Mainstream Deammonification WERF 2015

INFR6R11_WEF-IWAPspread.
qxd 9/9/2015 2:55 PM Page 1
Mainstream Deammonification
Infrastructure
Water Environment Research Foundation

635 Slaters Lane, Suite G-110 n Alexandria, VA 22314-1177
Phone: 571-384-2100 n Fax: 703-299-0742 n Email: werf@werf.org
www.werf.org
WERF Stock No. INFR6R11
IWA Publishing
Alliance House, 12 Caxton Street
London SW1H 0QS
United Kingdom
Phone: +44 (0)20 7654 5500
Fax: +44 (0)20 7654 5555
Email: publications@iwap.co.uk
Web: www.iwapublishing.com
IWAP ISBN:
Co-published by
September 2015
INFR6R11
MAINSTREAM
DEAMMONIFICATION
by:
Maureen O’Shaughnessy
OWC
2015
The Water Environment Research Foundation, a not-for-profit organization, funds and manages water quality
research for its subscribers through a diverse public-private partnership between municipal utilities, corporations,
academia, industry, and the federal government. WERF subscribers include municipal and regional water and
wastewater utilities, industrial corporations, environmental engineering firms, and others that share a commitment to
cost-effective water quality solutions. WERF is dedicated to advancing science and technology addressing water
quality issues as they impact water resources, the atmosphere, the lands, and quality of life.
For more information, contact:

635 Slaters Lane, Suite G-110
Alexandria, VA 22314-1177
Tel: (571) 384-2100
Fax: (703) 299-0742
www.werf.org
werf@werf.org
This report was co-published by the following organization.
IWA Publishing
London SW1H 0QS, United Kingdom
Tel: +44 (0) 20 7654 5500
Fax: +44 (0) 20 7654 5555
www.iwapublishing.com
publications@iwap.co.uk
© Copyright 2015 by the Water Environment Research Foundation. All rights reserved. Permission to copy must be
obtained from the Water Environment Research Foundation.
Library of Congress Catalog Card Number: 2015951604
IWAP ISBN: 978-1-78040-785-2
This report was prepared by the organization(s) named below as an account of work sponsored by the Water
Environment Research Foundation (WERF). Neither WERF, members of WERF, the organization(s) named below,
nor any person acting on their behalf: (a) makes any warranty, express or implied, with respect to the use of any
information, apparatus, method, or process disclosed in this report or that such use may not infringe on privately
owned rights; or (b) assumes any liabilities with respect to the use of, or for damages resulting from the use of, any
information, apparatus, method, or process disclosed in this report.
OWC
The research on which this report is based was developed, in part, by the United States Environmental Protection
Agency (EPA) through Cooperative Agreement No. CR-83419201-0 with the Water Environment Research
Foundation (WERF). However, the views expressed in this document are not necessarily those of the EPA and EPA
does not endorse any products or commercial services mentioned in this publication. This report is a publication of
WERF, not EPA. Funds awarded under the Cooperative Agreement cited above were not used
for editorial services, reproduction, printing, or distribution.
This document was reviewed by a panel of independent experts selected by WERF. Mention of trade names or
commercial products or services does not constitute endorsement or recommendations for use. Similarly, omission
of products or trade names indicates nothing concerning WERF's or EPA's positions regarding product effectiveness
or applicability.
ii
About WERF
The Water Environment Research Foundation, formed in 1989, is America’s leading

independent scientific research organization dedicated to wastewater and stormwater issues.
Throughout the last 25 years, we have developed a portfolio of more than $134 million in water
quality research.
WERF is a nonprofit organization that operates with funding from subscribers and the federal
government. Our subscribers include wastewater treatment facilities, stormwater utilities, and
regulatory agencies. Equipment companies, engineers, and environmental consultants also lend
their support and expertise as subscribers. WERF takes a progressive approach to research,
stressing collaboration among teams of subscribers, environmental professionals, scientists, and
staff. All research is peer reviewed by leading experts.
For the most current updates on WERF research, sign up to receive Laterals, our bi-weekly
electronic newsletter.
Learn more about the benefits of becoming a WERF subscriber by visiting www.werf.org.
Mainstream Deammonification iii

ACKNOWLEDGMENTS
The project team would like to thank the wastewater utilities, DC Water and Hampton
Roads Sanitation District (HRSD), that initiated and made possible this highly collaborative
research study between a consortium of participating utilities, organizations and individuals. The
project team thanks the Water Environment Research Foundation and the U.S. EPA for the
funding that supported the collaboration and sharing of results between the participants. The
project team thanks Martin Hell of Waterboard AIZ for performing full-scale demonstrations at
the Strass WWTP in Austria. The project team extends their sincerest appreciation to Norbert
Weissenbacher, BOKU University, Vienna and Sabine Podmirseg, University of Innsbruck who
performed molecular analysis and greenhouse gas investigations and Kartik Chandran and his
team at Columbia University for contributing method development for molecular methods and
performing molecular analysis. The project team thanks Rebecca Holgate, Old Dominion
University, Ryder Bunce, Old Dominion University, Dana Fredericks, Virginia Tech, and Daniel
Hingley, HDR for the tireless and productive work at the HRSD pilot demonstration site. The
project team extends appreciation to AECOM, Black and Veatch, Brown and Caldwell, and
HDR for in-kind support. This report is truly the result of a team effort.
This Project Was Jointly Funded By:

District of Columbia Water and Sewer Authority (DC Water), Washington, D.C.
Hampton Roads Sanitation District (HRSD), Virginia
Research Team
Principal Investigator:
Maureen O'Shaughnessy
OWC
Co-Principal Investigators:
Charles Bott, Ph.D., P.E., BCEE
HRSD
Haydee de Clippeleir
Columbia University and DC Water
David Kinnear, Ph.D., P.E.
HDR
Mark Miller
Virginia Tech and HRSD
Sudhir Murthy, Ph.D., P.E., BCEE
DC Water
J.B. Neethling, Ph.D., P.E., BCEE
HDR
Ahmed Omari
DC Water
Pusker Regmi
Old Dominion University and HRSD
iv
Andrew Shaw, P.E.
Black and Veatch
Beverley Stinson, Ph.D.
AECOM
Imre Takacs
Dynamita
Bernhard Wett
ARA Consult
Jose Jimenez
Brown & Caldwell
WERF Project Subcommittee
Leon Downing, Ph.D., P.E.
CH2M (formerly with Donohue and Associates)
Jose Jimenez, Ph.D., P.E.
Brown and Caldwell
Thomas D. Johnson, P.E.
CH2M
Domènec Jolis, Ph.D.
San Francisco Public Utilities
Helen Littleton, Ph.D., P.E., BCEE
Consultant
Ting Lu, Ph.D., P.E.
Black & Veatch Corporation
Innovative Infrastructure Research Committee Members
Stephen P. Allbee (Retired)
U.S. Environmental Protection Agency
Traci Case
Water Research Foundation
Kevin Hadden
Orange County Sanitation District
Peter Gaewski, MS, P.E. (Retired)
Tata & Howard, Inc.
Daniel Murray
Michael Royer
Steve Whipp, BSc, CEng, MICE, MIOW (Retired)
United Utilities North West
Mainstream Deammonification v
Water Environment Research Foundation Staff
Director of Research: Amit Pramanik, Ph.D., BCEEM
Program Director: Walter L. Graf, Jr.
vi
ABSTRACT AND BENEFITS
Abstract:
The objective of this research was to investigate the feasibility of applying the
deammonification concept, which is already highly successful and proven in sidestream
configurations, in the mainstream treatment process. The deammonification process for nitrogen
removal provides a more efficient biological pathway compared to traditional nitrification/
denitrification. The demonstrated advantages of applying deammonification to mainstream
treatment include energy-neutral or even energy-positive wastewater treatment, reduction of
aeration energy, and reduction in external carbon and alkalinity demands. Implementation of
mainstream deammonification is compatible with existing wastewater infrastructure, often with
minimal modifications. The successful application of full-plant deammonification could save
wastewater utilities operations costs for aeration and external carbon costs in the life cycle.
Through demonstration and conceptual application at collaborating utilities, this research
develops an evaluation framework for implementing full-plant deammonification.
Deammonification is a two-step biological process where ammonia-oxidizing bacteria
(AOB) aerobically convert half of the ammonia present in the wastewater to nitrite. In the second
step, anammox bacteria oxidize the ammonia using nitrite to produce nitrogen gas without the
organic carbon substrate required for conventional heterotrophic denitrification.
Deammonification requires significantly less oxygen and so less energy is needed for nitrogen
removal. Deammonification requires no external carbon addition, eliminating chemical
purchases such as methanol. Process configurations using mainstream deammonification
maximize energy recovery by diverting more particulate organic carbon away from the nitrogen
removal process and directing it toward anaerobic treatment from which methane can be
captured. The implications of deammonification for sustainable, cost effective and energy
positive wastewater treatment are extraordinary.
The report discusses application of short-cut nitrogen removal which includes nitritation-
denitritation, in which ammonia oxidation ends at the intermediate nitrite, with the mainstream
deammonification pathway. Both short-cut nitrogen removal pathways result in savings in
energy, carbon and alkalinity over conventional nitrification-denitrification. To be successful,
short-cut nitrogen removal strategies require maximizing AOB activity, while preventing the
establishment of the nitrite oxidizing bacteria (NOB) that oxidize nitrite to nitrate and this report
introduces and develops concepts for NOB out-selection.
To progress from nitritation-denitritation to deammonification, the AOB activity must be
controlled to oxidize only half of the influent ammonia to nitrite, and a method of retaining the
slow-growing anammox bacteria must be implemented. The report presents a progressive
pathway from conventional nitrification-denitrification to short-cut nitrogen removal and
discusses a framework of conditions and drivers for implementation. The report includes concept
studies, similar to case studies, for nine resource recovery facilities as shown below.
Mainstream Deammonification vii

Participating Resource Recovery Facilities
Chesapeake Elizabeth Treatment Plant (CETP), VA

Blue Plains Advanced Wastewater Treatment Plant (AWTP), Washington, DC
H.L. Mooney Advanced Water Reclamation Facility (HLM AWRF), VA
Robert W. Hite Treatment Facility (TF), CO
Egan Reclamation Plant (WRP), IL
McDowell Creek Wastewater Treatment Plant (WWTP), NC
Sacramento Regional Wastewater Treatment Plant (SRWTP), CA
Howard F. Curren Advanced Wastewater Treatment Plant (HFCAWTP), FL
Danbury Water Pollution Control Plant (WPCP), CT
The research concludes that mainstream deammonification can be achieved. It is possible

for wastewater treatment plants to retrofit to short-cut nitrogen removal utilizing existing
infrastructure, often with minor modifications. The research revealed key site-specific drivers for
applying short-cut nitrogen removal technology.
Benefits:
 Demonstrates that the successful application of mainstream deammonification could save
wastewater utilities operations costs for aeration and external carbon costs in the life cycle.
 Indicates that in concept studies, implementation of short-cut nitrogen removal, including
mainstream deammonification, can be retrofitted using existing infrastructure, often with
minor modifications.
Keywords: Deammonification, mainstream deammonification, anammox ammonia-oxidizing

bacteria, AOB, nitrite-oxidizing bacteria, NOB, cyclone, demonstrations, pilot tests, concept
studies.
viii
TABLE OF CONTENTS
Acknowledgments.......................................................................................................................... iv
Abstract and Benefits .................................................................................................................... vii
List of Tables ................................................................................................................................ xii
List of Figures .............................................................................................................................. xiv
List of Abbreviations .................................................................................................................. xxii
Executive Summary .................................................................................................................. ES-1
1.0 Single-Stage Mainstream Deammonification with Bioaugmentation – Mainstream

Deammonification Pilot at Blue Plains Advanced Wastewater Treatment Plant.... 1-1
1.1 Objective .............................................................................................................. 1-2
1.2 Sequencing Batch Reactor Deammonification Operation Strategies .................. 1-2
1.3 Experimental Setup and Methodologies .............................................................. 1-3
1.3.1 Deammonification Bench-Scale SBRs .................................................... 1-3
1.3.2 Methodologies and Data Acquisition..................................................... 1-11
1.4 Results and Discussion ...................................................................................... 1-24
1.4.1 AMX Bioaugmentation – Effectiveness and Temperature Sensitivity .. 1-24
1.4.2 AMX Retention Efficiency .................................................................... 1-26
1.4.3 NOB Repression .................................................................................... 1-27
2.0 Full-Scale Pilots at Strass WWTP ................................................................................ 2-1

2.1 Objective .............................................................................................................. 2-1
2.2 Testing Phases and Pilot-Configurations ............................................................. 2-2
2.2.1 Sidestream Reactor – Source of Seed Sludge .......................................... 2-4
2.2.2 Cyclone Characteristics ........................................................................... 2-5
2.2.3 AMX Seed Rate ....................................................................................... 2-5
2.2.4 SRT Information ...................................................................................... 2-6
2.2.5 Carbon Availability.................................................................................. 2-7
2.3 Experimental Setup and Methodology................................................................. 2-8
2.3.1 Sampling, Sample Processing, and Sample Coding ................................ 2-8
2.3.2 Ex Situ Tests ............................................................................................ 2-9
2.3.3 Method Development and Evaluation for the Quantification of
Active AMX Biomass .............................................................................. 2-9
2.4 Results and Discussion ...................................................................................... 2-21
2.4.1 Operational Performance of Strass WWTP ........................................... 2-21
2.4.2 NOB Repression – Activity Measurements and Ko Determination ...... 2-24
2.4.3 MX Bioaugmentation and Retention Efficiency (Particle Tracking) .... 2-29
2.4.4 Molecular Analysis ................................................................................ 2-39
2.4.5 Greenhouse Gas Emissions (NO and N2O as Intermediate Products
in N-Removal) ....................................................................................... 2-47
Mainstream Deammonification ix
3.0 Dual-Stage Mainstream Deammonification Without Bioaugmenation –
Full-Plant Deammonification for Energy Positive Nitrogen Removal Chesapeake-
Elizabeth Nutrient Removal Pilot Study...................................................................... 3-1
3.1 Material and Methods .......................................................................................... 3-3
3.1.1 Preliminary Treatment ............................................................................. 3-3
3.1.2 A-Stage High-Rate Activated Sludge Process (HRAS)........................... 3-3
3.1.3 B-Stage AVN ........................................................................................... 3-4
3.1.4 B-Stage AVN CSTR with Anammox MBBR ......................................... 3-6
3.1.5 Microbial Activity Measurements ........................................................... 3-9
3.1.6 Molecular Sampling and Analysis ........................................................... 3-9
3.2 Results ................................................................................................................ 3-11
3.2.1 A-Stage High Rate Activated Sludge .................................................... 3-11
3.2.2 B-Stage AVN ......................................................................................... 3-19
3.2.3 B-Stage AVN CSTR with Anammox MBBR ....................................... 3-24
3.3 Discussion .......................................................................................................... 3-37
3.3.1 A-Stage High-Rate Activated Sludge Process ....................................... 3-37
3.3.2 B-Stage AVN ......................................................................................... 3-37
3.4 Conclusions ........................................................................................................ 3-46
3.4.1 A-Stage High-Rate Activated Sludge Process (HRAS)......................... 3-46
3.4.2 B-Stage AVN ......................................................................................... 3-46
3.4.4 Anammox MBBR .................................................................................. 3-47
4.0 Process Modeling ........................................................................................................... 4-1

4.1 Process Units Modeling and Conceptual Model Configuration Setups............... 4-1
4.1.1 Conceptual Model Configuration Setup .................................................. 4-1
4.2 Bio-Kinetic Model – Structure and Formulation ................................................. 4-4
4.2.1 Plant-Wide Model – Two-Step Nitrification/Denitrification Model ....... 4-4
4.2.2 GHG Model – Four-Step Nitrification/Denitrification Model................. 4-8
4.3 Key Model Parameter Measurements and Calibration ........................................ 4-9
4.3.1 Key Model Parameters – Significance to Operation Strategies ............... 4-9
4.3.2 Key Model Parameters – Calibration ..................................................... 4-10
4.3.3 Dissolved Oxygen Half Saturation Concentrations for AOB and NOB
Growth (KO,AOB; KO,NOB) and Oxygen Inhibition Half Saturation
Concentration for Anammox Growth (KiO,AMX) .................................... 4-10
4.4 Simulation Studies and Evaluations................................................................... 4-15
4.4.1 Energy Balances – A Comparison Between Conventional Mainstream
Nitrogen Removal Process Nitrification/Denitrification,
Nitrite Shunt, and Deammonification .................................................... 4-15
4.4.2 AVN versus Ammonia-Based Control Simulation Evaluation ............. 4-18
4.4.3 NOB Out-Selection Mechanisms ........................................................... 4-20
4.4.4 Anammox Enrichment Simulation Evaluation ...................................... 4-27
x
5.0 Concept Studies .............................................................................................................. 5-1
5.1 Recipe for Suspended Growth Short-Cut Nitrogen Removal .............................. 5-1
5.2 Process Control .................................................................................................... 5-2
5.3 Considerations for Implementing Short-Cut Nitrogen Removal or
Mainstream Deammonification ........................................................................... 5-2
5.3.1 Operating Costs ........................................................................................ 5-2
5.3.2 Effluent Criteria ....................................................................................... 5-2
5.3.3 Sludge Treatment ..................................................................................... 5-2
5.3.4 C/N at Different Points in Treatment ....................................................... 5-3
5.3.5 Technological Approaches....................................................................... 5-3
5.3.6 Equipment Requirements ......................................................................... 5-3
5.4 Decision Matrix for Control/Approach ................................................................ 5-4
5.5 Concept Studies ................................................................................................... 5-5
5.5.1 HRSD Chesapeake Elizabeth ................................................................... 5-5
5.5.2 DC Water Blue Plains ............................................................................ 5-13
5.5.3 H.L. Mooney AWRF ............................................................................. 5-24
5.5.4 Robert W. Hite Treatment Facility ........................................................ 5-36
5.5.5 Egan WRP .............................................................................................. 5-47
5.5.6 McDowell Creek WWTP ....................................................................... 5-58
5.5.7 Sacramento Regional WTP .................................................................... 5-72
5.5.8 Howard F. Curren AWTP ...................................................................... 5-83
5.5.9 Danbury WPCP ...................................................................................... 5-90
5.6 Summary ............................................................................................................ 5-96
5.7 General Conclusions .......................................................................................... 5-96
References ....................................................................................................................................R-1
Mainstream Deammonification xi
LIST OF TABLES
ES- 1Decision Matrix for Implementing Short-Cut Nitrogen Removal .................................ES-5

1-1 Deammonification SBR Cycle ......................................................................................... 1-6
1-2 SBR A Operational Changes ........................................................................................... 1-7
1-3 SBR B Operational Changes ............................................................................................ 1-7
1-4 SBRs Operating Parameters During 2011-2012 ............................................................ 1-10
1-5 A List of Key Analyses During the Deammonification SBRs In Situ Tests ................. 1-15
1-6 Summary of Experimental Sampling and Analytical Procedures for the
SBR Testing at Blue Plains ............................................................................................ 1-16
1-7 AMX qPCR Results for the Five Tests .......................................................................... 1-22
2-1 Operational Modes and Phases at the Strass Pilot ........................................................... 2-3
2-2 Sampling Plan at the Strass WWTP (Austria) ................................................................. 2-3
2-3 Sampling Types at the Strass WWTP .............................................................................. 2-8
2-4 Dilution Factors Used for the Image Analysis According to Sampling Type ............... 2-12
2-5 Selected Granules Size Categories of the Image Analysis ............................................ 2-15
2-6 Primer Sequences used for the AMX Group ................................................................. 2-18
2-7 Summary of Sample Distinction by Different Methods, Compared to Expected Results
for the Six Investigated Sample Types .......................................................................... 2-19
2-8 Summary of the Used Techniques and Their Suitability for AMX Quantification ....... 2-20
2-9 Correlation of AMX Quantification Results Between Each Tested
Method for All Sample Types........................................................................................ 2-21
2-10 Example of the Activity Measurements at Strass WWTP (Sampling Event #12)......... 2-24
3-1 Comparison of Main Features of Ammonia-Based Aeration Control,
AVN (NH4) Control, and AVN (NH4-NOx) Aeration Control ...................................... 3-8
3-2 Average Raw Influent and A-Stage Effluent Characteristics ........................................ 3-11
3-3 Average Influent and Effluent COD Fractions .............................................................. 3-12
3-4 Average Characteristics of AVN CSTR Influent (A-Stage Effluent)
and Effluent Over the Entire Experimental Period ........................................................ 3-24
3-5 Comparison of Performance and Strategies Used by Recent Studies to
Achieve NOB Out-Selection in Mainstream Conditions ............................................... 3-40
4-1 AOB and AMX Seed Estimation ..................................................................................... 4-3
4-2 Components Relevant to Mainstream Deammonification in Sumo2 .............................. 4-6
4-3 Reactions Relevant to Mainstream Deammonification ................................................... 4-7
4-4 List of State Variables for the SUMO-N Model Including GHG Emissions .................. 4-8
4-5 Rate Expressions Used in the Sumo-N Model to Describe the Kinetics
for NO and N2O Production by AOB.............................................................................. 4-9
4-6 Autotrophic Biomass Parameters in the Two-Step Nitrification/Denitrification Model.. 4-10
4-7 Parameters Used in the GHG Model in Sumo-N for the Strass Case Study.................. 4-13
4-8 Three Different Process Scenarios Including Feasible Carbon Redirection .................. 4-16
4-9 Comparison Between AVN and Ammonia-Based Control Strategies in
Terms of Total Nitrogen Removal, Oxygen Demand, and NOB Suppression
for Simulated HRSD Pilot Reactor ................................................................................ 4-19
4-10 Impact of Selective Retention and Tank Depth on NOB Out-Selection ....................... 4-25
4-11 Evaluation of Individual Impact Factors on Anammox Accumulation ......................... 4-27
5-1 Decision Matrix for Implementing Short-Cut Nitrogen Removal ................................... 5-4
xii
5-2 List of Case Studies ......................................................................................................... 5-5
5-3 CETP NPDES Permit Requirements ............................................................................... 5-7
5-4 James River Bubble Permit Mass Limits ......................................................................... 5-7
5-5 Wastewater Composition for CETP................................................................................. 5-8
5-6 Process Design Elements ................................................................................................. 5-9
5-7 Equipment Requirements ............................................................................................... 5-10
5-8 NPDES Permit Limits for Blue Plains AWTP .............................................................. 5-15
5-9 Blue Plains AWTP Average Discharge Concentrations for 2011 ................................. 5-15
5-10 Wastewater Composition (Based on 2005, 2006, and 2008 Data) ................................ 5-17
5-11 Process Design Elements ............................................................................................... 5-18
5-13 Current VPDES Permit Limits for HLM AWRF .......................................................... 5-26
5-14 Wastewater Composition (2013 Data) ........................................................................... 5-27
5-16 Option 1 Equipment Requirements ................................................................................ 5-30
5-18 RWHTF NPDES Permit Requirements ......................................................................... 5-39
5-19 RHWTF Water Quality Criteria..................................................................................... 5-40
5-20 Wastewater Composition (Plant Design Data) .............................................................. 5-41
5-23 Current NPDES Permit Limits for Egan WRP .............................................................. 5-50
5-28 Current NPDES Permit Limits for McDowell Creek WWTP ....................................... 5-61
5-29 Wastewater Composition (Plant Design Data) .............................................................. 5-62
5-34 New NPDES Permit Limits for SRCSD (Effective December 2020) ........................... 5-76
5-35 Wastewater Composition (2013 Facilities Planning) .................................................... 5-77
5-36 Process Design Elements for SRCSD ............................................................................ 5-78
5-38 FDEP Permit Limits for Howard F Curren AWTP ....................................................... 5-84
5-39 HCAWTP Average Discharge Concentrations for 2011 ............................................... 5-85
5-40 Wastewater Composition ............................................................................................... 5-85
5-43 Current NPDES Permit Limits for Danbury WPCP ...................................................... 5-92
5-47 List of Case Studies ....................................................................................................... 5-96
Mainstream Deammonification xiii

