Plant Pathology (2016) 65, 782–791 Doi: 10.1111/ppa.

12466

Bacteria from the citrus phylloplane can disrupt cell–cell

signalling in Xanthomonas citri and reduce citrus canker
disease severity

J. C. Caicedoa*, S. Villamizara, M. I. T. Ferroa, K. C. Kupperb and J. A. Ferroa

a
Faculdade de Cie^ ncias Agra
! rias e Veterina
! rias, UNESP Universidade Estadual Paulista, Campus Jaboticabal Departamento de
Tecnologia Via de acesso Prof. Paulo Donato Castellane s/n, Jaboticabal, SP 14884-900; and bCentro de Citricultura Sylvio Moreira, IAC,
Cordeiro! polis, SP, Brazil

Xanthomonas citri subsp. citri (Xcc) is the causal agent of citrus canker, a disease that affects almost all types of citrus crops.
Production of particular Xcc pathogenicity factors is controlled by a gene cluster rpf, which encodes elements of a cell–cell
communication system called quorum sensing (QS), mediated by molecules of the diffusible signal factor (DSF) family. Inter-
ference with cell–cell signalling, also termed quorum quenching, either by signal degradation or over-production, has been
suggested as a strategy to control bacterial disease. In this study, three bacterial strains were isolated from citrus leaves that
displayed the ability to disrupt QS signalling in Xcc. Pathogenicity assays in sweet orange (Citrus sinensis) showed that bac-
teria of the genera Pseudomonas and Bacillus also have a strong ability to reduce the severity of citrus canker disease. These
effects were associated with alteration in bacterial attachment and biofilm formation, factors that are known to contribute
to Xcc virulence. These quorum-quenching bacteria may represent a highly valuable tool in the process of biological control
and offer an alternative to the traditional copper treatment currently used to treat citrus canker disease.

Keywords: biofilm, citrus canker, DSF, quorum quenching

bacteria direct important biological functions including

Introduction
Research over the last 20 years has expanded the view of
bacteria as unicellular organisms having the ability to
participate in complex social and cooperative behaviour.
The development of an intercellular communication sys-
tem is a hallmark characteristic that enables bacteria to
colonize new habitats, adapt to environmental changes,
resist host defence and antibiotic action, strengthen com-
petitiveness and take advantage of new food sources (Ng
& Bassler, 2009). Quorum sensing (QS) is a system of
bacterial cell–cell communication that enables the
microorganism to sense a minimum number of cells
(quorum) in order to respond to external stimuli in a
concerted fashion. The process of QS relies upon the
production, release and detection of small signalling
molecules called auto-inducers (AI). Each bacterial cell
produces a basal amount of AIs, which are exported to
the extracellular environment and reflect bacterial popu-
lation density. At high cell densities, the AI reach a criti-
cal concentration, at which point they are recognized by
their cognate receptor, triggering a cascade of biological
functions (Federle & Bassler, 2003). Quorum sensing
leads to the regulation of specific genes that in different
*E-mail: caicedocepeda@gmail.com
Published online 23 October 2015
bioluminescence, antibiotic production, virulence, motility
and biofilm formation (Rumbaugh et al., 1999; Gonzalez
& Keshavan, 2006).
Because QS or cell–cell signalling controls processes
associated with virulence of many pathogens, interference
with these processes may afford a route towards disease
control. Such interference could involve signal degradation
(quorum quenching) or signal over-production (pathogen
confusion) (Zhang & Dong, 2004; Newman et al., 2008;
Uroz et al., 2009). Quorum quenching is a mechanism
adopted by a number of bacteria to disrupt QS signalling
of competitors, affording these organisms an advantage
within a particular habitat (Zhang & Dong, 2004; Ni
et al., 2009).
The Gram-negative bacterium Xanthomonas citri
subsp. citri (Xcc) is the aetiologic agent of citrus canker,
a disease affecting almost all types of citrus crops. The
invasion and colonization of the host occurs through nat-
ural openings of the leaves (the stomata) and wounds in
the plant tissues. The pathogen multiplies within the
intercellular spaces, inducing cell hyperplasia, leading to
rupture of the leaf epidermis and resulting in raised
corky and spongy lesions surrounded by a water-soaked
margin, i.e. the characteristic canker lesion. Yellowish
chlorotic rings are also often observed on leaves and
fruits and, when conditions are highly favourable to dis-
ease development, could produce general defoliation, tree
decline and premature fruit drop (Timmer et al., 1991;
Schaad et al., 2006; Gottig et al., 2009).

