, MRSA can
build their cell wall using PBP2a (Fishovitz et al 2014). The mecA gene which
codes for PBP2a is part of a 21–60 kb mobile genetic element, referred to as
staphylococcal cassette chromosome mecA (SCCmecA). These cassette
chromosomes are varied in their structural arrangement as well as in genetic
content (Robinson and Enright 2004). Health care-associated MRSA (HA-
MRSA) clones are multi-drug resistant (such as Ciprofloxacin, Gentamicin
and Chloramphenicol). This is due to co-carriage of non-beta-lactam antibiotic
resistant determinants in comparatively large SCCmec element. MRSA clones
were primarily of hospital origin (Hiramatsu et al 2001).

A highly virulent exotoxin associated with CA-MRSA is PVL (Panton-

Valentine Leukocidin) encoded on the PVL gene. PVL is exotoxin functions
as a two-component pore-forming protein, encoded by the lukF-PV and lukS-
12
PV genes, and acts as a leukocidin that can lyse the cell membranes of human
neutrophils. Distinguishing genetic feature of CA-MRSA is that a high
percentage of strains carry genes for Panton–Valentine leukocidin (PVL),
which is largely absent from HA-MRSA strains (Kong et al 2016). In
Staphylococcus aureus resistance to sulfonamides is mediated by the
following main mechanisms; the permeability barrier and efflux pump,
naturally insensitive target enzymes, regulational changes in the target
enzymes, mutational or recombinational changes in the target enzymes and
acquired resistance by drug-resistant target enzymes (Huovinen 2001).

Dihydrofolate Reductase (DHFR) is a crucial enzyme in folate biosynthesis

pathway. In the Methicillin resistance Staphylococcus aureus, preliminary
Trimethoprim resistance were occurred due to the accumulation of point
mutations arise in the chromosomally located dfrB gene (Reeve et al 2016).
On the other hand, mechanisms of Co-Trimoxazole (COT) resistance MRSA
arisen due to the acquisition of plasmid located genes dfrA, (DHFR S1) dfrG
and dfrK (Coelho et al 2017). Also in S. aureus, Trimethoprim resistance was
seen due to changes occurring on the chromosomal dihydropteroate synthase
(DHPS) encoding gene (folP) (Griffith et al 2018).

DHFR (5,6,7,8-tetrahydrofolate, NADP oxidoreductase) enzyme of molecular

mass of 18kDa has a key role in cell growth and proliferation. DHFR is a key
enzyme in the tetrahydrofolate pathway and involved in active synthesizing
folic acids, thymidylate, purines and several other amino acids like glycine,
methionine, serine and N-formyl-methionyl tRNA. Disruption of folate
biosynthesis by deactivation of DHFR enzymes leads to break DNA
replication, and ultimately causes cell death (Wrobel et al 2019). Now a days,
DHFR enzymes coadded dfrG, dfrA, dfrB, dfrD and dfrK DHFR genes were
described in S. aureus. These DHFR genes are integrated into plasmids,
integrons, transposons exchangeable genetic elements. The sequence
similarity to dfrG and dfrK genes have 89 % to each other, dfrG and dfrK
genes are less similar to dfrA (38% and 39 %) and dfrB (41% and 42 %)
(Aires-de-Sousa and Dionisio 2016).

13
 CHAPTER III
MATERIALS AND METHODS

3.1 Materials and equipments

All the materials, equipments, reagents and media used in various stages of
this study is listed in Appendix I-IV.

3.2 Methodology

3.2.1 Research design

This study was Hospital based cross-sectional descriptive analytical study

which was carried out from September 2019 to March 2020 in Annapurna
Neurological Institute and Allied Sciences Hospital and Annapurna Research
Center (ARC), Maitighar, Kathmandu.

3.2.1.1 Study site

The phenotypic method was carried out in Annapurna Neurological Institute

and Allied Sciences hospital of microbiology department and molecular
method was conducted in Annapurna Research Center (ARC), Maitighar,
Kathmandu Nepal.

3.2.1.2 Study population and sample size

The study was conducted in the population visiting hospital and hospitalized

14
patients. Only those samples yielding growth of Staphylococcus aureus from
the cultured specimens were further tested for MRSA and Trimethoprim
Resistance MRSA. Total 822 samples were collected in this study that include
pus (124), blood (163), sputum (105), body fluids (17), urine (228), tissue
(11), catheter tip (24), CSF (86) and wound swab (64) and detailed collection
protocols were included in appendix V.

3.2.1.3 Inclusion criteria

All outdoor, indoor, ICU and ER samples, all age groups and both genders
with well labeled information which were collected aseptically in closed and
sterile container were included in the study.

3.2.1.4 Exclusion criteria

In the study, in order to avoid selection bias, repeated samples from the same
person were excluded.

3.2.2 Sample processing

The collected samples were processed immediately after it reached the

laboratory to apply following standard laboratory procedures.

3.2.2.1 Microscopic examination

The sample was spread on a clean slide and to made smear. The smear was
allowed to air dry and fixed. Then stained by Gram’s stain and finally
observed in microscope (Cheesbrough 2004). The detailed procedure of
Gram’s staining is in appendix IV.

3.2.2.2 Culture and Identification

Samples were cultured on different selective and differential media (Blood

agar and Mannitol salt agar). Then the plates were incubated at 37°C for 18 to
15
24 hours and then colony appearance on every plate were recorded.
Identification of S. aureus isolates was confirmed by conventional
microbiological methods based on colony characteristics, Gram’s staining
followed by various biochemical tests including catalase, oxidase, coagulase
(Cheesbrough 2010) and the detailed protocols were included in appendix II-
IV. Isolates were confirmed to be S. aureus, were used for further analysis.

3.2.2.3 Antibiotic susceptibility test

Antibiotic susceptibility test of the different clinical isolates towards the

various classes of antibiotics was performed by modified Kirby-Bauer disk
diffusion method on Mueller Hinton Agar. Inoculum were prepared by
suspending 2-3 morphologically similar colonies with sterile loop, inoculated
into NB and incubated at 37°C until turbidity matches with that of 0.5
McFarland Standard. The bacterial suspension was spread over the Mueller-
Hinton agar homogeneously and antimicrobial discs were dispensed on the
agar plates and incubated for 18 hours at 37°C and detailed procedure of AST
was given in appendix IV. The diameter of zone of inhibition was measured
for all antibiotics and interpreted as recommended by CLSI and reported the
results as resistant, intermediate and sensitive and antibiotic susceptibility
chart was included in appendix VI.

3.2.2.4 Screening for MRSA isolates

78 isolates of S. aureus were screened for Methicillin Resistant by using

Cefoxitin (30mcg) antibiotic. Isolates which were resistant to Cefoxitin (if the
inhibition zone size was ≤21mm) were preserved for further study (CLSI
2020).

3.2.2.5 Screening for Trimethoprim resistant MRSA isolates

41 isolates of MRSA were screened for Trimethoprim resistant by using Co-

Trimoxazole (25mcg) antibiotic. Isolates which were resistant to Co-

16
Trimoxazole (if the inhibition zone size was ≤10mm) were preserved for
further study (CLSI 2020).

3.2.2.6 Preservation of Trimethoprim resistant MRSA isolates

The isolates were preserved in Nutrient Broth (NB) containing 20% glycerol.
The organism was inoculated into 1ml prepared broth and incubated overnight
at 37oC and then stored at -20°C.

3.2.2.7 Revival of the preserved culture

The preserved cultures were revived on the Nutrient Agar (NA) and Mannitol
Salt Agar (MSA).

3.2.2.8 Genomic DNA extraction

2-3 identified colonies of MRSA isolated from nutrient agar were transferred
into nutrient broth in test tubes and incubated at 37°C overnight. From broth
culture, the genomic DNA was extracted using the CTAB method. Then the
extracted DNA was suspended in TE buffer and stored at -20°C (appendix
VII).

3.2.2.9 PCR amplification of dfrG gene and dfrA gene

Polymerase Chain Reaction (PCR) was performed in a final 25μl volume

reaction mixture containing 19 µl master mixture, 0.5µl each of the forward
and reverse primers and 5 µl of the extracted DNA was added in individual
amplification tubes. Thermal Cycling conditions for both genes were
contained an initial denaturation step at 94°C for 4 min, followed by 35 cycles
of denaturation 94°C for 1 min, annealing 57°C for 30 seconds, and 72°C for
1min ending with final extension step at 72°C for 4 min and followed by a
17
hold at 4°C. Positive control for dfrG and dfrA genes and negative control
(distilled water) were also regarded in each series of PCR reaction. The
detailed requirement was given in appendix VII-VIII. The primers used in this
study as follows.

dfrG gene primers (405bp) dfrA gene primers (270bp)

F:5’TGCTGCGATGGATAAGAA3’ F:5’CACTTGTAATGGCACGGAAA3’
R:5’TGGGCAAATACCTCATTCC3’ R:5’CGAATGTGTATGGTGGAAAG3’
(Aires-de-Sousa M et al 2016)
A= Adenine, T= Thymine, C=Cytosine, G=Guanine

3.2.2.10 Detection of PCR products by gel electrophoresis

The PCR product was subjected to electrophoresis in 1.5% agarose gel along
positive control, negative control and 100bp DNA ladder. 3 µl of PCR
amplicons along with 1.5µl of loading dye (Hi-Media) were loaded in a well
for each and subjected to electric current then finally band was observed by
UV TEC gel documentation method. The detail procedures included in
appendix VII-VIII.

3.3 Quality control

Quality control is considered as one of the important factors for the correct
result interpretation (Cheesbrough 2010) and is absolutely essential for good
operating procedure. During this study, quality control was applied in various
areas to obtain reliable microbiological results. Like, the sterility of each batch
of agar plate and biochemical media prepared was confirmed by incubating
one agar plate and 1 biochemical media of respective sets of each batch in
incubator. While using readymade dehydrated media, the manufacturer’s
instructions for preparation, sterilization and storage were followed to prevent
the alteration of the nutritional, selective, inhibitory and biochemical
properties of media.

18
Laboratory equipment like incubator, refrigerator, autoclave and hot air oven
were regularly monitored for their efficiency. The temperature of the incubator
and refrigerator was monitored every day. For stains and reagents, whenever a
new batch of them was prepared, a control smear was stained to ensure correct
staining reaction.