LIST OF FIGURES
1-1 Blue Plains AWTP A-B Flowsheet with Deammonification .......................................... 1-1
1-2 Deammonification System Key Components .................................................................. 1-2
1-3 Deammonification SBR Experimental Setup .................................................................. 1-4
1-4 Plan View of the Deammonification SBR Cover and Ports ............................................ 1-5
1-5 Aeration Regimes Schematics ......................................................................................... 1-8
1-6 Centrifuge Protocol for Anammox Retention ................................................................ 1-12
1-7 Sieve Protocol for Anammox Retention ........................................................................ 1-12
1-8 SBRs Feed UV Disinfection Performance ..................................................................... 1-13
1-9 DO/ORP and pH Meters ................................................................................................ 1-14
1-10 Typical Profile During Normal SBR Cycle ................................................................... 1-17
1-11 Typical Profile During an AMX Activity Test .............................................................. 1-18
1-12 Typical Results from a Constant DO Test for Ko Determination ................................. 1-19
1-13 Typical Results from a Declining DO Test for Ko Determination ................................ 1-20
1-14 AMX qPCR Results for the Five Tests .......................................................................... 1-23
1-15 Original Volume of Biomass Influenced AMX Quantification ..................................... 1-23
1-16 Correlation between AMX Activity and Deammonification Performance ................... 1-24
1-17 Temperature Sensitivity Test for the Raw AMX Sludge from Strass
Sidestream Treatment .................................................................................................... 1-25
1-18 Impact of Changing AMX Retention Method on Observed AMX Activity –
Phase II (25oC) ............................................................................................................... 1-26
1-19 Impact of Temperature and AMX Enrichment on AMX Activity –
Reactor A (Intermittent Aeration).................................................................................. 1-27
1-20 DO-Half Saturation Parameter (Ko) Testing Results – Phase I (15°C) ......................... 1-28
1-21 Intermittent Aeration versus Constant DO – Phase II (25oC) ........................................ 1-29
1-22 Specific Nitrogen Process Rates in Terms of Ammonia Removal per g VSS
and Day Depending on the DO Level During Applied “Constant DO Tests”............... 1-29
1-23 Comparison of Ko Values of Total Nitrifiers (AOB+NOB) and NOB ......................... 1-30
1-24 Nitrogen Concentration Profiles in the SBR A During Constant Low DO
Operation, Intermittent Low DO Operation, and Intermittent High DO Operation ...... 1-31
1-25 AOB and NOB Monod Growth Rate Functions of NH4 and NO2 Concentrations ....... 1-32
1-26 SBR Ammonia, Nitrate, and Nitrite Profiles During 1 Reaction Cycle with
High Ammonia Residual................................................................................................ 1-33
1-27 SBR Ammonia, Nitrate, and Nitrite Profiles During 1 Reaction Cycle
with No Ammonia Residual........................................................................................... 1-33
2-1 Cyclones Installed at the B-Stage in Strass...................................................................... 2-2
2-2 Carousel Type Aeration Tank at Strass WWTP Providing a DO Range of 000
to 055 mg/L along the Flow Path at Parallel Tank Operation ......................................... 2-3
2-3 Origin of the AMX Seed, the SBR Demon® Tank at the Strass WWTP (Austria) .......... 2-4
xiv
2-4 Seeding Volumes from the Sidestream Demon® Tank to the Mainstream
B-Stage (m³/d) Since the Beginning of the Sampling Campaign .................................... 2-5
2-5 Total SRT in the B-Stage at Strass During the First Project Year ................................... 2-6
2-6 COD Removal Efficiency of the A-Stage and Available COD Concentration
at the Influent to the B-Stage ........................................................................................... 2-7
2-7 Cyclone Fractions and Tanks that Were Sampled at Strass WWTP (Austria) ................ 2-8
2-8 Experimental Design of the Method Evaluation Approach, Depicting the
Six Different Sample Types (SL; SL-OF; SL-UF; B; B;OF; B-UF) and
Methodological Approaches Used in this Study.............................................................. 2-9
2-9 Setup for Ex Situ Anammox Activity Tests in the Lab (right) and an
Example of a Measured Removal of N-Compounds (left) ............................................ 2-11
2-10 Setup for Ex Situ AOB-Activity Tests in the Lab (right) and an
Example of a Measured OUR (left) ............................................................................... 2-11
2-11 Splitting the Scanned Image into the Three Channels (Red, Green, and Blue) ............. 2-13
2-12 Adjusting the Threshold to Target Only the Granule Fraction in the Image ................. 2-14
2-13 Showing the Outline of Each Granule, Including the Area Information that is
Exported to Excel ........................................................................................................... 2-14
2-14 Optimization of the Granule Volume Calculation from an Initial Sphere
to a Cylinder Model ....................................................................................................... 2-15
2-15 Non-Metric Multidimensional Scaling Ordination of Anammox/AnAOB Biomass
Quantification for All Six Sample Types (SL, SL-OF, SL-UF, B, B-OF and B-UF) ...... 2-19
2-16 Daily Nitrogen Effluent Concentration with Nitrite Level Indicating the Two
Most Successful Operation Modes for NOBRepression ............................................... 2-21
2-17 Comparison of this Year’s and Last Year’s Operational Data of the
Full-Scale Pilot Strass Indicating Advanced NOB Repression ..................................... 2-22
2-18 Plant Loading Profiles (PE) and MLSS (TSS) .............................................................. 2-22
2-19 Sludge Volume Index (SVI) Profiles (mL/g) and Temperature (°C) ............................ 2-22
2-20 Specific Energy Demand for Nitrogen Removal ........................................................... 2-23
2-21 Production and Depletion Rates of NH4-N, NO2-N and NO3-N During
Anaerobic Incubation of B-Samples at 20°C ................................................................. 2-25
Anaerobic Incubation of B-Samples at 30°C ................................................................. 2-25
Aerobic Incubation of B-Samples at 20°C .................................................................... 2-26
Aerobic Incubation of B-Samples at 30°C .................................................................... 2-26
2-25 Temperature Impact on Maximum Growth Rates of Nitrifiers (in mg N/L/d)
Calculated from Measured DO Depletion Profiles of Mainstream Mixed Liquor
Samples at 20°C and 30°C ............................................................................................. 2-27
2-26 Temperature Impact on Nitrifier DO Half Saturation Coefficients (Ko, mg O2/L)
Calculated from Measured DO Depletion Profiles of Mainstream Mixed Liquor
Samples at 20°C and 30°C ............................................................................................. 2-28
Mainstream Deammonification xv
2-27 Comparison of Maximum Growth Rates (left) and DO Half Saturation Ko (right)
of Total Nitrifiers (AOB+NOB) and NOB Only Calculated from Measured DO
Depletion Profiles of Mainstream Mixed Liquor Samples at 20°C and 30°C ............... 2-28
2-28 Evolution of the Anammox Biomass in the Mainstream (B) from Sampling
One to Twelve – Distribution of Granule Size Fraction ................................................ 2-29
One to Twelve – Abundance of Granules/mL ............................................................... 2-30
One to Twelve – Estimated Granule Volume/mL ......................................................... 2-31
2-31 Evolution of the AMX Biomass of the Mainstream Cyclone Overflow
Fraction (B-OF) from Sampling One to Twelve............................................................ 2-31
2-32 Evolution of the Anammox Biomass of the Mainstream Cyclone Underflow
Fraction (B-UF) from Sampling One to Twelve............................................................ 2-32
2-33 Evolution of the AMX Biomass of the Sidestream Process Water Tank (PW) from
Sampling One to Twelve ............................................................................................... 2-32
2-34 Comparison of Sidestream (PW) Total Solids (TS) and Total Granule
Volume in PW-Samples over the Sampling Period ....................................................... 2-33
2-35 Evolution of the AMX Biomass of the Sidestream Cyclone Overflow
Fraction (PW-OF) from Sampling One to Twelve ........................................................ 2-34
2-36 Evolution of the AMX Biomass of the Sidestream Cyclone Underflow
Fraction (PW-UF) from Sampling One to Twelve ........................................................ 2-34
2-37 Granule Volume [µL/mL] of all Three B-Sample Types (Strass WWTP) .................... 2-35
2-38 Granule Volume of all Three B-Sample Types (Strass WWTP) Denoted as % of
the Total TS.................................................................................................................... 2-35
2-39 Granule Volume [µL/mL] of all Three PW-Sample Types (Strass WWTP) ................ 2-36
2-40 Granule Volume of all Three B-Sample Types (Strass WWTP) Denoted as % of
the Total TS.................................................................................................................... 2-36
2-41 Comparison of Seeding Rate of Anammox Biomass from the SBR to the
Mainstream to the Granule Abundance in the Mainstream [Granules/mL] .................. 2-37
2-42 Two-Way-ANOVA of the Depth Analysis Including Sampling Depth and
Granule Size as Categorical Predictor (Factor) ............................................................. 2-38
2-43 Abundance of Each Granule Size Fraction Depending on Sampling Depth of
the B-Stage (Surface, 1 m, 3 m and 5 m) ....................................................................... 2-38
2-44 Granule Abundance per mL for each Sampling Depth .................................................. 2-38
2-45 Result of the Quantitative Analysis of AMX, Nitrospira, Nitrobacter, and AOB in
the Mainstream by qPCR Over the Whole Sampling Campaign ................................... 2-39
2-46 Start of NOB Repression After Sampling 12 in the Mainstream; Comparison of
qPCR and Activity Measurement Results...................................................................... 2-40
2-47 Denaturing Gradient Gel Electrophoresis of Amplified Anammox 16S DNA Gene
Fragments of Mainstream Samples B1-B17 Combined with Sidestream Samples
(PW) of Four Sampling Points ....................................................................................... 2-41
2-48 Denaturing Gradient Gel Electrophoresis of Amplified AOB 16S DNA Gene
Fragments of Mainstream Samples B1-B17 Combined with Sidestream Samples
(PW) of Four Sampling Points ....................................................................................... 2-41
xvi
2-49 Denaturing Gradient Gel Electrophoresis of Amplified Nitrobacter 16S DNA
Gene Fragments of Mainstream Samples B1-B17 Combined with Sidestream
Samples (PW) of Four Sampling Points ........................................................................ 2-42
2-50 Light Microscopy (upper left, lower right) and Binocular Loupe Image of
Granules from the Strass WWTP ................................................................................... 2-42
2-51 Fluorescence in Situ Hybridization with the 16S rRNA Gene Targeting
Probe AMX820 .............................................................................................................. 2-43
2-52 Morphology Analysis of a Mainstream Anammox Granule of the Mainstream in
Strass by Scanning Electron Microscopy ...................................................................... 2-43
2-53 Relative Abundance of Brocadia-Clusters in Different DEMON and
Mainstream Samples ...................................................................................................... 2-45
2-54 Setup of GHG Measurement Equipment During a WERF Project Meeting at
Strass WWTP ................................................................................................................. 2-46
2-55 GHG Emissions in the B-Stage, Nitrification, Aerated Zone (First Campaign) ........... 2-47
2-56 GHG Emissions in the B-Stage, Mainstream Demon, Aerated Zone
(Second Campaign)........................................................................................................ 2-47
3-1 HRSD A-B Pilot Process Flow Diagram (Pilot 10) ......................................................... 3-2
3-2 HRSD A-B Pilot Process Flow Diagram (Pilot 20) ......................................................... 3-3
3-3 A) Graphic Representation of the Control Logic of Ammonia-Based Intermittent
Aeration Control; B) Graphic Representation of ON/OFF DO Controller During
One Cycle......................................................................................................................... 3-6
3-4 A) Graphic Representation of the Logic of AVN Aeration Control; B) Graphic
Representation of ON/OFF Control During One Cycle and PID DO Control
During Aerobic Duration ................................................................................................. 3-8
3-5 Influent COD ................................................................................................................. 3-11
3-6 Average COD Fractions of the Influent and Effluent .................................................... 3-13
3-7 Impact of Aerobic SRT on the Total COD and sCOD Removal
Efficiencies of the A-Stage ............................................................................................ 3-14
3-8 Impact of Aerobic SRT on the Particulate COD Removal Efficiency of the
A-Stage .......................................................................................................................... 3-15
3-9 Impact of Aerobic SRT on the Colloidal COD Removal Efficiency of the A-Stage .... 3-15
3-10 Average COD Mass Balance ......................................................................................... 3-16
3-11 Impact of Aerobic SRT on the Readily Biodegradable COD Removal
Efficiency of the A-Stage............................................................................................... 3-16
3-12 Example Off-Gas Composition Results ......................................................................... 3-17
3-13 Effect of Influent Temperature on SVI .......................................................................... 3-18
3-14 Trends of A) Influent NH4+-N, Effluent NH4+-N and NOx-N B) NAR and Total
SRT ................................................................................................................................ 3-19
3-15 Trends of A) Influent COD/NH4+-N Ratio and TIN Removal Rate; B) MLSS
and COD Removal Rate................................................................................................. 3-20
3-16 Correlation Between TIN Removal Efficiency and Influent COD/NH4+-N: (A),
Maximum AOB Rates (B), Maximum AOB/NOB Rates Ratio (C) .............................. 3-21
3-17 Comparison of TIN Removal Efficiency with Influent COD/NH4+-N and
NAR at IMLR 0% (n=87), IMLR 100-300% (n=114), IMLR 400% (n=165) .............. 3-22
Mainstream Deammonification xvii

3-18 Trends of Microbial Populations (AOB, NOB and Total Bacteria) Presented as
Copies of DNA per mL of Sample from Targeted qPCR (A) and Weekly AOB
and NOB Activities (B) ................................................................................................. 3-23
3-19 AVN CSTR: A) Influent NH4+-N, Effluent NH4+-N and NOx-N; B) Influent
NH4+-N Loading, COD Removal Rate and TIN Removal Rate; and C) NAR and
Aerobic Fraction ............................................................................................................ 3-25
3-20 AVN Controller Performance ........................................................................................ 3-26
3-21 Different Phases of the Study Showing Variability and Relationship Between
A) Influent COD/NH4+-N, TIN Removal Efficiency and TIN Removal Rate/COD
Removal Rate ................................................................................................................. 3-27
3-22 Trends of Microbial Populations (AOB, NOB and Total Bacteria) Presented
as Copies of DNA per mL of Sample from Targeted qPCR (A) and Weekly
Maximum AOB and NOB Activities (B) ...................................................................... 3-28
3-23 Correlation Between A) amoA Abundance and Maximum AOB Rates
(Weekly Averages); B) Nitrospira sp Abundance and Maximum NOB Rates
(Weekly Averages); C) Different Phases of the Study Showing Variability and
Relationship Between NLR/Max AOB Rate Ratio and NAR ....................................... 3-29
3-24 Seasonal Variation in SVI, Nitrite Levels and Temperature During the
Entire Study ................................................................................................................... 3-31
3-25 Temporal Trends During the Study: A) NH4+-N, NO2--N, and NO3--N Removal
Rate; B) COD Removal Rate, Ratio of NO2--N Removal Rate to NH4+-N
Removal Rate, and NOx-N Removal Rate: NH4+-N Removal Rate .............................. 3-32
3-26 Temporal Trends During the Study: A) Influent NH4+-N, NO2--N, and
NO3--N, B) Effluent NH4+-N, NO2--N, and NO3-N ....................................................... 3-33
3-27 A) Trends of the TIN Removal Rate and the Maximum AMX Activity
(Phase I and Phase II) B) NO2--N Loading Rate Compared to the NO2--N Removal
Rate During Phase II at Influent NH4+-N Concentration of 26±25 mg N/L .................... 3-34
3-28 Maximum AMX Activity Test Results: A) During Phase II on Day 366;
B) During Phase I on Day 136 ....................................................................................... 3-35
3-29 Temporal Trends of A) Maximum NH4+-N, NO2--N Removal Rate and
NO3--N Production Rate During Weekly Maximum AMX Activity Test; B) AMX
Stoichiometric Ratio of NO2--N Removal Rate: NH4+-N Removal Rate and NO3--
N Production Rate to NH4+-N Removal Rate ................................................................ 3-36
3-30 Dissolved Oxygen Monod Curves for AOB (Model: Ko = 116 mg O2/L,
rmax = 5763 mg N/L/d) and NOB (Model: Ko = 016 mg O2/L, rmax = 2546 mg
N/L/d) Showing that NOB are Well Adapted at Low DO Compared to AOB .............. 3-42
3-31 Abundances of AMX Species Identified During Phase II of the Study
(Day: 358, 372, and 385) ............................................................................................... 3-45
4-1 Idealized Whole Plant Flowsheet..................................................................................... 4-2
4-2 Conceptualized AOB and Anammox Seeding ................................................................. 4-2
4-3 Monod Expressions Describing Rate and Substrate Affinities and Competition
Under Pilot Target Operational Conditions for NH4+-N, NO2--N and DO ...................... 4-9
4-4 Model Output versus Data for Three Aeration Regimes ............................................... 4-11
4-5 Configuration of the Strass Mainstream Deammonification Process in Sumo.............. 4-13
xviii
4-6 Modeled versus Observed N2O Emission at Increasing DO Setpoints and
Subsequently Higher Nitrite Accumulation ................................................................... 4-14
4-7 Conceptual WWTP Configuration Used for the Three Scenarios ................................. 4-15
4-8 Simulated Biomass Compositions in the Mixed Liquor for All Three Scenarios ......... 4-17
4-9 Simulated Effluent Inorganic Nitrogen Fraction for All Three Process Options .......... 4-17
4-10 Three Operating Modes: Comparison of Energy Use Indicated by Specific
OUR and Potential for Energy Recovery from Sludge Production as COD ................. 4-17
4-11 Simulation Output for AVN (top) and Ammonia-Based (bottom) Controls for
B-Stage Pilot Reactor at HRSD with 12-Minute Cycle ................................................. 4-19
4-12 Simulated NOB Growth Lag Based on Nitrite Availability .......................................... 4-20
4-13 SBRs In Situ Nitrogen Profiles at COD/N=15 and COD/N=46 under 45 min
Aeration Cycle Frequency (left charts) and Under 15 in Aeration Cycle Frequency .... 4-21
4-14 Simulated Impact of Transient Anoxia Frequency on NOB Out-Selection .................. 4-22
4-15 Bio-Augmentation versus SRT Conceptual Model ....................................................... 4-22
4-16 Simulation of HRSD Pilot Reactor with AVN Control Showing 100% and 50%
Seed Mass Rates and SRT Variation ............................................................................. 4-23
4-17 Simulation and Measured Profile of the DC Water Pilot Reactor ................................. 4-24
4-18 Mainstream Pilot Reactor Effluent Quality ................................................................... 4-25
4-19 Simulated Impact of Biodegradable COD on NOB Out-Selection ............................... 4-26
4-20 Configuration of Two Independent Mainstream Liquid Lanes in Glarnerland, Lane 2
with Anammox Accumulation by Seeding from the Sidestream and by the Cyclone........ 4-27
5-1 CETP Aerial View ........................................................................................................... 5-6
5-2 CETP Simplified Flow Schematic ................................................................................... 5-6
5-3 CETP AVN/Mainstream Deammonification Reactors .................................................. 5-10
5-4 Plan Schematic for CETP Upgrade................................................................................ 5-11
5-5 CETP Operating Cost Comparison ................................................................................ 5-12
5-6 Process Schematic for Blue Plains ................................................................................. 5-14
5-7 Aerial Photo of the Blue Plains Advanced Wastewater Treatment Facility with
Simplified Process Flow Description............................................................................. 5-14
5-8 Option 2 Proposed Flow Schematic............................................................................... 5-21
5-9 Option 2 Proposed Reactor Modifications ..................................................................... 5-21
5-10 Spatially Sequenced Aeration Schematic with Step-Feed Capability to
Multiple Zones ............................................................................................................... 5-22
5-11 Comparison of Potential Operating Costs of Nit/Denit versus Nitrite Shunt
versus Deammonification .............................................................................................. 5-22
5-12 Step-Wise Approach Towards Progressively Implementing
Mainstream Deammonification ..................................................................................... 5-23
5-13 Process Schematic for H L Mooney AWRF .................................................................. 5-25
5-14 Aerial Photo ................................................................................................................... 5-25
5-15 HLM AWRF ABAC Reactors ....................................................................................... 5-29
5-16 HLM AWRF Single-Stage AVN/Mainstream Deammonification Reactor .................. 5-31
5-17 HLM AWRF Dual-Stage AVN Reactor/Anammox Filters ........................................... 5-31
Mainstream Deammonification xix

5-18 Plan View Schematic for Option 1 (ABAC).................................................................. 5-32
5-19 Plan Schematic for Option 2 (Single-Stage Deammonification) ................................... 5-33
5-20 HLM AWRF Comparison of Potential Operating Costs of Nit/Denit
versus Nitrite Shunt versus Deammonification ............................................................. 5-34
5-21 RWHTF Aerial View ..................................................................................................... 5-36
5-22 RWHTF Simplified Flow Schematic ............................................................................. 5-37
5-23 RWHTF AVN/Mainstream Deammonification Reactors .............................................. 5-43
5-24 RHWTF Regulation 85 Operating Cost Comparison .................................................... 5-45
5-25 RHWTF Regulation 31 Operating Cost Comparison .................................................... 5-46
5-26 Process Schematic for Egan WRP ................................................................................. 5-48
5-27 Aerial Photo ................................................................................................................... 5-49
5-28 Aerial Photo (Aeration Basin Detail Including Flow Directions) ................................. 5-49
5-29 Monthly Temperatures and Seasonal Ammonia Limits ................................................ 5-50
5-32 Aerial Photo for Option 1 (North Battery Detail) .......................................................... 5-55
5-33 Aerial Photo for Option 2 (North Battery Detail) .......................................................... 5-55
5-34 Comparison of Potential Operating Costs of Nit/Denit versus Nitrite Shunt versus
Deammonification.......................................................................................................... 5-56
5-35 Process Schematic for McDowell Creek WWTP .......................................................... 5-58
5-36 Plant Overview Photo of McDowell Creek WWTP ...................................................... 5-59
5-37 Aerial Photo of McDowell BNR Basins and Secondary Clarifiers ............................... 5-60
5-38 Option 2 Proposed Flow Schematic for BTB-1 and 2 ................................................... 5-66
5-39 Option 2 Proposed Flow Schematic for BTB-3 and 4 ................................................... 5-66
5-41 Photograph of Filtrate Equalization Basin for Option 1 ................................................ 5-69
5-42 Aerial Photo for Option 2 (BTB-1 and 2 Detail) ........................................................... 5-69
5-43 Aerial and Site Overview Photos for Option 2 (BTB-3 and 4 Detail) ........................... 5-69
5-45 Process Schematic for Sacramento Regional Wastewater Treatment Plant (SRWTP).... 5-73
5-46 Aerial Photo (Current Plant) .......................................................................................... 5-74
5-47 Aerial Photo (Planned for 2020) .................................................................................... 5-75
5-48 Biological Nutrient Removal Process Schematic .......................................................... 5-75
5-49 Biological Nutrient Removal Process Layout................................................................ 5-76
5-50 Proposed Deammonication Flow Schematic for AVN .................................................. 5-80
5-52 Process Schematic of the Howard F Curren Advanced Wastewater Treatment Plant ..... 5-83
5-53 Aerial Photo of the Howard F Curren Advanced Wastewater Treatment Plant with
Simplified Process Flow Description............................................................................. 5-84
5-54 Process Schematic of Upgrade....................................................................................... 5-88
xx
5-56 Process Schematic for Danbury WPCP ......................................................................... 5-91
5-57 Aerial Photo ................................................................................................................... 5-91
5-58 Proposed Flow Schematic .............................................................................................. 5-93
5-59 Aerial Photo of Nitrification Tanks Showing Proposed Modifications ......................... 5-94
5-60 Comparison of Potential Operating Costs of Nit/Denit, Nitrite Shunt versus
Mainstream Deammonification xxi

LIST OF ABBREVIATIONS
µm micrometers
AADF average annual daily flow
A-B adsorption/bio-oxidation
AB aeration basins
ABAC ammonia-based aeration control
ADWF average dry weather flow
aHRT aeration duration
AM activity measurements
amoA monooxygenase subunit A
AMX anaerobic ammonium oxidization/oxidizing
anammox anaerobic ammonium oxidization/oxidizing
AnAOB anaerobic ammonium oxidizing population
ANOVA analysis of variation
AOA ammonia oxidizing archea
AOB ammonia oxidizing bacteria/biomass
AOO ammonia oxidizing organisms
aSRT aerobic solids retention time
AU absorption units
AVN ammonia oxidizing bacteria (AOB) versus nitrite oxidizing biomass (NOB)
AWTP Advanced Wastewater Treatment Plant
B B-stage mainstream
BAF biological aerated filters
BFP belt filter presses
BNR biological nitrogen removal
B-OF B-stage mainstream cyclone overflow
BPSA Blue Plains Service Area
BRF Biosolids Recycling Facility
BTB Biological Treatment Basins
B-UF B-stage mainstream cyclone underflow
C/N COD:TN
CAC chemical oxygen demand (COD) adsorption capacity
CAS conventional activated sludge
cBOD carbonaceous biochemical oxygen demand
CC Coulter counter analysis
cDNA complementary deoxyribonucleic acid
CDPH California Department of Public Health
xxii
CDPH Colorado Department of Public Health
CEL Central Environmental Laboratory
CEPT chemically enhanced primary treatment
CETP Chesapeake-Elizabeth Treatment Plant
cm centimeter
CMU Charlotte-Mecklenburg Utilities
COD chemical oxygen demand
CSO combined sewer overflow
CSTR continuous stirred tank reactor
DC District of Columbia
DEEP (Connecticut) Department of Energy and Environmental Protect
DEMON Deammonification process
DGGE Denaturing gradient gel electrophoresis
DNA deoxyribonucleic acid
DO dissolved oxygen
dpi dots per inch
E. coli Escherichia coli
EBPR enhanced biological phosphorus removal
EPS extracellular polymeric substances
ESS effluent suspended solids
FA free ammonia
FBI Fluidized Bed Incinerator
FDEP Florida Department of Environmental Protection
ffCOD filtered flocculated chemical oxygen demand
FISH Fluorescence in Situ Hybridization
FNE final effluent
g/L grams per liter
g/mol grams per mole
GA gravimetric analysis
GHG greenhouse gas
gpm gallons per minute
HFCAWTP Howard F. Curren Advanced Wastewater Treatment Plant
HiPOS high-purity oxygen system
HLM AWRF H.L. Mooney Advanced Water Reclamation Facility
HPO high purity oxygen
HQ heme protein quantification
hr(s) hour(s)
HRAS high-rate activated sludge
HRSD Hampton Road Sanitation District
Mainstream Deammonification xxiii

HRT hydraulic retention time
Hz hertz
HZO hydrazine oxidoreductase
hzsA hydrazine synthase
ICA instrumentation, control and automation
IFAS integrated fixed-film activated sludge
IMLR internal mixed liquor recycle
ISS inorganic suspended solids
kg kilograms
kg/ m3/d kilograms per cubic meters per day
kg/m2 hr kilograms per square meter per hour
kg/m2 kilograms per square meter
Ko dissolved oxygen half-saturation parameter
L liter
L/cycle liters per cycle
LASMA Lawndale Avenue Solids Management Area
LDO luminescent dissolved oxygen
m meter(s)
M mole
m3 cubic meters
m3/d cubic meters per day
m3/m2 hr cubic meters per square meter per hour
m3/m2 cubic meters per square meter
MBBR moving bed biofilm reactor
MBR membrane bioreactor
MDA mainstream deammonification
MG million gallons
mg/g/hr milligrams per gram per hour
mg/L milligrams per liter
mg/L/d milligrams per liter per day
mg/L/hr milligrams per liter per hour
mg/mg milligrams per milligram
mgd million gallons per day
min minutes
mL milliliter
mL/min milliliters per minute
mL/Wk milliliters per week
MLE Modified Ludzack-Ettinger
MLF mixed liquor fermentation
xxiv
MLR mixed liquor recycle
MLSS mixed liquor suspended solids
MLVSS mixed liquor volatile suspended solids
mm millimeters
mM millimole
MOV mechanically operated valve
MWRDGC Metropolitan Water Reclamation District of Greater Chicago
N.C. not controlled
N/A not applicable
N/DN nitrifying and denitrifying
NACWA National Association of Clean Water Agencies
NAR nitrite accumulation ratio
ng nanogram
NL No Limitation
NLR nitrogen loading rate
nm nanometer
NOB nitrite oxidizing biomass
NPDES National Pollutant Discharge Elimination System
NR not reported
NTU nephelometric turbidity units
O/N overnight
OAV optimum aerobic volume
OCT Optimal Cutting Temperature
OHO ordinary heterotrophic organisms
OP organophosphate
ORP oxidation reduction potential
ortho-P ortho-phosphate
OUR oxygen uptake rate
PAO polyphosphate-accumulating organisms
pCOD particulate chemical oxygen demand
PCR polymerase chain reaction
PE plant loading profiles
PID proportional-integral-derivative
PID proportional-integral-derivative
PLC programmable logic controller
ppm parts per million
PT Particle Tracking
PTF preliminary treatment facility
PVC polyvinylchloride
Mainstream Deammonification xxv

PW process water
PWCSA Prince William County Service Authority
PW-OF process water cyclone overflow
PW-UF process water cyclone underflow
qPCR quantitative polymerase chain reaction
RAS return activated sludge
RBC rotating biological contactor
rbCOD readily biodegradable chemical oxygen demand
rfc relative centrifugal force
RNA ribonucleic acid
RP-HPLC Reversed-phase high performance liquid chromatography
rpm revolutions per minute
RT reverse transcription
RWHTF Robert W. Hite Treatment Facility
RWI raw wastewater influent
s seconds
SBR sequencing batch reactor
SCFA short-chain fatty acids
sCOD soluble chemical oxygen demand
SD standard deviation
SL sludge
SLR solids loading rate
SM Standard Methods
SN/D nitrification/denitrification
SND simultaneous nitrifying and denitrifying
SNRB sidestream nutrient removal basins
SOR surface overflow rate
SRCSD Sacramento Regional County Sanitation District
SRT solids retention time
SRWTP Sacramento Regional Wastewater Treatment Plant
SS suspended solids
SSB Sludge Storage Basins
sTKN simplified total kjeldahl nitrogen
sTP soluble total phosphorus
SVI sludge volume index
TAN total ammonia nitrogen
TIN total inorganic nitrogen
TKN total kjeldahl nitrogen
TMDL Total Maximum Daily Load
xxvi
TN total nitrogen
TP total phosphorus
TS total solids
TSS total suspended solids
UASB upflow anaerobic sludge blanket
UCT University of Cape Town
uL microliters
U.S. EPA United States Environmental Protection Agency
UV ultraviolet
V volts
VFA volatile fatty acid(s)
VFD variable frequency drive
VPDES Virginia Pollutant Discharge Elimination System
VSS volatile suspended solids
WAS waste activated sludge
WERF Water Environment Research Foundation
WIP Watershed Implementation Plan
wk week
WPCP Water Pollution Control Plant
WRP Water Reclamation Plant
WWTP Wastewater Treatment Plant
xg centrifugal force (measured as gravity, xg)
Mainstream Deammonification xxvii

xxviii
EXECUTIVE SUMMARY
The objective of this research was to investigate the feasibility of applying the
deammonification concept, which is already highly successful and proven in sidestream
configurations, in the mainstream treatment process. The deammonification process for nitrogen
removal provides a more efficient biological pathway compared to traditional
nitrification/denitrification. The demonstrated advantages of applying deammonification to
mainstream treatment include energy-neutral or even energy-positive wastewater treatment,
reduction of aeration energy, and reduction in external carbon and alkalinity demands.
Implementation of mainstream deammonification is compatible with existing wastewater
infrastructure, often with minimal modifications. The successful application of full-plant
deammonification could save wastewater utilities operations costs for aeration and external
carbon costs in the life cycle. Through demonstration and conceptual application at collaborating
utilities, this research develops an evaluation framework for implementing full-plant
deammonification.
Deammonification is a two-step biological process where ammonia-oxidizing bacteria
(AOB) aerobically convert half of the ammonia present in the wastewater to nitrite. In the second
step, anammox bacteria oxidize the ammonia using nitrite to produce nitrogen gas without the
organic carbon substrate required for conventional heterotrophic denitrification.
Deammonification requires significantly less oxygen and so less energy is needed for nitrogen
removal. Deammonification requires no external carbon addition, eliminating chemical
purchases such as methanol. Process configurations using mainstream deammonification
maximize energy recovery by diverting more particulate organic carbon away from the nitrogen
removal process and directing it toward anaerobic treatment from which methane can be
captured. The implications of deammonification for sustainable, cost effective and energy
positive wastewater treatment are extraordinary.
The report discusses application of short-cut nitrogen removal which includes nitritation-
denitritation, in which ammonia oxidation ends at the intermediate nitrite, with the mainstream
deammonification pathway. Both short-cut nitrogen removal pathways result in savings in
energy, carbon and alkalinity over conventional nitrification-denitrification. To be successful,
short-cut nitrogen removal strategies require maximizing AOB activity, while preventing the
establishment of the nitrite oxidizing bacteria (NOB) that oxidize nitrite to nitrate. This report
introduces and develops concepts for NOB out-selection. To progress from nitritation-
denitritation to deammonification, the AOB activity must be controlled to oxidize only half of
the influent ammonia to nitrite, and a method of retaining the slow-growing anammox bacteria
must be implemented. The report presents a progressive pathway from conventional nitrification-
denitrification to short-cut nitrogen removal and discusses a framework of conditions and drivers
for implementation.
The research concludes that the mainstream deammonification pathway can be achieved.
It is possible for wastewater treatment plants to retrofit to short-cut nitrogen removal utilizing
existing infrastructure, often with minor modifications. The research revealed key site-specific
drivers for applying short-cut nitrogen removal technology. The study of deammonification in
the mainstream and sidestream is a rapidly developing field and readers are encouraged to access
current publications, sources and conference proceedings for advancements in knowledge. More
Mainstream Deammonification ES-1

recent work performed by the project team and others can be found in current publications and
conference proceedings, notably:
 Shortcut Nitrogen Removal – Nitrite Shunt and Deammonification prepared by the Shortcut
Nitrogen Removal Task Force of the Water Environment Federation and published by the
Water Environment Federation in 2015
 Proceedings of the IWA Nutrient Removal and Recovery 2015: Moving Innovation Into
Practice, held May 18-21, 2015 in Gdansk, Poland
ES.1 Report Structure
The report structure is as follows:
 Chapter 1.0 – Pilot-Scale Demonstration at the Blue Plains Advanced Wastewater
Treatment Plant (AWTP) in Washington, D.C.: DC Water conducted pilot testing at the
Blue Plains AWTP site to evaluate a seeded mainstream deammonification process for
possible implementation in their existing treatment process (a separate sludge, B-stage,
nitrification/denitrification process). A single-stage, one-sludge configuration with
bioaugmentation was investigated. Anammox retention by centrifuge and sieve were
demonstrated.
 Chapter 2.0 – Full-Scale Demonstration at the Strass Wastewater Treatment Plant
(WWTP), Austria: The overall flow-sheet of the Strass WWTP is similar to that of the Blue
Plains AWTP, however the Blue Plains AWTP must operate to meet more stringent nutrient
limits of 3 mg/L total nitrogen (TN) and 0.18 mg/L total phosphorus (TP). The full-scale
demonstration verified much of the mechanisms developed in the Blue Plains pilot. The
Strass process has successfully achieved NOB outselection under winter conditions. The
demonstration also focused on maximizing anammox retention and growth. Anammox
retention and granule formation using hydrocyclones was demonstrated. Chapter 2.0 also
presents molecular methods and results.
 Chapter 3.0 – Pilot-Scale Demonstration at the Chesapeake Elizabeth WWTP in
Virginia: Hampton Roads Sanitation District (HRSD) conducted pilot testing to investigate a
mainstream deammonification flow sheet in two or more stages and without
bioaugmentation. A fixed-film option for anammox retention was investigated. A novel
aeration control strategy, Ammonia Versus NOx (AVN), was developed that creates
operating conditions for AOB to outcompete NOB.
 Chapter 4.0 – Process Modeling: Process modeling work was performed using data
collected from the demonstrations to develop model kinetics and coefficients. A model
structure that describes mainstream deammonification and short-cut nitrogen removal was
developed and calibrated values for key model parameters were developed (See Table 4-6).
Notably, dissolved oxygen half-saturation coefficients (Ko) for AOB, NOB were found to
differ from default values with calibrated Ko values for AOB being higher than default (0.4
mg O2/L) and Ko for NOB being lower than default (0.14 mg O2/L) which lead to insight
into strategies for NOB outselection.
 Chapter 5.0 – Concept Studies: The framework developed for implementing short-cut
nitrogen removal is presented here along with concept studies of implementation at nine
diverse wastewater treatment plants which develop and illustrate the framework. These
facilities include: Danbury Water Pollution Control Plant, DC Water Blue Plains, Egan
ES-2
Water Reclamation Plant, Hampton Road Sanitation District, H.L. Mooney Advanced Water
Reclamation Facility, Howard F. Curren Advanced Wastewater Treatment Plant, McDowell
Creek Wastewater Treatment Plant, Robert W. Hite Treatment Facility, Sacramento Regional
Wastewater Treatment Plant. A summary of the framework follows.
ES.2 Framework for Short-Cut Nitrogen Implementation
A fundamental focus of short-cut nitrogen removal is to maximize AOB activity while
preventing NOB from becoming established. Further, to achieve mainstream deammonification,
anammox (AMX) bacteria must also be retained in the system. Multiple operational strategies
are required for NOB out-selection in mainstream treatment, comprising a “recipe” with the
following elements:
1) Residual ammonia (>2 mg/L): Maintaining residual ammonia at all locations within the
aeration tank ensures high AOB activity and continuous dissolved oxygen (DO)
competition for NOB. Facilities with a lower ammonia limit will require a polishing step
to remove ammonia.
2) High operational DO (> 1.5 mg/L): The higher DO not only maintains high AOB rates,
but also manages the relative substrate affinities of AOB and NOB towards NOB
out-selection.
3) Sufficient alkalinity: Insufficient HCO3- can inhibit AOB growth and needs to be avoided
(along with any other potentially inhibitory chemicals or environmental conditions).
4) Chemical oxygen Demand (COD) pressure and transient anoxia: Restrict aeration and
rapidly transition to anoxia at the end of ammonia oxidation such that NOB are deprived
of DO when nitrite is available. COD exerts pressure on NOB by providing competition
for nitrite during the anoxic period.
5) Limiting aerobic solids retention time (SRT): For high ammonia oxidation rates while
washing out pressured NOB. The intent of limiting the SRT of the system was to operate
very close to the AOB washout SRT such that NOB are out-selected. It is very important
to recognize that COD pressure, high DO, and intermittent aeration provide unfavorable
conditions for NOB without adversely affecting the AOB population. However, it is the
ability of the system to be operated at a very low SRT that eliminate NOB over AOB.
6) Bioaugmentation: AMX can be bioaugmented from sidestream deammonification
process, which provides competition in concert with heterotrophs for nitrite with NOB
during anoxia. Similarly, AOB can be bioaugemented from the sidestream
deammonification reactor in the form of the light flocular material in the overflow if
hydrocyclone is used for AMX retention. When AOB is bioaugmented to mainstream
reactor, SRT required to maintain desired ammonia oxidation can be lowered thus
introducing SRT pressure on NOB.
7) Process Control: A critical element in the design of short-cut nitrogen removal is the
process control used to implement the principals of the short-cut nitrogen recipe. Two
control concepts are described here briefly.
 Ammonia-Based Aeration Control (ABAC): ammonia measurements are used to control
aeration, either through adjustment of DO setpoints and/or adjustment of aeration timings.