782 ª 2015 British Society for Plant Pathology

 Citrus bacteria disrupt quorum sensing
Bacteria within the genus Xanthomonas encode a cell–
cell signalling or QS system mediated by molecules of
the diffusible signal factor (DSF) family. The DSF family
are cis-2-unsaturated fatty acids, of which the paradigm
is DSF itself, first identified in Xanthomonas campestris
pv. campestris and characterized as cis-11-methyl-2-
dodecenoic acid. The DSF-mediated signalling system
was discovered during mutagenesis assays designed to
identify genes associated with the regulation of synthesis
of extracellular degradative enzymes and extracellular
polysaccharides in X. campestris pv. campestris (Tang
et al., 1991). These genes were named rpf (for regulation
of pathogenicity factors). The QS system in the
Xanthomonas genus comprises three components: the
synthase, the sensor and the regulator. The rpfF gene
encodes RpfF, an enzyme of the crotonase family respon-
sible for the synthesis of DSF (Barber et al., 1997).
Genes rpfC and rpfG encode for the components
involved in signal transduction: the sensor RpfC and the
regulator RpfG (Slater et al., 2000; Dow et al., 2003).
RpfC is a complex sensor kinase whereas RpfG is com-
posed of a REC domain and an HD-GYP domain, which
is a phosphodiesterase involved in degradation of the sec-
ond messenger cyclic di-GMP (Ryan & Dow, 2010). At
physiological relevant levels, cyclic di-GMP binds specifi-
cally to the global transcriptional activator Clp (cyclic-
AMP receptor-like protein), which in turn regulates
many functions, including the expression of genes encod-
ing virulence factors, such as extracellular enzymes and
enzymes involved in xanthan synthesis (Ryan & Dow,
2010; Tao et al., 2010). Addition of exogenous DSF to
an rpfF mutant restores the synthesis of virulence factors
such as endoglucanase to wildtype levels (Barber et al.,
1997). This forms the basis of a bioassay for DSF in
which the level of endoglucanase activity, or expression
of the endoglucanase promoter, can be assessed in an
rpfF background (Barber et al., 1997; Slater et al., 2000;
Newman et al., 2004).
As mentioned above, the Rpf/DSF system is conserved
in the genus Xanthomonas, as well as in the related gen-
era Xylella and Stenotrophomonas (Ryan et al., 2008).
Recent work has shown that in Xcc, DSF signalling is
required for full virulence in a citrus host and that RpfF
regulates expression of almost 180 genes. The biological
functions performed by the gene products include chemo-
taxis and motility, adhesion, stress tolerance, transport
and detoxification (Guo et al., 2012). An early study by
Newman et al. (2008) identified the potential of DSF sig-
nal quenching in the control of disease caused by
X. campestris pv. campestris. Bacteria isolated from the
phyllosphere of field-grown plants that are natural hosts
for X. campestris pv. campestris could rapidly modify
and/or degrade DSF in vitro. These organisms belonged
to several different genera. Further, application of these
bacteria could reduce disease symptoms caused by
X. campestris pv. campestris in crucifers and Xylella fas-
tidiosa in grape. Currently, there is no information
regarding the isolation and identification of bacteria able
to disrupt DSF signalling in Xcc, nor on the use of quo-
Plant Pathology (2016) 65, 782–791
783
rum quencher bacteria as a tool to reduce citrus canker.
In this study, bacteria were isolated and identified from
the phyllosphere of citrus species that displayed different
susceptibility profiles to citrus canker. Using a DSF biore-
porter, the ability of these bacteria to disrupt QS in Xcc
306 was tested in vitro, and their ability to reduce the
virulence of Xcc in sweet orange was assessed.
Materials and methods
DSF bioreporters construction
The DSF-producing bacterium Xcc 306 (da Silva et al., 2002)
was transformed by electroporation with plasmid pKLN55 that
harbours an eng:gfp reporter fusion in which the X. campestris
endoglucanase promoter drives expression of the green fluores-
cent protein (GFP) gene. This reporter is inducible by DSF
(Newman et al., 2004). Electrocompetent cells were prepared
following do Amaral et al. (2005), with modifications. Briefly,
one isolated Xcc 306 colony was transferred to 200 mL nutrient
broth (NB) medium (8 g L!1 NB and 5 g L!1 NaCl, pH 7"0)
and grown with rotary shaking (160 rpm) at 28°C for 6 h to
reach a final concentration OD600 = 0"6, corresponding to the
mid-log growth phase. Bacterial cells were kept on ice for 1 h,
and subsequently two washes with 1 and 0"5 volumes of ice-
cold sterile 10% glycerol were performed with centrifugation
for 10 min to 4000 g at 4°C. A final washing was performed by
addition of 1 mL ice-cold sterile 10% glycerol and centrifuga-
tion at 13 000 g for 2 min at 4°C. The final concentration was
adjusted to 4 9 1010 CFU mL!1. Electroporation conditions
were: field strength (12"5 kV cm!1), capacitance 25 lF, resis-
tance 50 Ω and time pulse 2"66 ms. Transformed cells were
recovered in 1 mL NBY medium (0"8% nutrient broth, 0"2%
yeast extract, 0"2% K2HPO4, 0"05% KH2PO4) supplemented
with 20 mL glucose (10%) and 1 mL L!1 1 M MgSO4 and incu-
bated at 28°C for 3 h with constant shaking (180 rpm). To
allow for expression of antibiotic resistance, transformant cells
were selected on NA medium supplemented with 50 lg mL!1
kanamycin, resulting in the strain DSF reporter Xcc 306
(pKLN55), enabled to report the sensing of its own DSF. To
construct the biosensor for reporting exogenous DSF, a mutant
strain DrpfF Xcc 306 was produced using the overlap extension
PCR strategy (Lee et al., 2004). Briefly, a 1610 bp fragment was
amplified from genomic DNA of Xcc 306 using primers flanking
the gene rpfF (XAC 1879). This fragment was used as template
for two independent PCRs, using two pairs of primers designed
with chimeric and overlapping ends (Table 1). The sizes of PCR
products were 102 and 105 bp (positions 242–349 and 705–
809). These fragments were then used as templates for the sec-
ond step of PCR to yield recombined PCR products containing
the internal deletion of 164 bp of the rpfF gene. This fragment
was digested with SalI–MboI and transferred into SalI–BamHI
digested suicide plasmid vector pOK1 (Kaniga et al., 1991),
resulting in pOK1 DrpfF. The pOK1 construct was sequenced to
confirm the presence of the DrpfF deletion. This vector was used
to transform Xcc 306 by electroporation. Transformed cells
were recovered as described above, the transformant cells were
then selected in NA medium supplemented with 100 lg mL!1
spectinomycin. Xcc 306 DrpfF was then transformed by electro-