3.4 Data analysis

All the results were entered in the worksheet of Statistical Package for Social
Science software package (SPSS) version 16. Chi-square test was used to
determine significant association of dependent variables to different
independent variables. The p-value <0.05 was assumed to be significant for
the analysis.

19
 FLOW CHART

Samples (blood, urine, sputum, wound swab, pus etc.)

Cultured on mannitol salt agar (MSA)

S. aureus shows golden yellow

Incubation for 24 hours at
colonies on MSA
37⁰C

Sub cultured on nutrient agar and incubation for 24 hours at 37⁰C

Perform Gram’s staining (Gram positive cocci in cluster)

Perform biochemical tests like catalase, oxidase and coagulase test.

Match with McFarland 0.5

Pure colony inoculated in NB and
turbidity standard
incubate for 3hrs at 370C

Identification of MRSA using

Antibiotic Susceptibility testing
Cefoxitin antibiotic
(CLSI Guideline 2020)

Identification of Trimethoprim resistance MRSA

Data report
using Co-Trimoxazole (COT) antibiotic

Data report Genomic DNA extraction

Amplification of dfrG and dfrK genes

Detection of dfrG and dfrK genes by

gel electrophoresis

Data analysis and reporting

Figure 1: Flowchart showing laboratory diagnosis.

 CHAPTER IV
RESULTS

During the study period, total 822 clinical specimens, pus (124), blood (163),
sputum (105), body fluids (17), urine (228), tissue (11), catheter tip (24), CSF
(86) and wound swab (64) were collected from the patients visiting Annapurna
Neurological hospital and Allied Sciences. All collected samples were
processed phenotypically in Microbiology Department of the Hospital and
molecular study done in Annapurna Research Center (ARC), Maitighar,
Kathmandu Nepal. Observation made from the study are as follows.

4.1 Growth profile

In a total 822 clinical samples, 39.90% (328/822) samples showed growth

while 494 (60.10%) showed no growth. Among isolated organisms, 24%
(78/328) samples were confirmed as Staphylococcus aureus.

S. aureus
24% Other isolates

76%

Figure 2: Pie chart showing growth profile in clinical isolates

20
4.2 The distribution of Staphylococcus aureus isolates in clinical
samples

Among different clinical specimens, maximum number of S. aureus isolates

were obtained from pus 28 (38.89%) followed by blood 19 (24.34%) and
sputum 12 (15.38%). S. aureus was not obtained from body fluid and tissue
samples. Statistically, there was insignificant association (p >0.05).

Table 1: The distribution of S. aureus isolates in clinical samples

Sample type No. of total S. aureus P – value

sample
Number %
Blood 163 19 24.34
Sputum 105 12 15.38
Body fluid 17 0 0
Pus 124 28 38.89 >0.05
Catheter tip 24 1 1.28
Wound swab 64 5 6.44
Urine 228 10 12.83
CSF 86 3 3.84
Tissue 11 0 0

21
4.3 Antibiotic susceptibility pattern of Staphylococcus aureus

Of the following used antibiotics, the S. aureus showed maximum susceptible

to Vancomycin 75/78 (96.15%) followed by Linezolid 60/78 (76.93%)
Gentamycin 42/78 (53.85%). Maximum resistance was seen against
Ampicillin 70/78 (89.74%) followed by Erythromycin 63/78 (80.76%).

Table 2: Antibiotic susceptibility pattern of Staphylococcus aureus

Antibiotic used (mcg) Antibiotic susceptibility pattern

Sensitive % Resistant %
Ampicillin (10) 8 10.26 70 89.74
Cefoxitin (30) 37 47.44 41 52.56
Linezolid (30) 60 76.93 18 23.07
Erythromycin (15) 15 19.24 63 80.76
Vancomycin (30) 75 96.15 3 3.85
Co-Trimoxazole (25) 35 44.87 45 55.13
Gentamycin (10) 42 53.85 36 46.15
Ciprofloxacin (5) 28 35.89 50 64.11

22
4.4 Prevalence of Methicillin resistance Staphylococcus aureus

Out of 78 Staphylococcus aureus isolates, 41(53%) MRSA isolates were

observed. All the isolates were confirmed by Kirby Bauer disk diffusion test
using Cefoxitin antibiotic.

MSSA
47% MRSA
53%

Figure 3: Prevalence of Methicillin resistance S. aureus

23
4.5 Association of growth of MRSA with age and gender of
patients

On the basis of age wise distribution of patients, higher number of S. aureus

isolates were observed in age group 61-75 years 27(34.61%) and higher
number of MRSA isolates were observed in age group 61-75 years
15(36.58%) followed by age group 46-60 years 13(31.71%). On the basis of
gender wise distribution of patients, out of 41 MRSA isolates, 22(53.65%)
isolates were obtained from male patients and 19(46.35%) isolates from
female patients. Higher number of MRSA isolates were observed in male
patients in age group 61-75 years 10(24.39%) and female patients in age group
46-60 years 8(19.52%). Statistically, insignificant association (P > 0.05).

Table 3: Association of growth of MRSA with age and gender of patients

Age No. of No. of S. Gender of patients (MRSA) Age P–value

categor sample aureus group
y (%) (MRSA)
(years)
Male Female
Number (%) Number (%)
<15 14 2(2.56) 0 0 0
16-30 75 9(11.53) 1(2.43) 2(4.87) 3(7.30)
31-45 132 13(16.67 3(7.32) 3(7.32) 6(14.64)
)
46-60 239 20(25.65 5(12.19) 8(19.52) 13(31.71) 0.74
)
61-75 289 27(34.61 10(24.39) 5(12.19) 15(36.58)
)
76-90 68 9(11.53) 3(7.32) 1(2.45) 4(9.77)
>90 5 0 0 0 0
Total 822 78(100) 22(53.65) 19(46.35) 41(100)

24
4.6 Antibiotic susceptibility pattern of Trimethoprim resistance
MRSA isolates

The antibiotic susceptibility pattern of Trimethoprim resistant MRSA isolates

revealed that among following used antibiotics, the maximum susceptibility
was found towards Vancomycin 19/19(100%) followed by Linezolid 15/19
(78.95%). Maximum resistance was observed against Ampicillin 16/19
(84.22%) followed by Ceftriaxone 12/19(63.15%), Ciprofloxacin 11/19
(57.90%).

Table 4: Antibiotic susceptibility pattern of Trimethoprim resistant

MRSA isolates

Antibiotics used Sensitive Resistant

(mcg)
Number % Number %
Ampicillin 3 15.78 16 84.22
Clindamycin 10 52.64 9 47.36
Linezolid 15 78.95 4 21.05
Vancomycin 19 100 0 0
Gentamicin 9 47.36 10 52.64
Ciprofloxacin 8 42.10 11 57.90
Ceftriaxone 7 36.85 12 63.15

25
4.7 Prevalence of Trimethoprim resistance MRSA isolates

Among 41 MRSA isolates, 19(46.35%) were found to Trimethoprim

resistance. All the isolates were confirmed by Kirby Bauer disk diffusion test
using Co-Trimoxazole antibiotic.
56.00%

54.00% 53.65%

52.00%
%of MRSA isolates

50.00%

48.00%
46.35%
46.00%

44.00%

42.00%
TRMRSA TSMRSA

Figure 4: prevalence of Trimethoprim resistance MRSA isolates

26
4.9 Distribution of Trimethoprim resistance MRSA isolates
among clinical samples

Out of 19 Trimethoprim resistant MRSA isolates, higher number of isolates

were obtained from pus sample 9(47.37%) followed by blood 6(31.57%).
Statistically, there was not significant association between type of sample and
Trimethoprim Resistance Methicillin Resistant S. aureus (TRMRSA) isolates
(P > 0.05).

Table 6: Distribution of Trimethoprim resistance MRSA isolates among

clinical samples

Type of Total no. of TRMRSA isolates P- value

samples sample
Number %
Blood 13 6 31.57
Sputum 6 2 10.53
Pus 16 9 47.37 0.73
Urine 5 2 10.53
Wound swab 1 0 0

27
4.10 Distribution of Staphylococcus aureus, MRSA and
Trimethoprim resistance MRSA isolates among hospital unites

On the basis of hospital units, the higher prevalence of isolates was found in
general ward the followed by OPD, ICU and ER (Table 10). Statistically, there
was no significant association between type of hospital units and isolates (P
(0.78) > 0.05).

S. aureus MRSA TRMRSA

60.00%
52.64%
50.00% 47.44% 46.35%

40.00% 35.89%
% of isolates

31.58%
30.00% 26.82%

20.00% 19.51%
11.54% 10.51%
10.00% 7.32%
5.13% 5.27%
0.00%
OPD General ward ER ICU

Hospital units

OPD=Out Patient Department, ICU=Intensive Care Unit, ER=Emergency

ward

Figure 5: Bar graph showing distribution of S. aureus, MRSA and

Trimethoprim resistance MRSA isolates among hospital units.

28
4.11 MDR pattern of Staphylococcus aureus, MRSA and
Trimethoprim resistance MRSA isolates

Out of the total 78 S. aureus isolates, 43(55.12%) were found to be MDR and
remaining 35(44.88%) were non MDR. Similarly, out of total 41 Methicillin
resistance S. aureus, 26(63.41%) was observed to be MDR whereas 15
(36.59%) were non MDR and in case of Trimethoprim resistance MRSA, all
the isolates were found to be MDR. Statistically, there was significant
association between isolates with MDR and non MDR (P<0.05) with (χ2
=13.31 and df =2).

Table 7: MDR pattern of S. aureus, MRSA and Trimethoprim resistance

MRSA isolates

Isolates MDR Non MDR p-value

Number % Number %
S. aureus 43 55.12 35 44.88
MRSA 26 63.41 15 36.59 0.001
TRMRSA 19 100 0 0

29
4.12 Prevalence of dfrG and dfrA genes among Trimethoprim
resistance MRSA isolates

Phenotypically confirmed 19 TRMRSA isolates were subjected to multiplex

PCR for molecular detection of Trimethoprim resistant genes (dfrG and dfrA).
PCR amplification was performed using gene specific primers with annealing
temperature 57-degree centigrade. Among 19 TRMRSA isolates 14(73.68%)
isolates were found to be positive for dfrG gene whereas 6(31.58%) isolates
were found to be positive for dfrA gene. Statistically, there was not significant
association between the Trimethoprim resistance MRSA isolates and
dihydrofolate reductase genes (dfrG and dfrA) (p>0.05) with (χ2 =6.755 and df
=1).