 Ammonia Versus NOx (AVN) Control: an extension of ABAC to include nitrite
measurement and adjust control set points to maintain an equal balance of ammonia and
nitrite that is amenable for anammox bacteria to carry out deammonification.
ES.3 Considerations for Implementing Short-Cut Nitrogen Removal or Mainstream
Deammonification
Many factors must be considered in deciding whether or not to implement short-cut
nitrogen removal or to attempt mainstream deammonification. The most pertinent factors are
operating costs, effluent criteria and solids treatment technology.
The main driver for considering short-cut nitrogen options is the possibility of reducing
operating costs, including reductions in 1) electricity, 2) carbon, and 3) alkalinity. The extent of
the cost savings depends on the magnitude of existing costs including the unit cost of electricity,
carbon and alkalinity.
Effluent criteria are another important consideration. If a facility is required to meet a low
effluent TN, in addition to likely requiring additional carbon and alkalinity to reach the limits,
the control approach must be sufficiently robust to ensure those limits can be achieved reliably.
The recipe for short-cut nitrogen removal includes the need to maintain a residual ammonia
concentration of approximately 2 mg/L and so a facility with a stringent ammonia limit may
require a polishing step to remove ammonia.
A positive consideration for implementing mainstream deammonification is the presence
of ammonia-rich sidestreams from anaerobic digestion. If a sidestream is available, then
sidestream deammonification can reduce plant nitrogen loads and also provide seed material to
augment deammonification in the mainstream. This is especially useful when operating the
mainstream at a marginal SRT to put stress on NOBs.
COD:TN (C/N) at Different Points in Treatment
Through the course of the research, the carbon to nitrogen ratio has emerged as a key
metric for short-cut nitrogen removal. If the influent contains excess carbon (high C/N) to
denitrify all nitrate produced in complete nitrification to meet the effluent limits for nitrate or
TN, then there is no carbon driver to use short cut processes, and energy and reduction is the
main driver for cost savings. If carbon is limited, then a nitrite shunt coupled with heterotrophic
denitritation becomes an attractive proposition to alleviate the need for additional carbon. If the
C/N ratio is still lower, then a process that incorporates partial or full deammonification becomes
increasingly more viable.
Technological Approaches
Several technologies can be considered for short-cut nitrogen including suspended
growth systems, attached growth [moving bed biofilm reactor (MBBR), rotating biological
contactor (RBC), or biological aerated filters (BAF)], integrated fixed-film activated sludge
(IFAS) or granular activated sludge. The choice of technology depends on several
considerations. In the concept studies, the main consideration is the ability to fit the treatment
approach in with existing process trains and technology in order to maximize the use of existing
infrastructure and minimize capital costs.
ES-4
Equipment Requirements
An important consideration in moving from lab and pilot scale testing of short-cut
nitrogen processes are the requirements for specific equipment. Granule retention is a significant
consideration for deammonification processes based on suspended growth and can be achieved
either through cyclones, or retention sieves. Process control using intermittent aeration requires
fast actuators, accurate valve positioning and consideration of the impact that rapid airflow
changes have on the aeration system blowers.
ES.4 Decision Matrix for Control/Approach
Two overriding considerations in deciding which approach to take for short-cut nitrogen
removal are: 1) the effluent drivers and 2) the C/N ratio of the influent to the process. Table ES-1
is a matrix that compares effluent drivers to the C/N ratio to give suggested use of
bioaugmentation, a recommended control approach and the need for some form of polishing
stage. The ratios are provided for guidance only and the specific C/N ratio for a treatment facility
with a given configuration may still work for values outside of those suggested. Systems with a
very high C/N ratio should consider a “carbon diversion” to channel carbon away from
secondary treatment, for example by capturing more carbon in a primary or “A” stage to be sent
to anaerobic digestion.
Table ES-1. Decision Matrix for Implementing Short-Cut Nitrogen Removal.
C/N Ratio (COD:TN)
Moderate Very high C/N

Effluent Drivers Low C/N (0-5) C/N (5-10) High C/N (8-15) (15+)*
Low ammonia
No TN ABAC
No/high ammonia limit Bioaugmentation

Moderate TN AVN
Low ammonia Bioaugmentation

AVN & Reaeration or
Moderate TN AVN ABAC
Anammox Polishing or Reaeration
Low TN AVN
Anammox Polishing
Notes:
* - Consider carbon diversion
AVN = Ammonia versus NOx control
ABAC = Ammonia-based aeration control (must include robust control for low ammonia limits)
"Low Ammonia" limit = limit <2 mg/L (limits less than 1 mg/L may have other considerations)
Moderate TN = limit 6 -12 mg/L, Carbon Addition not needed
Low TN = limit <6 mg/L
Polishing: Post anoxic treatment, anammox

ES-6
CHAPTER 1.0
SINGLE-STAGE MAINSTREAM DEAMMONIFICATION

WITH BIOAUGMENTATION – MAINSTREAM
DEAMMONIFICATION PILOT AT BLUE PLAINS
ADVANCED WASTEWATER TREATMENT PLANT
This section summarizes the work conducted from the year 2011 to early 2012 to
establish a bench-scale single sludge deammonification process at Blue Plains’ Advanced
Wastewater Treatment Plant (AWTP) research laboratories, Washington, D.C. Significant time
was spent on developing the setup and creating appropriate testing protocols to evaluate this
innovative technology. This work was carried out under Task 2 of the project as described in the
project plan: Task 2 – Blue Plains Pilot Testing. This section of this report describes the
objectives and strategies, experimental setup and methodologies, and results of this pilot study.
DC Water conducted pilot testing at the Blue Plains AWTP site to evaluate a seeded
mainstream deammonification process for possible implementation in their existing B-stage
process (separate sludge nitrification/denitrification process) (Figure 1-1). The overall process
flow-sheet is represented by the Strass pilot configuration, but Blue Plains AWTP must operate
to meet stringent nutrient limits of 3 mg/L total nitrogen (TN) and 0.18 mg/L total phosphorus
(TP). Operation for these limits while optimizing energy and carbon consumption by
implementing deammonification presents an additional challenge. This work was completed in
parallel with the Strass pilot configuration.
Figure 1-1. Blue Plains AWTP A-B Flowsheet with Deammonification.
Mainstream Deammonification 1-1

1.1 Objective
The main goal of this bench-scale pilot study was to understand the mechanisms and
process kinetics for autotrophic organisms associated with deammonification and to use these
kinetics for process modeling. The bench-scale bioaugmentation was intended to complement the
full-scale testing at Strass.
1.2 Sequencing Batch Reactor Deammonification Operation Strategies
Four key process components were identified for successful mainstream
deammonification. Figure 1-2 schematically illustrates these components in a deammonification
system comprised of both mainstream and sidestream deammonification processes. The key
process components are as follows:
1. Anaerobic ammonium oxidizing (anammox) retention – solids retention time (SRT)
decoupling.
2. Nitrite oxidizing biomass (NOB) repression.
3. Anammox bioaugmentation.
4. Ammonia oxidizing bacteria (AOB) bioaugmentation.
The first three key components were investigated in bench-scale experiments.
Anammox enrichment in the reactor is necessary to maintain a viable anammox
population and overcome the NOB. This enrichment was conducted via selective retention of the
anammox population using a centrifuge and later a sieve. In addition, anammox bioaugmentation
was conducted by seeding the sequencing batch reactor (SBR) with sludge from a full-scale
sidestream deammonification process at Strass Wastewater Treatment Plant (WWTP), Austria.
The operating dissolved oxygen (DO) level was decreased to try to outselect NOB. The
DO level was varied throughout the testing phases in the range of 0.03-0.3 mg/L. The literature
suggested that AOBs have lower DO-half-saturation concentration than NOB (Sin et al., 2008).
Thus, operating at low DO levels near the DO-half saturation for the NOB and operating near the
minimum SRT required for the AOB would result in the washout of the NOB while retaining the
AOB population. The second strategy to outselect NOB was through the application of transient
anoxia via intermittent aeration.
Figure 1-2. Deammonification System Key Components.
1-2
1.3 Experimental Setup and Methodologies
The following subsections describe the experimental setup and methodologies used for
this evaluation. The first subsection (Section 1.3.1) explains the bench-scale SBR and
experimental setup and SBR operations. The methodology used and the data acquisition for this
bench-scale pilot study are explained in Section 1.3.2, Methodologies and Data Acqusition.
1.3.1 Deammonification Bench-Scale SBRs
The experimental setup and SBR operations are described in the following sections. The
section regarding setup (Section 1.3.1.1) outlines the specific components of the bench-scale
pilot. The SBR operations explained in Section 1.3.1.2 describes adjustments made to SBR
cycles and a guide to changes made to the operations during the one-year pilot.
1.3.1.1 SBR Experimental Setup
The main bench-scale experimental setup was comprised of a semi-automated 10-L SBR
system equipped with process controls to allow for continuous operation. The system was housed
in a large incubator for temperature control. A separate incubator was used to house a 50-L
feeding tank equipped with a mechanical mixer and later an ultraviolet (UV) disinfection system.
Figure 1-3 schematically illustrates the experimental setup and the various components including
monitoring and control instrumentation (Note: The figure shows only one reactor, but the actual
setup included two reactors). The following is a list of components:
 10-L SBR glass tanks.
 Custom-built SBR Lid and O-ring systems (attached to mechanical mixers) to seal the
reactors for off-gas collection and to minimize DO intrusion (Figure 1-4).
 Probes:
o DO.
o Oxidation reduction potential (ORP).
o pH.
o Temperature.
o NO/N2O liquid probes (Note: these probes were not used in 2011, but provisions were
made to use these probes if required).
 Aeration system and DO controls using HACH SC200 meter.
 pH controls using EUTECH alpha-pH800 meter.
 NO/N2O off gas monitoring system.
 N2O gas filter correlation analyzer (Teledyne, San Diego, CA).
 NO chemiluminescence analyzer (Teledyne, San Diego, CA).
 Timers for process control and automation.
 Feed UV disinfection module.
 Automated feed pumps.
 Automated decant pumps.
 Manual wasting pumps.
 Automated substrate feed pumps.

LEGEND S P1
A = Acid NO
B = Base Analyzer
S = Substrate 250 mL/min
W1
D = Decant Pump DO N2 O
F = Feed Pump Timer
Controller Analyzer
M = Motor 835 mL/min
m = Manifold WAS
P = Pump Tank
Air pH
SV = Solenoid Valve SV
Controller #1
Pump
W = Waste Pump #1
(5-L)
M
m
Vent opening P1 A
to atmosphere
P1 B U
F1
V
Reactor
Probe – [pH]
Lid
Probe – [DO]
J-tube
N2 O Probe
Decant Tank
NO Probe
SE Feed
#1 (50-L)
D1 (20-L)
NO/N2 O
Meter
SBR #1
INCUBATOR #1 INCUBATOR #2
Figure 1-3. Deammonification SBR Experimental Setup.

The figure depicts only one reactor, but actual setup included two reactors.
1-4
Waste line
Feed lines
Decant line
Post-aeration
line
Mixer
NO and N2O
N2 gas
probe ports
Sampling
ORP probe
port
Sweep gas port
N2O sampling port
Aeration airline
NO sampling port LDO Acid/base and carbon source

probe addition
Figure 1-4. Plan View of the Deammonification SBR Cover and Ports.
1.3.1.2 SBR Operations

The following subsections describe the SBR operations, including the SBR cycle, the
operational chronology, and aeration modes.
1.3.1.2.1 SBR Cycle
The SBRs were designed to carry out a deammonification phase followed by a nitrate
trimming phase. Initial modeling runs suggested running both reactors at four cycles per day
would maintain adequate mixed liquor suspended solids (MLSS) concentration in the reactors to
allow for good sludge settleability characteristics. In Phase II of testing, the number of cycles for
Reactor B was increased to six cycles to increase the MLSS concentration. The operation cycle
started with filling the reactors with secondary-treated effluent from Blue Plains. The ammonia
in the feed was adjusted daily to target a 20 mg/L concentration. After the filling period was
complete, the aeration cycle started with the air compressor turned on and off depending on the
aeration regimen. The aeration period lasted for four hours in the case of four-cycle operation
and two hours in the case of six-cycle operation. Following the aeration period was a post anoxic
period where the air-flow was turned off and an external carbon substrate was added to remove
any nitrate that accumulated during the aeration period from nitration. The post anoxic period
lasted 35 minutes and was followed by, a short five-minute re-aeration period, where DO level
reached levels higher than 2 mg/L, before settling and decanting. Table 1-1 shows the cycle
phases for four-cycle and six-cycle operations.

Table 1-1. Deammonification SBR Cycle.
Phase Duration Reactor Condition Action

Fill 7 min Mixer is on.
Reactor Volume is at
maximum level.
Reactor A is filled with
5.25L.
Reactor B is filled with
3.5L.
React – aeration 4-cycle – 4 hrs Mixer is on.
6-cycle – 2 hrs Air is controlled.
React – post anoxic 4-cycle – 35 min Mixer is on.

6-cycle – 40 min Air is off.
Carbon substrate is
added.
Re-aeration 5 min Mixer is on.
Air is on.
Settle/Decant 4-cycle – 75 min Mixer is off.

6-cycle – 70 min Air is off.
Decant pump is on.
Idle 5 min Mixer is on.

Reactor Volume is at
minimum level.
Total Cycle Time 4-cycle – 6 hr

6-cycle – 4 hr
1-6
1.3.1.2.2 Operation Chronology
Reactor A was operated in an intermittent aeration mode with 20 minutes aerobic/10 minutes
anoxic cycles. Soon after, the aerobic/anoxic cycle time was reduced making the switch between air
on and off more frequent. Table 1-2 shows the key changes to the SBR operation in terms of target
DO and the aerobic/anoxic cycles.
Table 1-2. SBR A Operational Changes.
Date Change Purpose
March 14 Changed the cycle time from 4 to 6 hrs. To increase the aerobic fraction and increase MLSS concentration.
April 1 Dropped target DO from 0.2 to 0.12 mg/L. To apply pressure on the NOBs.
April 7 Reduced the length of the aerobic/anoxic To apply more pressure on NOBs by increasing the frequency of
cycles from 20min/10min to 4 min/2 min. cyclic switch between aerobic and anoxic periods.
April 22 Dropped target DO from 0.12 to 0.06 mg/L. To apply pressure on the NOBs.
June 7 Target DO increased to 0.3 mg/L and To compensate for lower aerobic fraction, the DO was increased to
aerobic/anoxic cycle was adjusted to maintain ammonia oxidation activity. The increase in the anoxic
3 min/3 min. periods to 3 min was to allow DO to drop to zero.
June 24 Aerobic/anoxic cycle was adjusted to To allow DO to drop to zero during the anoxic periods.
2 min/4 min.
August 10 Phase II started (25oC). Enhancing anammox activity by minimizing temperature difference
between seed sludge source and target sludge.
September 18 Aerobic/anoxic cycle was adjusted to To allow DO to drop to zero during the anoxic periods.
2 min/6 min.
September 26 Started a new anammox retention method To improve anammox retention.
using a sieve.
April 10 Phase III: intermittent at DO of 1.5 mg O2/L To improve NOB out-selection.
and aerobic/anoxic cycle of 2.7 min/7.5 min.
Reactor B was operated in a constant DO aeration mode. The reactor was initially started in
January of 2011, but due to equipment failure, the reactor was restarted on March 30, 2011. Table
1-3 shows the key changes to the SBR operation in terms of target DO and the aerobic/anoxic cycles.
Similar to Reactor A, the target DO was reduced systematically from 0.1 mg/L to as low as 0.03
mg/L to apply pressure on the NOB population and wash them out of the system.
Table 1-3. SBR B Operational Changes.
Date Change Purpose
March 30 DO level was 0.1 mg/L.
April 22 Dropped target DO to 0.06 mg/L. To apply pressure on the NOBs.
May 13 Dropped target DO to 0.05 mg/L. To apply pressure on the NOBs.
June 9 increased target DO to 0.05 mg/L. Optimized DO level.
August 10 Phase II started (25oC). Enhancing anammox activity by minimizing temperature
difference between seed sludge source and target sludge.
September 26 Started a new anammox retention method using a sieve. To improve anammox retention.
July 17 Phase III: intermittent at DO of 1.5 mg O2/L and To improve NOB out-selection.
aerobic/anoxic cycle of 10 min/20 min.

1.3.1.2.3 Deammonification SBRs Aeration Modes
Both intermittent and constant DO aeration modes were used in this study..
In the intermittent aeration mode, diffused air was introduced into the SBR using an air
compressor during the aeration phase. The air-flow was turned on and off to create a sequence of
aerobic and anoxic periods throughout the react-aeration phase. The aerobic and anoxic periods
were controlled using a timer that turned off a solenoid valve for the duration of the anoxic
period. During the aerobic period, the aeration was controlled using a DO probe and a DO
controller that controlled the DO level between two setpoints. When the DO in the reactor
exceeded the maximum setpoint, the compressor was turned off, and when the DO dropped
below the minimum setpoint, the compressor was turned on. During the anoxic periods the
compressor remained off and the DO was allowed to drop. Figure 1-5 shows a schematic
illustration of the aeration mode in Reactor A. Various aerobic/anoxic periods were considered
during the testing periods. Initially, the aerobic time was set for 20 minutes and the anoxic period
was set for 10 minutes. Subsequently, the periods were significantly reduced to apply more
pressure on the NOB population by increasing the cyclic frequency of the transient anoxia.
Figure 1-5. Aeration Regimes Schematics.

(a) Low Constant DO; (b) Low DO intermittent aeration; and (c) High DO intermittent aeration.
Note: the air on/off intervals were variable and specific to each testing period.
1-8
In the constant DO aeration mode, diffused air was introduced into the SBR using an air
compressor. Similar to the intermittent aeration mode, during the aerobic periods the aeration
was controlled using a DO probe and a DO controller between two setpoints. When the DO
concentration in the reactor exceeded the maximum setpoint, the pump was turned off, and when
the DO concentration dropped below the minimum setpoint, the pump was turned on. Figure 1-5
also shows a schematic illustration of the aeration mode in Reactor B.
The reactors were seeded with sludge from various plants including a second stage
nitrifying and denitrifying sludge (N/DN) from Blue Plains AWTP, simultaneous nitrifying and
denitrifying sludge (SND) from a membrane bioreactor (MBR) plant, high rate process sludge at
Blue Plains AWTP, post denitrification deep bed filter (with methanol) backwash sludge from
H.L. Mooney WWTP, and anammox sludge from Strass WWTP. The initial seed impacted
startup conditions but not necessarily the steady state performance. The reactors were seeded
weekly with sludge from Strass sidestream deammonification process to provide anammox
bioaugmentation from a sidestream to the mainstream system.
Initial modeling of the SBRs suggested operating the reactors at four cycles per day to
maintain an adequate MLSS concentration to ensure proper settling characteristics. Table 1-4
shows the reactors’ key operating parameters under Phase I and II.

Table 1-4. SBRs Operating Parameters During 2011-2012.
Phase I – 15°C Phase II – 25°C Phase II – 25°C at High Intermittent DO

Key Parameter Unit
Reactor A Reactor B Reactor A Reactor B Reactor A Reactor B
Initial sludge seed mass – 67% Blue Plains 50% MBR SND 100% anammox 67% Blue Plains 100% anammox 100% anammox
composition N/DN High Rate Sludge from Strass from Strass
17% H. L. Mooney
33% Strass Post Denitrification 33% anammox
33% anammox
Weekly AMX seeding rate mL/wk 20 20 20-30 20-30 40-80 80-140
SBR operation:
# of cycles/d – 4 4 4 6 4 4
Filling L/cycle
Rate min 5.25 5.25 5.25 3.5 5.25 5.25
Time min 7 7 7 7 7 7
Aerobic phase time – 240 240 240 120 240 240
Aeration regime min Intermittent Constant DO Intermittent Constant DO intermittent DO intermittent DO
Anoxic phase time min 35 35 35 40 35 35
Reaeration time min 5 5 5 5 0 0
Settle/decant time min 75 75 75 70 80 80
Idol time 5 5 5 5 5 5
Carbon addition – methanol methanol None Glycerol – –
Notes:
AMX - anammox
1-10
The SBRs were started on January 3, 2011 marking Phase I of testing, operating at 15ºC.
Phase I lasted approximately eight months, followed by approximately four months of operation
under Phase II, operating at 25ºC. The reactors were fed secondary treated and clarified effluent
from Blue Plains AWTP with the ammonia concentration adjusted to target a concentration of
20 mg N/L.
1.3.2 Methodologies and Data Acquisition
The following subsections describe the pilot test methodologies and data acquisition
procedures. Section 1.3.2.1 explains the anammox (AMX) organism retention. Section 1.3.2.2
explains the use of a UV disinfection system to ensure that the feed was free of NOBs. Section
1.3.2.3 explains the monitoring for DO, ORP, and pH. Section 1.3.2.4 describes the NO and NO2
monitoring. In Situ test methods under various conditions are described in Section 1.3.2.5.
Ex Situ side tests for DO-half saturation parameters and AMX temperature sensitivity are
explained in Section 1.3.2.6. Collection of molecular work samples is described in Section
1.3.2.7.
1.3.2.1 AMX Retention
In order to decouple the AMX SRT from the sludge SRT in the SBRs, a means for
retaining the anammox organisms was required. In full-scale application, a hydro-cyclone is
usually utilized (Strass WWTP), which relies on separating the denser anammox aggregates and
granules from the remainder of the sludge. In the bench-scale setup, a centrifuge based approach
was initially utilized. However, due to the complexity and the relatively lower anammox
retention efficiency of this method, an alternative approach using a sieve was developed. The
sieve-based approach relied on the relative incompressibility of the anammox particles compared
to other flocs present in the sludge matrix. The new approach was relatively less complex and
provided higher efficiency of retaining anammox than the centrifuge based approach. The
retention process took place during the normal wasting procedure where anammox was retained
and the remaining sludge was wasted. Figures 1-6 and 1-7 illustrate the two approaches.

Figure 1-6. Centrifuge Protocol for Anammox Retention.
Figure 1-7. Sieve Protocol for Anammox Retention.
1-12
1.3.2.2 UV Disinfection System
A UV disinfection system was installed on the SBR feeding system during Phase II of
testing to ensure that the feed was free of any NOBs. NOB presence was observed in the
secondary effluent of Blue Plains when recycles from the nitrogen removal stage were sent back
to the secondary reactors. The SBR feed contents were circulated through the UV module for
three hours before the feeding cycle began. Figure 1-8 shows the UV disinfection performance
using an Escherichia coli (E-coli) test results. The system was maintained on a weekly basis to
ensure that tubes were clean and free of any deposits.
No UV
Treatment
3hrs UV
Treatment
24hrs UV
Treatment
Figure 1-8. SBRs Feed UV Disinfection Performance.

1.3.2.3 DO/ORP and pH Monitoring
The DO concentration was measured and controlled using HACH SC200 meters and
luminescent dissolved oxygen (LDO) probes. The set points varied according to different
experimental phases. ORP was also monitored during the anammox maximum activity tests to
ensure that true anoxic conditions existed. DO data was saved daily from the controller and
stored on the laboratory personal computer to ensure that the aeration patterns were not
interrupted. The pH was monitored and controlled using the EUTECH alpha-pH800 meter with a
minimum set point of 7.0 and maximum set point of 7.2 for both reactors. Figure 1-9 shows the
pH and DO/ORP meters.
Figure 1-9. DO/ORP and pH Meters.