poration with the plasmid pKLN55, resulting in the DSF repor-
ter strain Xcc 306 DrpfF/pKLN55 unable to sense the
production of its own DSF, but still able to sense DSF from a
foreign source. To exclude any potential inhibitory effect of cul-
ture media over endoglucanase expression, DSF reporter strain
784 J. C. Caicedo et al.
Table 1 Primers used in this study
Primer Primer sequence (50 –30 )a
rpfF F GGGCGAAATCGTCAAGGTGGTCAT
R GCGAGTTCATCCAGCAATGCCTCAG
AB F TGTTCGCACGGCTGATCCGC
R cgacgcggcCCGCCGAAGCCGACATGCA
CD F cttcggcggGCCGCGTCGCCCCTCAACT
R GGCACCAGCACGTCGACGAT
A1 F AGAGTTTGATCCTGGCTCAG
PC5B R TACTTTGTTACGACTT
a
Lower case letters correspond to chimeric and overlapping ends; underlined letters correspond to the cut sites of MboI (single line) and SalI (dou-
ble line).
Xcc 306/pKLN55 and wildtype Xcc 306 were inoculated in
three different culture media (NA, LB agar and NYGA), supple-
mented with 0"25% carboxymethylcellulose (CMC). Relative
levels of endoglucanase activity for Xcc 306/pKLN55 and Xcc
306 were compared in cultures grown in each medium by mea-
suring the radial diffusion after staining the plate with 0"1%
Congo red for 30 min as described by Wood (1981).
Isolation and identification of DSF inhibitory bacteria
Epiphytic and endophytic bacteria were isolated from the sur-
face and from macerates of citrus leaves (with and without
symptoms of citrus canker) of the sweet orange cultivars Folha
Murcha, P^era Rio, IAPAR 73 and Valencia. Plant material was
macerated with a mortar and pestle in 10 mM KPO4 buffer
(pH 7"2) and appropriate dilutions were plated on 10% trypti-
case soy agar (Merck). Plates were incubated at 28°C for 72 h,
and single colonies representing phenotypical variety were
streaked onto Petri dishes containing trypticase soy agar. These
colonies were over-sprayed with a suspension of the DSF
biosensor strain Xcc 306/pKLN55 at a final concentration of
106 CFU mL!1. Bacterial isolates displaying antibacterial activ-
ity (reduction or inhibition of growth) against DSF biosensor
Xcc 306/pKLN55 were excluded from study. Degradation or
modification of DSF by a neighbouring strain leads to blockage
in DSF sensing by biosensor Xcc 306/pKLN55. This results in
a decrease in GFP fluorescence observed using an Olympus
BX60 microscope in the blue UV range. Each citrus leaf isolate
was spotted on Petri dishes containing NA medium and in
proximity to the DSF bioreporter Xcc 306/pKLN55. API kits
(bioM!erieux) were used to identify both Gram-positive and
Gram-negative bacterial species, capable of degrading or modi-
fying DSF, and this was confirmed by sequencing (3730xl
DNA sequencer; Applied Biosystems) PCR-mediated 16S rRNA
amplification products obtained using the universal primers PA
and PC5B (Table 1). Cycling conditions were as follows: 94°C
for 2 min for initial denaturation; 25 cycles of 94°C for 30 s,
52°C for 30 s and 72°C for 1 min; and a final extension of
72°C for 10 min. The nucleotide sequences found were com-
pared to the 16S rRNA sequence from the GenBank database
using a nucleotide BLAST search.
Kinetics of DSF degradation in vitro assay
The kinetics of DSF degradation in vitro by DSF inhibitory
bacteria was measured using the DSF bioreporter strain DrpfF
Xcc 306/pKLN55 as follows: 50 lL of DSF extracted with
ethyl acetate (Barber et al., 1997) from the supernatant of
cultures of Xcc 306 was added to 5 mL of cell suspension
Product (bp) Use Reference
1610 Mutagenesis Guo et al. (2012)
102 Mutagenesis This study
105 Mutagenesis This study
1486 16S rRNA Kuske et al. (1997)
(106 CFU mL!1) of each DSF inhibitory bacterium; any
remaining DSF was subsequently extracted with ethyl acetate
after 2, 4, 8, 12, 24 and 48 h and was quantified with the
bioreporter DrpfF Xcc 306/pKLN55 (only able to sense DSF
from an exogenous source). Briefly, a sterile filter paper disk
(3 mm diameter) soaked with the extracted DSF was placed on
the surface of an NA plate containing a bioreporter DrpfF Xcc
306/pKLN55. The radial distance from the centre of the paper
disk to the distal edge of the GFP signal of the bioreporter
strain was measured, after incubation for 24 h at 28°C. To
estimate the amount of DSF present in the samples, the radial
distance was compared to those recorded in the DSF standard
curve, which reflects the area of detectable GFP fluorescence
against known amounts of DSF. The DSF standard curve was
prepared according to Newman et al. (2004) with variations:
DSF was extracted from the supernatant of overnight Xcc 306
cultures, adding equal volumes of water-saturated ethyl acetate,
with subsequent evaporation to dryness. The residue was dis-
solved in 1 mL methanol. Progressive amounts of this standard
DSF source (5, 10, 15, 20, 25, 30, 40, 45 and 50 lL) were
added to 3 mL NB medium and mixed. DSF units are given as
the volume of DSF (in lL) added to NB medium before extrac-
tion. DSF was then extracted with an equal volume of ethyl
acetate, dried and resuspended in 50 lL methanol. The
extracted DSF was placed on a sterile filter paper disk (3 mm
diameter) and assayed using the DrpfF Xcc 306/pKLN55 as
described above. The radial distance from the centre of the fil-
ter disk to the distal edge of visible GFP fluorescence in the
bioreporter strain was measured after incubation for 24 h at
28°C, and the fluorescence area was plotted against DSF units
concentration.
Virulence test
Virulence assays were performed under controlled growth condi-
tions at the Plant Laboratory, Technology Department FCAV/
Universidade Estadual Paulista, SP, Brazil. Two methods of
infection were used: leaf infiltration and spray. All plants were
grown in a growth chamber maintained at 28°C and with a
photoperiod of 16 h. The assays were performed using the same
cultivars of sweet orange (Folha Murcha, Pera Rio and Valen-
cia) from which DSF inhibitory bacteria were originally isolated.
The antagonistic bacteria tested were only those that showed a
higher ability in vitro for DSF degradation or modification. All
plants were the same age at the time of inoculation; fully
expanded immature citrus leaves of similar age were infected by
infiltration pressure with needleless syringes containing both Xcc
306 and DSF inhibitory bacterial isolates. The bacterial strains
were mixed just prior to infection and the final concentration
Plant Pathology (2016) 65, 782–791
 Citrus bacteria disrupt quorum sensing
was adjusted to 104 CFU mL!1 in 10 mM MgCl2 for each
strain. The infiltrated leaves were photographed 21 days post-
inoculation (DPI). To resemble natural infection of citrus can-
ker, the infections were also performed by a spray method as