Table 8: Prevalence of dfrG and dfrA genes among Trimethoprim

resistant MRSA isolates

DHFR genes TRMRSA isolates P – value

Positive Negative
Number % Number %
dfrG 14 73.68 5 26.32 0.009
dfrA 6 31.58 13 68.42

30
4.13 Prevalence of dfrG and dfrA genes among the clinical
samples

The higher prevalence of dfrG genes were found in pus sample 7(42.87%)
then followed by blood 4(28.57%). Similarly, dfrA genes were found high in
pus 3(50%) followed by blood 2(33.33%), sputum 1(16.67%). Statistically,
there was not significant difference between Trimethoprim resistance genes
(dfrG and dfrA) and clinical specimens (p>0.05).

Table 9: Prevalence of dfrG and dfrA genes among the clinical samples.

Clinical Total no. of Trimethoprim resistance genes P – value

samples sample
(n=19) dfrG gene dfrA gene (n=6)
(n=14)
Number % Number %
Blood 6 4 28.57 2 33.33
Sputum 2 2 14.28 1 16.67 0.81
Pus 9 6 42.87 3 50
Urine 2 2 14.28 0 0

31
 CHAPTER V
DISCUSSION

The present study was carried out in Annapurna Neurological Hospital and
Allied Sciences and Annapurna Research Center (ARC). This study was
conducted by collecting clinical samples of patients visiting Annapurna
hospital. In the study, 822 non-repetitive clinical specimens were submitted to
Microbiology Department Laboratory of the Hospital for culture were
processed and Trimethoprim resistance MRSA isolates were subjected to
Annapurna Research Center (ARC) for detection of dihydrofolate reductase
genes (dfrG gene and dfrA gene). The main aim of this study was to know the
status of MRSA, Trimethoprim resistant MRSA and prevalence of
Trimethoprim resistance genes (dfrG gene and dfrA gene).

The data presented in this study could provide information of immediate

public health importance to clinicians on the selection of antimicrobial agents
for the prophylaxis and treatment of patients. S. aureus has the notable
capability to quickly adjust to the varying environments of hospitals and other
healthcare institutions, overcoming antibiotic activity with a diversity of
different resistance mechanisms. Methicillin-Resistant Staphylococcus aureus
(MRSA) is a growing medical concern. Now days, in most developed
countries, the rates of infections caused by MRSA increased among in patients
and out patients.

In this study, a total 822 clinical samples, 39.90% (328/822) samples were
showed growth, among them 24% (78/328) samples were confirmed as
Staphylococcus aureus which is similar to the findings of Kandel et al (2020)
39 (25.5%), Belbase et al (2017) (20.9%), Karki et al (2019) (19.3%) and
Sapkota et al (2019) (19.96%). In this study, among the 78 (24%)
Staphylococcus aureus isolates, the percentage of isolates were obtained
28(35.89%), 19(24.34%), 12(15.38%), 10(12.83%) 5(6.44%) from pus, blood,
sputum, urine, wound swab samples, respectively. Which is similar to the
findings of Sapkota et al (2019) and Shahi et al (2018) had been reported high

32
percentage of prevalence in pus sample 49 (55.64%) and 77 (70.6%),
respectively. This finding suggest that the highest prevalence of S. aureus was
seen in pus sample due to it causes the vast majority of skin and soft tissue
infections and wound infections.

In the present study, the S. aureus showed maximum susceptibility to

Vancomycin 75(96.15%) followed by Linezolid 60(76.93%) Gentamycin
42(53.85%) and maximum resistance was seen against Ampicillin 70
(89.74%) followed by Erythromycin 63(80.76%), which is similar to the
findings of Khanal et al (2015), Adhikari et al (2017), Baral et al (2011) and
Kumburu et al (2018) who also reported high susceptibility to Vancomycin.
Similar study done by Kandel et al (2020) also reported maximum sensitive to
Vancomycin. This indicates that Vancomycin susceptibility is high as
compared to antibiotics of other class.

In the present study, among 41 MRSA isolates, the high prevalence of MRSA
isolates was found in the age group 61-75 (36.58%) and followed by age
group 46-60 (31.71%). The maximum MRSA isolates was found from male in
age group 61-75 whereas from female in age group 46-60 years, which is
similar to study conducted by Khanal et al (2015) where he reported high
percentage (9.1%) of MRSA found in age group greater than 45 years.
Similarly, Shahi et al (2018) who reported the high prevalence of MRSA was
found in age group greater than 60 years in which 28.7% from outdoor and
27.9% from indoor patients. These variations could be due to the differences
in the circulating clones or due to the variations in infection prevention
practices.

In the present study, 46.35% (19/78) Co-Trimoxazole (COT) resistance

MRSA isolates were obtained, which is similar to study done by Sapkota et al
(2020) who reported 42.55% Co-Trimoxazole resistant MRSA. Similar study
done by Rajesh et al (2018) reported 52 (32.2%) MRSA was Co-Trimoxazole
resistance. Another observation conducted by Jr et al (2016) reported 22
(20.37%) MRSA was Co-Trimoxazole resistance. A study done by Maharjan
et al (2021) reported that 18(31.04%) were Co-Trimoxazole resistance MRSA
33
clones. This finding is compatible with the findings of Kandal et al (2020),
Rout et al (2017), Baral et al (2011) and Belbase et al (2017) where (83.3%),
(71.41%), (64%) and 10 (27.8%) MRSA strains resistant to Co-Trimoxazole
were reported, respectively.

A study done by Coelho et al (2017) reported that 102 (83.6%) isolates were
resistant to Co-Trimoxazole. This result may be due to the variable
distribution of Co-Trimoxazole resistance MRSA strains depending upon the
geographical location, study population and the higher prevalence of
resistance to Co-Trimoxazole could be due to widespread, indiscriminate use
of these antibiotics.
In the present study, the higher prevalence of Co-Trimoxazole resistant
isolates was found in pus samples 9 (47.37%) followed by blood 6 (31.57%).
Similarly, a study done by Amorim et al (2007) reported that the higher
prevalence of Co-Trimoxazole resistant isolates was found in pus samples.
Results obtained in this study were in contrast to the findings of Nurjadi et al
(2014) where high number of isolates was mostly from skin and bloodstream
infections. This is because it involves more to cause common diseases like
wound infections, skin infections and pneumonia.

In this study, the maximum susceptibility was found towards Vancomycin 19

(100%) followed by Linezolid (15/19) 78.95%. Maximum resistance was
observed against Ampicillin 16 (84.22%) followed by Ceftriaxone 12 (63.15),
Ciprofloxacin 11 (57.80%). Vancomycin and Linezolid is the most effective
drug for treatment of diseases caused by MRSA isolates. Similarly,
investigation done by Sato et al (2018) where he reported Co-Trimoxazole
often combined with drugs such as Vancomycin is used to treat an MRSA
infectious disease.

In this study, among the 78 S. aureus isolates, (47.44%) was seen in general
ward followed by OPD (35.89%). Similar study was done by Baral et al
(2011), Shrestha et al (2021) and Shahi et al (2018) where S. aureus was seen
high in general ward than OPD. The high prevalence of Methicillin resistance
S. aureus was seen in general ward (46.35%) among hospital units. Similarly,
34
Shahi et al (2018) also reported 14 (38.9%) strains were isolated from
outpatients whereas 22 (61.1%) strains of MRSA were isolated from admitted
patients. Results obtained in this study were in contrast to the finding of
Khanal et al (2018) where high prevalence of MRSA was among OPD
patients.

Similarly, a study done by Kandel et al (2020) found patients admitted in

hospital (72.2%) harbored more MRSA than outpatients (27.8%). In this study
Trimethoprim resistant MRSA were observed high in general ward (52.64%)
than OPD (31.58%). The possible reason behind the high infection in General
ward may be due to the overcrowding, understaffing and close patient contact.
In the present study, 53% (41/78) isolates were resistant to Cefoxitin that is
MRSA, which is similar to findings of Jr et al (2016), Belbase et al (2017) and
Maharjan et al (2021) where 108 (45.76 %), (47.4%) and 47 (45%) MRSA
were reported, respectively.

In this study, from 78 S. aureus isolates, 43 (55.12%) were found to be MDR

and remaining 87 (47.80%) were non MDR which is similar to the findings of
Maharjan et al (2021) who reported 50% (52) S. aureus to be multidrug
resistant. Similarly, the study conducted by Joachim et al (2017) reported that
21.3% were S. aureus MDR. In this study, out of 41 Methicillin resistance S.
aureus, 26 (63.41%) was observed to be MDR, which is similar to the findings
of Maharjan et al (2021) who reported 44 (84.61%) MRSA isolates were
MDR. Similarly, another study conducted by Joachim et al (2017) reported
72.7% MRSA strains were MDR.

In the present study, all the Trimethoprim resistance MRSA were found to be
MDR. Statistically, there were significant association between isolates with
MDR and non MDR (P<0.05) with (χ2=13.31 and df=2). In the present study,
among 19 Co-Trimoxazole resistant MRSA isolates 14 (73.68%) isolates were
found to positive for dfrG gene whereas 6 (31.58%) isolates were found to
positive for dfrA gene. Statistically, insignificant association between the
Trimethoprim resistance MRSA isolates and dihydrofolate reductase genes
(P>0.05). A study done by Nurjadi et al (2021) reported that out of 95
35
samples, (32.6%) were SXT resistant, out of that (23) 72% were harbored
dfrG gene and (9) 28% were harbored dfrA gene.

Similarly, a study conducted by Rossato et al (2020) reported that 100%

(30/30) and 13.3% (4/30) Co-Trimoxazole resistant MRSA isolates were
carried by dfrG and dfrA and genes, respectively. A study conducted by
Nurjadi et al (2021) reported that out of two Trimethoprim-Sulfamethoxazole
resistant isolates, both isolates harbored dfrG gene and dfrA gene. Similarly, a
study done by Coelho et al (2017) reported, from 58 (61%) resistant to
Trimethoprim resistant MRSA isolates, (78%) were harbored dfrG gene and
(19%) were harbored dfrA genes.

There are several limitations of this study. The most important being the
inclusion of only a hospital visiting patient specimens and it may not be
represented whole country. Other clinical outcomes that is diagnosis and
mortality were not evaluated due to limited data and it being a retrospective
investigation, it was not necessary to inform the be present physicians of the
results to effect on care. All the sulfonamides antibiotic resistance genes and
DNA sequencing were not performed in the present study. To our knowledge,
this is the first report of Trimethoprim resistance genes (dfrG gene and dfrA
gene) in Nepal.