1.3.2.4 NO/N2O Monitoring
The nitrogen oxides NO and N2O were monitored during normal SBR operation to assess
greenhouse gas emissions from the SBRs. The reactors were covered with lids to create a
confined space to allow for the collection of gasses emitted from the water’s surface. Air was
used as the carrier gas to transport the SBR off-gasses to the analyzers. The N2O gas was
monitored using a gas filter correlation analyzer model 320E from Teledyne, San Diego,
California. The NO gas was monitored using chemiluminescence analyzer model T200M from
Teledyne as well. The gas flow rates utilized with these instruments were approximately
850 mL/min and 125 mL/min respectively. Analyses were conducted once the variability was
below 0.2 ppm for both analyzers. The concentration, stability, and gas flow rates were stored
directly on the laboratory computers for graphical analysis.
1.3.2.5 In Situ Tests
Besides online monitoring, several sampling routines were conducted in the SBRs to
monitor the deammonification performance. Table 1-5 shows a list of analyses of interest and the
frequency of sampling, and Table 1-6 summarizes the analytical procedures used. The following
discussion describes these routines and demonstrates the use of data acquisition for calculating
some important performance parameters and indicators.
1-14
Table 1-5. A List of Key Analyses During the Deammonification SBRs' In Situ Tests.
Reactor
Parameter Unit Feed
Sampling
Aerobic Phase Anoxic Phase Sampling Time Decant-Effluent Waste
Time
Total suspended
solids (TSS) mg/L Daily 2/wk Daily 2/wk
Volatile
suspended
solids (VSS) mg/L Daily 2/wk Daily 2/wk
Total chemical
oxygen demand
(COD) mg/L 2/wk
Soluble COD mg/L 2/wk 4/wk Start/End 4/wk 3/phase
Flocculated &
filtered COD
(ffCOD) mg/L 2/wk
Total kjeldahl
nitrogen (TKN) mg/L-N 2/wk 2/wk End 2/wk
Ammonia mg/L-N Daily 4/wk 6-9/phase 4/wk 3/phase 2/wk
Nitrate mg/L-N Daily 4/wk 6-9/phase 4/wk 3/phase 2/wk
Nitrite mg/L-N Daily 4/wk 6-9/phase 4/wk 3/phase 2/wk
Alkalinity mg CaCO3/L 2/wk End

Table 1-6. Summary of Experimental Sampling and Analytical Procedures for the SBR Testing at Blue Plains.
Sampling/ Preservation/ Holding

Matrix Measurement Analysis Method Quantity of Sample
Measurement Method Storage Time(s)
Liquid – TSS Composite SM – 2540 D. TSS dried at 103- 30 mL Fridge/8oC 1-2 days
Unfiltered 105oC.
VSS Composite SM – 2540 E. Fixed and volatile 30 mL Fridge/8oC 1-2 days
solids ignited at 550oC.
TKN Grab/P. Syr.1 SM – 4500-N-orgB. Macro- 10 mL 2 – 3 drops of 0.3 N 1-3 days
Kjeldahl Method. H2SO4/8°C
COD Grab/P. Syr. HACH – Dichromate 8000 2 mL N/A 0-10 min
Liquid – sCOD Grab/P. Syr./1.2 µ GF HACH – Dichromate 8000 2 mL N/A 0-10 min
Filtered ffCOD Grab/P. Syr./0.45 µ 2 100 mL/2 mL3 N/A 0-10 min
Ammonia Grab/P. Syr./0.45 µ HACH – Salicylate Method 0.5 mL H. Range N/A 0-10 min
10205, Ammonia TNTplus. 2 mL L. Range
Nitrate Grab/P. Syr./0.45 µ HACH - Dimethylphenol Method 0.2 mL H. Range N/A 0-10 min
10206, Nitrate TNTplus. 1 mL L. Range
Nitrite Grab/P. Syr./0.45 µ HACH – Method 10207, USEPA 0.2 mL H. Range N/A 0-10 min
Diazotization, nitrite TNTplus. 2 mL L. Range
Alkalinity Grab/P. Syr./0.45 µ 50 mL N/A
Sludge TSS Grab/P. Syr. SM – 2540 D 30 mL Fridge/8°C 1-2 days
VSS Grab/P. Syr. SM – 2540 E 3 0mL Fridge/8°C 1-2 days
Notes:
1P.Syr. = Plastic Syringe.
2The ffCOD sample is flocculated first using zinc sulfate and filtered thru a 0.45 micron syringe membrane filter.
3100 mL for the flocculation and 2 for the analysis.
SM – Standard Methods.
1-16
1.3.2.5.1 Normal Operation Condition Profiles
The purpose of these profiling tests was to monitor the deammonification performance in
the reactor under normal conditions. They were conducted twice per week during the first cycle in
the day. Several analytes were measured using the HACH spectrometer including ammonia,
nitrate, nitrite, ortho-phosphate (ortho-P) and soluble chemical oxygen demand (sCOD).
Ammonia, nitrate and nitrite were measured every 20 minutes during the aeration and anoxic
phase; sCOD was measured at the beginning and end of the anoxic phase; phosphorus was
measured at the beginning and end of the cycle. Figure 1-10 shows a typical profile response from
Reactor A during a normal cycle. An observed reduction in ammonia, an increase in nitrate, and
low nitrite levels throughout the cycle were usually observed. From the profile, an observed
ammonia reduction rate was calculated [mg N/L/hr or mg N/g volatile suspended solids (VSS)/hr].
Similarly, the rate of nitrate increase was calculated. The net difference between the ammonia
reduction and nitrate production was assumed to be the nitrogen removed via deammonification. It
should be noted here that this estimation was a simplification and a few assumptions were made to
estimate this rate. It was assumed that endogenous denitrification and nitrate production via
deammonification counteracted one another and the net impact on nitrate level was considered
insignificant relative to the total nitrogen removed. Also, ammonia release due to decay was
considered negligible relative to the total ammonia removed.
Figure 1-10. Typical Profile During Normal SBR Cycle.

1.3.2.5.2 Ideal Operation Condition Profiles (Maximum AMX Activity)
The purpose of this test was to determine the maximum anammox activity of the SBR
sludge. The test was performed in the SBRs where ideal conditions for anammox reaction were
created (i.e., zero DO and NO2 concentration is much greater than the NO2 half-saturation-
concentration). The AMX activity tests were performed twice a week during the first cycle of the
day. Nitrogen gas was used to purge any oxygen in the reactor before the test started and to
prevent oxygen intrusion from the atmosphere during the test. Ammonia, nitrate and nitrite were
measured every 20 minutes during the entire test; sCOD and ortho-P were measured at the start
and end of the test. Figure 1-11 shows a typical profile during an AMX activity test. The total
nitrogen removed via anammox was estimated from the ammonia and nitrite reduction slopes.
Figure 1-11. Typical Profile During an AMX Activity Test.
1.3.2.6 Ex Situ Tests

Several side tests were conducted using sludge from the SBRs to understand the affinity
of AOB and NOB to oxygen, and using the raw anammox sludge to evaluate temperature
sensitivity. The following discussion describes these tests.
1.3.2.6.1 DO-Half-Saturation Parameter (Ko) Test
It was important to understand the oxygen affinity for the AOB and NOB populations
throughout the testing phases to determine the optimum DO operation setpoint for NOB
washout. Also, evaluating the impact of switching from conventional nitrification process to a
low DO deammonification process was of interest. Giraldo et al. have indicated the selection for
ammonia oxidizing archea (AOA) at a low Ko of 0.01 mg/L in a simultaneous nitrification
denitrification MBR plant in New Jersey (Giraldo et al., 2011). Therefore, it was considered that
a population shift or change in metabolic efficiency may occur in the SBRs after operation at low
DO level for an extended period of time. The Ko parameter was estimated using two methods
(constant DO and declining DO). These methods are discussed here.
1-18
Constant DO Method:
This method was conducted in a batch reactor where sludge from the SBRs was spiked
with ammonia (or nitrite) to provide non-limiting conditions. The sludge was aerated to reach a
certain DO level and the air-flow was controlled to maintain this DO setpoint. Ammonia (or
nitrite) reduction was monitored to establish a removal rate (mg N/g VSS/hr). The DO setpoint
was then modified and the removal rate was measured again. This process was repeated for
several DO setpoints usually in the range 0.1-2 mg/L (Figure 1-12a). The DO setpoint and the
removal rate were then plotted on a chart and a model was fitted to the data using Equation 1
below to predict the Ko value (Figure 1-12b). The 95% confidence interval was also calculated
to determine the quality of the data used for Ko estimation.
Ko = 0.2
mg/L
(a) (b)
Figure 1-12. Typical Results from a Constant DO Test for Ko Determination.
Equation 1:
𝐷𝑂
Removal rate (r) = 𝑟𝑚𝑎𝑥 (𝐷𝑂+𝑘
𝑜)
One advantage of this method was that an individual Ko value for AOB and NOB
populations could be determined separately.

Declining DO Method:
In this method a batch reactor was filled with sludge from the SBR and spiked with
ammonia (or nitrite) to ensure non limiting conditions. The sludge was aerated to achieve a DO
level of approximately 3-6 mg/L and then air-flow was turned off to allow the DO to decline.
Initially, the ammonia (or nitrite) reduction rates would be at maximum. As the DO declined the
rate dropped depending on the organisms’ affinity to oxygen which was determined by the half-
saturation concentration.
Figure 1-13 shows a typical DO declining profile. Using a regression model (adopted
from the Smith regression, Smith et al., 1998), the data was fitted by a curve that was described
by Equation 2 including the maximum reduction rate and Ko. Similar to the Constant DO
method, the 95% confidence intervals were calculated for data quality assessment purposes.
Equation 2:
−𝑌𝐴𝑂𝐵 𝐷𝑂𝑇
𝑇= ∗ ((𝑘𝑜 ∗ 𝐿𝑛( ) + 𝐷𝑂𝑇 − 𝐷𝑂𝑜 )
(4.57 − 𝑌𝐴𝑂𝐵 ) ∗ 𝑟𝑚𝑎𝑥 𝐷𝑂𝑜
Where:
T = Time required to reduce oxygen from DOo to DOT via ammonia oxidation, in days.
YAOB = AOB true yield, mg chemical oxygen demand (COD)/mg N. In the case of DO decline
due to nitrite oxidation, YNOB would be used instead. Also, 1.14 would be used instead of 4.57.
rmax = The maximum oxygen depletion rate, mg/L/d.
DOT = DO concentration at time T, in mg/L.
DOo = Initial DO concentration at time T=0 days, in mg/L.
Figure 1-13. Typical Results from a Declining DO Test for Ko Determination.
1-20
1.3.2.6.2 Temperature Sensitivity Activity Test
The purpose of the anammox temperature sensitivity test was to study the temperature
impact on the anammox sludge and determine the Arrhenius coefficient Ѳ. Anammox activity
tests were conducted at various target reactor temperatures. Nitrogen gas was used to strip the
DO from the reactor. Ice and hot water bags were used to control the reactor’s temperature. NH3,
NO3, and NO2 were measured every 15 minutes during the test; sCOD was measured at the
beginning and end of the test.
1.3.2.7 Molecular Work Sampling
Molecular work samples were collected twice a week, one sample was collected during
the normal profiling and one during the anammox activity test. Samples were preserved for
deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) analysis using the following protocol.
 Put the centrifuge into the 0°C incubator a day before.
 Prepare three tubes for duplications of RNA extraction.
 Add 2 mL of the sample to micro-centrifuge tube.
 Put sample vials into the ice bath to cool down for 10 minutes.
 Centrifugation for 10 minutes at 5000 xg at 0°C.
 Remove supernatant.
 Pipette 2 mL of RNA protect bacteria reagent into a micro-centrifuge tube.
 Mix immediately using a vortex for five seconds.
 Incubate for five minutes at room temperature.
 Centrifugation for 10 minutes at 5000 xg at 0°C.
 Remove supernatant and store the samples in a (-80°C) freezer.
The objective of the molecular work analysis was to provide molecular quantitation of
AMX, AOB, and NOB and functional gene expression of monooxygenase subunit A (amoA) and
hydrazine oxidoreductase (hzo), which are involved in electron transfer in the deammonification
reactors.
DNA and RNA extraction were conducted using the DNeasy mini kit, and RNeasy mini
kit (Qiagen, CA). Resulting DNA and RNA concentrations and quality were measured by UV
spectrophotometry (Varian, CA).
The abundance of AMX, AOB and NOB was quantified via SYBR® Green chemistry
quantitative polymerase chain reaction (PCR/(qPCR) assays targeting AMX 16S rRNA gene
(van der Star et al., 2007), amoA gene (Rotthauwe et al., 1997), Nitrobacter 16S rRNA gene
(Graham et al., 2007) and Nitrospira 16S rRNA gene (Kindaichi et al., 2007), respectively.
Total bacterial abundance was quantified using eubacterial 16S rRNA gene targeted
primers (Ferris et al., 1996). For RNA analysis, reverse transcription (RT) was conducted in
order to generate complementary DNA (cDNA) using Quantitect Reverse Transcription kit
(Qiagen, CA). Concentrations of amoA and hzo determined via RT-q-PCR were normalized to
AOB 16S rRNA and AMX 16S rRNA concentrations. The qPCR assays were conducted on a
iQ5 real-time PCR thermal cycler (BioRad Laboratories, Hercules, CA). Standard curves for
qPCR were generated via serial decimal dilutions of plasmid DNA containing specific target
gene inserts. The qPCR tests for standard plasmid DNA and sample DNA/cDNA were conducted
with duplication and triplication, respectively. DNA grade double-distilled H2O (Fisher
Scientific, MA) was used for non-template control. Primer specificity and the absence of primer-
dimers were confirmed via melt curve analysis.

Initial molecular data obtained from anammox seed samples (deammonification process -
DEMON) indicated an underestimation of the anammox quantification. The researchers
hypothesized that the increased suspended solid concentration of sidestream DEMON might
influence the overloading in the DNA extraction protocol of automated DNA extraction
machine, Qiacube. Therefore, they addressed this by conducing qPCR with different original
volume of biomass (250 µL, 190 µL, 150 µ L). Nine samples from the sidestream DEMON were
used in the test (Table 1-7).
Table 1-7. AMX qPCR Results for the Five Tests.
(Units are all copies/mL)
Sample % Recovery
Sample Date Test 0 Test 1 Test 2 Test 3 Test 4
No. for Test 4
23 5/22/2012 3.33E+08 2.64E+08 1.81E+09 8.51E+08 1.37E+10 98%
24 6/19/2012 4.10E+08 2.46E+08 1.87E+09 1.45E+09 9.79E+09 76%
25 7/25/2012 1.53E+08 1.44E+08 1.67E+09 1.28E+09 9.28E+09 74%
26 8/16/2012 2.68E+08 1.68E+08 1.55E+09 1.34E+09 9.35E+09 75%
27 9/11/2012 2.29E+08 1.05E+08 1.05E+09 1.23E+09 7.74E+09 65%
28 9/26/2012 3.25E+08 2.23E+08 1.59E+09 1.35E+09 8.09E+09 65%
29 11/7/2012 1.67E+08 1.33E+08 1.08E+09 7.12E+08 8.46E+09 70%
30 12/7/2012 1.35E+08 8.85E+07 8.19E+08 9.02E+08 8.30E+09 71%
31 1/3/2013 6.29E+07 3.81E+07 5.66E+08 9.29E+08 5.66E+09 49%
In addition, Standard DNA spiking tests into biomass were conducted to determine
extraction efficiency of DNA. Briefly, the known concentration of DNA (4.16E9 copies) were
added into the original volume of biomass and then followed by the DNA extraction and qPCR.
Each test was conducted as follows.
 Test 0: Previous qPCR test result.
 Test 1: Repeat qPCR test with previously extracted DNA, 250 µL of original volume.
 Test 2: qPCR test with repeat DNA extraction, 190 µL of original volume.
 Test 3: qPCR test with repeat DNA extraction, 150 µL of original volume.
 Test 4: Test 2 + spiking standard DNA (4.16E9 copies/sample).
Previous AMX qPCR result (test 0) and repeat test (test 1) were not statistically different
(p<0.05) showing that AMX qPCR was highly reproducible when the same DNA extracts were
applied (Figure 1-14). This implies potential bias of AMX quantitation might be caused by other
than qPCR test itself.
While comparing results from the different original volume of biomass, significant
underestimation of AMX quantity was observed in test 1 (250 µL). Whereas, test 2 and test 3
results were not statistically different (p<0.05). Thus, the results demonstrated that more than
190 µL of original volume of biomass could cause the underestimation of AMX quantitation
possibly due to the overloading of DNA extraction (Figure 1-15). Therefore, the researchers’
initial hypothesis that the extraction was overloaded and possibly influenced the qPCR tests was
accepted via the test results.
1-22
In addition, results of the spiking test with standard AMX DNA averaged 71% of
recovery for the nine samples, suggesting that the efficiencies of the DNA extraction protocol
did not significantly influence the qPCR results. The possible reason of variable percent recovery
of standard DNA in each sample is not yet entirely clear and remains to be determined.
From this experiment, the optimum (or at least maximum) amount of original biomass
should be determined and use of similar amounts of biomass for DNA extraction is highly
recommended between samples within the experiment even though the concentrations of
biomass are varied.
Figure 1-14. AMX qPCR Results for the Five Tests.
Figure 1-15. Original Volume of Biomass Influenced AMX Quantification.

1.4 Results and Discussion
This section describes how the bioaugmentation efficiency was found to be sensitive to
the reactor operating temperature (Section 1.4.1). Section 1.4.2 explains the methodology
adjustments to increase AMX retention. The pilot performance is organized to the key findings
and operation strategies sections.
1.4.1 AMX Bioaugmentation – Effectiveness and Temperature Sensitivity
The AMX bioaugmentation helped maintain anammox activity by partially out-
competing the NOB in the SBR system. Figure 1-16 shows a correlation between the active
AMX fractions in the reactors, which were indicated by the maximum AMX activity measured
in the reactors under ideal anammox conditions, and the deammonification activity in the
reactors during normal operation.
Figure 1-16. Correlation Between AMX Activity and Deammonification Performance.
The bioaugmentation efficiency was found to be sensitive to the reactor operating

temperature. Several AMX activity tests were conducted using the AMX seed sludge from Strass’
sidestream deammonification process. The tests were conducted at various wastewater
temperatures ranging from 12o to 38oC. The purpose was to determine the temperature Arrhenius
coefficient of the seed sludge and to therefore describe the impact of temperature on changes in
seed anammox activity.
1-24
The Strass sidestream process was operated at 30°C. Typical observed Arrhenius for
autotrophs are 1.072 and 1.06 for AOB and NOB respectively. Figure 1-17 shows the results from
tests conducted at eight different wastewater temperatures. Two Arrhenius models were used to
describe the data distribution. The first was the conventional model using Equation 3, and the
second was a double logistic model using Equation 4, which described the data over the whole
temperature range. The Arrhenius coefficients generated from the best fit to the data were 1.14 and
1.17 respectively. As seen from the figure, the anticipated AMX activity of the bioaugmented seed
at 25°C was almost three times the activity at 15°C. These Arrhenius coefficients are much greater
than those observed for autotrophs, suggesting that the seed was particularly sensitive to a decrease
in temperature, and a much larger decrease in AMX activity occurs for the seed than would be
predicted for autotrophs.
Equation 3:
𝑟𝑇 = 𝑟20 ∗ 𝜃 (𝑇−20) ;
Where:
𝑟𝑇 = AMX activity at temperature T.
𝑟20 = AMX activity at temperature 20°C
T = Test temperature in °C
Equation 4:
1 1
𝑟𝑇 = 𝑟20 ∗ 𝜃 (𝑇−20) ∗ ∗
1 + exp(−𝐿𝑠𝑡𝑒𝑒𝑝 ∗ (𝑇 − 𝐿𝑐𝑟𝑜𝑠𝑠 )) 1 + exp(𝐻𝑠𝑡𝑒𝑒𝑝 ∗ (𝑇 − 𝐻𝑐𝑟𝑜𝑠𝑠 ))
Where:
𝐿𝑠𝑡𝑒𝑒𝑝 & 𝐿𝑐𝑟𝑜𝑠𝑠 = Logistic parameters pertaining to the lower end of the curve.
𝐻𝑠𝑡𝑒𝑒𝑝 & 𝐻𝑠𝑡𝑒𝑒𝑝 = Logistic parameters pertaining to the higher end of the curve.
Figure 1-17. Temperature Sensitivity Test for the Raw AMX Sludge from Strass Sidestream Treatment.

Similar work conducted earlier by Wett et al., 2010b on aerobic nitrifier bioaugmentation
from a sidestream process to a mainstream process suggested that the temperature sensitivity was
reduced when the difference in temperature between the seed source and target sludge was
minimized. The same concept could be applied for the anammox bioaugmentation. This concept
can be explored in the future testing phases by integrating a sidestream process component into
the deammonification SBR system.
1.4.2 AMX Retention Efficiency
Initially, the AMX were retained in the SBRs by centrifuging the wasted sludge, and then
separating and returning the heavier AMX fraction. This method was only effective in retaining
about two-thirds of the bioaugmented AMX. On September 26, 2011 in a separate evaluation,
the Blue Plains team developed a new methodology using a sieve to separate the AMX granules
from the remainder of the sludge. This method relied on the incompressibility of the AMX
granules compared to activated sludge floc material in the sludge matrix. An estimated AMX
recovery efficiency of greater than 90% was achieved, which improved the SRT decoupling
capability within the mainstream reactor.
Figure 1-18 shows the chronological test results from the maximum AMX activity
profiles for Reactor A and Reactor B. As mentioned earlier, Reactor A was initially started with
sludge seed from Strass, and thus, AMX organisms were dominating, which explains the initial
high activity levels. After running the SBRs for an extended period of time, the AMX activity
appeared to diminish over time due to the gradual loss of anammox. Note how the AMX activity
in both reactors was restored once the new method was applied.
Figure 1-18. Impact of Changing AMX Retention Method on Observed AMX Activity –
Phase II (25oC).
1-26
AMX seed was shipped on a regular basis from Strass WWTP, Austria. During the
testing, it was observed that the raw sludge activity was somewhat variable from sample to
sample. Also, it was suspected that the seed was losing its potency during storage in between
shipments. Therefore, the bioaugmentation strategy was modified to add seed based on
maintaining similar activity rather than similar seed mass. The modified strategy attempted to
ensure the maximum AMX activity in the reactors is maintained fairly constant.
Figure 1-19 compares the results for AMX activity during normal cycle operation and
under ideal condition (i.e., maximum potential AMX activity) for Reactor A. The figure shows
an overall improvement in AMX activity due to temperature increase, improved seeding and
improved AMX enrichment. The maximum AMX activity increased from approximately
1.5 to 9 mg N/g VSS/h, and the activity during normal operation increased from 0.25 to
1.9 mg N/g VSS/h. In addition, the improved stability in performance was believed to be due to
changes in the bioaugmentation strategy from being mass based to being activity based.
Figure 1-19. Impact of Temperature and AMX Enrichment on AMX Activity -

Reactor A (Intermittent Aeration).
1.4.3 NOB Repression

The strategies used to evaluate NOB repression are described in the following
subsections. The strategies included intermittent aeration, DO setpoint adjustments, and
maintaining specific ammonia concentrations.
1.4.3.1 Intermittent Aeration and DO Setpoint
As mentioned earlier, there were three strategies applied to outselect the NOB organisms
in the SBR systems through aeration; low DO and intermittent aeration (i.e., cyclic
aerobic/anoxic) at low and high DO setpoint. Reactor B was operated at constant low DO
setpoints ranging between 0.03 and 0.1 mg/L throughout the first two testing phases. Reactor A
on the other hand was operated at low DO setpoints ranging between 0.06 and 0.3 mg/L, and
aeration was interrupted to create cyclic aerobic/anoxic periods.
The actual DO profiles measured in the reactor revealed that distinct anoxic periods did
not occur in Reactor A. However, after switching the aeration mode to 2 min “air on”/6 min “air
off” in Phase II, the DO levels reached zero during the “air off” periods. In both systems, the DO
setpoint was increased to 1.5 mg O2/L during Phase III. The main difference between both
reactors was the frequency of aerobic/anoxic cycling.

The performance profiles in both reactors showed that low DO operation was ineffective
in repressing the NOB. The Ko testing results showed that the NOB had higher affinity for
oxygen than the AOB, which is contrary to what was the suggested in the literature (Sin et al.,
2008). Figure 1-20 shows the Ko testing results for both reactors using two methods (declining
and constant DO). As seen from the figure, the results showed that the NOB-Ko values were
consistently lower than those for AOB, which explained the resilience of NOB to washout.
Comparing Reactors A and B, the intermittent aeration mode at low DO setpoint had a
slightly better performance than the constant low DO. Figure 1-21 compares the anammox
activity in both reactors during Phase II of testing, where the aeration cycle in Reactor A was
2 min “air on”/6 min “air off”. As seen from the results the activity was approximately doubled
in Reactor A.
Figure 1-20. DO-Half Saturation Parameter (Ko) Testing Results – Phase I (15°C).
1-28
Figure 1-21. Intermittent Aeration versus Constant DO – Phase II (25oC).
Two different types of aerobic activity tests were conducted in order to investigate half-
saturation values for oxygen of AOB and NOB on biomass samples taken from the pilot systems
(biomass adapted to low DO operation). Results from constant DO-tests clearly indicate a
deviation from broadly accepted DO affinity (Figure 1-21) and higher AOB-rates than NOB-
rates only in a higher DO-range (Figure 1-22). Results from the declining DO-tests (Figure 1-23)
confirm Ko-values for total nitrifiers (AOB+NOB) being more than twice as high as for NOB
only. The same range of averaged Ko parameter values have been measured at the bench-scale
pilot as well as at the full-scale demonstration system.
Figure 1-22. Specific Nitrogen Process Rates in Terms of Ammonia Removal per g VSS and Day
Depending on the DO Level During Applied “Constant DO Tests.”
Monod expressions fitted to measured data by applying least square error minimization (arrow indicates 15% higher N-processing
rates of AOB at a DO level of 1.5 mg/L)(data from phase III, 25°C and high DO setpoint).

Figure 1-23. Comparison of Ko Values of Total Nitrifiers (AOB+NOB) and NOB.
(left) only in bench-scale batch-reactors at Blue Plains WWTP and (right) in full-scale at Strass WWTP.
From looking at the nitrogen balances during constant low DO, intermittent low DO and
intermittent high DO (Figure 1-24), it could be concluded that intermittent aeration increased the
total nitrogen loss by allowing anammox to take up the formed nitrite during anoxic periods and
by more efficient use of organic carbon by heterotrophic denitrification. Moreover, at high DO
operation the ammonium removal rates significantly increased and the latter also allowed for
more total nitrogen removal (Figure 1-23).
1-30
NH3 NO2 NO3
20
18
CONCENTRATION, mgN/L
16
14
12
10
8
6
4
2
0
9:07 9:36 10:04 10:33
NH3 NO2 NO3

20
18
16
14
12
10
8
6
4
2
0
9:07 9:36 10:04 10:33 11:02 11:31 12:00 12:28
NH3 NO2 NO3

20
18
16
14
12
10
8
6
4
2
0
9:07 9:36 10:04 10:33 11:02 11:31 12:00 12:28
Figure 1-24. Nitrogen Concentration Profiles in the SBR A During Constant Low DO Operation,
Intermittent Low DO Operation and Intermittent High DO Operation.

1.4.3.2 Ammonia Residual
Similar to the DO operation strategy of maintaining high AOB activity over NOB,
operating with ammonia residual is necessary to ensure no kinetic limitation on AOB activity
and maximum rates are achieved. Figure 1-25 shows the Monod function of the growth rates for
AOB and NOB as a function of ammonia and nitrite concentration. The graph suggests that
operating at ammonia concentrations higher than 2 mg N/L will be necessary to maintain higher
AOB growth rate than NOB. This is crucial for the ability to out-select NOB population. Figure
1-26 and 1-27 show profiles during one reaction cycle with high ammonia and low ammonia
residuals respectively. As seen from these profiles, when ammonia residual is high, high TN
removal was observed, but when ammonia residual is low, nitrate production increased
suggesting inadequate NOB out-selection.
Figure 1-25. AOB and NOB Monod Growth Rate Functions of NH4 and NO2 Concentrations.
Chandran and Smets, 2005.
1-32
Figure 1-26. SBR Ammonia, Nitrate, and Nitrite Profiles During One Reaction Cycle with High Ammonia Residual.
Figure 1-27. SBR Ammonia, Nitrate, and Nitrite Profiles During One Reaction Cycle with No Ammonia Residual.

1-34
CHAPTER 2.0
FULL-SCALE PILOTS AT STRASS WWTP

The data presented in this section encompass efforts under the following work tasks,
which are highly interwoven and therefore summarized within one report section.
 Task 1 – Demonstration Testing of Seeded Full-Plant.
The full-scale full-plant deammonification demonstration was installed in the Strass,
WWTP (Austria). Sidestream deammonification operates successfully and can provide seed for
bioaugmentation of the mainstream B-stage process. Minor modifications to existing
infrastructure including sludge transfer pipes and the cyclone classifier for AMX enrichment
were installed on the B-stage process waste activated sludge (WAS) line. Research objectives
include assessment of AMX efficiency and competiveness under colder wastewater
temperatures; evaluating cyclone design efficiency for separating anammox granules; evaluating
anammox attrition from pumping and recycle; and determining the minimum and maximum
anammox SRT for successful operation.
 Task 4 – Evaluation of Full-Scale Process Performance.
As operation of the full-scale demonstration continued (Phase 1, Task 1), data concerning
treatment performance and energy consumption were analyzed by the project team to apply to
the design and operation of the pilot testing efforts described in Tasks 2 and 3 of Phase 1.
 Task 6 – Molecular Verification of Population Dynamics.
This task applies qualitative and quantitative molecular techniques to determine and
monitor the population dynamics in the mainstream bioreactor. The latter allowed for
determination of the quantities of ordinary heterotrophic (OHO), AOB, NOB, and AMX to
verify anammox bacteria can be enriched in the mainstream.
2.1 Objective
The goal of the full-scale demonstration project at Strass WWTP was to demonstrate the
feasibility of the deammonification concept, which is already highly successful and proven in
sidestream configurations at this plant, for the mainstream process. The full-scale test plan at
Strauss WWTP was developed in conjunction with the results of the Blue Plains bench-scale
pilots. Using the fundamental process kinetics and the successful control mechanisms identified
for NOB outselection and AMX enrichment, process modeling was used to help identify the full-
scale demonstration strategy. The full-scale work is required to validate and advance the Blue
Plains bench-scale work. Data received from the trials will be systematically analyzed by
calibration of a numerical model which facilitates understanding of the project results in a
generic tool. Ultimately this model will help the implementation of this innovative technology at
many plants interested in this WERF study.

2.2 Testing Phases and Pilot Configurations
The trial conducted at the WWTP Strass aimed to evaluate anammox enrichment in the
mainstream, a task which was achieved by seeding active biomass from a sidestream SBR
reactor (Demon® process) to the mainstream and by further retaining the anammox biomass,
forming characteristic granules, in the mainstream with a cyclone system. The sampling at Strass
was started on April 27, 2011 (Control), when no seeding and cyclone operation had taken place.
The cyclone at the mainstream was installed on June 1, 2011 and seeding itself was launched on
June 8, 2011 (Tables 2-1 and 2-2)
The testing phases at the Strass WWTP can be separated into two regimes, depending on
the cyclone that was operating. The first cyclone (henceforth named “Cyclone A”) is a multiple
small cyclone setup which was replaced in the first week of September 2011 (shortly before
sampling #7) by an alternative setup using a larger cyclone at lower pressure (this cyclone is
henceforth denoted “Cyclone B”) (Figure 2-1).
Figure 2-1. Cyclones Installed at the B-Stage in Strass.