described by Li & Wang (2012), with modifications. Briefly, the
abaxial surfaces of fully expanded, immature leaves of each
plant were sprayed with a mix solution of each DSF inhibitory
bacteria and Xcc 306 at a final concentration of 107 CFU mL!1
in 10 mM MgCl2 for each strain. After inoculation, the plants
were covered with plastic bags for 24 h to maintain a high rela-
tive humidity (>90%) and to force the opening of stomata for
symptom development. The sprayed leaves were photographed
21 DPI. Canker lesions from five infiltrated leaves and five
sprayed leaves were quantified 21 DPI, and the infected areas
were calculated using IMAGEJ v. 1.48 (Schneider et al., 2012).
The assays were performed in triplicate, and the statistical anal-
ysis of data was performed using one-way ANOVA with post hoc
testing (Bonferroni) using SPSS STATISTICS DESKTOP, v. 22.0 soft-
ware (IBM).
Biofilm formation and attachment assays
Bacterial retention of crystal violet was used to assess the bacte-
rial ability to attach to abiotic and biotic surfaces (O’Toole &
Kolter, 1998; Gottig et al., 2009). To measure the effect of DSF
inhibitory bacteria on the attachment ability of Xcc 306 to abi-
otic surfaces, overnight cultures of Xcc 306 and the potential
antagonistic bacteria were centrifuged to recover a cell pellet,
which was washed, and adjusted to a final concentration of
107 CFU mL!1 in 10 mM MgCl2 for each strain. Subsequently,
100 lL of each DSF inhibitory bacterium were mixed with
100 lL of Xcc 306 and added to each well of a 96-well
polyvinylchloride (PVC) plate. Positive controls were 10
wells with 100 lL of each DSF inhibitory bacterium and 10
wells with 100 lL of Xcc 306; negative controls were 10 wells
with 100 lL of MgCl2 10 mM. The plate was incubated for 8 h
at 28°C. The wells were then stained with 1% crystal violet for
15 min at room temperature. To remove non-adherent cells and
excess stain, three washes were performed with running tap
water. Two hundred microlitres of 95% ethanol were then
added to each well to solubilize the crystal violet and absor-
bance was determined at 562 nm in a biophotometer. To mea-
sure bacterial attachment to biotic surfaces, 40 lL of each
mixed bacterial suspension (20 lL of each DSF inhibitory strain
and 20 lL of Xcc 306) were applied to the abaxial face of citrus
leaves, and the leaves were incubated in a wet chamber for 8 h
at 28°C. Bacterial attachment was measured by crystal violet
staining as described above for abiotic surfaces. Scanning elec-
tron microscopy (SEM) was used to obtain direct evidence of
the effect of DSF inhibitory bacteria in the attachment ability
and biofilm formation of Xcc 306 to the leaf surface. The DSF
inhibitory bacteria tested were only those that showed a higher
ability in vitro for DSF degradation or modification. To assess
biofilm formation, leaves of sweet orange (Folha Murcha, Pera
Rio and Valencia) were infected by overspray with mixed solu-
tions of each DSF inhibitory bacterium and Xcc 306 at a final
concentration of 107 CFU mL!1 in 10 mM MgCl2 for each
strain; randomly chosen 7 DPI samples (0"8 9 0"8 cm) were dis-
sected from leaves. To preserve the original biofilm morphology
and to avoid dehydration of the EPS layer in samples, a pre-fixa-
tion step was performed with 2"5% (v/v) glutaralde-
hyde + 75 mM lysine fixative in 0"1 M sodium cacodylate buffer
(pH 7"2) for 8 min at room temperature (Ratnayake et al.,
2012), followed by a conventional fixation with 3% glutaralde-
Plant Pathology (2016) 65, 782–791
785
hyde in 0"1 M phosphate buffer (pH 7"2) overnight. Subse-
quently the fixed areas were washed three times with 0"1 M
phosphate buffer (pH 7"2), and post-fixed in 2% OsO4 in
0"1 M phosphate buffer (pH 7"2) for 4 h and rinsed twice in
0"1 M phosphate buffer (pH 7"2). After rinsing, the samples were
dehydrated with ethanol solution (5, 10, 20, 30, 40, 50, 60, 70,
80, 90 and 100%) for 10 min each, repeating the final wash
twice. Leaf samples were dried in an EMS 850 critical point
dryer and coated with gold using a sputter coater Denton
Vacuum Desk II. SEM micrographs were obtained using a JSM-
6490 scanning electron microscope (Jeol USA) at 15 kV. Addi-
tional assays using API 20E, NE kits and PCR amplification of
16S rRNA were performed to identify bacteria in leaves that
showed some form of biofilm formation. To assess bacterial
attachment to leaves, bacterial suspensions of mixed solutions of
each DSF inhibitory bacterium and Xcc 306 were prepared as
described above. Forty microlitres of these suspensions were
applied to the abaxial surface of detached sweet orange leaves
and were incubated in a wet chamber for 10 h at 28°C. After
washing twice with sterile tap water, inoculated areas were dis-
sected from leaves for SEM observation under the same condi-
tions as described above. The controls used in both assays were
leaves of sweet orange (Folha Murcha, Pera Rio and Valencia)
inoculated with Xcc 306 alone. SEM analysis was performed
three times, with five replicates each time.
Results
Construction of DSF reporter strains
To assess the presence and functionality of DSF family
molecules in Xcc, two DSF bioreporters were con-
structed by transformation of wildtype Xcc 306 and a
rpfF mutant with plasmid pKLN55 (Newman et al.,
2004). This plasmid carries the eng::gfp promoter
fusion in which the endoglucanase promoter drives gfp
gene expression. Colonies of Xcc with pKLN55
expressed GFP, but no changes were observed in the
macroscopic morphology of the colonies grown on
NBY or NA medium, suggesting that the production of
pigment and exopolysaccharide was not altered com-
pared to the wild strain. The Xcc rpfF deletion mutant
(DrpfF) was constructed using overlap extension-PCR as
described in the Materials and Methods. The DrpfF
strain had impaired DSF production (as expected) and
colonies grown on NBY or NA medium displayed
changes in shape (circular to irregular), surface texture
(smooth to rough), reduced mucoidy, and a loss of pig-
mentation. Nevertheless, Xcc DrpfF retained the ability
to sense and respond to the addition of DSF from an
exogenous source. Specifically, Xcc DrpfF carrying
pKLN55 responded to exogenous DSF by expression of
GFP. This second bioreporter was used to assay the
levels and biological activity of DSF in the different
in vitro tests with the inhibitory bacteria. Endoglucase
activity in the bioreporter strain Xcc 306/pKLN55 and
Xcc 306 wildtype, showed similar activity levels in all
three culture media tested, suggesting the absence of
any compound inhibiting endoglucanase expression in
the media (data not shown).
786 J. C. Caicedo et al.