36
 CHAPTER VI
CONCLUSIONS AND RECOMMENDATIONS

6.1 Conclusions

In this study, the prevalence of Methicillin Resistant Staphylococcus aureus

(MRSA) isolates was found to be 53% (41/78), out of that 19 (46.34%) were
resistant to Co-Trimoxazole. The higher prevalence of isolates was found in
pus sample. The higher prevalence of MRSA isolates was found in age group
61-75 years (36.58%). The most effective antibiotics for S. aureus isolates was
Vancomycin (96.15%) followed by Linezolid (76.93%) and Gentamycin
(53.85%). The higher prevalence of Co-Trimoxazole resistant MRSA was
found in general ward (52.64%) and in age group 46-60 years (47.37%). In the
study, the most effective antibiotics for Co-Trimoxazole resistant MRSA
isolates was Vancomycin (100%) followed by Linezolid (78.95%). Co-
Trimoxazole resistant MRSA have been considered a major healthcare issue.
Thus, early identification of Co-Trimoxazole resistant MRSA is an important
step toward timely implementation of appropriate treatment.

In this study, among 19 Co-Trimoxazole resistant MRSA isolates 14 (73.68%)

isolates were found to be positive for dfrG gene whereas 6 (31.58%) isolates
were found to be positive for dfrA gene. Statistically, insignificant association
between the Co-Trimoxazole resistant MRSA isolates and Trimethoprim
resistance genes (dfrG gene and dfrA gene). Hence, it was concluded that
Trimethoprim resistance MRSA infection is enhancing life threatening
infections in hospitals. But Co-Trimoxazole remains drug of choice for
treatment of MRSA infections. However, systematic investigation of Co-
Trimoxazole resistance MRSA associated infections as well as monitoring of
antimicrobial strategy may be supportive.

37
6.2 Recommendations

1. The study result observed higher prevalence of dfrG and dfrA genes in Co-
Trimoxazole resistant MRSA isolates, consistent and regular observation
should be done in all clinical laboratories.

2. Vancomycin and Linezolid seem to be effective drug. Therefore, these

antibiotics can be used as empirical therapy.

3. Reliable laboratory procedures should be used for monitoring changes in the

resistance trend toward MRSA clone and for managing the infected patients.

38
 REFERENCES

Adhikari RP, Shrestha S, Barakoti A and Amatya R (2017). Inducible

Clindamycin and Methicillin resistant Staphylococcus aureus in a tertiary care
hospital, Kathmandu, Nepal. BMC Infect Dis 17 (1): 483-488.

Angelis GD, Cipriani M, Cauda R and Tacconelli E (2011). Treatment of Skin

and Soft Tissue Infections due to community-associated Methicillin-Resistant
S. aureus in Europe: The role of Trimethoprim-Sulfamethoxazole0010. Clin
Infect Dis 52 (12): 1471–1472.

Amorim ML, Faria NA, Oliveira DC, Vasconcelos C, Cabeda C, Mendes AC,
Calado E, Castro AP, Ramos MH, Amorim MJ and Lencastre HD (2007).
Changes in the clonal nature and antibiotic resistance profiles of Methicillin-
resistant Staphylococcus aureus isolates associated with spread of the
EMRSA-15 clone in a tertiary care Portuguese Hospital. J Clin Microbiol 45
(9): 2881–2888.

Aries-de-Sousa MA and De-Lencastre H (2003). Evolution of sporadic

isolates of Methicillin-resistant Staphylococcus aureus (MRSA) in Hospitals
and their similarities to isolates of community-acquired MRSA. J Clin
Microbiol 14 (8): 3806–3815.

Aires-de-Sousa M and Dionisio F (2016). Trimethoprim-Sulfamethoxazole

resistance in Staphylococcus aureus in Africa: Distribution of resistance genes
and evaluation of the success of major MRSA clones. Eur J Clin Microbiol
Infect Dis 36 (7): 1252-1243.

39
Baral R, B and Acharya A (2011). Antimicrobial susceptibility patterns of
clinical isolates of Staphylococcus aureus in Eastern Nepal. Health
Renaissance 9 (2): 78-82

Belbase A, Pant ND, Nepal K, Neupane B, Baidhya R, Baidya R and Lekhak

B (2017). Antibiotic resistance and biofilm production among the strains
of Staphylococcus aureus isolated from pus/wound swab samples in a tertiary
care hospital in Nepal. Ann Clin Microb Antimicrob 16 (1): 15.

Bhatt MP, Bhalla GS, Tande K, Jindamwar P, Chaudhari CN, Grover N and
Sahni AK (2015). Antimicrobial susceptibility profile of Methicillin-resistant
Staphylococcus aureus at a tertiary care centre. Infect Dis (Auckl) 6 (36): 1-5.

Boucher HW and Corey GR (2008). Epidemiology of Methicillin-Resistant

Staphylococcus aureus. Clin Infect Dis 46 (5): 344–349.

Brown GM (1992). The biosynthesis of folic acid. JBC 237 (2): 536-540.

Capasso C and supuran CT (2020). Sulfa and trimethoprim-like drugs

antimetabolites acting as carbonic anhydrase, dihydropteroate synthase and
dihydrofolate reductase inhibitors. J Enzyme Inhib Med Chem 29 (3): 379-
387.

Caspers P, Bury L, Gaucher B, Heim J, Shapiro S, Siegrist S, Hoffmann A S,

Laure Thenoz L and Urwyler H (2009). In vitro and in vivo properties of
dihydrophthalazine antifolates, a novel family of antibacterial drugs. ASM
Journals 53 (9): 3620–3627.

Cheebrough M (2004). Medical laboratory manual for tropical countries. 2:

146-180.

40
Cheesbrough M (2010). District laboratory practice in tropical countries.
Cambridge university press. http://dx.doi.org/10.1017/CBO9780511543470
Accessed 18 July 2013.

Chua K, Laurent F, Coombs G, Grayson ML and Howden BP (2011). Not

community-associated Methicillin-Resistant Staphylococcus aureus (CA-
MRSA) a clinician’s guide to community MRSA. Its evolving antimicrobial
resistance and implications for therapy. Clin Infect Dis 52 (1): 99-114.

Clarke RS, Bruderer MS, Pou Ha K and Edwardsa AM (2019). RexAB Is

Essential for the Mutagenic Repair of Staphylococcus aureus DNA Damage
Caused by Co-Trimoxazole. Antimicrob Agent Chemother 63 (12): e00944-
19.

Clinical and Laboratory Standards Institute (CLSI) (2020). Performance

standards for antimicrobial disk susceptibility testing, 27th informational
supplement. CLSI document M100S25 (ISBN) 1-56238-805-3.

Coelho C, de Lencastre H and Aires-de-Sousa MA (2017). Frequent

occurrence of Trimethoprim-Sulfamethoxazole hetero-resistant
Staphylococcus aureus isolates in different African countries. Eur J Clin
Microbiol Infect Dis 36 (7): 1243-1252.

Coque TM, Singh KV, Weinstock GM and Murray BE (1999).

Characterization of dihydrofolate reductase genes from Trimethoprim-
Susceptible and Trimethoprim-Resistant strains of Enterococcus faecalis.
Antimicrob Agents and Chemother 43 (1): 141–147.

Dale GN, Broger C, Hartman PG, Langen H, Page MGP, Then RF, and Ber
DS (1995). Characterization of the gene for the chromosomal Dihydrofolate
Reductase (DHFR) of Staphylococcus epidermidis ATCC 1490: The origin of
the Trimethoprim-Resistant S1 DHFR from Staphylococcus aureus. J
Bacteriol 177 (11): 2965–2970.

41
David Mz And Daum Rs (2010). Community-associated Methicillin-Resistant
Staphylococcus Aureus: Epidemiology and clinical consequences of an
emerging epidemic. Clin Microb Rev 23 (3): 616–687.

Deurenberg RH and Stobberingh EE (2008). The evolution of Staphylococcus

aureus. Infect Genet and Evol 8 (6): 747–763.

Deurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA and

Stobberingh EE (2007). The molecular evolution of Methicillin-Resistant
Staphylococcus aureus. Clin Microb Infect Dis 13 (3): 222–235.

Dibah S, Arzanlou M, Jannati F and Shapouri R (2014). Prevalence and

antimicrobial resistance pattern of Methicillin Resistant Staphylococcus
aureus (MRSA) strains isolated from clinical specimens in Ardabil, Iran. Iran
J Microb 6 (3): 163-168.

Diekema DJ, Pfaller MA, Schmitz J, Smayevsky J, Bell J, Jones RN, Beach
M, and the SENTRY Participants Group (2001). Survey of infections due to
Staphylococcus Species: Frequency of occurrence and antimicrobial
susceptibility of isolates collected in the United States, Canada, Latin
America, Europe, and the Western Pacific region for the SENTRY
antimicrobial surveillance program, 1997–1999. Clin Infect Dis 32 (2): 114–
32.

Enright MC, Robinson DA, Randle G, Feil EJ, Grundmann H and Spratt BG
(2002). The evolutionary history of Methicillin-Resistant Staphylococcus
aureus (MRSA). Microb Infect Dis 99 (11): 7687–7692.

Fishovitz J, Hermoso JA, Chang M and Mobashery S (2014). Penicillin-

binding Protein 2a of Methicillin-resistant Staphylococcus aureus. IUBMB
Life 66 (8): 572–577.

Frey KM, Lombardo MN, Wright DL and Anderson AC (2010). Towards the
understanding of resistance mechanisms in clinically isolated Trimethoprim-
42
resistant, Methicillin-Resistant Staphylococcus aureus dihydrofolate
reductase. J Struct Biol 170 (1): 93–97.

Ghebremedhin B, Olugbosi MO, Raji AM, Layer F, Bakare RA, Konig B and
Konig W (2009). Emergence of a Community-Associated Methicillin-
Resistant Staphylococcus aureus strain with a unique resistance profile in
southwest Nigeria. J Clin Microb 47 (9): 2975–2980.

Giri N,2 Sujina Maharjan S, Tika Bahadur Thapa TB, Pokhrel S, Govardhan
Joshi G, Shrestha O, Shrestha N, and Rijal BP (2021). Nasal carriage of
Methicillin-Resistant Staphylococcus aureus among healthcare workers in a
tertiary care hospital, Kathmandu, Nepal. Intern J Microb 1-8.