Cyclone A (left), Cyclone B since early September 2011 (right).
Traditionally the low-loaded biological stage (B-stage) at Strass is operated in a Modified

Ludzack-Ettinger (MLE)-mode. Usually the second tank in series is intermittently aerated and
controlled by the on-line ammonia signal at the effluent of the tank. At peak loading, aeration in
the first tank in series turns on (at a higher range of ammonia setpoints). In June, at the start-up
of seeding and cyclone operation, the treatment strategy was switched to SND-mode with all
four tanks in parallel at low DO (Figure 2-2). The B-stage was operated with tanks in series with
higher DO in the second tank (pre-denitrification), later with higher DO in the first tank (post-
denitrification), and finally back to MLE high DO-operation.
2-2
Table 2-1. Operational Modes and Phases at the Strass Pilot.
Cyclone Setup Date Operation Mode and DO set points in tanks T1 and T2
No cyclone before June Serial tanks: MLE mode T1 swing and T2=2.0
Batteries of small high pressure cyclones 01.06.2011
06.06.2011 Parallel tanks: T1=0.7 and T2=0.7
18.08.2011 Serial tanks: T1=0.5 and T2=0.7
2 large low pressure cyclones 06.09.2011
29.09.2013 Serial tanks: T1 = 0.9 and T2=0.4
28.11.20 Serial tanks: MLE mode T1 swing and T2 = 2.0
31.01.2012
Table 2-2. Sampling Plan at the Strass WWTP (Austria).
Sampling Date Interval (days) Interval (weeks) Accumulated (weeks)
1 27.04.2011 0 0 0
2 10.06.2011 44 6.3 6.3
3 01.07.2011 21 3.0 9.3
4 20.07.2011 19 2.7 12.0
5 10.08.2011 21 3.0 15.0
6 29.08.2011 19 2.7 17.7
7 14.09.2011 16 2.3 20.0
8 04.10.2011 20 2.9 22.9
9 27.10.2011 23 3.3 26.1
10 24.11.2011 28 4.0 30.1
11 20.12.2011 26 3.7 33.9
12 29.12.2011 9 1.3 35.1
0.15-0.20 0.50-0.55 0.14mg/L

0.00mg/L 0.01mg/L
0.01mg/L 0.00mg/L
0.10mg/L 0.40-50 0.30-0.40
Figure 2-2. Carousel Type Aeration Tank at Strass WWTP Providing a DO Range of
0.00 To 0.55 mg/L Along the Flow Path at Parallel Tank Operation.

2.2.1 Sidestream Reactor – Source of Seed Sludge
The deammonification process Demon® has been implemented at the Strass WWTP,
Austria, in an SBR tank (Figure 2-3) with a maximum volume of 500 m3 and at loading rates up
to 450 kg of ammonia nitrogen per day. The aeration system is operated within a very tight pH-
bandwidth of 0.01. Due to oxygen input, nitritation runs at a higher rate than anaerobic ammonia
oxidation, and H+ production drives the pH-value to the lower setpoint and aeration stops. While
dissolved oxygen is depleted, all the nitrite that has been accumulated during the aeration
interval is used for oxidizing ammonia. In the course of this biochemical process, some alkalinity
is recovered. Additionally, alkaline rejection water is fed continuously to the reactor until the
pH-value reaches the upper setpoint and aeration is switched on again.
Figure 2-3. Origin of the AMX Seed, the SBR Demon® Tank at the Strass WWTP (Austria).
2-4
2.2.2 Cyclone Characteristics
Cyclone A is a multiple small cyclone setup operated with seven cyclones. Cyclone B is a
setup with a single, larger cyclone, operating at lower pressure (Figure 2-1).
2.2.3 AMX Seed Rate
Two different approaches were used to transfer seed from the sidestream to the mainstream:
 Semi-continuous wasting of cyclone overflow: In every SBR-cycle for a defined period of
time the waste sludge of the sidestream DEMON was pumped to the mainstream system to
bioaugment as much AOB-biomass as possible and to avoid any uncontrolled loss of AMX
mass.
 Periodical seeding of mixed liquor (Figure 2-4): Ensures the transfer of a defined mass of
AMX granules without any size selection.
Figure 2-4. Seeding Volumes from the Sidestream Demon® Tank to the Mainstream B-Stage (m³/d)
Since the Beginning of the Sampling Campaign.

2.2.4 SRT Information
The total SRT in the B-stage shows a variability between five and approximately 20 days
throughout the year (Figure 2-5). The aerobic SRT is difficult to quantify due to the MLE-mode
having up to 100% swing zones controlled by online ammonia effluent concentration. In
general, out of the skiing season, the aerobic SRT is about 50% of the total SRT or less and
during the skiing season, the aerobic SRT reaches up to 100% of the total SRT.
Figure 2-5. Total SRT in the B-Stage at Strass During the First Project Year.
2-6
2.2.5 Carbon Availability
In principal, the two-stage biological treatment (A/B approach) appears perfect for the
deammonification strategy since reduced carbon availability in the B-stage means less
heterotrophic competition for nitrite. A typical COD-removal efficiency of 50-60% is achieved at
an SRT of 0.5 days (Figure 2-6) in the A-stage. During the summer season alum precipitation for
P-removal was shifted from the B-stage to the A-stage in order to improve upstream COD-removal
efficiency. However, this measure shows limited success and will be combined with polymer
dosage in the future.
During the winter season, at decreasing water temperature, the A-stage typically shows a
poorer performance. In the 2011/2012 winter, the COD-removal efficiency dropped as low as 40%
(Figure 2-6). An additional COD load was therefore passed on to the B-stage causing increased air
demand which offset some of the energy savings from the achieved nitrite shunt in N-removal.
COD-removal A-stage (%) COD influent B-stage (mg/L)

100 500
450
90
400
80 350
300
70
250
60 200
50 150
100
40
50
30 0
1-Jan-11 20-Feb-11 11-Apr-11 31-May-11 20-Jul-11 8-Sep-11 28-Oct-11 17-Dec-11 5-Feb-12
Figure 2-6. COD Removal Efficiency of the A-Stage and Available COD Concentration at the Influent to the B-Stage.

2.3 Experimental Setup and Methodology
The following subsections describe the sampling procedures and analytical methodology
used to measure microbial populations and activity. The first two subsections address sampling and
testing. Section 2.3.3 provides an in-depth description of methods used regarding: gravimetric
analysis, activity measurements, particle tracking, heme quantification, coulter-counter analysis,
DNA extraction and quantification, and a comparison of the methodologies studied.
2.3.1 Sampling, Sample Processing, and Sample Coding
Samples were taken at the WWTP Strass (Austria) from the following sources (Table 2-3
and Figure 2-7):
A total of 0.5 L was collected using a plastic beaker for subsequent molecular analyses
and particle tracking analyses. From that, 15 mL was immediately frozen for DNA extraction
and image analysis. For the activity measurements, 5 L of sample were collected and
heated/cooled to either 30°C or room temperature (~20°C).
Table 2-3. Sampling Types at the Strass WWTP.
Sampling Source Sample Code
B-stage mainstream B
B-stage mainstream cyclone overflow B-OF
B-stage mainstream cyclone underflow B-UF
Process water (Demon) PW
Process water cyclone overflow PW-OF
Process water cyclone underflow PW-UF
Sampling for the image analysis of different depth profiles was performed with a barrel
pump connected to a plastic tube. The tube was fixed to a metal bar to assure the correct
sampling depth. Samples were taken at 1, 3, and 5 m depth.
Figure 2-7. Cyclone Fractions and Tanks that Were Sampled At Strass WWTP (Austria).
Key: PW process water, PW-OF…Process water cyclone overflow, PW-UF…process water cyclone underflow,
B…B-stage, B-OF…cyclone B-stage overflow, B-UF…cyclone B-stage underflow.
2-8
2.3.2 Ex Situ Tests
Oxygen half saturation concentration for AOB and NOB growth were determined using
the same methods used at Blue Plains AWTP (See Section 1.3.2.6.1).
2.3.3 Method Development and Evaluation for the Quantification of Active AMX
Biomass (Podmirseg, et al. 2014)
The most widely used method to quantify abundance of active AMX mass is based on the
measured consumption rates of ammonia and nitrite (so called activity test; e.g., Wett et al.,
2007). In this study, the systematic measurement of enrichment of AMX granules was important
to assess the performance of the applied cyclone selection technology. For this purpose, a
method based on image analyses combined with color filtration was developed. In parallel to this
effort, the same working group has developed two alternative methods – one based on hem
measurement and the other one applying a coulter counter which is more commonly known from
the medical analyses field.
In a method comparison, samples were analyzed with six methodologically completely
different approaches, i.e., gravimetric analysis (GA), heme protein quantification (HQ), Coulter
counter analysis (CC), quantitative PCR (qPCR), activity measurements (AM) and a novel image
analysis approach, called Particle Tracking (PT) (Figure 2-8).
The aim of this study was to establish and/or optimize each strategy for the different
sample matrices (SL-sludge and B-biological) and summarize each technique’s specific assets
and drawbacks. The goal was to define a reliable, reproducible and user-friendly technique or
combination of techniques that allows for a fast and simple quantification and characterization of
AMX biomass. Applicability in standard lab-facilities of wastewater treatment plants was
considered as further benefit of a method for completing routine process examinations at
wastewater treatment facilities.
Figure 2-8. Experimental Design of the Method Evaluation Approach, Depicting the
Six Different Sample Types (SL; SL-OF; SL-UF; B; B;OF; B-UF)
and Methodological Approaches Used in This Study.

2.3.3.1 Gravimetric Analysis
Samples were collected in three replicates (1 L each) and special care for aliquotation of
samples was taken. AMX granules settle very fast in insufficiently mixed suspensions due to
their compactness and size. A mixer with Rushton impeller in a baffled vessel was used to
guarantee fully homogenized liquors and hence representative partition. Aliquots for AM, PT,
GA and HQ were used right away and samples used for CC, or qPCR were stored at 4°C and
20°C, respectively.
Gravimetric analyses were performed with membrane-filtered samples (Machery-Nagel
GF5 – diameter 25 mm) [suspended solids (SS)] that were dried each at 105°C overnight (O/N).
The organic fraction of the SS (VSS) was calculated after processing of dried samples in a
muffle furnace (550°C, three hours). Granular suspended solids (granular-SS) were collected and
gently washed on an analysis sieve (mesh size 0.125 mm), and dried at 105°C O/N.
2.3.3.2 Activity Measurements
The activity of the AMX was characterized as the measured conversion rates of NH4,
NO2 and NO3 in mixed liquor samples under nearly natural habitat conditions. For this, initial
ammonium was adjusted to 100 mg N/L with NH4HCO3 and nitrite to 70 mg N/L with NaNO2,
respectively. Phosphate buffer was added (10 mM) and the pH adjusted to 7.2. Representative
100 mL-aliquots of samples were transferred to 100 mL-Erlenmeyer flasks with screw caps.
These caps were equipped with a septum, perforated by a 2 mm sampling-tube and a hypodermic
needle as gas exit. The flasks were bubbled for 3 min with nitrogen gas via the sampling tube to
remove oxygen, and then incubated at 30°C and slowly mixed with a magnetic stirrer. Samples
(0.5 mL) were retrieved in 30 min intervals over a period of 4 hours and immediately centrifuged
in a pre-cooled rotor at 5.000 rfc for three minutes. The supernatant was then used for further
analysis. Nitrite and nitrate were quantified by ion pair reversed-phase high performance liquid
chromatography (RP-HPLC) (column: standard-C18, 5 µm, 50x4 mm; eluent: n-octylamine
(1 g/L) in 10% (v/v) methanol, pH 4 adjusted with phosphoric acid; flow-rate: 1.2 mL/min;
detection: UV 210 nm; modified protocol based on Doblander and Lackner (1996). Ammonium
was analyzed colorimetrically by the improved Berthelot reaction according to (Rhine et al.
1998). AMX activity was characterized as nitrogen turnover of the available ions of NH4, NO2
and NO3 (sum of all three species). Activity rates were calculated of linear concentration curve
progressions, i.e., an interval that is not characterized by substrate scarceness.
2.3.3.2.1 Anammox Activity Tests
The active AMX mass was quantified indirectly by ex situ tests where the rate of removal
of spiked nitrite loads is measured (Figure 2-9). Activity measurements were conducted in
combination with periodical sludge wastage according to the following protocol:
 Sampling of 5 L of sludge and spiking with NaNO2 (results NO2-N > 50 mg/L).
 Cover vessel. Start mixing and wait 5 minutes for complete dissolution of salt.
 Measurement of filtered samples for 4 data points for NH4-N, NO2-N, NO3-N, temperature,
DO, pH, time; time intervals were 0, 40, 80, 120 min for the mainstream samples and 0, 20,
40, 60 min for process water samples, respectively.
 Determine total suspended solids (TSS) concentration and calculate nitrite depletion and total
N-turnover per g TSS per hour: [g N/g TSS/hr].
2-10
Figure 2-9. Setup for Ex Situ Anammox Activity Tests in the Lab (right) and
an Example of a Measured Removal of N-Compounds (left).
2.3.3.2.2 AOB-Activity Tests

The AOB activity was tested with the same sample of 5 L as the anammox activity test.
The aerobic test was carried out after the anaerobic test using the following protocol:
 Start mixing and aerating and wait at least five minutes for stable DO-level (> 3 mg DO/L).
 Measurement from filtered samples every 15 minutes: Four data points for NH4-N, NO2-N,
NO3-N, temperature, DO, pH, time.
 Determine TSS concentration and calculate nitrite production dNO2-N per g TSS per hour:
[g /g TSS/h].
 Additional oxygen uptake rate (OUR)-test (DO-depletion profile after aeration has been
turned off) to quantify AOB-activity (Figure 2-10).
Figure 2-10. Setup for Ex Situ AOB-Activity Tests in the Lab (right)
and an Example of a Measured OUR (left).
DO and oxygen depletion rates were measured with a WTW Multi 3420 device (WTW
GmbH, Germany) and O2 FDO 925 probe (WTW GmbH, Germany).
The pH was measured with a WTW 323 device (WTW GmbH, Germany) and the Sentix
41 electrode (WTW GmbH, Germany) with an incorporated temperature sensor.

2.3.3.3 Particle Tracking
The particle tracking was conducted through an image analysis of the different sample
types. The image analysis was performed to quantify the number of anammox granules per mL
sample to estimate the total volume of granules compared to the total dry matter and to determine
the distribution of granule size fractions. This method was thus suited to evaluate the granule
enrichment and overall retention in the mainstream; and furthermore to compare the
effectiveness of the two cyclone types in separating anammox biomass from the WAS.
The open source software Fiji (http://fiji.sc/wiki/index.php/Fiji) was chosen for this
purpose. Samples were either analyzed directly after sampling (stored overnight at 4°C) or from
previously frozen and then thawed samples. The ideal dilution rates according to sampling type
were optimized as follows (Table 2-4).
Table 2-4. Dilution Factors Used for the Image Analysis According to Sampling Type.
Sample Code Dilution Factor
B 3 or 6
B-UF 6
B-OF 3 or 6
PW 6
PW-OF 6
PW-UF 30 or 60
MC 3
MC-OF 6
MC-UF 6
ContM 3
PWG 6
PWG-OF 6
PWG-UF 30
The samples were diluted accordingly in a total volume of 15 mL and transferred into a
sterile plastic petri dish. Petri dishes were scanned next to a ruler (to determine the scale) at
600 dpi with the Plustek OpticPro 640 scanner and a white background. Images were saved as
(*.tif) files.
The white balance of the images was corrected with the “improve color function” in the
Microsoft Office picture manager software by clicking directly in the area above the petri dish.
This step has to be optimized for each scanner type.
Files were analyzed with the Fiji software as follows:
 Drag and drop image to the bottom line of the program window.
 Calibrate image: use line tool -> draw line on scanned ruler (e.g., 11 cm) go to (analyze-> set
scale -> write known length (e.g., 110 ) choose mm as unit; check Global field (in order to
use this scale with every new image you open) => it is then approximately 23.5 pixel/mm or
0.0235/µm => OK.
 Use circle drawing tool -> chose whole area around the petri dish-> Edit-> copy (Strg + C);
then File-> new -> internal clipboard.
2-12
 Imag ge -> Color -> > Split chan
nnels -> you obtain three different wiindows of thhe image (bluue,
red, green)
g (Figurre 2-11).
 Proceess -> Imagee calculator ->- subtract th he blue from
m the red chaannel -> creaate new imagge
(this strategy wass chosen as iti increases best
b the conttrast of the ggranules commpared to thee
backg ground (wasste activated sludge).
 Inverrt image: Imaage -> Look kup tables -> Invert LUT T.
 Imag ge -> adjust ->
- Threshold d set at (Figu ure 2-12):
o 50/255 (e.g., for PW-, PW-OF or PW-UF-sam mples) -> Appply.
o 75/255* (e.g.,
( for B-stage mainstrream samplees (WAS andd granules) --> Apply.
 Add a median filtter (1.0 pixeels): Process -> Filter -> Median. (thiis step was iincluded to
reducce the noise ofo very smalll false posittive signals aand was stanndardized.
 Analy yze -> Analy yze particless -> set at: sh
how outline (or bare outlline if you ddon’t want thhem
all nu
umbered): diisplay resultss and chose a circularityy of 0.00-1.000 (by settingg the circularrity
at e.g
g., 0.95-1.00 only perfecttly round obj bjects will bee detected) (F
Figure 2-13)).
 Expo ort results to Excel.
Note: *TThis thresholdd was adjustted for each sampling timme as frozenn and fresh saamples can sshow
different properties; during
d our analysis
a the threshold
t setttings were sset between 660/255 and
75/255; once
o a thresh
hold was dettermined for a sampling date it was nnot changed again.
Figure 2-111. Splitting thee Scanned Imag

ge Into the Threee Channels (Redd, Green, and B
Blue).
Mainstream
m Deammonifiication 2-13
Figure 2-12. Adjusting the Threshold to Target Only the Granule Fraction in the Image.
Figure 2-13. Showing the Outline of Each Granule, Including the Area
Information that is Exported to Excel.
The analysis of the data obtained from the Fiji software were exported into Microsoft
Excel and for each sampling and sample type the following parameters were calculated (n=3 for
all sampling types per sampling date):
 Granules mL-1 sample. Mean value ± standard deviation (SD) for n=3.
 Total granule volume per mL sample.
2-14
To obtain the total granule volume, the area data (for each detected granule by Fiji) was
regarded as a spherical section. Therefore the radius and further the volume of each granule
could be deduced from the equations r= √A/∏ (circle area A) and V=4/3*r³*∏ (Volume). When
comparing the accumulated granule volumes within one sample with the total dry matter of a
sample, an overestimation by a factor of 10 was observed with the total sphere model (for PW-
UF samples). Thus, the model was adjusted with a new formula assuming cylindrical shapes
(Figure 2-14). As can be seen in the image analysis, most of the granules are not completely
spherical and the new cylindrical model should be more appropriate for a general volume
calculation.
Figure 2-14. Optimization of the Granule Volume Calculation

from an Initial Sphere to a Cylinder Model.
All detected granules were categorized by size and the abundance of each category
compared to the total granule abundance was calculated as a percent of total granules (Table 2-
5). After experimental tests with the different sample types, the density of each sample could be
defined as 1.01 ± 0.01. Therefore, the calculated granule volume (e.g., µL/mL) could be set equal
with granule weight (mg/mL) using the factor 1.01. Total granule weight was then compared to
the total dry matter for each sample type. This calculated the abundance of total granule weight
[%] compared to total TS (g/L).
Table 2-5. Selected Granules Size Categories of the Image Analysis.
Category Name Size Range [Mm]
1 > 0.4
2 0.4-0.3
3 0.3-0.2
4 0.2-0.1
5 < 0.1

2.3.3.4 Heme Quantification
In this study, alkaline extraction of heme proteins and subsequent spectrophotometric
measurement of the reduced hemochrome was performed. The procedure is based on the method
for heme quantification in animal tissue described by (Sinclair et al., 2001). It was optimized for
heme extraction from AMX, and the proposed measurement of the spectral difference of
oxidized and reduced heme was simplified. The procedure was sized to 2 mL Eppendorf tubes,
but can easily be scaled to the centrifugation tubes available, according to the following steps:
 After centrifugation of 1.5 mL of mixed liquor in 2 mL Eppendorf tubes at 5.000 rcf for
3 min, the supernatant was discarded and the pellet resuspended in 1 M NaOH up to the
original volume (1.5 mL).
 Tubes were placed with open lids in boiling water for 2 min, reclosed, and left for cooling
down to room temperature for approximately 10 min with occasional vortexing.
 Subsequently, cell fragments were spun down at 5.000 rcf for 3 min and 1 mL of supernatant
was transferred to 1 mL photometer-cuvettes.
For the reduction of heme, 100 µL of a freshly prepared (!) 200 g/L sodium dithionite in
1 M NaOH solution was added and mixed. After completion of heme reduction (approximately
5 min), the extinction of the supernatant at 535, 550 and 570 nm was measured with a
spectrophotometer and the peak height at 550 nm calculated in relation to the linear baseline
defined by the extinctions at 535 and 570 nm. Calibration of the analysis was performed with the
1-heme cytochrome c from horse heart (Sigma C-2506; M = 12.384 g/mol), possessing a molar
extinction coefficient of ε550 = 15.000 AU/M/cm.
Most spectrophotometers offer a method for three-wavelength-calibration, and for manual
calculation of the peak height (Absorption Units; AU), Equation 5 may be of use:
Equation 5:
𝐸570 − 𝐸535
𝑃𝑒𝑎𝑘 ℎ𝑒𝑖𝑔ℎ𝑡 (𝐴𝑈) = 𝐸550 − 𝐸535 − ∗ (550𝑛𝑚 − 535𝑛𝑚)
570𝑛𝑚 − 535𝑛𝑚
E535, E550, E570…measured extinctions at respective wavelength
2.3.3.5 Coulter-Counter Analysis

To define the abundance, total volume, and particle size distribution of AMX granules, a
Coulter counter approach was chosen. The principle of this method is the measurement of drops
in electrical conductivity, occurring whenever a particle passes a defined pore that separates two
electrodes immerged in an isotonic buffer solution. This alteration in electrical conductivity is
proportional to the electrically isolating granule volume and allows for a detailed sample
characterization (Coulter 1956).
Here the Multisizer II (Coulter Beckman Inc.) was used with a 1 mm aperture. For all
performed measurements, a specific isotonic buffer solution [0.73 g/L KH2PO4, 0.72 g/L
NaH2PO4 * H2O, 0.79 g/L NaCl, in Aqua dest. adjusted to pH 7.2 with 10 M NaOH] was used.
Calibration of the 256 allocable measuring channels was performed with Dowex 50W (Sigma
Aldrich) ion-exchange particles, made of styrol-divinyl-benzol. These spherically shaped
particles with an average diameter of 320 µm exhibit normal size distribution and were thus
ideally suited for this purpose. They were suspended in isotonic solution and visualized under a
stereo microscope (Leica MSV 266). Then, the normal size distribution and average particle size
2-16
were determined through image analysis [Fiji software; (excluding the color channel subtraction
step)]. These data allowed for the determination of the modal particle radius that could then be
applied for the size definition of the 256 measuring channels. The instrument software
automatically extrapolated size ranges of unknown measurement channels.
To avoid blocking of the aperture and to reduce the probability of coincidental
measurements, samples were first sieved through a 1 mm mesh-size sieve, collecting the flow-
through. Subsequently the latter was liberated from particles <125 µm by rinsing the granules
over a 0.125 mm sieve at a gentle water jet. Excess, non-granular sludge from the DEMON®
tank could be eliminated. The anammox granules were then resuspended into an isotonic buffer
solution and washed three times (i.e., suspended in the solution, sedimented (approximately
3 min), supernatant discarded). At this step the concentrated granule sample could be
resuspended in the desired volume (depending on the necessary dilution) and measured with the
Coulter counter.
2.3.3.6 DNA Extraction and Quantification
DNA extraction is required to complete molecular analysis and quantify the relative
amount of target bacterial populations and visualize genetic diversity of the target populations.
DNA extraction was conducted using a modified DNeasy® Blood and Tissue protocol
(QIAGEN; Handbook 07/2006), according to the "Pretreatment for Gram-Positive Bacteria"
work-flow. An initial physical break-up was added; 1 ml of sample, filled into an Eppendorf
tube, was put into liquid nitrogen for 5 min and then into a water bath at 65°C for another 5 min.
This step was repeated twice. After the chemical lysis (until step 5; i.e., buffer containing
lysozyme (20 mg/mL) and Proteinase K (included in the kit), another physical disruption was
added; samples were transferred to a PowerBead tube (MO BIO Laboratories, Inc.) and shaken
4 min at a frequency of 60 Hz in a horizontal shaker (Retsch MM2000, Germany). Samples were
then centrifuged at 8000 rcf for 3 min before the protocol was continued at step 6. Finally for the
last DNA elution step, instead of adding 200 µL of Buffer AE, 100 µL of Buffer AE, pre-heated
to 60°C were added at two successive steps (50 µL each).
2.3.3.6.1 Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
Real-time PCR was performed with the 1 X Sensimix™ SYBR® Hi-rox (Bioline, USA)
based on the DNA-intercalating dye SYBR Green I. The Rotorgene 6000 Real Time Thermal
Cycler (Corbett Research, Sydney, Australia) was used in combination with the Rotor-Gene
Series Software 1.7. Standard construction was performed from an enriched anammox-granule
sample with endpoint PCR and the primer set Pla46f and Amx667r (van der Star et al., 2007).
Freshly prepared, ten-fold dilutions ranging from 106 to 102 and 101.2 gene copies were used for
standard curve construction. Quantitative PCR was performed in 20 µL assays with each reaction
mix containing 1X Sensimix™ SYBR® Hi-rox (Bioline, USA), 250 nM of each primer,
0.4 mg/mL BSA, distilled water (RNase/DNase free, Gibco™, UK) and 2 µL of either
1:10 diluted DNA-extract, or standard DNA. Thermocycling was conducted in technical
duplicates as follows: initial 95°C for 10 min, 40 cycles of 20 s at 95°C, 20 s at 57°C, and 20 s at
72°C. To check for product specificity and potential primer, dimer formation runs were
completed with a melt-analysis starting from 60°C to 99°C with 0.25°C increments and a
transition rate of 5 s. The R² value of the standard curve was >0.999.
2.3.3.6.2 Denaturing Gradient Gel Analysis (DGGE)
Denaturing gradient gel electrophoresis (DGGE) was performed with the Ingeny phorU®
vertical electrophoresis system (Ingeny, The Netherlands). A denaturing chemical-concentration

(100% denaturant according to 7M urea plus 40% formamide in 1X TAE-buffer) optimized for
each tested primer pair was used. The anammox group was chosen as the first group to be
investigated. Altogether AMX, AOB, AOA, NOB will be screened with this method. For AMX,
the 16S rRNA was amplified with the primer pair listed in Table 2-6. After DNA quantification
with the PicoGreen dsDNA quantitation reagent (Invitrogen, Carlsbad, New Mexico) (1) 50 ng
of PCR product were loaded on the 7.5% acrylamide gel containing a 25-40% denaturing
chemical gradient. For each sampling point and sample type, three parallels were loaded on one
gel. The DGGE was run for 16 h at 60°C in 1X TAE buffer (pH 7.4) at 100 V. The Genecraft®
100 bp DNA ladder (#GC-015-004. Genecraft®. Germany) served as marker for subsequent
image normalization. Gels were stained with silver nitrate (2) using the Hoefer Automated Gel
Stainer (Amersham Pharmacia Biotech. Germany) and then analyzed with the GelCompar II
software package (version 4.0. Applied Maths, Belgium).
Table 2-6. Primer Sequences Used for the AMX Group.
Target Group Primer Name Sequence (5'-3') Reference

CGCCCGCCGCGCGCGGCGGGCGGG
Pla46F-GC GCGGGGGCACGGGGGGGGATTAGG van der Star et al. 2007.
AMX CATGCAAGTC
AMX667R ACCAGAAGTTCCACTCTC van der Star et al. 2007.
The DGGE gel was scanned at 600 dpi and banding patterns were normalized with the
GelCompar II software. For ideal band distinction scanned gel images were subjected to a
background normalization based on the “rolling ball” algorithm (3) performed with the Fiji
software (http://fiji.sc/wiki/index.php/Fiji). Banding patterns are normalized and cluster analysis
was carried out using the Dice correlation coefficient to obtain the pair-wise similarities and the
Ward algorithm. The program settings were set at 1.0% optimization and 0.5% position
tolerance.
2.3.3.6.3 Fluorescence In Situ Hybridization
This technique should allow for a detection of differences between granules from the
seeding source (Demon) and granules transferred to the mainstream. The completely different
habitat conditions (temperature, nutrients, DO, etc.) could lead to a change in the granule
composition or structure. This hypothesis was investigated via Fluorescence In Situ
Hybridization (FISH) and specific probes targeting AMX (different species), AOB and NOB.
FISH experiments were conducted as follows: AMX granules were fixed in 4%
paraformaldehyde solution overnight at 4°C immediately after sampling. They were then
embedded in Optimal Cutting Temperature (OCT) compound, cut into 20 µm slices with a
cryomicrotome (-20°C) and attached to poly-L-lysine coated slides, as shown by (Vlaeminck et
al., 2010). The FISH procedure was assessed as described by (Amman et al., 1990). The image
acquisition was performed with a Leica SP5 microscope.
2.3.3.7 Method Comparison
This study compared six methodologically completely different approaches that were
optimized for anammox quantification with a focus on fast, reliable and user-friendly techniques.
Results are illustrated in Figure 2-15 and summarized in Tables 2-7, 2-8, and 2-9. Among the
2-18
tested methods (GA, PT, CC, HQ, AM and qPCR), heme quantification and qPCR were best
suited to discriminate both sample types and all three cyclone-fractions, respectively. The novel
PT technique and CC analysis furthermore rendered valuable information on granule size
distribution, which can help to judge process operation and cyclone efficiency and give hints on
possible community distribution due to dominant granule size. Through a combination of the
latter two techniques, the researchers were able to enlighten the discrepancy of gross- and net-
biomass in anammox granules.
Figure 2-15. Non-Metric Multidimensional Scaling Ordination of Anammox/AnAOB Biomass Quantification for all Six
Sample Types (SL, SL-OF, SL-UF, B, B-OF and B-UF).
All six quantitative methods, GA, PT, HQ, AM, qPCR and CC were included for the calculation.
Samples from the same group are connected by lines defining convex hull surface area of NM-MDS scores.
Table 2-7. Summary of Sample Distinction by Different Methods, Compared to
Expected Results for the Six Investigated Sample Types.
Labeling Expected AMX Abundance* GA PT HQ AM qPCR CC

SL 2 2 2 2 2 2 2
SL-OF 3 3 3 3 3 3 3
SL-UF 1 1 1 1 1 1 1
B 5 5 6 5 6 5 n.a.
B-OF 6 5 5 6 5 6 n.a.
B-UF 4 3 4 4 4 4 n.a.
AMX Accuracy to measure
6 3 2 5 1 4
specificity abundance of AnAOB only
Notes:
Discrepancies highlighted in gray.
* Numbers are reflecting the ranked expected abundance with 1 representing the highest and 6, the lowest AMX
abundance, respectively; numbers in the bottom line are ranked from 1 (best suited method) to 6 (least suited method).