bitory strain to degrade DSF in vitro, and thus determine

Isolation and identification of bacteria able to disrupt
DSF signalling
Bacteria were isolated from leaves of field-grown citrus
plants with and without symptoms of citrus canker. A
total of 114 isolates with distinct colony phenotype
were recovered from citrus leaves (Table 2). All of
these isolates were screened in vitro for their ability to
disrupt DSF-mediated induction of gfp expression in
the wildtype bioreporter strain Xcc 306/pKLN55. Bac-
teria that displayed any antibacterial activity against
DSF biosensor Xcc 306/pKLN55 were excluded from
this study. A total of seven isolates able to inhibit this
DSF signalling pathway were identified. These were
classified using API kits and by sequencing of PCR-
mediated 16S rRNA amplification products. They
included two Gram-positive bacteria (Bacillus sp. SJ13
and Bacillus sp. SJ15) and five Gram-negative bacteria
(Pseudomonas sp. SJ02, Pseudomonas sp. SJ01, Raoul-
tella sp. SJ08, Kosakonia sp. SJ23 and Citrobacter sp.
SJ11; Table 3).
Inhibition of DSF signalling and degradation of the
DSF signal
To obtain direct evidence that the impairment of the
DSF signalling pathway is associated with the degrada-
tion of DSF rather than other reasons such as repression
of the eng promoter independently of DSF or inhibition
of bioreporter strain growth, the kinetics of DSF degra-
dation was measured to establish the ability of each inhi-
Table 2 Number of bacterial isolates with a different growth pattern
isolated from citrus leaves
No. of CFUs isolated
Citrus cultivar Leaves with symptoms Leaves without symptoms
the rate of change of the active molecule. For these
experiments, DSF was extracted from Xcc culture super-
natants and added to each strain grown in NB medium.
The supernatant was harvested at different times and
DSF was extracted and assayed using the Xcc DrpfF/
pKLN55 reporter. The strains that showed high ability
to degrade the DSF signal in vitro were: Pseudomonas
sp. SJ01, Pseudomonas sp. SJ02 and Bacillus sp. SJ13.
Its maximum activity was recorded 6 h after DSF addi-
tion. The rate of degradation reached by Pseudomonas
sp. SJ01 was 1"3- and 2"2-fold faster than that reached
by Pseudomonas sp. SJ02 and Bacillus sp. SJ15 respec-
tively (Fig. 1). The remaining strains (Raoultella sp.
SJ08, Kosakonia sp. SJ23 and Citrobacter sp. SJ11) dis-
played a weak impairment of the DSF signalling pathway
and their activity was similar to that of efficient DSF
inhibitory strains only after 48 h following DSF addi-
tion.
Effects of DSF-degrading strains on Xcc virulence
Virulence assays were performed under controlled
growth conditions and canker lesions were quantified at
21 DPI. These assays showed that when citrus leaves
were inoculated with mixtures of Xcc and different DSF
inhibitory bacteria by spraying, the number of canker
lesions decreased significantly for three bacteria, Pseu-
domonas sp. SJ02, Pseudomonas sp. SJ01 and Bacillus
sp. SJ13, and increased for one, Bacillus sp. SJ15, rela-
tive to the control inoculated with Xcc alone (Figs 2a &
3a). When effects were assayed by leaf infiltration of bac-
teria, Pseudomonas sp. SJ02 and Bacillus sp. SJ13 still
conferred a significant (at least 2"5-fold) reduction in the
number of canker lesions, while Bacillus sp. SJ15 showed
a slight decrease (Figs 2b & 3b).

Folha Murcha 10 16 Effects of DSF-degrading strains on Xcc attachment

Pera Rio 8 13 and biofilm formation
Valencia 14 24
For most pathogenic bacteria, surface attachment and
IAPAR 73 7 22
subsequent biofilm formation are essential stages in

Table 3 Diffusible signal factor (DSF) inhibitory bacteria isolated from citrus leaves

GenBank accession Similarity16S rDNA DSF degradation

Isolate Closest species type strain no. (%) Origin assaya

Pseudomonas sp. Pseudomonas oryzihabitans NBRC NBRC 102199 97 Folha Murcha/Pera +++
SJ02 102199 Rio
Pseudomonas sp. Pseudomonas auruginosa PAO1 NR074828.1 98 Pera Rio/Valencia +++
SJ01
Bacillus sp. SJ13 Bacillus amyloliquefaciens NR117946.1 97 Folha Murcha/ +++
MPA1034 Valencia
Bacillus sp. SJ15 Bacillus vallismortis DSM 11031 NR024696.1 97 Folha Murcha ++
Raoultella sp. SJ08 Raoultella planticola JCM 7251 NR112011.1 98 Pera Rio/Valencia +
Kosakonia sp. SJ23 Kosakonia cowanii 888-76 NR025566.1 98 Valencia +
Citrobacter sp. Citrobacter freundii NBRC 12681 NR113596.1 98 IAPAR 73/Valencia +
SJ11

a
DSF degradation ability based on plate inhibition assay. +, low; ++, medium; +++, high.

Plant Pathology (2016) 65, 782–791

 Citrus bacteria disrupt quorum sensing 787

Figure 1 Kinetics of diffusible signal factor

(DSF) degradation by differing DSF inhibitory
bacteria strains. Each time point represents
the average of three replicate samples for
each treatment. Comparable patterns of DSF
degradation were obtained in three
independent experiments.