Givney R, Vickery A, Holliday A, Pegler M And Benn R (1998). Evolution of

an endemic Methicillin-Resistant Staphylococcus aureus population in an
Australian Hospital from 1967 to 1996. J Clin Microb 36 (2): 552–556.

Goldberg E, Paul M, Talker O, Samra Z, Raskin M, Hazzan R, Leibovici L

and Bishara J (2010). Co-trimoxazole versus Vancomycin for the treatment of
Methicillin-Resistant Staphylococcus aureus bacteraemia: a retrospective
cohort study. J Antimicrob Chemother 65 (8): 1779 –1783.

Gordon NC, Price JR, Cole K, Everitt R, Morgan M, Finney J, Kearns AM,
Pichon B, Young B and Wilson DJ et al (2014). Prediction of Staphylococcus
aureus antimicrobial resistance by whole-genome sequencing. J Clin Microb
52 (4): 1182–1191.

Gordon RJ and Lowy FD (2008). Pathogenesis of Methicillin-Resistant

Staphylococcus aureus Infection. Clin Infect Dis 46 (5): 350–359.

Griffith EC, Wallace MJ, Wu Y, Kumar G, Gajewski S, Jackson P, Phelps

GA, Zheng Z, Lee RE and White SW (2018). The structural and functional
basis for recurring sulfa drug resistance mutations in S. aureus dihydropteroate
synthase. Front Microb 9: 1369-1385.
43
Grundmann H, Aires-de-Sousa M, Boyce J and Tiemersma E (2006).
Emergence and resurgence of Meticillin-Resistant Staphylococcus aureus as a
public-health threat. Centre Infect Dis 368 (9538): 874-885.

Harkins CP, Pichon B, Doumith M, Parkhill J, Westh H, Tomasz A, Lencastre

H, Bentley SD, Kearns AM and Holden Matthew TG (2017). Methicillin-
Resistant Staphylococcus aureus emerged long before the introduction of
methicillin into clinical practice. Genome Biol 18 (1): 130.

Hassoun A, Linden PK and Friedman B (2017). Incidence, prevalence, and

management of MRSA bacteremia across patient populations a review of
recent developments in MRSA management and treatment. Crit Care 21 (1):
211.

Heijer CDJD, Bijnen EMEV, Paget WJ, Pringle M, Goossens H, Bruggeman

CA, Schellevis FG, Stobberingh EE and the APRES Study Team (2013).
Prevalence and resistance of commensal Staphylococcus aureus, including
Meticillin-Resistant S aureus, in nine European countries: a cross-sectional
study. Lancet Infect Dis 13 (5): 409-415.

Hiramatsu K, Cui L, Kuroda M and Ito T (2001). The emergence and

evolution of Methicillin-Resistant Staphylococcus aureus. Tren Microb 9 (10):
486-494.

Huovinen P (2001). Resistance to Trimethoprim-Sulfamethoxazole. Clin

Infect Dis 32 (11): 1608–1614.

Jr DLV, Paclibare PAP, Cabrera EC and Rivera WL (2016). Molecular and

phenotypic characterization of Methicillin-Resistant Staphylococcus aureus
isolates from a tertiary hospital in the Philippines. Trop Med Health 44 (3).

Kadlec K and Schwarz S (2009). Identification of a novel Trimethoprim

resistance Gene, dfrK, in a Methicillin-Resistant Staphylococcus aureus
44
ST398 strain and its physical linkage to the tetracycline resistance gene tet (L).
Antimicrob Agents Chemother 53 (2): 776–778.

Kandel SN, Adhikari N, Dhungel B, Shrestha U, Thapa A, Khadga B, Karki

G, Adhikari B, Banjara M, Rijal KR, Ghimire P (2020). Characteristics of
Staphylococcus aureus isolated from clinical specimens in a Tertiary Care
Hospital. Microbiol Insig 11–16.

Karki S, Sah AK, Lamichhane J, Maharjan A, Sharma L, Rajbhandari R,

Parajuli S, Acharya S and Khanal S (2019). Biofilm formation and detection
of icaD gene in Staphylococcus aureus isolated from clinical specimens. The
Open Microbiol J 13 (1): 230-235.

Kengne M, FotsingO, Ndomgue T and Nwobegahay JM (2019). Antibiotic

susceptibility patterns of Staphylococcus aureus strains isolated at the
Yaounde Central Hospital, Cameroon: a retro prospective study. Pan Afr Med
J 32 (103).

Kerttula AM, Lyytikäinen O, Kardén-Lilja M, Ibrahem S, Salmenlinna S,

Virolainen A and Varkila JV (2007). Nationwide trends in molecular
epidemiology of methicillin-resistant Staphylococcus aureus, Finland, 1997–
2004. BMC Infect Dis 7 (1): 94.

Khanal LK, Adhikari RM and Guragain A (2018). Prevalence of Methicillin

Resistant Staphylococcus aureus and Antibiotic Susceptibility Pattern in a
Tertiary Hospital in Nepal. J Nep Healt Res Counc 16 (39): 172-174.

Khanal R, Sah P, Lamichhane P, Lamsal P, Upadhaya S and Pahwa VK

(2015). Nasal carriage of Methicillin Resistant Staphylococcus aureus among
health care workers at a tertiary care hospital in Western Nepal. Antimicrob
Resist Infect Cont 4 (39).

45
Klein E, Smith DL and Laxminarayan R (2007). Hospitalizations and Deaths
Caused by Methicillin-Resistant Staphylococcus aureus, United States, 1999–
2005. Emer Infect Dis 13 (12): 1840-1846.

Kluytmans J, Belkum AV and Verbrugh H (1997). Nasal carriage of

Staphylococcus aureus: epidemiology, underlying mechanisms, and associated
risks. Clin Microb Rev 10 (3): 505–520.

Kong EF, Johnson JK and Jabra-Rizk MA (2016). Community-associated

Methicillin-Resistant Staphylococcus aureus: An Enemy amidst Us. PLoS
Pathog 12 (10): 5837-5844.
Kumari N, Mohapatra TM and Singh Y (2008). Prevalence of Methicillin-
Resistant Staphylococcus aureus (MRSA) in a Tertiary-Care Hospital in
Eastern Nepal. J Nepal Med Assoc 47 (3): 53-56.

Kumburu HH, Sonda T, Leekitcharoenphon P, Zwetselaar MV, Lukjancenko

O, Alifrangis M, Lund O, Mmbaga BT, Kibiki G, and Aarestrup FM (2018).
Hospital epidemiology of Methicillin-Resistant Staphylococcus aureus in a
tertiary care Hospital in Moshi, Tanzania, as determined by whole genome
sequencing. Biomed Res Int 2018: 1-12.

Lakhundi S and Zhang K (2018). Methicillin-Resistant Staphylococcus

aureus: molecular characterization, evolution, and epidemiology. Clin Microb
Rev 30 (4):1-18.

Lindsay JA (2014). Evolution of Staphylococcus aureus and MRSA during

outbreaks. Infection, Genetics and Evolution 21:548-553.

Liu YG (2009). Molecular Pathogenesis of Staphylococcus aureus Infection.

NIH Public Access 65 (2): 1-14.

Liu C, Bayer A, Cosgrove SE, Daum RS, Fridkin SK, Gorwitz RJ, Kaplan SL,
Karchmer AW, Levine DP, Murray BE, Rybak MJ, Talan DA and Chambers
HF (2011). Clinical practice guidelines by the infectious disease’s society of
46
America for the treatment of Methicillin Resistant Staphylococcus aureus,
infections in adults and children. Clin Infect Dis 52 (3):18–55.

Maharjan B, Karki ST, Maharjan R (2021). Antibiotic susceptibility pattern of

Staphylococcus aureus isolated from pus/wound swab from children attending
international friendship children's Hospital. Nep J Biotech 9 (1): 8-17.

Malachowa N and DeLeo FR (2010). Mobile Genetic Elements of

Staphylococcus aureus. Cell Mol Life Sci 67 (18): 3057–3071.

Navratna V, Nadig S, Sood V, Prasad K, Arakere G and Gopal B (2010).

Molecular Basis for the Role of Staphylooccus aureus Penicillin Binding
Protein 4 in antimicrobial resistance. J Bacter 192 (1): 134-144.

Nishiguchi MK, Doukakis P, Egan M, Kizirian D, Phillips A, Prendini L,

Rosenbaum H, Torres E, Wyner Y and Desalle R (2002). DNA Isolation
Procedures. https://www.researchgate.net/publication/236626109 Accessed 28
December 2013.

Nurjadi D, Chanthalangsy Q, Zizmann E, Stuermer V, Moll M, Klein S,

Boutin S, Heeg K and Zanger P (2021). Phenotypic detection of hemin-
inducible Trimethoprim-Sulfamethoxazole hetero-resistance in
Staphylococcus aureus. Microb Spectr 9 (2): 1510-1521.

Nurjadi D, Olalekan AO, Layer F, Shittu AO, Alabi A, Ghebremedhin B,

Schaumburg F, Hofmann-Eifler J, Van Genderen PJJ, Caumes E, Fleck R,
Mockenhaupt FP, Herrmann M, Kern WV, Abdulla S, Grobusch MP,
Kremsner PG, Wolz C and Zanger P (2014). Emergence of Trimethoprim
resistance gene dfrG in Staphylococcus aureus causing human infection and
colonization in sub-Saharan Africa and its import to Europe. J Antimicrb
Chemother 69 (9): 2361–2368.

Nurjadi D, Schäfer J, Friedrich-Janicke B, Mueller A, Neumayr A, Calvo-

Cano A, Goorhuis A, Molhoek N, Lagler H, Kantele A, Van Genderen PJJ,
47
Gascon J, Grobusch MP, Caumes E, Hatz C, Fleck R, Mockenhaupt FP and
Zanger P (2015). Predominance of dfrG as determinant of Trimethoprim
resistance in imported Staphylococcus aureus. Eur J Clin Microb Infect Dis
21: 1095–1095.

Nurjadi D, Zizmann E, Chanthalangsy Q, Heeg K and Boutin S (2021).

Interrative analysis of whole genome sequencing and phenotypic resistance
toward prediction of Trimethoprim-Sulfamethoxazole resistance in S. aureus.
Front Microb 11: 1-7.