Table 2-8. Summary of the Used Techniques and Their Suitability for AMX Quantification.
Time
Needed
Method Methodological Background Advantages Drawbacks Detection limit Sample -1
not applicable to
Mass determination of granular fast, cheap smallest fraction
GA (<0.125 mm) not defined 6-8 h
biomass >0.125 mm diameter little equipment needed
not very specific
exact AMX abundance and red granule color with conventional
particle number/-area biomass area/-volume*; necessary for flat-bed scanner
PT determination through image granule size distribution activated sludge- ca. 50 µM particle
10 min
analysis
little equipment needed matrix diameter
relatively fast adjustable, here

the protocol was
exact; cheap adjusted that range
HQ protein quantification none known 30 min
measures mostly AMX of both sample
matrices was
little equipment needed captured;
biased through Non detect
denitrifier
sum of NO2-, NO3-, NH4-N measures activity not only if rate is low,
AM community and 6h
depletion/production- rates presence incubation can be
ammonia resolution
(B) prolonged
extraction- bias
AMX specific; if RNA-based 1.2 104 gene
qPCR 16S rRNA gene quantification
also activity parameter special equipment copies/L
1.5 d/ 3h**
needed
particle number/-volume special equipment ideal granule size

exact anammox abundance 2%-60% of
determination; needed;
CC and – volume* aperture; in this 45 min
granules assigned to size sample matrix study 20 µm
granule size distribution
channels dependent diameter
Notes:
* The Coulter counter renders the net biomass volume, whereas Particle Tracking the gross volume.
** First time including standard construction and DNA-extraction, second qPCR run only.
2-20
Table 2-9. Correlation of AMX Quantification Results Between each Tested Method for All Sample Types.
GA PT sieved PT total HQ qPCR AM
GA – 0.9537c 0.9384c 0.7094c 0.5361b 0.3706b

PT sieved 0.9537c – 0.9914c 0.7764c 0.6857c 0.489c
PT total 0.9384c 0.9914c – 0.7799c 0.6773c 0.5269c
HQ 0.7094c 0.7764c 0.7799c – 0.8082c 0.2981a
qPCR 0.5361b 0.6857c 0.6773c 0.8082c – 0.3829c
AM 0.3706b 0.489c 0.5269c 0.2981a 0.3829c –
Notes:
Pearson’s correlation coefficients shown together with their significance levels, defined as superscript letters:
a (p<0.01), b (p<0.001) and c (p<0.0005)
2.4 Results and Discussion

This section discusses results of the B-stage performance at the Strass WWTP. Sections
2.4.1 and 2.4.2 discuss the operational performance and activity measurements at Strass WWTP.
Section 2.4.3 presents more detailed information on AMX bioaugmentation and retention
strategies.
2.4.1 Operational Performance of Strass WWTP
One of the crucial goals for the trial was the outselection of NOB indicated by increasing
nitrite levels. The best performance in terms of nitrite formation was achieved with parallel tank
low-DO operation at the beginning of the experimental period and with MLE high-DO operation
at the end of the report period (Figure 2-16).
10.0 NH4-N effluent [mg/l] NO3-N effluent [mg/l] NO2-N effluent [mg/l]
9.0
8.0
7.0
6.0
5.0
4.0
3.0
2.0
1.0
0.0
17-May-11 6-Jul-11 25-Aug-11 14-Oct-11 3-Dec-11 22-Jan-12
Figure 2-16. Daily Nitrogen Effluent Concentration with Nitrite Level Indicating the
Two Most Successful Operation Modes for NOBRepression.

The direct comparison of nitrogen removal during the high-loaded Christmas season
2011 against 2010 (Figures 2-17 and 2-18) shows the enormous benefit due to the nitrite route in
N-removal. As confirmed by activity measurements during this period, approximately 25% of
ammonia oxidation produced nitrate while the major portion, 75%, was converted via the nitrite
shunt. Higher reduction rates for nitrite compared to nitrate resulted in a much higher overall N-
removal efficiency and less carbon was required. As a side effect of the use of the cyclones on
the B-stage in the Strass WWTP improved and stable settling properties were detected
Figure 2-19.
2010/2011 NO3-N effluent 2010/2011 NO2-N effluent 2011/2012 NO3-N effluent 2011/2012 NO2-N effluent
25
nitrogen concentration (mg N/L)
20
15
10
0
1-Dec 11-Dec 21-Dec 31-Dec 10-Jan 20-Jan 30-Jan
Figure 2-17. Comparison of This Year’s and Last Year’s Operational Data of the
Full-Scale Pilot Strass Indicating Advanced NOB Repression.
Typically high nitrate level at Christmas peak-load; similar temperature conditions of approximately 10°C,
load conditions and ammonia effluent concentrations of approximately 2-5 mg N/L for both years.
350000 2010/2011 loading PE 2011/2012 loading PE 2010/2011 mixed liquor TSS 2011/2012 mixed liquor TSS 7.0
300000 6.0
250000 5.0
PE (60gBOD)
200000 4.0
MLSS (g/L)
150000 3.0
100000 2.0
50000 1.0
0 0.0
Figure 2-18. Plant Loading Profiles (PE) and MLSS (TSS).

2010/2011 SVI 2011/2012 SVI 2010/2011 temperature 2011/2012 temperature
140 14
120 12
100 10
temperature (°C)
SVI (ml/g)
80 8
60 6
40 4
20 2
0 0
Figure 2-19. Sludge Volume Index (SVI) Profiles (mL/g) and Temperature (°C).
2-22
Because of significantly higher N-removal efficiency at lower air demand, the measured
specific energy uptake was substantial lower than the previous year (Figure 2-20).
2010/2011 specif.energy (kWh/kgNelim) 2011/2012 specif.energy (kWh/kgNelim)

10
9
8
7
6
5
4
3
2
1
0
1-Dec 11-Dec 21-Dec 31-Dec 10-Jan 20-Jan 30-Jan 9-Feb
Figure 2-20. Specific Energy Demand for Nitrogen Removal.

2.4.2 NOB Repression – Activity Measurements and Ko Determination
Activity measurements were performed over the whole experimental phase for
mainstream samples at the Strass WWTP. They were incubated at either 20°C (room
temperature) or 30°C (temperature of the SBR, where the seed originates from). A two-hour
anaerobic phase was followed by 45 minutes of aerobic incubation. Looking at the anaerobic
activity measurements, sample event #12 showed for the first time the trend of a simultaneous
ammonia and nitrite depletion (at 20°C) (see Table 2-10 and Figure 2-21). Prior to this, ammonia
seemed to be redissolved during the incubation period. This fact was even more pronounced at
higher temperatures (Figure 2-22). Coinciding with this sampling period, nitrite concentrations
of up to 0.7 mg/L were measured in the mainstream of the WWTP.
Table 2-10. Example of the Activity Measurements at Strass WWTP (Sampling Event #12).
Activity Measurement Anaerobic Measurement Time [min) T (°C) pH DO (mg/L) NH4-N NO2-N NO3-N
Sample B 20°C 1 0 20.5 6.96 0.05 14.00 9.96 2.65
Added NaNO2 + NH4Cl 275 mg / 255 mg 2 40 21.2 7.05 0.01 13.60 1.30 0.49
Sample Volume 5L 3 80 21.7 7.02 0.02 13.30 0.18 0.22
TS (g/L) 5.62 4 120 22.2 6.94 0.02 13.60 0.11 0.18
Activity Measurement Anaerobic Measurement Time (min) T (°C) pH DO (mg/L) NH4-N NO2-N NO3-N
Sample B 30°C 1 0 29.4 6.81 0.39 13.80 7.28 1.67
Added NaNO2 + NH4Cl 275 mg / 255 mg 2 40 29.4 6.96 0.01 14.10 0.47 0.33
Sample Volume 5L 3 80 29.4 6.91 0 15.00 0.22 0.26
TS (g/L) 5.62 4 120 29.4 6.85 0 15.50 0.23 0.25
Sample B 20°C 1 0 22.3 7.12 1.7 13.10 0.36 0.34
Added NaNO2 + NH4Cl 0/0 2 15 22.4 7.22 1.37 9.03 2.75 0.93
Sample Volume 5L 3 30 22.6 7.22 2.49 5.84 5.56 2.00
TS (g/L) 5.62 4 45 22.7 7.19 3.21 1.64 8.76 3.04
Sample B 30°C 1 0 29.2 7.09 1.18 14.60 0.28 0.36
Added NaNO2 + NH4Cl 0/0 2 15 29.1 7.15 2.12 10.20 3.90 1.29
Sample Volume 5L 3 30 28.8 7.14 3.12 5.66 7.88 2.90
TS [g/L] 5.62 4 45 28.6 7.17 4 1.44 11.16 3.91
Notes:
TS – total solids.
Measured parameters are: temperature, pH, DO, TS, NH4-N, NO2-N, NO3-N and DO-depletion at the end of the incubation (Data
not shown).
2-24
Figure 2-21. Production and Depletion Rates of NH4-N, NO2-N and NO3-N
During Anaerobic Incubation of B-Samples at 20°C.
During Anaerobic Incubation of B-Samples at 30°C.

Looking at the aerobic measurements for sample event #12, for the first time ammonia
depletion goes along with a nitrite production rate that is distinctly higher than the nitrate
production (Figure 2-23). This indicated a successful reduction of NOB activity. This trend was
more accentuated at 30°C (Figure 2-24).
During Aerobic Incubation of B-Samples at 20°C.
during Aerobic Incubation of B-Samples at 30°C.
2-26
Maximum growth rates at close to operating temperature (test temperature set at 20°C;
blue profile in Figure 2-25) clearly follows the actual loading conditions at the plant with
relatively high activity during the summer, minimum activity during off-season period in the fall
and maximum activity at peak season at the very end of the year. The 30°C profile in general
follows the same trend but does not show the distinct peak in the winter indicating that maximum
activity at low operating temperature (~ 10°C) does not translate into maximum activity in the
high-temperature tests. Obviously nitrifiers (AOB+NOB) cannot acclimate to significant
difference between operational temperature level and test temperature.
140
120
100
80
r,max(20°C)
60
r,max(30°C)
40
20
0
PN2 PN4 PN5 PN6 PN7 PN8 PN9 PN10 PN12
Figure 2-25. Temperature Impact on Maximum Growth Rates of Nitrifiers (in mg N/L/d) Calculated from
Measured DO Depletion Profiles of Mainstream Mixed Liquor Samples at 20°C and 30°C.

DO half-saturation coefficients as shown in Figure 2-26 do not exhibit a clear
temperature dependency. Moreover results do not indicate that nitrifiers adapt their oxygen
affinity to the operational DO-level in the biological system. The final sample (PN12) shows the
lowest Ko values although the highest DO-setpoints of 2.0 were applied (compared to 0.7 mg
DO/L at the initial samplings).
Ko values determined from sidestream DEMON samples are in a similar range of 0.3 mg
DO/L despite significantly higher maximum growth rates (~130 compared to ~90 for the
mainstream at 30°C).
0.7
0.6
0.5
0.4
ko(20°C)
0.3
ko(30°C)
0.2
0.1
0
PN2 PN4 PN5 PN6 PN7 PN8 PN9 PN10 PN12
Figure 2-26. Temperature Impact on Nitrifier DO Half Saturation Coefficients (Ko, mg O2/L) Calculated from
Measured DO Depletion Profiles of Mainstream Mixed Liquor Samples at 20°C and 30°C.
The determination of Ko values specifically for NOB yields lower values compared to
the total group of nitrifiers (Figure 2-27) which confirms findings from the bench-scale tests at
Blue Plains. Higher maximum growth rates and lower Ko values point out the difficulties in
NOB-repression. Only in the last sample this trend has been reversed and lower NOB-rates have
been measured.
r,max(20°C) r,max(30°C) r,max(NOB,20°C) r,max(NOB,30°C) ko(20°C) ko(30°C) ko(NOB,20°C) ko(NOB, 30°C)

250 0.8
0.7
200
0.6
0.5
150
0.4
100 0.3
0.2
50
0.1
0 0
PN6 PN7 PN9 PN12 PN6 PN7 PN9 PN12
Figure 2-27. Comparison of Maximum Growth Rates (left) and DO Half Saturation Ko (right) of
Total Nitrifiers (AOB+NOB) and NOB Only Calculated from Measured DO Depletion Profiles of
Mainstream Mixed Liquor Samples at 20°C and 30°C.
2-28
2.4.3 AMX Bioaugmentation and Retention Efficiency (Particle Tracking)
The particle strategy by image analysis using the Fiji software is a new technique used in
this research and has enabled the investigation of the following factors:
 Determination of exact granule abundance within different sample types.
o Evaluation of enrichment effectiveness of AMX biomass in the mainstream.
o Evaluation of retention capacity of AMX biomass in the mainstream.
 Grouping of particles into different size categories.
 Evaluation of cyclone effectiveness regarding granule selection.
 Estimation of total granule volume.
 Comparison of different sample depths to evaluate the mixing effectiveness within the
mainstream tank.
The method requires only slight adjustments for each sample type (i.e., the threshold has
to be determined once per sample type), and it is a fast tool that can be used as a standardized
monitoring technique. The data obtained through image analysis shall further be combined and
correlated with common parameters such as results from the quantitative real-time PCR, activity
measurements or chemical characteristics determining anammox biomass.
Particle tracking of the samples at the WWTP Strass was performed for all sampling
dates since the start of the survey. Data from the mainstream (B-samples) are given in more
detail as an illustration example (Figures 2-28 through 2-30), and all other sample types are
given as summaries in Figures 2-31 through 2-32.
particle size distribution per sample B-samples
100,00
90,00
< 0.1 mm [%]
80,00
70,00 0.2-0.1 mm [%]

60,00
0.3-0.2 mm [%]
[%]
50,00
40,00
0.4-0.3 mm [%]
30,00
20,00
> 0.4 mm [%]
10,00
0,00
B1 B2 B3 B4 B5 B6 B7 B8 B9 B1 B1 B1
0 1 2
sample type
Figure 2-28. Evolution of the Anammox Biomass in the Mainstream (B) from
Sampling One to Twelve – Distribution of Granule Size Fraction.

2.4.3.1 AMX Biomass in the B-Samples
As can be seen in Figure 2-28, the smallest size fraction of the granules (<0.1 mm radius)
represents the most abundant fraction of all detected granules in the mainstream. What can
however be noticed over time is the gradual increase in abundance of the other size fractions,
especially of fraction 4 (0.1 mm-0.2 mm radius).
At sample event #7, nearly all granules can be assigned to the smallest granule size
fraction. At this time, Cyclone A at the mainstream was exchanged with the alternative model
Cyclone B (Figure 2-1). It is not clear how this fact accounts for the change in granule size
distribution at sampling event #7.
The following sampling events (#8-12), clearly highlight the different properties of the
two cyclone models regarding granule size separation (see also Figure 2-32 left). Cyclone B
selects for bigger granules in the underflow and thus eventually enables the establishment of an
AMX biomass in the mainstream with clearly larger granule diameters. The overall effect on the
AMX biomass is hence more pronounced on granule size than on particle abundance as is shown
in Figure 2-29. The total particle number is not increasing but rather stagnating at a level of 5.7 ±
1.9 particles/mL sludge (sampling 3-12), whereas the total granule volume (Figure 2-30) is
constantly increasing after sampling event #7. By sampling event #12, granules of the size
fraction 1 (>0.4 mm) and 2 (0.3-0.4 mm) already account for 0.8% and 3.6% of all granules,
respectively.
Particles mL-1 B-sample

B1
14,00
B2
B3
B4
B5
B6
particles mL -1
B7
B8
B9
B10
B11
B12
0,00
sample type
Sampling One to Twelve – Abundance of Granules/mL.
2-30
B1
Particle volume µL mL-1 B sample
B2
0,1 B3
B4
B5
-1
B6
particle volume µL mL
B7
B8
B9
B10
B11
B12
0,0
sample type
Sampling One to Twelve – Estimated Granule Volume/mL.
2.4.3.2 AMX Biomass in the B-OF-Samples

The overflow fraction of the cyclone of the mainstream had an average particle number
of 4.4 ± 4.2 particles/mL, thus showing a high standard deviation (Figure 2-31). Looking at the
two different cyclones in particular, the variation (SD) was similar. As the trial proceeded,
granules > 0.2 mm emerged. With the exception of one single time point with 2.2% of
size 2 granules (radius 0.3-0.4 mm) - sampling event #10 - no granules >0.3 mm were detected in
the overflow.
Figure 2-31. Evolution of the AMX Biomass of the Mainstream Cyclone Overflow Fraction (B-OF)
from Sampling One to Twelve.
Distribution of granule size fraction (left); abundance of granules per mL (middle) and estimated granule volume per mL (right).

2.4.3.3 AMX Biomass in the B-UF-Samples
The anammox biomass in the cyclone underflow samples were continuously enriched
(particles/mL). Also, the granule size distribution could be directed towards larger granules
(cyclone properties). At the end of the sampling reported here, size 1 and 2 granules accounted
for 0.8% and 4.3% of all granules, respectively. This clear shift in granule size distribution can
also be seen in the graph in Figure 2-32 (right) where the increase in granule volume shows a
relatively steeper slope than the gain in particle number (Figure 2-32 middle). Particle numbers
in the underflow were roughly ten times higher than in the mainstream.
Figure 2-32. Evolution of the Anammox Biomass of the Mainstream Cyclone Underflow Fraction (B-UF)
Distribution of granule size fraction (left); abundance of granules/mL (middle) and estimated granule volume/mL (right).
2.4.3.4 AMX Biomass in Process Water (PW) Samples
The AMX biomass in the process water (PW) sample showed a very slow but steady
increase in the larger granule fractions (Figure 2-33). The overall particle abundance remained
stable. Again, the increase in total granule volume towards the end of the sampling campaign can
be attributed to the increase in the larger granule fraction. Due to the high seeding load, which is
transferred regularly from the sidestream to the mainstream in this experimental setup, a
deterioration of the ammonium-elimination capacity in the SBR would be expected. Looking at
the yearly average values this hypothesis is not supported. The yearly mean ammonium-
elimination of the SBR was as high as 96% for 2011, even exceeding the yearly mean of 95% for
2010. Thus the additional enrichment of anammox biomass in the mainstream does not
necessarily present a risk for the operation of a sidestream Demon® tank.
Figure 2-33. Evolution of the AMX Biomass of the Sidestream Process Water Tank (PW) from Sampling One to Twelve.
2-32
The surprising fact that despite high seeding rates the final anammox abundance (in terms
of granule volume) in the sidestream system was about twice as high as before the start of the
experiment can be explained by following observations (Figure 2-34). Excessive wasting and
bioaugmentation led to a significant drop in mixed liquor concentration (TSS decreased from ca.
4 g/L down to almost 2 g/L). As a consequence of a much lower mass of flocculent biomass, the
selection efficiency between flocs and granules improved and less granules embedded in the
floc-fraction were lost. After a recovery period of reduced seeding rates, the TSS level returned
to almost the same level as before but at a much higher portion of granules – a clearly visible
development.
Figure 2-34. Comparison of Sidestream (PW) Total Solids (TS) and Total Granule Volume
in PW-Samples Over the Sampling Period.

2.4.3.5 AMX Biomass in the Process Water Cyclone Overflow (PW-OF) Samples
The trends for the process water cyclone overflow (PW-OF) samples were similar as for
B-stage mainstream cyclone overflow (B-OF) samples. The cyclone was able to keep the
abundance of larger granules, in this case, size 1 granules (>0.4 mm) below 0.5% at all times
(Figure 2-35). The volume increase at the end of the sampling period is again due to the
generally larger granules in the whole SBR system.
Figure 2-35. Evolution of the AMX Biomass of the Sidestream Cyclone Overflow Fraction (PW-OF)
Distribution of granule size fraction (left); abundance of granules/mL (middle) and estimated granule volume/mL (right)
2.4.3.6 AMX Biomass of the Process Water Cyclone Underflow (PW-UF) Samples
The size distribution in the process water cyclone underflow (PW-UF) was similar as in
the PW and PW-OF. Over time, larger granules emerged and persisted in the system. The
cyclone underflow was characterized by a high abundance of size 4 and 5 granules. Smallest
granules represented less than one third of all granules in the end (Figure 2-36). Total particle
abundance reached the maximum at sampling event #7. Afterwards the total volume increase can
be attributed to the larger granules in the system.
Figure 2-36. Evolution of the AMX Biomass of the Sidestream Cyclone Underflow Fraction (PW-UF)
2-34
Figures 2-37 and 2-38 compare the different cyclone fractions and the mainstream-
sample regarding granule volume changes [µL/mL sample] and total granule weight compared to
total solids [%]. A slow increase of AMX biomass was noticeable in the mainstream. The next
sampling campaign will show the effectiveness of the granule retention through the cyclone
strategy. At the end of 2011, granules represented 0.4% of the TS in the mainstream, compared
to 3.2% in the cyclone underflow, respectively.
-1
Particle volume µL mL all B-samples
0,3
0,25
particle volume µL mL-1
0,2 B-OF
B
0,15 B-UF
0,1
0,05
0
0,0 5,0 10,0 15,0 20,0 25,0 30,0 35,0 40,0
t [w]
Figure 2-37. Granule Volume [µL/mL] of All Three B-Sample Types (Strass WWTP).
TS granules B-samples [%] on total TS
3,50
3,00
B-samples
2,50
B-OF-samples
2,00 B-UF-samples
[%]
1,50
1,00
0,50
0,00
0,0 5,0 10,0 15,0 20,0 25,0 30,0 35,0 40,0
t [weeks]
Figure 2-38. Granule Volume of All Three B-Sample Types (Strass WWTP) Denoted as % of the Total TS.

Figures 2-39 and 2-40 compare the different SBR cyclone fractions and the SBR-sample
itself regarding granules volume changes [µLmL sample] and the percentage of total granule
weight on total solids [%]. As can be seen in Figure 2-40, the granule fraction of the cyclone
underflow eventually made nearly all the total solids in the tank. These values also indicate that
the volume calculation model (image analysis) is not overestimating the granule volumes. The
anammox biomass of the PW samples lies above the cyclone overflow at all times and eventually
represents approximately 23% of the total dry matter in the SBR Demon® tank.
Particle volume µL mL-1 all PW-samples
25
20
particle volume µL mL-1
15
PW-OF
PW
10 PW-UF
0
0,0 5,0 10,0 15,0 20,0 25,0 30,0 35,0 40,0
t [w]
Figure 2-39. Granule Volume [µL/mL] of All Three PW-Sample Types (Strass WWTP).
TS granules of PW-samples [%] on total TS
100.00
PW-samples
PW-OF-
[%]
samples
PW-UF-
samples
0.00
0.0 5.0 10.0 15.0 20.0 25.0 30.0 35.0 40.0
t [weeks]
Figure 2-40. Granule Volume of All Three B-Sample Types (Strass WWTP) Denoted as % of the Total TS.
2-36
Figure 2-41 shows the direct correlation between biomass seeding from the SBR to the
mainstream and the granule abundance [particles/mL] in the mainstream. The particle abundance
decreased after longer periods of no to little seeding and increased after higher seeding rates.
After the initial seeding phase and cyclone operation, a minimum particle abundance of
2.4 particles/mL is maintained in the system.
Figure 2-41. Comparison of Seeding Rate of Anammox Biomass from the SBR to the Mainstream
to the Granule Abundance in the Mainstream [Granules/mL].
2.4.3.7 Granules Distribution Over Depth of Aeration Tank

A depth analysis was performed to show that activity measurements do not depend on the
sampling depth in the mainstream tank of the B-stage. In order to prove this, the particle tracking
method was used. Samples retrieved from the surface, 1-m, 3-m, and 5-m depth were compared
with each other. As can be seen in Figures 2-42 through 2-44, the four different samples showed
slightly different abundances of the different granule size fractions: e.g., the surface sample had
more granules of the size three and four and the 1-m sample showed mostly size one granules.
However after statistical analysis and taking into account standard deviations, no significant
(p<0.05) differences could be found for total dry matter, granule number/mL and the distribution
of granule size fractions among the samples. These findings show complete mixing and
homogenous granule distribution in the aeration tank can be assumed.

Figure 2-42. 2-Way-ANOVA of the Depth Analysis
Including Sampling Depth and Granule Size as
Categorical Predictor (Factor).
particle size distribution per sample

100,0
90,0
80,0
70,0
60,0 < 0.1 mm [%]

[%] 0.2-0.1 mm [%]
Figure 2-43. Abundance of Each Granule Size Fraction
50,0
0.3-0.2 mm [%]
Depending on Sampling Depth of the B-Stage

40,0 0.4-0.3 mm [%]
(Surface, 1 m, 3 m and 5 m). 30,0 > 0.4 mm [%]
20,0
10,0
0,0
B (surface) depth 1 depth 2 depth 3
sample type
Particles mL-1 sample
10
-1
particles mL
Figure 2-44. Granule Abundance per mL for

Each Sampling Depth. 1
sample type
B (surface) depth 1 depth 2 depth 3
2-38
2.4.4 Molecular Analysis
The molecular analysis of the anammox population in the Strass WWTP (Austria)
samples revealed the following trends.
2.4.4.1 Quantification of the AMX, AOB, and NOB Community in the Mainstream
Using RT-qPCR
The abundance of the microbial AOB, NOB, and AMX population was determined by
real-time PCR and is depicted in Figure 2-45. As shown in this figure, the anammox abundance
is generally lower than that of AOB and NOB. For all groups a slight decrease was noticed
during sampling 7 to 10, during the low load autumn period. Looking at the NOB population,
Nitrobacter showed few changes in the abundance, while for Nitrospira a steady decrease was
detected after sampling 12. Accordingly, at sampling 12, the activity measurements (Figure 2-45,
red square) showed for the first time a higher nitritation rate.
1.E+09
1.E+08
1.E+07
1.E+06
gene copies mL-1
1.E+05
1.E+04
1.E+03
1.E+02
1.E+01
1.E+00
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
sampling
AOB 16S rRNA Nb 16S rRNA AMX 16S rRNA Ns 16S rRNA
Figure 2-45. Result of the Quantitative Analysis of AMX, Nitrospira, Nitrobacter and AOB in the
Mainstream by qPCR Over the Whole Sampling Campaign.

2.4.4.1.1 In Situ Activity Measurements of Mainstream Samples
Aerobic and anaerobic activity measurements were performed throughout the whole
sampling campaign. This section presents the results of the experiments performed at 20°C (also
10°C and 30°C were tested). As was shown in Figures 2-24 and 2-26, there is a change in the
dynamics starting from sampling 12. The aerobic incubation confirmed an inhibition of the NOB
group by nitrite accumulation and the anaerobic incubation showed for the first time an
simultaneous ammonia and nitrite depletion (also at sampling 15). Further investigation on
which chemical ammonia resolution biases the actual ammonia depletion rate is needed. A
combination of activity measurement and qPCR results is shown in Figure 2-46.
20°C RT Aerobic Incubation

8.0
7.0
6.0
5.0
∆NH4
4.0
3.0
∆NO2
[∆ mg g-1 h -1]
2.0
1.0
0.0 ∆NO3
-1.0
-2.0
-3.0
-4.0 5 6 7 8 9 10 12 13 14 15 16 17
-5.0
-6.0
-7.0
-8.0 samplings
Figure 2-46. Start of NOB Repression After Sampling 12 in the Mainstream;

Comparison of qPCR and Activity Measurement Results.
2.4.4.2 Qualitative Community Analysis Through DGGE
To monitor the dynamics of the AOB, NOB, and AMX community in the mainstream,
DGGE analysis was performed for the following groups: AMX (Pla46f-GC/AMX667r), ammonia
oxidizing bacteria (AOB) (189f-GC/654r), Nitrobacter (Nitro1198f-GC/1423r), Nitrospira
(NTSPAf-GC/NTSPAr). Additionally selected samples from the sidestream (Process water, PW)
from sampling 1, 6, 12, and 17 were loaded to compare the population of the seeding source
(Demon) and the receiving tank (mainstream B-stage) The following trends were detected.
2.4.4.2.1 AMX
Diversity of AMX was generally relatively low (Figure 2-47). Sampling 1 (control
sample before start of seeding) completely clustered apart from all other samplings expressing
the prompt effect of seeding biomass from the Demon to the mainstream. The dominant bands
that can be found in process water samples were immediately found in the mainstream. They
represented the most abundant group. Faint bands that could be seen at sampling 1, i.e., without
AMX enrichment, disappeared throughout the sampling campaign, indicating the dominance of
the population from the seeding source.
2-40
Figure 2-47. Denaturing Gradient Gel Electrophoresis of Amplified Anammox 16S DNA Gene Fragments of Mainstream
Samples B1-B17 Combined with Sidestream Samples (PW) of Four Sampling Points.
M…Marker, 1-17…mainstream samples; PW…process water (sidestream); three replicas per sampling time were loaded.
2.4.4.2.2 AOB
In contrast to the Nitrospira, Nitrobacter and AMX analyses, the AOB fingerprint pattern
of sampling 1 was not different from the subsequent samplings (Figure 2-48). This indicates that
the autochthonous community was not affected by the seeding from the Demon. However there
was a community shift after sampling 7 that points out that the AOB population was more
influenced by changes in the operational strategy. Another hint for this finding might be that
bands detected in the PW samples could not be found in the mainstream samples.
Figure 2-48. Denaturing Gradient Gel Electrophoresis of Amplified AOB 16S DNA Gene Fragments of Mainstream Samples
B1-B17 Combined with Sidestream Samples (PW) of Four Sampling Points.
M…Marker, 1-17…mainstream samples; PW…process water (sidestream); three replicate at a time were loaded.
2.4.4.2.3 Nitrobacter
Contrary to Nitrospira analysis, the primer pair targeting Nitrobacter species revealed a
more diverse and more dynamic community. Samples from the sidestream clearly grouped apart
from the mainstream. The GelCompar II software analysis defined three clusters for the
mainstream, namely sampling 1-7, sampling 8-12 and sampling 13-17. These results are in
accordance with real-time PCR and activity measurement results (Figure 2-49) that suggest at
least three phases during the monitoring period.