Figure 2 Reduction in the severity of citrus

canker disease by the action of inhibitory
quorum sensing bacteria isolated from citrus
leaves. (a) Spray inoculation on the abaxial
side of citrus leaves, both bacteria were co-
inoculated at a concentration of 107
CFU mL!1. Inoculated leaves were
photographed at 21 days post-inoculation.
(b) Inoculation by infiltration. Right side of
leaf: Xanthomonas citri subsp. citri at a
concentration of 104 CFU mL!1, left side of
leaf: DSF inhibitory bacteria isolated plus
X. citri subsp. citri. Both bacteria were co-
infiltrated at the same concentration of 104
CFU mL!1. The bacterial strains were mixed
just prior to infection. The assays were
repeated three times with three plants each
time, yielding similar results. Only one
representative result is presented in the
figure.

maintenance, survival and early establishment of
pathogenicity in tissue. It is now accepted that QS plays
a major, if not essential, role in bacterial biofilm forma-
tion (Branda et al., 2005). Due to the inability of Xcc
306 DrpfF to form well-established biofilms (data not
shown), it was investigated whether there was a link
between the virulence reduction of Xcc in a susceptible
host and its ability to attach and form a biofilm on citrus
leaf surfaces co-inoculated with DSF inhibitory bacteria.
Assays of solubilization of crystal violet stain by ethanol
provide an indirect quantitative estimation of the
attached cell population. The results showed that Pseu-
domonas sp. SJ02, Pseudomonas sp. SJ01 and Bacillus
sp. SJ13 strains significantly reduced the attachment abil-
ity of Xcc 306 to abiotic and biotic surfaces, with 8-fold
lower levels of crystal violet stain retention. These levels

Plant Pathology (2016) 65, 782–791

788 J. C. Caicedo et al.

Figure 3 Quantification of canker lesions in citrus leaves at 21 days post-inoculation. (a) Leaves inoculated by spraying a mixture of DSF inhibitory
bacteria and Xanthomonas citri subsp. citri (107 CFU mL!1). (b) Leaves inoculated by pressure infiltration with a mixture of DSF inhibitory bacteria
and X. citri subsp. citri (104 CFU mL!1). Values given are the means and bars represent standard deviation of measurements. Values marked with
an asterisk are significantly different from those with the pathogen alone at P < 0"05 using one-way ANOVA with post hoc test (Bonferroni) with SPSS
STATISTICS DESKTOP software, v. 22.0.

are similar to those observed in attachment assays of
Xcc DrpfF and Xcc 306 (Fig. 4). Scanning electron
microscopy analysis was performed at 10 h and 7 DPI
by overspray, with a mix solution of each DSF inhibitory
bacterium and Xcc 306 at a final concentration of
107 CFU mL!1 each in 10 mM MgCl2. SEM revealed a
critical reduction in Xcc adherence ability after 10 h
when co-inoculated with Pseudomonas sp. SJ02, Pseu-
domonas sp. SJ01 or Bacillus sp. SJ13, relative to leaves
infected with Xcc alone (Fig. 5a–d). Seven days post-

Figure 4 Bacterial attachment assays to abiotic and biotic surfaces based on bacterial retention of crystal violet stain. The bars represent standard
deviation of measurements. The assays were repeated three times in three independent experiments that yielded similar results. Only one
representative result is presented in the figure.