Perreten V, Kadlec K, Schwarz S, Andersson UG, Finn M, Greko C, Moodley

A, Kania SA, Frank LA, Bemis DA, Franco A, Iurescia M, Battisti A, Duim
B, Wagenaar JA, Duijkeren EV, Weese JS, Fitzgerald JR, Rossano A and
Skold O (2001). Resistance to Trimethoprim and Sulfonamides. Biomed Cent
l32 (4): 261-273.

Pradhan P, Rajbhandari P, Nagaraja SB, Shrestha P, Grigoryan R,

Satyanarayana S and Davtyan H (2021). Prevalence of Methicillin-Resistant
Staphylococcus aureus in a tertiary hospital in Nepal. AMR Supplement 16
(2): 1-16.

Rajaduraipandi K, Mani KR, Panneerselvam K, Mani M, Bhaskar M and

Manikandan P (2006). Prevalence and antimicrobial susceptibility pattern of
Methicillin Resistant Staphylococcus aureus: A Multicentre Study. Indian J
Med Microb 24 (1): 34-8.

Raut S, Bajracharya K, Adhikari J, Pant SS and Adhikari B (2017). Prevalence

of Methicillin Resistant Staphylococcus aureus in Lumbini Medical College
and Teaching Hospital, Palpa, Western. BMC Res Notes 10 (1):187.

Reeve SM, Scocchera EW, G-Dayanadan N, Keshipeddy S, Krucinska J,

Hajian B, Ferreira J, Nailor M, Aeschlimann J, Wright DL and Anderson AC
(2016). MRSA isolates from the United States hospitals carry dfrG and dfrK

48
resistance genes and succumb to propargyl-linked antifolates. Cell Chem Bio
23 (12): 1458–1467.

Reeve S, Scocchera E, Ferreira J, G-Dayanandan N, Keshipeddy S, Wright DL

and Anderson AC (2016). Charged propargyl-linked antifolates reveal
mechanisms of antifolate resistance and inhibit Trimethoprim-Resistant
MRSA strains possessing clinically relevant mutations. J Med Chemother 59
(13): 6493–6500.

Robinson DA and Enright MC (2004). Multilocus sequence typing and the

evolution of Methicillin-Resistant Staphylococcus aureus. Clin Microb Infect
Dis 10 (2): 92–97.

Rossato AM, Primon-Barros M, Rocha LDL, Reiter KC, Gomes Dias CA and
Azevedo PAD (2020). Resistance profile to antimicrobials agents in
Methicillin-Resistant Staphylococcus aureus isolated from hospitals in South
Brazil between 2014-2019. Rev Soc Bras Med Trop 53: 1-10.

Sapkota J, Sharma M and Bhatt CP (2019). Prevalence of Staphylococcus

aureus from clinical samples in tertiary care Hospital: A descriptive cross-
sectional study. JNMA J Nepal Med Assoc 57 (220): 398-402.

Sato T, Kawamura M, Furukawa E and Fujimura S (2018). Screening method

for Trimethoprim-Sulfamethoxazole-resistant small colony variants of
Staphylococcus aureus. J Glob Anti Resist 15: 1-5.

Scholtzek AD, Hanke D, Eichhorn I, Walther B, Lubke-Becker A, Duijkeren

EV, Kock R, Schwarz S and Febler AT (2020). Heterogeneity of antimicrobial
susceptibility testing results for Sulfamethoxazole/Trimethoprim obtained
from clinical equine Staphylococcus aureus isolates using different methods.
Vet Microb 242.

Sekiguchi J, Tharavichitkul P, Akiyama TM, Chupia V, Fujino T, Araake M,

Irie A, Morita K, Kuratsuji T and Kirikae T (2005). Cloning and
49
characterization of a novel Trimethoprim-Resistant Dihydrofolate Reductase
from a nosocomial isolate of Staphylococcus aureus CM. S2 (IMCJ1454).
Anti A Chemother 49 (9): 3948–3951

Shahi K, Rijal KR, Adhikari N, Shrestha TU, Banjara MR, Vijay K Sharma
VK and Ghimire P (2018) Methicillin Resistant Staphylococcus aureus:
Prevalence and antibiogram in various clinical specimens at Alka Hospital.
TUJM 5 (1): 77-82.

Shittu A, Nubel U, Udo E, Lin J and Haogakwe S (2009). Characterization of

Meticillin Resistant Staphylococcus aureus, Isolates from Hospitals in
Kwazulu-Natal Province, Republic of South Africa. J Med Microb 58 (9):
1219-1226.

Shrestha LB, Syangtan G, Basnet A, Acharya KP, Chand AB and Pokharel K

(2021). Methicillin-resistant Staphylococcus aureus in Nepal. J Nepal Med
Assoc 59 (237): 518-22.

Stryjewski ME and Corey GR 2014). Methicillin-Resistant Staphylococcus

aureus: An Evolving Pathogen. Clin Infect Dis 58 (1):10–9.

Talan DA, Krishnadasan A, Gorwitz RJ, Fosheim GE, Limbago B, Albrecht V

and Moran GJ for The EMERGEncy ID Net Study Group (2011). Comparison
of Staphylococcus aureus from Skin and Soft-Tissue Infections in US
emergency department patients, 2004 and 2008. Clin Infect Dis 53 (2):144–
149.

Tiwari HK, Sapkota D and Sen RM (2008). High prevalence of multidrug-

resistant MRSA in a tertiary care Hospital of Northern India. Infect Drug
Resist 30 (1): 57–61.

Waitayangkoon P, Thongkama A, Benjamungkalaraka T, Rachayona M,

Thongthaisina A, Chatsuwanb T, Thammahongb A and Chiewchengchola D,
(2020). Hospital epidemiology and antimicrobial susceptibility of isolated
50
Methicillin-Resistant Staphylococcus aureus: a one-year retrospective study at
a tertiary care center in Thailand. Pathog Glob Health 114 (4): 212-217.

Wankhade AB, Panda S, Hathiwala R and Keche Y (2017). Study of antibiotic

resistance profiling of Staphylococcus aureus isolated from clinical specimens
of the patients attending a tertiary teaching Hospital from Chhattisgarh. Inter J
Res Med Sci 5 (11): 4808-4811.

Wrobel A, Arciszewska K, 2 Maliszewski D Drozdowska D (2020).

Trimethoprim and other nonclassical antifolates an excellent template for
searching modifications of dihydrofolate reductase enzyme inhibitors. J
Antibiot 73 (1): 5–27.

51
 APPENDICES
APPENDIX I

LIST OF MATERIALS AND EQUIPMENTS

A. Equipments
Hot air oven, Cotton Microscope, Inoculating loop
Pipettes, Distilled water, Weighing Machine, Cover slips
Incubator, Test tubes Refrigerator, Petri dishes
Autoclave, Lysol Thermo cycler (GeneiTM), Paraffin tape
Electrophoresis tank Gel Documentation (Uvitech Cambridge)
Water bath, Forceps PCR tubes, Comb, Glass slides
Conical flasks, Spatula Plastic Containers, Eppendorf tube
Measuring cylinder Immersion oil, Inoculating wire

B. Chemicals and Reagents

For Microbiological tests For DNA extraction and PCR
3% Hydrogen peroxide, Safranin 1x, 10x Buffer, Agarose,
Gram’s iodine, Barium chloride Ethidium Bromide, CTAB
Crystal violet, Kovac’s reagent Loading dye, TAE,
Barritt’s reagent, Sulphuric acid Deionized water, DNA Ladder
Absolute alcohol, Paraffin oil DNA polymerase, proteinase K
Mc Farland solution 0.5, Decolorizer Primers, sodium acetate, SDS
Normal saline (NaCl), Plasma DNTPs, chloroform-phenol

C. Microbiological Media
Nutrient agar Mannitol salt agar
Nutrient broth Blood agar
Sulphur Indole Motility agar Urea broth
Triple Sugar Iron agar MR/VP
Simmons citrate agar
Muller Hinton agar
D. Antibiotic Discs
Ampicillin (10µg)
Cefoxitin (30µg)
Chloramphenicol (30µg)
Ceftriaxone (30µg)
Amikacin (30µg)
Levofloxacin (5µg)
Doxycycline (30µg)
Cotrimoxazole (25µg)
ii
Vancomycin (30µg)
Tetracycline (30µg)
Ciprofloxacin (5µg)
Linezolid (30µg)
Erythromycin(15µg)
Nitrofurantoin (300µg)
Azithromycin (15µg)
Gentamicin (120µg)
 APPENDIX II

COMPOSITION AND PREPARATION OF DIFFERENT CULTURE

MEDIA

The culture media were used from HI-Media Laboratories Pvt. Limited.

A. Nutrient Agar (NA)

Ingredients gm/liter
Peptone 10.0
Sodium chloride 5.0
Beef extract 10.0
Yeast extract 1.5
Agar 12.0
Final pH 7.3±0.2

Preparation: About 37 grams of the medium was dissolved in 1000 ml

distilled water and boiled to dissolve completely. Then the medium was
autoclaved at 121°C for 15 minutes.

B. Blood base agar

Ingredients 15.0 gm/liter
Beef Heart Infusion 500.0
Agar 15.0
Tryptose 10.0
Sodium Chloride 5.0
Final pH (at 25°C) 7.3±0.2

Direction: 40 g of the powder was suspended in 1000 ml distilled water and

mixed thoroughly, dissolved by boiling with frequent agitation and sterilized
by autoclaving at 121°C (15 lbs pressure) for 15 minutes. After cooling to 45-
50°C, 5% sterile defibrinated sheep blood was added aseptically, then mixed
with gentle rotation and immediately poured in sterile petri plates.

iii
C. Mannitol Sorbitol Agar (MSA)
Ingredients gm/liter
D-Mannitol 10.0
Beef extract 1.00
Protease peptone 10.00
Agar 15.0
Phenol red 0.025
Sodium chloride 75.0
Final pH (at 25ºC) 7.3 ± 0.1

Direction: Suspend 111.0 grams in 1000ml distilled water. Heat to boiling to

dissolve the medium completely. Sterilize by autoclaving at 15lbs pressure
(121ºC) for 15 minutes. If desired add 5.0% v/v Egg Yolk Emulsion (FD045).
Mix well and dispense as desired.

D. Nutrient Broth (NB)

Ingredients gm/liter
Beef extract 1.5
Sodium chloride 5.0
Peptone 5.0
Yeast extract 1.5
Final pH 7.3±0.2

Preparation: About 37 grams of the medium was dissolved in 1000 ml

distilled water and boiled to dissolve completely. Then the medium was
autoclaved at 121°C for 15 minutes.