Figure 2-49. Denaturing Gradient Gel Electrophoresis of Amplified Nitrobacter 16S DNA Gene Fragments of Mainstream
Samples B1-B17 Combined with Sidestream Samples (PW) of Four Sampling Points.
M…Marker, 1-17…mainstream samples; PW…process water (sidestream); three replicates per sampling time were loaded.
2.4.4.3 Morphology of AMX Granules from Strass WWTP (Austria)
The appearance of AMX granules was determined using binocular loupe magnification, as
shown in Figure 2-50 (upper right, lower left). Interestingly, ciliates belonging to the genus
Vorticella sp. were found attached to AMX granules. Indeed, previous studies indicated that the
most dominant protozoan group found in wastewater treatment plants belong to the ciliated family
(Martín-Cereceda et al., 2001, Papadimitriou et al., 2007). Overall, they were found to be
responsible for decreasing bacterial numbers contained in wastewater. In addition, some protozoa
have the capability to consume dissolved and flocculated organic matter (Bishop et al., 1995).
Figure 2-50. Light Microscopy (upper left, lower right) and Binocular Loupe Image
(upper right, lower left) of Granules from the Strass WWTP.
2-42
The FISH image of the granule cross-section showed that anammox bacteria hybridizing
with the probe Amx820-Cy5 were present throughout the granules from sidestream (Figure 2-51).
This probe targets both “Candidatus Brocadia” and “Candidatus Kuenenia.” To distinguish
between these two genera, other probes like Ban162 and Kst157 should be used in the next trials.
The aforementioned probe Amx820 has been widely used by several authors for the
characterization of AMX granules (Cho et al., 2010; Lopez et al., 2008; Vlaeminck et al., 2010).
Figure 2-51. Fluorescence in Situ Hybridization with the 16S rRNA Gene Targeting Probe AMX820.
Granules slice thickness 20 µM.
AMX granules are characterized by a heterogenous and rough surface with lobate
extrusions and cavities (Figure 2-52), as shown by the scanning electron microscopy. This fact
could explain the interstitial voids observed in the granules slices (Figure 2-50, lower right).
Accordingly, (Cho et al., 2010; Vlaeminck et al., 2010) reported a similar external morphology
of AMX granules using scanning electron microscopy. Preliminary results indicate that the
granules are completely composed of anammox biomass, as no cohesive layer of AOB could be
detected on the granule surface but there were some AOB accumulations. Further trials and
slicing of the granules shall confirm the exact distribution of these two groups.
Figure 2-52. Morphology Analysis of a Mainstream Anammox Granule of the Mainstream in Strass
by Scanning Electron Microscopy.

2.4.4.4 Summary of the Sequencing Approach of Selected Samples
The following sections provide a summary of the sequencing approach of selected
samples of the mainstream deammonification campaign in Strass and of four different DEMON
plants, with a special focus on AMX, AOB and NOB. The community structure of several
biomass samples (Mainstream Deammonification and DEMON-sidestream process), was
characterised through a sequencing approach (Ion Torrent Personal Genome Machine) targeting
the V6 region of the 16S rRNA gene with the primer pair 1055F/1392R (Ferris et al., 1996). For
the full-scale mainstream deammonification monitoring in Strass, DEMON and selected
mainstream samples were analysed.
2.4.4.4.1 AMX Population
For Strass WWTP, most sequences retrieved from the DEMON were grouped into an
unclassified group of Brocadiaceae (75%) and the remaining sequences could be assigned to
Candidatus Brocadia fulgida (25%). The mainstream showed exactly the same community
pattern at time point 1 (i.e., sample A, the control sampling, prior to DEMON seeding into the
mainstream).
Over the monitoring period, the abundance of these two clusters varied drastically in the
mainstream, with the pooled sample B (time point 3, 4, and 5) comprising 75% of Candidatus B.
fulgida and only 25% of the unclassified group. At sampling C (time point 7, 8, 9, and 10), this
trend was turned around again with reduced Candidatus B. fulgida (16.7%) and the dominant
unclassified group (83.3%). The last two samples D and E (i.e., sampling 11+12 (D) pooled and
15, 16, and 17 (E) pooled, respectively) were very similar to each other, but not to the prior
sampling points. Here the general diversity was increased with sequences of Candidatus B.
anammoxidans and Candidatus Anammoxoglobus showing up. The relative abundance for
sample D and E, respectively was as follows: Candidatus Anammoxoglobus 0.2% / 0.62%,
Candidatus B. anammoxidans 0% / 0.15%, Candidatus B. fulgida 95.3% / 90.4%, and the
unclassified cluster 4.55% / 8.8%.
Looking at the three other DEMON samples (WWTP Glarnerland, Lavis with low
temperature leachate treatment and Limmattal with high COD sludge liquor treatment), also here
the unclassified cluster was also the dominant group, with 62.7%, 87.4%, and 66.3%,
respectively (Figure 2-53). The second most abundant group was Candidatus B. fulgida with
37.3%, 12.3%, and 33.7% in the respective samples. Candidatus B. anammoxidans was present
at low abundance in WWTP Lavis (0.15%) and Limmattal (0.05%) and Candidatus Kuenenia
could only be detected in WWTP Lavis (0.15%).
2.4.4.4.2 AOB Population
The AOB community showed two distinct patterns for the DEMON samples. WWTP
Strass, Lavis and Limmattal samples were dominated by Nitrosomonas-sequences (>91%),
whereas the DEMON in Glarnerland showed a dominance of an unclassified cluster (85%) and
only then Nitrosomonas-sequences (12.2%). Additionally here a Nitrosospira-cluster (2.3%) was
identified. All DEMON samples, except for WWTP Strass exhibited a small population of a yet
uncultured cluster (<4.4%).
2-44
Figure 2-53. Relative Abundance of Brocadia-Clusters in Different
DEMON and Mainstream Samples.
The evolution of the mainstream AOB-community (Strass) followed an interesting trend.

The initial population was comprised of an unclassified (66.7%) and an uncultured cluster
(33.3%) and eventually assimilated with the seeding source (DEMON), showing a final
dominance of Nitrosomonas-sequences (97.7%) and reduced unclassified (1.88%) and
uncultured (0.44%) population.
2.4.4.4.3 NOB Population
The sequencing result for NOB showed a clear dominance of Nitrospira-sequences in all
samples, except for the DEMON tank at WWTP Glarnerland, where only Nitrobacter-sequences
could be detected. In general, Nitrobacter-sequences were restricted to the DEMON in Strass
and Glarnerland. Interestingly a third group, an unclassified cluster of NOB could be detected in
the DEMON Limmattal sample but in no other sample. Here, apart from the dominant Nitrospira
(64%), this cluster encompassed the remaining 36% of all sequences.
These results have to be considered as general indicator of diversity and distribution but
absolute sequences that could be retrieved from each sample differed considerably.

Figure 2-54. Setup of GHG Measurement Equipment During a WERF Project Meeting at Strass WWTP.
2-46
2.4.5 Greenhouse Gas Emissions (NO and N2O as Intermediate Products in
N-Removal)
Three sets of week-long measurement campaigns were carried out for measuring
greenhouse gas (GHG) emissions (N2O, NO, NO2, CH4, CO2) in order to compare carbon
footprint before and after modifications in operation and to understand process implications on
the gas phase (Figure 2-54). Preliminary results indicate significantly higher NO- and N2O-
emissions at higher nitrite levels during the transition period after switching operation modes
(comparing Figure 2-55 versus Figure 2-56).
Figure 2-55. GHG Emissions in the B-Stage, Nitrification, Aerated Zone (1st campaign).
Figure 2-56. GHG Emissions in the B-Stage, Mainstream Demon, Aerated Zone (2nd campaign).

2-48
CHAPTER 3.0
DUAL-STAGE MAINSTREAM DEAMMONIFICATION

WITHOUT BIOAUGMENATION –
FULL-PLANT DEAMMONIFICATION FOR ENERGY
POSITIVE NITROGEN REMOVAL CHESAPEAKE-
ELIZABETH NUTRIENT REMOVAL PILOT STUDY
On December 29, 2010, the U.S. Environmental Protection Agency (U.S. EPA)
established the Chesapeake Bay Total Maximum Daily Load (TMDL) to restore clean water in
the Chesapeake Bay and the region’s streams, creeks and rivers. Accordingly, each state that
discharges into the Chesapeake Bay has prepared a Watershed Implementation Plan (WIP). Each
WIP is designed to accomplish a set of allocation goals identified in the EPA Chesapeake Bay
TMDL. In Virginia’s WIP, the Hampton Roads Sanitation District (HRSD) is required to meet
the following limits for the seven wastewater plants (cumulatively) that discharge into the James
River basin:
 Reduce total nitrogen discharged by 1.6 million pounds annually by December 31, 2016.
 Potentially reduce total nitrogen discharged by an additional 1 million pounds annually by
December 31, 2021.
Since the limits are based on the total mass discharged from all seven of the HRSD-
operated plants discharging to the James River basin, HRSD has the flexibility to make the most
cost-effective plant modifications collectively to meet the nutrient allocations. HRSD determined
that upgrading the 24 mgd Chesapeake-Elizabeth Treatment Plant (CETP), which primarily
serves Virginia Beach and Norfolk, would be the most cost-effective solution to meet the 2021
nutrient allocation of 3.4 million pounds per year (current nutrient allocation is six million
pounds per year).
Several typical wastewater treatment plant configurations could be applied to reduce
effluent nitrogen. These traditional solutions, although proven effective, increase cost to
ratepayers primarily due to external carbon use, frequently methanol. Several emerging
technologies could remove the nitrogen with much less or even without external carbon usage,
with lower oxygen requirements, and with reduced alkalinity requirements – all contributing to a
lower life-cycle cost. To help evaluate potential emerging process configurations to implement
for the CETP upgrades, HRSD is conducting pilot testing (approximately 5 gpm) of several
nitrogen removal process alternatives that include a novel deammonification process
(Figure 3-1).

Figure 3-1. HRSD A-B Pilot Process Flow Diagram (Pilot 1.0).
The two major objectives of the pilot study at HRSD’s CETP were:
1) To study the feasibility of a biological nitrogen removal upgrade of CETP at a reduced
capital and operating costs.
2) To explore possibilities for the implementation of new shortcut nitrogen removal through
repression of NO2- oxidation and polishing using anammox, which could be applied beyond
the CETP upgrade.
The adsorption/bio-oxidation (A-B) pilot study consisted of a common A-stage feeding

two parallel B-stages. The A-stage was a high-rate activated sludge (HRAS) process. The B-
stage intended for the first objective was a plug-flow activated sludge process and was named
AOB versus NOB (AVN). The second B-stage was a continuous stirred tank reactor (CSTR)
activated sludge process followed by an anammox moving bed biofilm reactor (MBBR) for
nitrogen polishing, the combined process was named AVN+. The process flow diagram
presented in Figure 3-1 gives an overview of the pilot study setup.
The results and discussion provided herein are based on the pilot configuration as shown
in Figure 3-1. The pilot was later modified to include two parallel A-stages and one plug-flow
AVN process that was followed by a MBBR with anammox as shown in Figure 3-2. Only one
A-stage (HRAS-control) was connected to the B-stage, while the other A-stage served as an
experimental train (HRAS-experimental) to understand the mechanisms of carbon removal in
high-rate processes. Note that the parallel experimental A-stage is not shown in Figure 3-2, but is
designed identically to the control A-stage.
3-2
Figure 3-2. HRSD A-B Pilot Process Flow Diagram (Pilot 2.0).
3.1 Material and Methods

The materials and methods used. to evaluate the dual-stage mainstream
deammonification without bioaugmentation are described in the following subsections.
3.1.1 Preliminary Treatment
Using a chopper pump, raw wastewater influent (RWI) for the pilot process was pumped
from the effluent channel of the preliminary treatment facility (PTF) at the CETP. The PTF
includes fine screens and forced vortex grit removal. Due to the inefficiencies of the PTF, the
pumped RWI first passed through a 208 L drum equipped with a variable speed mixer that was
operated at a speed that allowed grit to settle but kept particulate and colloidal organic matter in
suspension. Accumulated grit was periodically removed by draining and cleaning out the tank.
Floatable material, such as oil and grease, was continuously removed by allowing the tank to
overflow to a floor drain. From the grit and scum removal tank, the RWI was pumped by a
peristaltic pump through basket screens with 2.4 mm openings into a temperature control tank.
This tank contained a submersible heater to maintain the desired operating temperature during
colder months, and a finned-tube coil with coolant recirculated through a water-cooled chiller for
temperature control during the warmer months.
A programmable logic controller (PLC) controlled power to the heater and chiller based
on a signal from a thermocouple in the temperature control tank and a user setpoint. This setup
provided the capability to provide a constant influent wastewater temperature to the biological
processes anywhere from 15 to 25°C. The temperature control tank also contained a constant
speed mixer. These processes were only necessary for the pilot and not intended for the full-scale
pilot.
3.1.2 A-Stage High-Rate Activated Sludge Process (HRAS)
The A-stage reactor was constructed from clear polyvinylchloride (PVC) pipe supported
vertically on one end with an operating volume of 170 L, a hydraulic retention time (HRT) of 30
minutes, and a side water depth of 3.4 meters. Aeration was provided using compressed air and a
17.7 cm membrane disc diffuser with the DO monitored by a DO sensor. The reactor was
completely sealed and vented through a waterseal in order to monitor the off-gases. The desired
DO setpoint was maintained using a single-loop proportional-integral-derivative (PID) controller
modulating a mechanically operated valve (MOV) on the compressed air line. Since the HRAS
reactor was mixed only by aeration, a minimum MOV closure was set to ensure continuous
airflow. The SRT of the A-stage process was controlled either by wasting solids directly from the
reactor (Garrett configuration) or from the clarifier underflow using a programmable digital

peristaltic pump. The SRT was maintained between 1 to 6 hours depending on the desired MLSS
concentration.
The reactor overflowed by gravity to a steep cone-bottom clarifier. The clarifier had a
submerged vertical inlet inside of a center well. This configuration helped dissipate the influent
hydraulic energy and allowed additional bioflocculation to occur before solids separation. The
clarifier was fitted with a scraper mechanism that rotated at 0.25 rpm and directed settled solids
to the bottom of the clarifier cone. A peristaltic pump returned settled biomass in the clarifier to
the aeration tank at a rate of 50-150% of the influent flow. The surface overflow rate (SOR) was
0.7 m3/m2·hr and a solids loading rate (SLR) of 1.4 kg/m2·hr at 100% return activated sludge
(RAS) and 3000 mg/L MLSS. The RAS flow was monitored using a magnetic flow meter. The
SRT of the HRAS process was controlled by wasting solids from the underflow of the clarifier
using a programmable digital peristaltic pump. Effluent from the clarifier overflowed to a 208 L
drum that served as a flow through feed storage tank for the B-stages. Effluent suspended solids
(ESS) and pH were monitored in this tank. Mixing was maintained with a constant speed mixer.
A-stage effluent was pumped from the feed storage tank to the B-stages with a programmable
digital peristaltic pump.
The composition of carbon dioxide and oxygen in the off-gases was periodically
monitored using a Servomex gas analyzer. Composite samples were collected from the influent
and effluent and analyzed for TSS, VSS, total and soluble carbonaceous biochemical oxygen
demand (cBOD), COD, sCOD (1.5 µm), sCOD (0.45 µm), filtered flocculated chemical oxygen
demand ( ffCOD), total kjeldahl nitrogen (TKN), simplified total kjeldahl nitrogen (sTKN), TP,
soluble total phosphorus (sTP), PO43--P, total ammonia nitrogen (TAN), volatile fatty acid
(VFA), calcium, magnesium, and alkalinity. Grab samples were also routinely collected from the
biological reactor and analyzed for MLSS, mixed liquor volatile suspended solids (MLVSS),
TKN, COD, and TP.
3.1.3 B-Stage AVN
The B-stage-AVN consisted of three equal volume tanks in series, each 151 L for a total
operating volume of 454 L, and a cone-bottom clarifier. The clarifier had a submerged vertical
inlet inside of a center well. This configuration helped dissipate the influent hydraulic energy and
allowed additional bioflocculation to occur before solids separation. The clarifier was fitted with
a scraper mechanism that rotated at 0.25 rpm and directed settled solids to the bottom of the
clarifier cone. A peristaltic pump returned settled biomass in the clarifier to the aeration tank.
The SOR was 0.1 m3/m2·hr and a SLR of 0.3 kg/m2·hr at 100% RAS and 3000 mg/L MLSS. All
three biological reactors were equipped with a variable speed mixer (Caframo: Georgian Bluffs,
Ontario, Canada) at G = 106/s to maintain complete-mix conditions. Aeration was provided
using compressed air and a 22.9 cm membrane disc diffuser with the DO monitored by a DO
sensor. The desired DO setpoint was maintained using ON/OFF switching of solenoid valves on
the compressed air line. Tanks were intermittently aerated and the aeration pattern was controlled
based on the effluent NH4+-N setpoint. The aeration capacity allowed all 3 tanks to be
intermittently aerated without a defined anoxic zone. The AVN had a total HRT of 4 hours, with
the influent set at a constant flow of 1.9 L/min. This HRT represents the existing HRT of
CETP’s aeration tanks when operating at design flow.
There was a provision for an internal mixed liquor recycle (IMLR) line to return nitrified
mixed liquor from the last aerobic reactor to the first reactor using a peristaltic pump at a rate
between 100-400% of the influent flow. When IMLR was used, the first tank was not aerated.
3-4
RAS from the clarifier was returned to the first reactor at 100% of the influent flow. SRT was
controlled by wasting solids from the last aerobic tank (Garrett configuration). The SRT was
maintained between 5-10 days based on operation performance and MLSS concentration. pH
was monitored using a probe in the last aerobic reactor. Although there was a provision to
control pH using a proportional controller with sodium hydroxide solution addition to the final
aerobic reactor, it was rarely used.
This system was controlled using AVN (NH4) aeration control. Under this control
strategy, a fixed total cycle time (in minutes) was defined by the user. Each cycle consisted of an
aerobic period followed by an anoxic period, each of which would vary based on effluent NH4+-
N. The desired range of effluent NH4+-N concentration was user-selected. For example, the user
selects an effluent NH4+-N range of 2-4 mg N/L, a total cycle time of 14 minutes, a DO level of
1.5 mg O2/L (these were typical values used throughout the experiments), and assume the initial
aerobic/anoxic fraction is 7 minutes aerobic and 7 minutes anoxic. If the effluent NH4+-N
increased above 4 mg/L, the aerobic fraction was increased by 1 minute and the anoxic fraction
was decreased by 1 minute, so the new ratio was 8 minutes aerobic/6 minutes anoxic. This
continued until the effluent NH4+-N was within the desired range, at which point the controller
did not change the time periods (Figure 3-3A). When the effluent NH4+-N level dropped below
2 mg/L, the length of the aerobic period decreased and the length of the anoxic period increased,
until the effluent NH4+-N level returned to within the desired range. To prevent over or under-
aeration, the system contained a user-defined maximum and minimum aeration period duration.
Because air flow was controlled by solenoid valves, to achieve an average DO of 1.5 mg O2/L,
the solenoids were set to open at 1.2 mg O2/L (low DO setpoint) and close at 1.7 mg O2/L (high
DO setpoint). A graphical representation of the ON/OFF DO controller is provided in Figure
3-3B.

A
NO NO
online [NH4-N] > High online [NH4-N] < Low
Aerobic Duration Unchanged
setpoint setpoint
YES YES
Increase Aerobic Duration Decrease Aerobic Duration
Figure 3-3. A) Graphic Representation of the Control Logic of Ammonia-Based Intermittent Aeration Control.
B) Graphic Representation of ON/OFF DO Controller During One Cycle.
3.1.4 B-Stage AVN CSTR with Anammox MBBR

The AVN CSTR included a single 340 L aeration tank and a cone-bottom clarifier. While
it is recognized that a more plug-flow reactor configuration would be expected for full-scale
implementation, a single CSTR was used for this study for simplicity associated with the
development and testing of the aeration control schemes. The clarifier had a submerged vertical
inlet inside of a center well. This configuration helped dissipate the influent hydraulic energy and
allowed additional bioflocculation to occur before solids separation. The clarifier was fitted with
a scraper mechanism that rotated at 0.25 rpm and directed settled solids to the bottom of the
clarifier cone.
A peristaltic pump returned settled biomass in the clarifier to the aeration tank. The SOR
was 0.1 m3/m2·hr and a SLR of 0.5 kg/m2·hr at 100% RAS and 3000 mg/L MLSS. This tank was
equipped with a variable speed mixer (Caframo: Georgian Bluffs, Ontario, Canada) at G = 175/s
in order to maintain complete-mix conditions. Aeration was provided using compressed air and a
3-6
23 cm membrane disc diffuser with the DO monitored by a DO sensor. The desired DO setpoint
was maintained using a single-loop PID controlling a MOV on the compressed air line. RAS
from the clarifier was returned to the AVN CSTR with a peristaltic pump at 100% of the influent
flow. SRT was controlled by wasting solids from the bioreactor (Garrett configuration) with a
programmable digital peristaltic pump. The AVN CSTR was equipped with sensors to monitor
NO3--N, NO2--N and NH4+-N. These signals were used to control the intermittent aeration pattern
of the AVN CSTR.
The anammox MBBR had a volume of 454 L where 50% of the volume was filled with
K3 biofilm carriers (AnoxKaldnes: Lund, Sweeden). The effective surface area of the carriers
was 500 m2/m3. Mechanical mixing of the carriers was achieved by a variable speed mixer
(Caframo: Georgian Bluffs, Ontario, Canada) at G = 14/s. The pH was recorded continuously by
an online pH probe and the reactor was covered with Styrofoam to avoid oxygen transfer from
the atmosphere. During startup, the anammox MBBR was operated with a temporary clarifier to
recycle sludge back to the MBBR. The anammox MBBR did not rely on any sensor-based
process control.
To impose conditions favorable for NOB out-selection and to provide effluent suitable
for AMX polishing, an aeration controller was developed which uses online in situ DO, NH4+,
NO2- and NO3- sensors. The first component of AVN control was the aerobic duration controller
with the goal of maintaining equal effluent NH4+-N and NOx-N (NOx-N/NH4+-N = 1) in the
AVN CSTR at all times (Figure 3-4A). The latter would guarantee a treatable effluent for the
final polishing step with AMX. The other component of the AVN control was the DO controller,
which maintains the DO at a desired setpoint during the aerated period (Figure 3-4B).
Under the AVN strategy, NH4+-N was compared to the sum of NO2--N and NO3--N
(NOx-N). First, the cycle duration (aerobic time + anoxic time) had a defined minimum and
maximum aerobic time. The cycle duration was kept constant at 12 minutes and minimum and
maximum aeration times were set at 4 and 10 minutes, respectively. These setpoints were
selected to avoid NH4+-N concentrations below 1.5 mg N/L. As the AVN controller aimed at
maintaining NH4+-N concentrations equal to NOx-N. When the NH4+-N concentration was
greater than NOx-N concentration, the aerobic time was increased and the aerobic time was
decreased when the NOx-N concentration was greater than NH4+-N concentration, while
maintaining the cycle duration constant. The aerobic time was allowed to fluctuate between the
minimum and maximum setpoints by a PID controller. When aerated, a PID controller controlled
a MOV to maintain the target DO setpoint of 1.6 mg O2/L.
The aeration control strategies used in this study are compared with traditional ammonia-
based aeration control in Table 3-1.

A
YES
Online [NOx-N]> Decrease Aerobic Duration
Online [NH4-N]
NO
Increase Aerobic Duration
B Online DO
DO setpoint
Reactor DO
Aerobic Duration Anoxic Duration
One Cycle Duration
Figure 3-4. A) Graphic Representation of the Logic of AVN Aeration Control.

B) Graphic Representation of ON/OFF Control During One Cycle and PID DO Control During Aerobic Duration.
Table 3-1. Comparison of Main Features of Ammonia-Based Aeration Control, AVN (NH4) Control
and AVN (NH4-NOx) Aeration Control.
ABAC* AVN (NH4) Control AVN (NH4-NOx) Control
Control setpoint Effluent NH4+-N Effluent NH4+-N Effluent NH4+-N setpoint = Effluent NOx-N
Control variable DO intensity Aerobic Fraction Aerobic Fraction
DO Variable DO setpoint Constant DO Constant DO
Aeration Pattern Continuous aeration Intermittent aeration Intermittent aeration
Sensors NH4+-N and DO NH4+-N and DO NH4+-N, NO2--N, NO3--N and DO
Notes:
*Most commonly used feed-back ammonia-based aeration control (ABAC)
3-8
3.1.5 Microbial Activity Measurements
The microbial activity measurements conducted are described below.
3.1.5.1 AOB-NOB Maximum Activity Measurement
To measure AOB and NOB activity, 4 L samples were collected and dispensed into 4 L
vessels and aerated for 30 minutes to oxidize excess COD, spiked with 20-30 mg/L NH4+-N (as
ammonium chloride) and 2-4 mg/L NO2--N (as sodium nitrite), respectively, and sampled
continuously for 1 hour at 20-minute intervals. All collected samples were analyzed for NH4+-N,
NO2--N, and NO3--N. Mixing was provided by a magnetic stir bar. The dissolved oxygen was
maintained between 2.5 and 4 mg O2/L. pH was maintained between 7 and 7.5 by adding sodium
bicarbonate. The AOB and NOB rates were calculated as the slope of NOx-N produced and
NO3-N produced, respectively.
3.1.5.2 AMX Maximum Activity Measurement
To measure anammox activity, the anammox MBBR Reactor was isolated from the
system. Approximately 15 minutes of mixing was performed to allow the consumption of excess
COD. A sample was taken at time 0 for sCOD, NH4+-N, NO2--N, and NO3--N. The MBBR was
then spiked with 10 mg/L NH4+-N (as ammonium chloride) and 8 mg/L NO2--N (as sodium
nitrite) and sampled continuously at 20-minute intervals until the NO2--N was less than 1.5 mg/L
NO2--N. On the last sample of the activity measurement, a sCOD sample was taken along with
NH4+-N, NO2--N, and NO3--N. The dissolved oxygen was maintained less than 0.01 mg O2/L
and was recorded at 20 minute intervals. The pH was recorded at 20 minute intervals as well.
Ammonia uptake and nitrite uptake rates were calculated as the slope of the NH4+-N and NO2--N
values taken during the activity test. Nitrate production rates were calculated as the slope of the
NO3--N production. To measure AOB and NOB activity, 4 L samples were collected and
dispensed into 4 L vessels and aerated.
3.1.6 Molecular Sampling and Analysis
The following subsections discuss the molecular sampling and analysis.
3.1.6.1 AOB and NOB Molecular Sampling
Molecular sampling was performed on a weekly basis. Grab samples were collected from
AVN and AVN CSRT and 1.5 mL was transferred into a 1.7 mL micro centrifuge tube. The vial
was placed into the centrifuge at 0°C and turned on for 3 minutes at 13,000 rpm. Supernatant
was discarded. The vial containing the biomass was then filled with 1.5 mL of RNA Protect
Solution and the biomass was re-suspended in this solution using a vortex mixer. Vials were
incubated at room temperature for a period of 5 minutes and then placed back into the centrifuge
at 0°C for 3 minutes at 13,000 rpm. Supernatant was discarded and samples were labeled with
the date and immediately stored on dry ice and transferred to HRSD’s Central Environmental
Laboratory (CEL) for storage in freezer at -80°C. Vials were then shipped via Fed-Ex to
Columbia University for qPCR analysis.
3.1.6.2 AMX Molecular Sampling
Molecular sampling was performed on a biweekly basis, the same week as biomass
density was performed. Kaldnes K3 media pieces were collected by a grab sample from the
anammox MBBR. Three anammox media pieces were placed into approximately 50 mL of Tris-
Acetate-EDTA 1x solution and swirled to remove any excess biomass not attached to the media.
Using tweezers that were sterilized with isopropyl alcohol and an RNase AWAY Surface
decontaminant, biomass was transferred from one media piece into a 1.7 mL micro centrifuge
tube, with a minimum amount of 0.1 mL of biomass in the centrifuge tube (one piece of media

per tube). The vial was placed into the centrifuge at 0°C and turned on for 3 minutes at 13,000
rpm. The supernatant was discarded. The vial containing the biomass was then filled with 1.5 mL
of Tris-Acetate-EDTA 1x solution and the biomass was re-suspended in this solution using a
vortex mixer. Vials were placed back into the centrifuge at 0°C for 3 minutes at 13,000 rpm.
Supernatant was discarded and samples were labeled with the date and immediately stored on
dry ice and transferred to HRSD’s CEL for storage in freezer at -80°C. Vials were then shipped
via Fed-Ex to Columbia University for qPCR analysis.
3.1.6.3 Molecular Analysis
DNA and RNA extraction was conducted using the DNeasy and RNeasy mini kits
(Qiagen, CA). Resulting DNA and RNA concentrations and quality were initially checked by
UV spectrophotometry (Varian, CA). The abundance of AOB and NOB was quantified via
SYBR® Green chemistry qPCR assays, NH4+, amoA gene (Rotthauwe et al., 1997), Nitrobacter
16S rRNA gene (Graham et al., 2007) and Nitrospira 16S rRNA gene (Kindaichi et al., 2007),
respectively. Total bacterial abundance was quantified using eubacterial 16S rRNA gene targeted
primers (Ferris et al., 1996). qPCR assays were conducted on a iQ5 real-time PCR thermal cycler
(BioRad Laboratories, Hercules, CA). Standard curves for qPCR were generated via serial
decimal dilutions of plasmid DNA containing specific target gene inserts. qPCR for standard
plasmid DNA and sample DNA were conducted with duplication and triplication, respectively.
DNA grade deionized distilled water (Fisher Scientific, MA) was used for non-template control.
Primer specificity and the absence of primer-dimers were confirmed via melt curve analysis of
each and every qPCR profile.
DNA extraction was conducted using the DNeasy mini kit (Qiagen, CA). Resulting DNA
concentrations and quality were measured by Nanodrop Lite UV spectrophotometry
(Thermofisher, Massachusetts). The abundance of AMX was quantified via SYBR® Green
chemistry qPCR assays targeting AMX 16S rRNA gene (van der Star et al., 2007). C. “Brocadia
fulgida” specific qPCR assay was applied based on the highly variable region of the hydrazine
synthase (hzsA gene) (Park et al., 2011). qPCR primers were used with TaqMan chemistry
(forward, 5’-AGT TAG TGA GTG TGG ATG GCG TGT-3’; reverse, 5’-TCA TCC TGC GTG
AGG AAC TTG TCA-3’; probe, 5’-/56-FAM/AT TCA GCC G/Zen/T GCG TAC ACC AGC
TTG CTT /3IABkFQ/-3’) (IDTDNA, IA).
qPCR assays were conducted on a iQ5 real-time PCR thermal cycler (BioRad
Laboratories, CA). Standard curves for qPCR were generated via serial decimal dilutions of
plasmid DNA containing specific target gene inserts. qPCR for standard plasmid DNA and
sample DNA were conducted with duplication and triplication, respectively. DNA grade double-
distilled H2O (Fisher Scientific, Massachusetts) was used for non-template control. Primer
specificity and the absence of primer-dimers were confirmed via melt curve analysis.
3-10
3.2 Results
Results of the research conducted in this phase are presented in the following sections.
Specifically, results of:
 A-stage high-rate activated sludge.
 B-stage AVN.
 B-stage AVN with CSTR with Anammox MBBR.
3.2.1 A-Stage High Rate Activated Sludge
The A-stage pilot was operated continuously for one year from January until December
2012. During this phase of the study the impact of operational parameters (i.e., DO, SRT, and
aeration duration) on COD removal were evaluated and are discussed below.
3.2.1.1 Influent Characteristics
Raw influent samples for the pilot system were collected from the A-stage temperature
control tank using a composite sampler. Table 3-2 includes the average values of these samples.
Figure 3-5 is a plot of the influent COD data. These values represent CETP’s raw influent and
plant recycles, which include filtrate from both belt filter press dewatering and centrate from
centrifuge dewatering. The solids contained in these recycle streams were responsible for the
unusually high particulate fractions of TKN, COD, and TP. The contribution of solids recycle to
the influent particulate chemical oxygen demand (pCOD) load can be seen in Figure 3-5 where the
pCOD is elevated until a sudden decline at the end of May. Better solids recovery by the plant’s
dewatering processes were responsible for the decrease in pCOD returned to the head of the plant.
Table 3-2. Average Raw Influent and A-Stage Effluent Characteristics.
Parameter (Units) Raw Influent Effluent