Plant Pathology (2016) 65, 782–791

 Citrus bacteria disrupt quorum sensing
Figure 5 Scanning electron microscopy
analysis of bacterial attachment to citrus leaf
surfaces. (a–d) Bacterial attachment after
10 h of incubation. (a, c) Pseudomonas sp.
SJ02 plus Xanthomonas citri 306; (b, d)
X. citri 306. Images at two different
magnifications; (e) Pseudomonas sp. SJ02;
and (f) X. citri 306, 7 days post-inoculation.
The strains were inoculated at the same
concentration of 107 CFU mL!1.
infection with Xcc and DSF inhibitory bacteria, SEM
showed a lack of biofilm formation on leaf surfaces
co-inoculated with Pseudomonas sp. SJ02 and Bacillus
sp. SJ13, relative to leaves infected with Xcc alone
(Fig. 5e, f). Although a well-structured biofilm was
evident on leaf surfaces co-inoculated with Xcc and
Pseudomonas sp. SJ01, biochemical and molecular char-
acterization of bacteria recovered from these leaves
showed that Pseudomonas sp. SJ01 was responsible
because no Xcc could be recovered.
Discussion
Quorum sensing is a cell-to-cell communication system
that enables the bacterial community to act in a coordi-
nated fashion and take advantage of competitors in a
particular habitat, but is not absolutely essential for bac-
terial survival. Inhibition of QS can lead to certain phe-
notypic alterations, such as virulence reduction,
decreased biofilm formation and increased bacterial sen-
sitivity to treatments (Ng & Bassler, 2009). In this
study, several bacteria from the citrus phyllosphere able
to disrupt the communication system in Xcc 306 were
isolated and identified using the DSF bioreporter strain
Xcc 306/pKLN55, which contains an eng::gfp reporter
fusion in which the eng promoter drives expression of
Plant Pathology (2016) 65, 782–791
789
the gene encoding the green fluorescent protein. This
reporter is inducible by DSF. It should be noted that in
addition to the enzymatic degradation of the DSF signal,
the reduction in the activation of the DSF-dependent
eng promoter by different bacteria could be due to a
number of mechanisms. These include the production of
small molecules that could repress eng promoter expres-
sion in a fashion independent of DSF or the production
of growth inhibitors of the bioreporter strain. For exam-
ple, there is evidence that cell-to-cell communication
mediated by DSF family signals is not exclusive to xan-
thomonads and that bacteria of unrelated genera,
including Pseudomonas aeruginosa and Burkholderia
species, produce the same or related signals (Boon et al.,
2008; Davies & Marques, 2009). In particular,
P. aeruginosa produces cis-2-decenoic acid, which
induces a dispersion response in biofilms formed by a
range of Gram-negative and Gram-positive bacteria and
yeast (Davies & Marques, 2009). To date, it is not
known whether cis-2-decenoic exerts any action on Xcc,
such as activation or inhibition of the DSF signalling
pathway. Finally, it is known that many Bacillus
species produce antimicrobial compounds, which
could conceivably inhibit Xcc growth. In addition,
P. aeruginosa and other pseudomonad species produce
antibacterial phenazines, such as phenazine-1-carboxylic
790 J. C. Caicedo et al.
acid, active against Xanthomonas oryzae pv. oryzae, the
causal agent of rice bacterial blight (Xu et al., 2015).
Seven DSF inhibitory bacteria were isolated from
citrus leaves showing activity in vitro against QS sig-
nalling in Xcc. Interestingly, only three of this panel of
strains, those with the highest efficiency of DSF degrada-
tion in vitro, were effective at reducing disease symptoms
in planta following spray inoculation, mimicking the nat-
ural infection process. The leaf surface is considered a
restrictive and hostile habitat for the bacterial colonist.
Nutrient limitations, sudden temperature changes and
relative humidity are some of the factors that determine
the leaf microbiota (Lindow & Brandl, 2003). Attach-
ment to the leaf surface and colonization are critical
aspects of the early stage of pathogenesis (Gottig et al.,
2009). Intriguingly, DSF signalling in Xcc positively reg-
ulates five genes encoding cell surface attachment struc-
tures such as adhesins (hmsHR) and fimbria (pilM) (Guo
et al., 2012). Interruption of DSF signalling by DSF-
degrading bacteria may lead to a down-regulation of
these genes with consequences for attachment, epiphytic
fitness and disease severity. Consistent with this con-
tention, a lack of biofilm formation by Xcc was observed
on the surface of the leaves co-infected with DSF inhibi-
tory bacteria by spraying, although well-established bio-
films were found on the surfaces of leaves sprayed with
Xcc alone.
When the citrus leaves were infected by infiltration,
Pseudomonas sp. SJ02 and Bacillus sp. SJ13 both
reduced the number of canker lesions in the host (as was
seen with spray inoculation); nevertheless Pseudomonas
sp. SJ01 showed an unexpected slight increase in the
number of canker lesions. The reasons for this difference
between the two inoculation methods are unclear.
Absence of an inhibitory effect may reflect differences in
the expression of genes involved in DSF degradation in
the two environments (leaf surface versus plant meso-
phyll) but this remains speculative.
A mechanism to explain how quencher bacteria
degrade or modify the DSF molecule produced by Xcc
could be that the DSF molecule could act as potential
substrate to the UDP-sugar transferase enzymes, modify-
ing short fatty acids by adding a sugar moiety from
UDP-sugars (UDP-glucose or UDP-galactose). These
UDP-sugar pools are produced by the activity of car-
bamoylphosphate synthetase encoded by carA and carB.
The nucleotide sequence of the carAB locus in the DSF
inhibitory bacteria Pseudomonas sp. SJ02, Pseudomonas
sp. SJ01 and Bacillus sp. SJ13 in the present study have
strong similarity with those of carAB genes present in
the Pseudomonas strain G isolated by Newman et al.
(2008) and described by those authors as efficient DSF
inhibitory bacteria in X. campestris.
Quorum sensing is an important target for prophylac-
tic and therapeutic interventions. This study identified
new bacteria that could be an alternative to the tradi-
tional copper treatment currently used to treat citrus
canker. Importantly, this would reduce the selection
pressure for copper resistance. The search for organisms
that act as inhibitors of QS in phytopathogenic bacteria
could also be an effective strategy in a wider context.
Because the organisms characterized here were origi-
nally isolated from the citrus phylloplane, the current
study also contributes to an understanding of the poten-
tial interactions of bacteria on leaf surfaces.
In conclusion, the findings indicate that members of
the autochthonous microbiota of different genera have a
beneficial effect on plant health. These bacteria may rep-
resent a highly valuable tool in the process of biological
control and offer an alternative to the traditional copper
treatment currently used for the treatment of citrus can-
ker disease, with significant environmental, economic
and health implications worldwide.
Acknowledgements
The authors thank Professor Ulla Bonas, Institute of
Biology, Dept. of Genetics Martin-Luther-University,