E. Muller Hinton Agar

Ingredients gm/liter
Casein Acid Hydrolysate 17.5
Agar 17
Beef, Infusion form 300.0
Starch 17.5
Final pH (at 25°C) 7.3±0.2

iv
 Preparation: As directed by the manufacturer Company, 38 grams of the
medium was suspended in 1000 ml distilled water and the medium was
warned to dissolve. Then the medium was sterilized by autoclaving at 121 °C
for 15 minutes.

F. OF Basal Medium
Ingredients gm/litre
Agar 2
Bromothymol blue 0.080
Sodium chloride 5.00
Dipotassium hydrogen phosphate 0.3
Tryptone 2.00
Final pH (at 25ºC) 6.8±0.2

Preparation: 9.38 grams was suspended in 1000 ml distilled water and heated
to boiling to dissolve the medium completely. It was dispensed in 100 ml 100
ml amounts and sterilized by autoclaving at 15 lbs. pressure (121ºC) for 15
minutes. To first 100 ml of sterile basal medium, 10 ml of sterile 10% dextrose
solution was added ascetically. To second 100 ml, 10 ml sterile 10% lactose
solution was added. To third 100 ml, 10 ml sterile 10% saccharose solution
was added. The solution was mixed and dispensed aseptically in 5 ml amounts
in sterile tubes in duplicate for aerobic and anaerobic fermentation.

v
 APPENDIX III

COMPOSITION AND PREPARATION OF DIFFERENT STAINING

AND TEST REAGENTS

For Gram stain

A. Crystal Violet solution:

Crystal violet 20.0 g
Ethanol or Methanol 95 ml
Ammonium oxalate 9.0 g
Distilled water 1 litre

Preparation: In a clean piece of paper, 20 gm of crystal violet was weighed

and transferred to a clean brown bottle. Then, 95 ml of ethanol was added and
mixed until the dye was completely dissolved. To the mixture, 9 gm of
ammonium oxalate dissolved in 200 ml of distilled water was added. Finally,
the volume was made 1 litre by adding D/W.

B. Lugol’s Iodine
Potassium iodide 20.0g
Iodine 10.0 g
Distilled water 1000ml

Direction: 20 gm of potassium iodide was dissolved in 250 ml of D/W and

then 10 gm of iodide was added and stirred until it was dissolved completely.
Final volume was made 1 liter by adding D/W.

C. Acetone alcohol decolorizer

Acetone 500 ml
Distilled water 25 ml
Ethanol (Absolute) 475 ml

vi
 Direction: To 25 ml D/W, 475 ml absolute alcohol was added, mixed and
transferred into a clean bottle. Then immediately, 500 ml acetone was added to
the bottle and mixed well.

D. Safranin
Safranin 10.0g
Distilled water 1000 ml

Direction: In a clean piece of paper, 10 gm of Safranin was weighed and

transferred to a clean bottle. Then 1 liter of D/W was added to the bottle and
mixed well until Safranin dissolved completely.

For biochemical test reagents

A. Catalase reagent
Hydrogen peroxide 3ml
Distilled water 97ml

Direction: To 97 ml of D/W, 3 ml of hydrogen peroxide was added and mixed

well.

B. Oxidase reagent
Tetramethyl p-phenylene diamine dihydrochloride (TPD) 1 gm 1gm
Distilled water 100ml

Direction: one-gram tetramethyl p- phenylene dihydrochloride was taken in

clean bottle and 100ml distilled water was added.

For normal saline

Sodium chloride 0.85 g 0.85g

Distilled water 100 ml 100ml

vii
Direction: 0.85 gm sodium chloride was weighed and transferred to a clean
leak proof bottle premarket to hold 100 ml. D/W was added to the 100 ml
mark, and mixed until the salt was fully dissolved. The bottle was labeled and
stored at room temperature.

For McFarland solution

1% Barium chloride solution was prepared by mixing 1 gram of anhydrous

barium chloride in 100 distilled water, 1% sulphuric acid solution was
prepared by mixing 1 ml of concentrated sulphuric acid in 99 ml of distilled
water. 1 % barium chloride and 1% sulphuric acid was mixed in appropriate
proportion as per the concentration required. Most commonly 0.5 McFarland
solution is used as standard for Antibiotic susceptibility test which is prepared
by mixing 0.05 ml Bacl2 in 9.95 ml of 1% H2SO4 solution. The prepared
solution was mixed well to form turbid suspension. For better results and
accuracy in procedures, in every 6 months prepare a fresh McFarland solution
of required concentration.

viii
 APPENDIX IV

DETAILED PROCEDURES OF DIFFERENT TESTS

Gram’s staining

First devised by Ham Christian Gram during the late 19th century, the gram
stain can be used effectively to differentiate all the bacterial species into two
large groups: those that take up the basic dye, crystal violet (Gram-positive)
and those that allow the crystal dye to wash out easily with the decolorizer
alcohol or acetone (Gram negative). The following steps are involved in gram
stain:

Procedure: A thin film of material to be examined was prepared on a clean

grease free slide and dried. The smear was heat fixed and allowed to cool
before staining. The slide was flooded with crystal violet stain and allowed to
remain without drying for 1 minute. The slide was rinsed with tap water
shaking excess water off the slide. The slide was flooded with iodine solution
and allowed to remain on the surface without drying for twice as long as the
crystal violet was in contact with the slide surface. The slide was rinsed with
tap water shaking excess water off the slide. The slide was flooded with
alcohol acetone decolorizer for 10 seconds and rinsed immediately with tap
water until no further color flows from the slide with decolorization. Thicker
smear requires more aggressive decolorizing. The slide was flooded with a
counter stain (Safranin) for 1 minute and washed off with water. The slide was
blotted between two clean sheets of bibulous paper and examined
microscopically under oil immersion at 100X.

Catalase test

Catalase is an enzyme, which is produced by microorganisms that live in

oxygenated environments to neutralize toxic forms of oxygen metabolites;

ix
H2O2.  The catalase enzyme neutralizes the bactericidal effects of hydrogen
peroxide and protects them. Anaerobes generally lack the catalase enzyme.

Procedure: Transfer a small amount of bacterial colony to a surface of clean,

dry glass slide using a loop or sterile wooden stick. Place a drop of 3%
H2O2 on to the slide and mix. Positive result is the rapid evolution of oxygen
(within 5-10 sec.) as evidenced by bubbling. Negative result is no bubbles or
only a few scattered bubbles. Dispose of your slide in the biohazard glass
disposal container.

Oxidase test

The oxidase test is used to identify bacteria that produce cytochrome c

oxidase, an enzyme of the bacterial electron transport chain. When present
the cytochrome c oxidase oxidizes the reagent to (indophenols) purple color
end product. When the enzyme is not present, the reagent remains reduced and
is colorless.

Procedure: Take a filter paper soaked with the substrate tetramethyl-p-

phenylenediamine dihydrochloride. Moisten the paper with a sterile distilled
water. Pick the colony to be tested with wooden or platinum loop and smear in
the filter paper. Observe inoculated area of paper for a color change to deep
blue or purple within 10-30 seconds.

Coagulase Test

Coagulase test is used to differentiate Staphylococcus aureus (positive)

produce the enzyme coagulase, from Staphylococcus
epidermis and Staphylococcus saprophyticus (negative) which do not produce
coagulase called Coagulase Negative Staphylococcus (CONS). Coagulase is
an enzyme-like protein and causes plasma to clot by converting fibrinogen to
fibrin. Staphylococcus aureus produces two forms of coagulase: bound and
free. In bound coagulase, clumping factor is bound to the bacterial cell wall
and reacts directly with fibrinogen. This results in an alternation of fibrinogen
x
so that it precipitates on the staphylococcal cell, causing the cells to clump
when a bacterial suspension is mixed with plasma. This doesn’t require
coagulase-reacting factor. In free coagulase, involves the activation of
plasma coagulase-reacting factor (CRP), which is a modified or derived
thrombin molecule, to from a coagulase-CRP complex. This complex in turn
reacts with fibrinogen to produce the fibrin clot.

Procedure: Place a drop of physiological saline on each end of a slide, or on

two separate slides. With the loop, straight wire or wooden stick, emulsify a
portion of the isolated colony in each drop to make two thick suspensions.
Add a drop of human or rabbit plasma to one of the suspensions, and mix
gently. Look for clumping of the organisms within 10 seconds. No plasma is
added to the second suspension to differentiate any granular appearance of the
organism from true coagulase clumping.

Oxidative/ Fermentative test

The oxidative-fermentative test determines if certain gram-negative rods

metabolize glucose by fermentation or aerobic respiration (oxidative). During
the anaerobic process of fermentation, pyruvate is converted to a variety of
mixed acids depending on the type of fermentation. The high concentration of
acid produced during fermentation will turn the bromothymol blue indicator in
OF media from green to yellow in the presence or absence of oxygen.

Procedure: Inoculate two tubes of oxidative-fermentative (OF) test medium

with the test organism using a straight wire by stabbing “half way to the
bottom” of the tube. Cover one tube of each pair with 1 cm layer of sterile
mineral oil or liquid paraffin (it creates anaerobic condition in the tube by
preventing diffusion of oxygen), leaving the other tube open to the air.
Incubate both tubes at 35oC for 48 hours (Slow growing bacteria may take 3
to 4 days before results can be observed).

Antibiotic susceptibility testing

xi
Preparation of inoculum: By touching 2-3 morphologically similar colonies
with sterile loop, inoculate into NB and incubate at 37°C until turbidity
matches with that of 0.5 McFarland Standard. Direct colony suspension
method can also be used.

Inoculation of agar plates: The agar plates, canister of discs is brought to

room temperature before use. It should be made sure that the agar surface does
not have any moisture, if so, should be dried by keeping in the incubator.
Using sterile swab, a plate of MHA is inoculated with the bacterial suspension
using carpet culture technique. The plate is left for about 5 minutes to let the
agar surface dry. Using sterile forceps, appropriate antimicrobials disc (6 mm
diameter) is placed evenly distributed on the inoculated plate, not more than 6
discs are placed on a 90 mm diameter Petri plate. Within 30 minutes of
applying the discs, the plated are incubated at 35°C for 16-18 hrs. After
overnight incubation, the plates are examined to ensure confluent growth.
Using a measuring scale, the diameter of each zone of inhibition in mm is
measured and results interpreted accordingly.

xii
 APPENDIX V

SAMPLE COLLECTION PROTOCOL

All the samples were collected by experienced medical personnel in a clean,

leak proof container as per the guidelines of the department. The specimens
were immediately sent to the microbiology laboratory for routine culture and
sensitive testing. All the samples were processed immediately without delay.