Halle-Wittenberg, Germany for plasmid pOK1, to Pro-
fessor Steve E. Lindow, University of California, Berkeley
USA for his advice and the plasmid pKLN55, to Profes-
sor Max Dow, BIOMERIT Research Centre, University
College, Cork, Ireland, for his critical review and valu-
able suggestions, to Dr Michael Chandler from CNRS,
Laboratoire de Microbiologie et G!enetique Moleculaires,
Universit!e Toulouse, France for his critical reading and
valuable suggestions, to Dr Maria C. Vasquez, Universi-
dad de Santander, UDES Colombia, for her assistance in
a bacterial characterization and to the Centro de Recur-
sos Biol!ogicos e Biologia Gen^ omica CREBIO, Univ.
Estadual Paulista, Jaboticabal SP, Brazil for the DNA
sequencing. J.C.C. was the recipient of a PhD fellowship
from PAEDEX/UNESP/AUIP.
References
do Amaral AM, Toledo CP, Baptista JC, Machado MA, 2005.
Transformation of Xanthomonas axonopodis pv. citri by
electroporation. Fitopatologia Brasileira 30, 292–4.
Barber CE, Tang JL, Feng JX et al., 1997. A novel regulatory system
required for pathogenicity of Xanthomonas campestris is mediated
by a small diffusible signal molecule. Molecular Microbiology 24,
555–66.
Boon C, Deng Y, Wang LH et al., 2008. A novel DSF-like signal from
Burkholderia cenocepacia interferes with Candida albicans
morphological transition. ISME Journal 2, 27–36.
Branda SS, Vik S, Friedman L, Kolter R, 2005. Biofilms: the matrix
revisited. Trends in Microbiology 13, 20–6.
Davies DG, Marques CNH, 2009. A fatty acid messenger is responsible
for inducing dispersion in microbial biofilms. Journal of Bacteriology
191, 1393–403.
Dow JM, Crossman L, Findlay K, He Y-Q, Feng J-X, Tang J-L, 2003.
Biofilm dispersal in Xanthomonas campestris is controlled by cell–cell
signaling and is required for full virulence to plants. Proceedings of the
National Academy of Sciences, USA 100, 10995–1000.
Federle MJ, Bassler BL, 2003. Interspecies communication in bacteria.
Journal of Clinical Investigations 112, 1291–9.
Gonzalez JE, Keshavan ND, 2006. Messing with bacterial quorum
sensing. Microbiology and Molecular Biology Reviews 70, 859–75.
Gottig N, Garavaglia BS, Garofalo CG, Orellano EG, Ottado J, 2009. A
filamentous hemagglutinin-like protein of Xanthomonas axonopodis
Plant Pathology (2016) 65, 782–791
 Citrus bacteria disrupt quorum sensing
pv. citri, the phytopathogen responsible for citrus canker, is involved
in bacterial virulence. PLoS ONE 4, e4358.
Guo Y, Li YJ, Zhang Y, Wang N, 2012. Diffusible signal factor-
mediated quorum sensing plays a central role in coordinating gene
expression of Xanthomonas citri subsp. citri. Molecular Plant–Microbe
Interactions 25, 165–79.
Kaniga K, Delor I, Cornelis G, 1991. A wide-host-range suicide vector
for improving reverse genetics in Gram-negative bacteria: inactivation
of the blaA gene of Yersinia enterocolitica. Gene 109, 137–41.
Kuske CR, Barns SM, Busch JD, 1997. Diverse uncultivated bacterial
groups from soils of the arid southwestern United States that are
present in many geographic regions. Applied and Environmental
Microbiology 63, 3614–21.
Lee J, Lee HJ, Shin MK, Ryu WS, 2004. Versatile PCR-mediated
insertion or deletion mutagenesis. BioTechniques 36, 398–400.
Li J, Wang N, 2012. The gpsX gene encoding a glycosyl transferase is
important for polysaccharide production and required for full virulence
in Xanthomonas citri subsp. citri. BMC Microbiology 12, 31.
Lindow SE, Brandl MT, 2003. Microbiology of the phyllosphere.
Applied and Environmental Microbiology 69, 1875–83.
Newman KL, Almeida RPP, Purcell AH, Lindow SE, 2004. Cell-cell
signaling controls Xylella fastidiosa interactions with both insects and
plants. Proceedings of the National Academy of Sciences, USA 101,
1737–42.
Newman KL, Chatterjee S, Ho KA, Lindow SE, 2008. Virulence of plant
pathogenic bacteria attenuated by degradation of fatty acid cell-to-cell
signaling factors. Molecular Plant–Microbe Interactions 21, 326–34.
Ng WL, Bassler BL, 2009. Bacterial quorum-sensing network
architectures. Annual Review of Genetics 43, 197–222.
Ni N, Li M, Wang J, Wang B, 2009. Inhibitors and antagonists of
bacterial quorum sensing. Medicinal Research Reviews 29, 65–124.
O’Toole GA, Kolter R, 1998. Initiation of biofilm formation in
Pseudomonas fluorescens WCS365 proceeds via multiple, convergent
signalling pathways: a genetic analysis. Molecular Microbiology 28,
449–61.
Ratnayake K, Joyce DC, Webb RI, 2012. A convenient sample
preparation protocol for scanning electron microscope examination of
xylem-occluding bacterial biofilm on cut flowers and foliage. Scientia
Horticulturae 140, 12–8.
Rumbaugh KP, Griswold JA, Iglewski BH, Hamood AN, 1999.
Contribution of quorum sensing to the virulence of Pseudomonas
aeruginosa in burn wound infections. Infection and Immunity 67,
5854–62.
Plant Pathology (2016) 65, 782–791
791
Ryan RP, Dow JM, 2010. Intermolecular interactions between HD-GYP
and GGDEF domain proteins mediate virulence-related signal
transduction in Xanthomonas campestris. Virulence 1, 1–5.
Ryan RP, Fouhy Y, Garcia BF et al., 2008. Interspecies signalling via the
Stenotrophomonas maltophilia diffusible signal factor influences
biofilm formation and polymyxin tolerance in Pseudomonas
aeruginosa. Molecular Microbiology 68, 75–86.
Schaad NW, Postnikova E, Lacy G et al., 2006. Emended classification
of xanthomonad pathogens on citrus. Systematic and Applied
Microbiology 29, 690–5.
Schneider CA, Rasband WS, Eliceiri KW, 2012. NIH IMAGE to IMAGEJ:
25 years of image analysis. Nature Methods 9, 671–5.
da Silva AC, Ferro JA, Reinach FC et al., 2002. Comparison of the
genomes of two Xanthomonas pathogens with differing host
specificities. Nature 417, 459–63.
Slater H, Alvarez-Morales A, Barber CE, Daniels MJ, Dow JM, 2000. A
two-component system involving an HD-GYP domain protein links
cell-cell signalling to pathogenicity gene expression in Xanthomonas
campestris. Molecular Microbiology 38, 986–1003.
Tang JL, Liu YN, Barber CE, Dow JM, Wootton JC, Daniels MJ, 1991.
Genetic and molecular analysis of a cluster of rpf genes involved in
positive regulation of synthesis of extracellular enzymes and
polysaccharide in Xanthomonas campestris pathovar campestris.
Molecular and General Genetics 226, 409–17.
Tao F, He YW, Wu DH, Swarup S, Zhang LH, 2010. The cyclic
nucleotide monophosphate domain of Xanthomonas campestris global
regulator Clp defines a new class of cyclic di-GMP effectors. Journal
of Bacteriology 192, 1020–9.
Timmer LW, Gottwald TR, Zitko SE, 1991. Bacterial exudation from
lesions of Asiatic citrus canker and citrus bacterial spot. Plant Disease
75, 192–5.
Uroz S, Dessaux Y, Oger P, 2009. Quorum sensing and quorum
quenching: the yin and yang of bacterial communication.
ChemBioChem 10, 205–16.
Wood PJ, 1981. The use of dye-polysaccharide interaction in b-D-
glucanase assay. Carbohydrate Research 94, C19–23.
Xu S, Pan X, Luo J et al., 2015. Effects of phenazine-1-carboxylic
acid on the biology of the plant-pathogenic bacterium Xanthomonas
oryzae pv. oryzae. Pesticide Biochemistry and Physiology 117,
39–46.
Zhang LH, Dong YH, 2004. Quorum sensing and signal interference:
diverse implications. Molecular Microbiology 53, 1563–71.