Pus and wound swab: Pus samples were collected on a sterile cotton swab or
aspirated in syringe. For closed wounds and aspirates, 2% chlorohexidine
followed by an iodine solution was used for disinfection whereas for open
wounds, it was debrided then rinsed thoroughly with sterile saline prior to
collection of pus sample. Pus samples should be such that it contains the
deepest portion of the lesion or exudates rather than superficial debris. Swab
collection should be avoided as long as aspirates or biopsy samples can be
obtained. If swab is the only option, then sterile cotton swab was gently rolled
over the surface of the wound approximately five times, focusing on areas
where there is evidence of pus or inflamed tissue and labeled with date, time
and the patient’s information. Two samples were taken from each patient, one
for culture and another from direct Gram stain.

Blood: Blood samples were collected using strict aseptic conditions. After
proper sterilization of skin 2-10ml of blood 2-3ml (children), 5ml (adults) was
withdrawn from patients and dispensed into sterile screw capped culture
bottles containing 50 ml of BHI broth.

Urine: Patients were asked to collect 10-20 ml of clean voided (clean catch)
first morning mid-stream urine in a sterile, dry, wide necked, leak proof plastic
container. Catheterized specimens or suprapubic aspirates were collected by
physician from infants and patients who were unable to produce urine because

xiii
of urologic or neurologic problems including impaired consciousness. The
specimens were processed without delay.

Sputum: The sputum sample was collected in a wide-mouthed leak proof,

disposable plastic container under the supervision of health care worker. The
patient was advised not to rinse or gargle the mouth with non-sterile water or
mouth mouthwash prior to sample collection and also instructed to collect
specimen resulting from deep cough but not the saliva or post-nasal discharge.
Early morning sample before toothbrush was suggested to collect after
drinking hot water for the patient difficult for deep-cough. The container was
labeled properly and immediately delivers to the laboratory as soon as possible
for further processing.

Body fluids: Body fluids (pleural, peritoneal, ascetic, synovial and

cerebrospinal fluids) were obtained with the help of trained physicians. The
needle puncture site was cleaned with alcohol and disinfected with iodine
solution to prevent the specimen contamination or infection of the patient.
About 3-5ml of the sample was drawn. For CSF sample collection, lumbar
puncture was done by a trained physician. The sample was collected into
sterile, leak-proof vials or tubes, after proper labeling to the laboratory
immediately and processed.

xiv
 APPENDIX VI

ZONE INTERPRETATION CHART OF CLSI FOR Staphylococcus

aureus. (CLSI 2019)

Antibiotic (symbol) disc Sensitive Intermediate Resistant

content (mm or (mm) (mm or
(µg) more) less)
Amikacin (AK) 30 17 15-16 14
Ampicillin (AMP) 10 29 - 28
Cefoxitin (CX) 30 22 - 21
Co-Trimoxazole (COT) 25 17 14-16 14
Ciprofloxacin (CIP) 5 21 16-20 20
Erythromycin (E) 15 21 18-20 18
Amoxyclav (AMC) 30 20 - 19
Linezolid (LZ) 30 21 - 20
Levofloxacin (LE) 5 19 16-18 15
Azithromycin (AZM) 15 18 14-17 13
Nitrofurantoin (NIT) 300 17 15-16 14
Vancomycin (VA) 30 21 18-21 17
Ofloxacin (OF) 5 18 15-17 14
Gentamicin (GEN) 30 18 - 18
Nalidixic acid (NA) 30 13 14-18 19
Ceftriaxone (CTR) 30 21 14-20 13
Tetracycline (TE) 30 19 15-18 14

xv
 APPENDIX VII

COMPOSITION AND METHOD OF PREPARATION OF DIFFERENT

REAGENTS FOR GENOMIC DNA EXTRACTION AND GEL
ELECTROPHORESIS

A. TE buffer (10X and 1X, pH 8)

Requirements
1M Tris-HCL, pH 8.0
0.5 M EDTA, pH 8.0
Composition of 10X buffer
100mM Tris Cl
10mMEDTA
Composition of 1X buffer
10mM Tris Cl
1mM EDTA

Procedure: To prepare 100 ml of 10 X Tris-EDTA solutions, take 88 ml

deionized water in 250 ml conical flask. Add 10 ml of 1M Tris Cl (pH 8.0).
Mix it. Check the pH It should be 8.0. If it is not 8.0 then adjust by keeping
HCL and NAOH. Sterilize the solution by autoclaving. To prepare 1X
solution, take 1 volume of 10X solution, add 9 volumes of deionized water.
Mix it, store the solution at room temperature.

B. Phenol: Chloroform

Remove the crystalline phenol from the -20°C freezer and thaw it at 60-65°C
it at 60-65°C. Add desired volume of the phenol to an appropriately sized
bottle. Add an equal volume of 10X TE buffer to the phenol. Shake vigorously
and allow the layers to separate which may take a few minutes. Remove the
aqueous layer and repeat the process by adding equal volume of 10X TE
xvi
 again. Add an equal volume of 1X TE buffer to the phenol and also repeat the
second volume of 1XTE buffer. After the final aspiration, leave a small layer
of 1X TE buffer above the phenol. Evaluate the pH of the TE buffer by
dropping 10µl onto pH paper. If it is still too high, perform equilibrium step
again.

C. 0.2N NaOH+2% SDS

10 N Sodium hydroxide (NaOH) solutions

10% sodium dodecyl sulfate (SDS)
Deionized water Measuring cylinder, conical flask,
Beaker, magnetic stirrer.

Procedure: To prepare 100 ml of lyses solution, take 80 ml of deionized

water in a 100 ml measuring cylinder. Add 2 ml of 10N NaOH solution and 10
ml of SDS. Adjust the volume to 100 ml with deionized water. Mix the
solution. Prepare solution freshly and use at room temperature.

D. 0.5 M EDTA

146.12 grams of EDTA was dissolved in 200 ml of distilled water. The pH

was adjusted to 8.3 and autoclaved. The solution was kept at room
temperature.

E. 1.5% Agarose gel

0.45 grams of agarose was dissolved in 30 ml of 1X TAE buffer. The mixture

was thoroughly mixed and then boiled till clear solution was obtained. 0.7 µl
EtBr was added to the solution and then left at room temperature to cool for a
while. When the temperature reached lukewarm, the solution was poured in an
electrophoresis plate with a comb and left to solidify.

F. CTAB Buffer

xvii
100ml of 1 molar Tris HCl was taken in conical flack and 280ml of 5 molar
NaCl was added. 40ml of 0.5 molar EDTA was added. 20 grams of CTAB
was added and finally volume one liter was formed by adding distilled water.

APPENDIX VIII

DNA EXTRACTION AND PCR PROTOCOL

DNA Extraction Protocol

3000 µl (3 ml) of bacterial suspension was centrifuged at 10,000 rpm for 5

min and supernatant were discarded. The pellet was suspended in 567µl TE
buffer and mixed well by vertexing. The lysis of cell wall and protein were
done by added 30µl of 10% SDS and 3µl of 20mg/ml Proteinase K followed
by mixing and incubation at 37°C for 30 min - 1 hr. After incubation, 100µl
5M NaCl was added followed by 80µl of CTAB/NaCl (10% CTAB/ 0.7 M
NaCl) were added and incubated at 65°C for 10 minutes. Equal volume of
chloroform: isoamyl alcohol (C: I) in the ratio 24:1 was added to the
suspension. Centrifuge for 5 min at 10,000 rpm. Upper aqueous phase was
transferred to new tube. Equal volume of P: C: I was added and centrifuged at
14,000 rpm for 5 minutes. Transfer supernatant to a new tube. Solution was
treated with iso propanol and centrifuged at 12,000 rpm for 5 minutes. 100µl
70% ethanol was added and centrifuged at 12,000 rpm for 5 minutes. Air dried
and resuspend in 50µl of TE buffer.

PCR Protocol

Choosing target substrates and PCR primers: The choice of the target
DNA is of course dictated by the specific experiment and that should be
uncontaminated with other DNAs. Primer can be prepared by the researchers
themselves but that always may not be possible for all researchers so choosing
specific PCR primers available in the market is an important issue in any PCR
amplification.

xviii
Reaction Set Up:
Component 25 µl reaction mixture
PCR master mix 19
Forward primer 0.5
Reverse primer 0.5
Target DNA 5

The reaction mixture for the PCR was prepared as follows:

For the blank: 19 µl Master mix, 0.5 µl each Forward primer and Reverse
primer and 5 µl Nuclease free water.
For positive control: 19 µl Master mix, 0.5 µl each Forward primer and
Reverse primer, 5 µl DNA template (positive control).
For the sample: 19 µl Master mix, 0.5 µl each Forward and Reverse primer, 5
µl template DNA. Then, gently mix the reaction mixture and collect all the
liquid to the bottom of the tube.

PCR conditions (35 cycles):

Steps Temperature Time
Initial denaturation 94°C 4 Minutes
Denaturation 94°C 1 Minute
Annealing 57°C 30 Seconds
Extension 72°C 1 Minute
Final extension 72°C 4 Minutes
Hold 4°C Infinity

Validating the Reaction: Once the PCR reaction has run, there are two ways
of determining success or failure. The first is simply take some of the final
reaction and run it out on an agarose gel with appropriate molecular weight
marker to make sure that the reaction was successful and the second and
ultimate validation of a PCR reaction is to directly sequence the amplicons.

Gel Electrophoresis: 1.5 agarose gel was prepared and boiled agarose
completely dissolved but do not over boil. Let agarose cooled down to about
45o – 50oC and 0.5 microliter EtBr was added then mix well. Gel was poured
xix
into casting tray with comb in place and remove the bubbles with pipette tip.
The tray was placed at room temperature in 30 minutes for solidification and
remove the comb. The tray was transferred into electrophoretic tank. 1.5
microliter loading dye and 3 microliter PCR products (sample) were mixed
well and carefully loaded onto the well on gel. 80Volt voltage was applied for
40 minutes and bands were observed.

xx
 APPENDIX IX

ETHICAL APPROVAL LETTER FROM NHRC

xxi