COD (mg/L) 490 210
sCOD (mg/L) 215 95
pCOD (mg/L) 275 115
TKN (mg N/L) 45 35
TAN (mg N/L) 33 27
NOX-N (mg N/L) 0.3 0.4
TP (mg P/L) 6.1 3.5
OP (mg P/L) 4.1 2.0
Alkalinity (mg CaCO3/L) 170 150
TSS (mg/L) 200 65
VSS (mg/L) 180 58
pCOD sCOD
600
500
Influent COD (mg/L)
400
300
200
100
0
Jan Feb Apr May Jul Sep Oct Dec
Figure 3-5. Influent COD.

The influent and effluent COD characterization results are included in Table 3-3. The
active biomass fraction has not been determined yet. The dataset was very limited (influent n=7,
effluent n=10) so it only represents a short duration during the colder months. The results
suggest that the influent WW is composed predominately (44%) of slowly biodegradable
substrate (XS) and only 1/3 of that is colloidal (XSC). The WERF protocol suggests several
checks to ensure the results agree with typical municipal wastewater fractions, which are influent
COD/cBOD5 and mixed liquor VSS/TSS. The pilot influent COD/cBOD5 ratio averaged 2.7,
which is higher than the typical range of 1.9-2.2. A higher value suggests a higher than normal
particulate inert (XI) fraction in the influent. The VSS/TSS fraction of the pilot mixed liquor
averaged 0.90 where the typical value is 0.75. A higher value indicates a lower influent inorganic
suspended solids (ISS) fraction. These values contradict each other but when the short SRT of
the A-stage is considered, it is understandable that less ISS has accumulated in the MLSS. While
the exact reason these checks did not hold for the pilot has yet to be explored, it can be assumed
that the higher particulate fractions are attributed to solids recycle at the plant and inert colloids
(i.e., iron-sulfide complexes and elemental sulfur) from ferric chloride and hydrogen peroxide
addition for odor control.
Table 3-3. Average Influent and Effluent COD Fractions.
Parameter Influent (Std Dev) Effluent (Std Dev)
SI (mg COD/L) 26 (3) 26 (4)

SS (mg COD/L) 116 (15) 37 (12)
XI (mg COD/L) 119 (76) 134 (34)
XS (mg COD/L) 197 (35) 191 (30)
XSC (mg COD/L) 69 (7) 100 (22)
XSP (mg COD/L) 128 (32) 91 (15)
fSI 0.06 (0.01) 0.07 (0.01)
fSS 0.26 (0.06) 0.10 (0.03)
fXI 0.24 (0.12) 0.34 (0.07)
fXS 0.44 (0.08) 0.49 (0.06)
The results for the effluent characterization suggest that there is no change in the XS
fraction. Presumably, a portion of the SS is converted to bacterial cells and cell components,
resulting in an increase of XSC. The decrease in XSP is likely associated with settling or
bioflocculation and not hydrolysis and mineralization. However, an increase in the XI
concentration should not be expected. It is also important to note that during the period observed,
COD removal only averaged 15%. Further investigation is needed to determine if the wastewater
characterization methods are appropriate for the A-stage effluent.
3-12
3.2.1.2 Operating Parameters
The A-stage pilot was operated under varying conditions to determine the impact of DO,
aerobic duration, and SRT on COD removal. The impact of temperature and total HRT has not
been evaluated to date. Additional data provided by Jimenez (2002) is included in several of the
figures as a comparison. Jimenez (2002) operated a high rate activated sludge pilot and obtained
the data presented at an HRT of 30 minutes, a DO of 1.0 mg/L, and 20°C. The pilot consisted of
a complete-mix reactor that what was continuously fed screened municipal wastewater.
3.2.1.2.1 Dissolved Oxygen
The impact of DO was evaluated by manipulating the DO setpoint between 0.1 and 2.0
mg/L. The DO concentration did not correlate well with COD removal efficiencies (data not
shown). This was in part due to the ineffectiveness of the DO controller to maintain the DO
setpoint. Alternatively, assuming the BioWin (EnviroSim Associates Ltd. Hamilton, Ontario)
defaults for half saturation coefficient (0.05 mg/L) and max specific growth rate (3.2/d) apply to
the A-stage, at a DO concentration of 0.2 mg/L, OHOs are already at 80% of their maximum
specific growth rate. Therefore, controlling COD removal by bulk DO control would require a
very accurate and precise DO controller. As mentioned previously, this seems to be impractical
in the A-stage due to sensor fouling. Since the impact bulk DO on the COD removal mechanisms
still needs to be evaluated, alternative sensors will be demonstrated in the pilot.
3.2.1.2.2 Aerobic Duration
Because DO control proved to be difficult and not very effective, aeration duration
(aHRT) control was implemented. The total HRT (30 mins) remained constant when the aHRT
was changed. A consequence of this type of operation was that the aerobic SRT also changed
when the aHRT was altered. Typically, the total SRT was increased when the aHRT was
decreased in order to maintain similar mixed liquor concentrations and aerobic SRTs. Because of
this relationship between HRT, SRT, and MLSS the aerobic HRT does not appear to have a
significant effect on the effluent fractions (Figure 3-6). However, the aerobic duration does
impact overall COD removal, which was 50%, 27%, and 14% at 30, 20, and 15 minutes,
respectively. This suggests that the system is limited based on reaction time and oxygen uptake.
This data also suggests that SRT plays a more important role on the COD removal mechanisms,
however, further investigation is needed.
Influent Effluent
100
ffCOD
80
COD Fraction (%)
cCOD
60
40
pCOD
20
0
30 20 15 30 20 15
Aerobic HRT (mins)
Figure 3-6. Average COD Fractions of the Influent and Effluent.

While aerobic duration is a plausible control parameter, anaerobic zones in an A-stage
have many disadvantages. Under anaerobic conditions, the only active mechanisms are
hydrolysis and bioflocculation (assuming available adsorption sites). Since bioflocculation is
rapid, the aerobic HRT should be adequate for complete bioflocculation to occur. Because a
primary goal of the A-stage is to limit hydrolysis so that carbon redirection to energy recovery
processes is optimized, the anaerobic zones should be eliminated. Additionally, anaerobic
conditions may also result in the production of sulfides and VFAs, which would further promote
sludge bulking. The advantages of aeration duration control could simply be full-scale
operational flexibility. Since the footprint of an A-stage is relatively small, multiple trains may
not be available to adjust for variations in the influent flow and loads. The use of aerobic
duration would allow the control of COD removal under various conditions (e.g., seasonal and
wet weather) while maintaining similar solids loading to the clarifier.
3.2.1.2.3 Solids Retention Time
While no apparent correlation was observed at the bulk DO ranges studied
(0.1-2.0 mg/L), presumably because of the difficulty of controlling the DO concentration, COD
removal did correlate well with SRT and aerobic SRT. Total COD removal of the A-stage ranged
from less than 5% to over 75% and sCOD removal ranged from less than 5% to over 60%
(Figure 3-7). However, it should be expected that 20-30% of the influent pCOD is removed just
by settling in the clarifier. This discrepancy could be associated with poor sampling procedures
(i.e., grab versus composite samples), data that was collected when the system was not at steady
state, or short-circuiting as result of cyclical aeration in a CSTR. As expected, the sCOD removal
approaches zero as the SRT decreases. Since the A-stage was never operated below an aerobic
solids retention time (aSRT) of approximately 0.1 days, the data below this value are most likely
the result of the system not being at steady state. Due to numerous equipment malfunctions and
settling issues, the system was drained and restarted often. Because the SRT values were
determined using grab samples and the COD removal efficiencies were determined by 24-hr
composite samples, it is very likely there are discrepancies in the dataset. Obvious outliers were
removed from the dataset.
100 100
sCOD Removal Efficiency (%)
80 80
COD Removal Efficiency (%)
60 60
40 40
20 20
0 0
0.0 0.5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 2.0
Aerobic SRT (Days) Aerobic SRT (Days)
Figure 3-7. Impact of Aerobic SRT on the Total COD and sCOD Removal
Efficiencies of the A-Stage.
3-14
3.2.1.2.4 Settling and Bioflocculation
Figure 3-8 presents pCOD removal efficiency compared to aSRT for the pilot and for
Jimenez (2002). A potential explanation for the difference between Jimenez (2002) and the pilot
pCOD removal efficiencies on the upper end could be attributed to filamentous bulking in the
A-stage. Excessive filaments are known to form sweep flocs that essentially filter pCOD and
cCOD during settling. It is also likely that the higher fraction of pCOD, as seen in the WW
fractionation, would translate to higher pCOD removal efficiencies. Particulate COD production
should not have been observed because of inherent settling in the clarifier. This further supports
that sampling errors could explain these results.
100
80
pCOD Removal Efficiency (%)
60
40
20
-20
-40 A-stage Pilot

Jimenez et al. 2002
-60
0.0 0.5 1.0 1.5 2.0
Aerboic SRT (Days)
Figure 3-8. Impact of Aerobic SRT on the Particulate COD Removal Efficiency of the A-Stage.
Due to the high rate operation of the A-stage, colloidal COD removal was not observed. The
negative removals of pCOD and cCOD can be attributed to cCOD production either from readily
biodegradable chemical oxygen demand (rbCOD) conversion to bacterial material or hydrolysis of
pCOD to cCOD without complete bioflocculation (Figure 3-9). The cCOD could be the
accumulation of bacterial cells, pin flocs, cell debris, and loose EPS material. This data suggests that
extracellular polymeric substances (EPS) production is limited based on reaction time and therefore
bioflocculation is limited. Additional testing is required to determine what the COD adsorption
capacity (CAC) is at the SRTs observed and if it is maximized indicating EPS limiting conditions.
100
cCOD Removal Efficicency (mg/L)
50
-50
A-stage Pilot
Jimenez et al. 2002
-100
0.0 0.5 1.0 1.5 2.0
Aerobic SRT (days)
Figure 3-9. Impact of Aerobic SRT on the Colloidal COD Removal Efficiency of the A-Stage.

3.2.1.2.5 Mineralization
The amount of mineralization was determined as the difference of a COD mass balance
on the entire system (Figure 3-10). At an average aerobic SRT of 0.14±0.06 days, approximately
10±6% of the influent COD was mineralized. At an average COD removal of 45±12%, this is
approximately 23% of the COD removed through the A-stage. Assuming that 20-30% COD
removal is associated with settleable material, this leaves the remaining fraction to be removed
by bioflocculation and storage.
100 100
80 80
COD Fraction (%)
COD Fraction (%)

60 60
Effluent
WAS
Mineralization
40
40
20
20
0
0
Effluent WAS Mineralization
Figure 3-10. Average COD Mass Balance.
Assuming that minimal hydrolysis takes place because of the short SRT, mineralization
should only be associated with rbCOD removal. Comparing aerobic SRT to rbCOD removal
(Figure 3-11) it appears that controlling rbCOD is limited to a very narrow SRT range and even
at the lowest possible SRT (i.e., approaching washout), 45% is still removed. Ideally, rbCOD
removal should approach near 100% removal at the longer SRTs. However, rbCOD removal
may have been limited by HRT or the fact that both processes were CSTRs.
100
rbCOD Removal Efficiency (%)
80
60
40
20
A-stage Pilot
Jimenez et al. 2002
0
0.0 0.5 1.0 1.5 2.0
Aerobic SRT (Days)
Figure 3-11. Impact of Aerobic SRT on the Readily Biodegradable COD Removal Efficiency of the A-Stage.
3-16
3.2.1.2.6 Storage
The storage mechanisms have not been directly investigated in the pilot, however,
phosphorus data can at least provide an indication of the presence of polyphosphate-
accumulating organisms (PAOs). However, because the plant seasonally adds ferric chloride for
odor control, some chemical phosphorus occurs through the A-stage. One point to consider is
that work by McClintock et al. (1993) and Mamais and Jenkins (1992) demonstrated that
enhanced biological phosphorus removal (EBPR) has a critical SRT-temperature combination
that occurs well before complete washout of OHOs. Erdal et al. (2006) also found similar results,
albeit at lower SRT values at the same temperatures. This difference may have been attributed to
the use of synthetic feed or the fact it was a carbon limited system whereas Mamais and Jenkins’
process was P limited and fed with acetate supplemented domestic sewage. Erdal et al. (2006)
attribute the decline of EBPR near the washout SRT (or cessation of P uptake and release) to
glycogen metabolism being rate limiting. Extrapolated from Mamais and Jenkins (1992) and
McClintock et al. (1993) (assuming linear relationship), washout occurs around
1 day SRT at 25°. Therefore, it can be assumed that storage associated with EBPR is not
occurring in the A-stage.
3.2.1.3 Off-Gas Testing
Figure 3-12 is an example dataset of the off-gas measurements that were performed.
During this particular test, the aeration was intermittent with 20 minutes of aeration and 10
minutes unaerated. CO2 stripping occurred when the air initially turned on, which is
demonstrated by the peaks. Using this data in situ OUR were calculated. Typical OUR values of
the A-stage were between 110-130 mg/L/hr.
O2 (%) Std Airflow (SLPM) CO2 (%)

35 0.8
30 0.7
0.6
Airflow (SLPM) and O2 (%)
25
0.5
20
CO2 (%)
0.4
15
0.3
10
0.2
5 0.1
0 0
7:12:00 8:24:00 9:36:00 10:48:00
Figure 3-12. Example Off-Gas Composition Results.

3.2.1.4 Settling
Monitoring of settling performance and filaments occurred throughout the study. Due to
the nature of the septic influent wastewater and the complete mix hydraulics of the bioreactor,
settling performance was poor with SVI values often greater than 200. Microscopic analysis
confirmed the presence of Thiothrix spp. Thiothrix spp. are sulfur oxidizing bacteria that thrive
on reduced sulfur compounds and organic acids (Jenkins et al., 2004), both of which were
present in the raw influent especially during the warmer months (Figure 3-13).
Efforts to reduce the influent sulfide load (e.g., iron salt addition) were not effective in
eliminating the settling issues. Settling did not improve until intermittent aeration and constant
airflow with no measurable bulk DO was applied to the A-stage. This occurred in October 2012
as shown in Figure 3-13. It is unclear exactly why these operating conditions resulted in better
settling. It was postulated that lower influent temperatures contributed along with the possibility
that Thiothrix spp. have a lower affinity for oxygen than floc-forming bacteria. This is an issue
that still needs to be resolved.
SVI Temp
600 30
500 25
Influent Temperature ( C)
400 20
SVI (mL/g)
300 15
200 10
100 5
0 0
Dec Apr Jul Oct Jan
Figure 3-13. Effect of Influent Temperature on SVI.
3-18
3.2.2 B-Stage AVN
Results for the B-stage reactor and the AVN control are discussed in the following sections.
3.2.2.1 Long-Term Operation
There were many operational variables that had an effect on the performance of the
B-stage; however, A-stage performance had a significant impact on the operation and
performance of AVN. The goal of the A-stage operation was 50-60% influent COD removal, but
optimal reactor design and control strategy for the A-stage proved to be very much a trial-and-
error process. As a result, the influent COD to the B-stage varied and was difficult to control for
much of the pilot operation. Therefore, during the course of the study period, AVN showed
variable performance in terms of N removal (Figure 3-14 A, Note that “Day 0” on the horizontal
axis of all subsequent figures represents the date of January 3, 2012).
Figure 3-14. Trends of A) Influent NH4+-N, Effluent NH4+-N and NOx-N B) NAR and Total SRT.

The influent NH4+-N concentration and COD/NH4+-N ratio fluctuated due to changes in
A-stage operations as a part of fine tuning control over COD removal (Figure 3-14A and Figure
3-15A). The effluent NH4+-N and NOx-N variability can be seen in Figure 3-14A, while the
fluctuations in nitrite accumulation ratio [NAR= NO2+-N/ (NO2--N+NO3--N)] can be seen in
Figure 3-14B. The changes to the SRT were made constantly to keep up with the changing
influent load (Figure 3-14B). The total inorganic nitrogen (TIN) removal rate was 95±30 mg
N/L/d for the influent COD/NH4+-N ratio of 10.2±2.2 at a 4 hr HRT during the study. Trends of
TIN removal rates and influent COD/NH4+-N ratios followed each other as expected (Figure
3-15A). The MLSS was quite variable and followed the trends of the COD removal rate (Figure
3-15B). The variability in MLSS can be attributed to changes in SRT and influent COD/NH4+-N
during the study period.
Figure 3-15. Trends of A) Influent COD/NH4+-N Ratio and TIN Removal Rate; B) MLSS and COD Removal Rate.
3-20
3.2.2.2 TIN Removal Efficiency
The influent COD/NH4+-N ratio impacted TIN removal efficiency as seen from the
positive correlation between these parameters in Figure 3-16A. The TIN removal efficiency of
the AVN process was 66±17% during the study. Efforts were made to explore other factors that
might influence TIN removal efficiency beyond the obvious effect of influent COD/NH4+-N
ratio. The results presented in Figure 3-16B show that there is a positive correlation between ex
situ maximum AOB rates and TIN removal efficiency. The correlation is even stronger with
moderate influent COD/NH4+-N ratios of 8-11. Since the anoxic and aerobic times were
controlled based on the target residual NH4+-N, higher AOB rates allowed more anoxic time for
denitrification, improving the overall TIN removal performance. Contrary to expectation, there
was no correlation between the extents of NOB out-selection represented by the ratio of
maximum AOB rate: NOB rate and TIN removal efficiency (Figure 3-16C). In fact, this was true
within the full spectrum of influent COD/NH4+-N ratios.
100
A
%TIN removal efficiency
80
60 r ² =0.52
40
20
0
6 8 10 12 14 16
Influent COD/NH4-N
100 B
%TIN removal efficiency
80
60
40 r ² =0.75
8<Influent (COD/NH4-N)<11
20 Influent (COD/NH4-N)<8
Influent (COD/NH4-N)>11
0
200 250 300 350 400 450 500 550 600
Maximum AOB rate (mgN/L/d)
100 C
% TIN removal efficiency
80
60
r ² = 0.0007
40
Influent (COD/NH4-N) <8
20 8< Influent (COD/NH4-N)<11
Influent (COD/NH4-N)>11
0
0 2 4 6 8 10 12 14
Maximum AOB rate: Maximum NOB rate
Figure 3-16. Correlation Between TIN Removal Efficiency and Influent COD/NH4+-N:
(A), Maximum AOB Rates (B), Maximum AOB/NOB Rates Ratio (C).

The impact of IMLR on TIN removal efficiency can be seen in Figure 3-17. The TIN
removal efficiency and influent COD/NH4+-N ratio were not statistically different with 100-300
% IMLR and no recycle (0% IMLR: 60±18%, 100-300% IMLR: 64±17%, p=0.091, 0% IMLR:
10.07±2.17, 100-300% IMLR: 9.67±2.15, p=0.356). The TIN removal efficiency and influent
COD/NH4+-N ratio were greater with 400% IMLR compared to 100-300% IMLR (400% IMLR:
74±13%, 100-300% IMLR: 64±17%, p<0.001, and 400% IMLR: 10.87±2.0%, 100-300% IMLR:
9.67±2.15%, p=0.003). Therefore, it can be concluded that IMLR did not significantly improve
the overall TIN removal efficiency when compared to operation with all reactors intermittently
aerated. Although the NAR was greater when an IMLR of 100-300% was employed, there was
no improvement in the TIN removal efficiency for similar influent COD/NH4+-N ratios
compared to operation without IMLR (Figure 3-17).
Influent COD/NH4-N
TIN removal efficiency
14 100 NAR 1.0
12
80 0.8
Influent COD/NH4-N
10
8 60 0.6
NAR
6 40 0.4
4
20 0.2
2
0 0 0.0
0 100-300 400
IMLR (%)
Figure 3-17. Comparison of TIN Removal Efficiency with Influent COD/NH4+-N and NAR
at IMLR 0% (n=87), IMLR 100-300% (n=114), IMLR 400% (n=165).
3-22
3.2.2.3 NOB Out-Selection in AVN
NOB out-selection was inferred through ex situ AOB and NOB maximum activity
measurements, NAR, and targeted molecular analysis for bacterial populations. The AOB
activity was greater than NOB activity (AOB: 400±79 mgN/L/d, NOB: 257±133 mgN/L/d,
p<0.001) during the entire study. The results of targeted molecular analysis for AOB, NOB
(Nitrobacter sp. and Nitrospira sp.) and total bacterial population clearly showed the declining
trend for NOB population during the period of low ex situ NOB activity (Figure 3-18). The
trends of NAR can be seen in Figure 3-14B and a summary is provided in Figure 3-17.
amoA
Nb 16S A
Ns 16S
1e+12 Total 16S
1e+11
Abundance (copies/ml)
1e+10
1e+9
1e+8
1e+7
50 100 150 200 250 300 350 400
Max AOB rate

600 B
Max NOB rate
500
Activity (mgN/L/d)
400
300
200
100
0
50 100 150 200 250 300 350 400
Days
Figure 3-18. Trends of Microbial Populations (AOB, NOB and Total Bacteria) Presented as
Copies of DNA per mL of Sample from Targeted qPCR (A) and Weekly AOB and NOB Activities (B).

The following subsections discuss performance of the AVN CSTR with the Anammox
MBBR reactors.
3.2.3.1 AVN CSTR Performance
The key characteristics of the AVN CSTR effluent are summarized in Table 3-4. The
trends of influent NH4+-N and effluent NH4+-N and NOx-N are presented in Figure 3-19A which
also demonstrates the effectiveness of AVN control in maintaining equal NH4+-N and NOx-N in
the effluent. The NH4+-N loading rate and COD removal rate can be compared with TIN removal
rate during the entire study in Figure 3-19B. The trend of the nitrite accumulation ratio [NAR =
NO2--N/ (NO2--N+NO3--N)], which is an indicator of the extent of NOB out-selection, and the
aerobic fraction (aerobic time: cycle time), is presented in Figure 3-19C. It can be seen that the
aerobic fraction follows the trends of the NAR during the study period. The total SRT and
aerobic fraction presented in Figure 3-19, gives a measure of the aerobic SRT of the AVN CSTR
during the study. Since the AVN aeration controller and nutrient sensors were still being fine-
tuned, the ratio of effluent NH4+-N and NOx-N remained variable in Phase I (Figure 3-19A). In
Figure 3-20, a 24-hr profile of NH4+-N, NO3--N, NO2--N, NOx-N, and DO, as controlled by the
AVN strategy, is presented. The functioning of the AVN control can be seen in this figure.
Table 3-4. Average Characteristics of AVN CSTR Influent (A-Stage Effluent) and
Effluent over the Entire Experimental Period.
Parameter Influent Effluent
pH 7.05±0.14 6.88±0.12
COD (mg/L) 306±87.3 66±22.5
sCOD (mg/L) 128±41.9 33±9.8
NH4+ (mg N/L) 29.7±3.9 7.3±4.4
TKN (mg N/L) 38.5±4.6 –
COD/TKN 6.7±1.4 –
Ortho-P (mg P/L) 3±1.2 2.7±0.7
Alkalinity (mg CaCO3/L) 159.7±17.1 85.3±23.3
3-24
Figure 3-19. AVN CSTR: A) Influent NH4+-N, Effluent NH4+-N and NOx-N; B) Influent NH4+-N Loading,
COD Removal Rate and TIN Removal Rate, and C) NAR and Aerobic Fraction.

Aerobic Fraction
NH4-N
NO2-N
A
10 NO3-N 1.0
NOx-N 0.9
8 0.8
0.7
Aerobic Fraction
Nitrogen (mg/L)
6 0.6
0.5
4 0.4
0.3
2 0.2
0.1
0 0.0
2.0
Dissoved Oxygen (mg/L)
4.0 1.5
B
3.5 1.0
Dissolved Oxygen (mg/L)
3.0 0.5 DO
2.5 0.0
2.0 1-hour
1.5
1.0
0.5
0.0
24-hour
Figure 3-20. AVN Controller Performance.
A) 24-hour (12 AM to 11:59 PM) trends of reactor NH4+-N, NO2--N, NO3--N and aerobic fraction (ratio of aerobic time: total cycle time)
B) 24-hour DO profile and an insert showing DO profile for 1 hour.
The aerobic fraction was allowed to fluctuate between 0.33-0.83.
3-26
During Phase I, the TIN removal rate, the efficiency and the ratio of TIN removal rate:
COD removal rate was the lowest among all phases (Figure 3-21). In general, the ratio of
TIN/COD removal rate is an indicator of the efficiency of the TIN removal in terms of influent
COD/N. The very low TIN/COD removal rate (0.05±0.021) and TIN removal efficiency
(30±18%) during Phase I suggests more aerobic oxidation of COD was occurring than anoxic
oxidation of COD using NOx as the electron acceptor (Figure 3-21). This is in line with the fact
that the aerobic SRT fraction during Phase I was 0.65±0.21, while the total SRT was 6±3.6 d
Figure 3-19). Further, the TIN removal rate was lower during Phase I compared to other phases
in relation to the COD removal rates, as seen in Figure 3-12.
Influent COD/NH4-N
TIN removal efficiency
16 100 TIN removal rate/COD removal rate 0.12
TIN removal rate/COD removal rate

14
0.10
80
Influent COD/NH4-N
12
0.08
10 60
8 0.06
6 40
0.04
4
20
0.02
2
0 0 0.00
Phase I Phase II Phase III Phase IV Phase V
Figure 3-21. Different Phases of the Study Showing Variability and Relationship Between
A) Influent COD/NH4+-N, TIN Removal Efficiency and TIN Removal Rate/COD Removal Rate.
Error bars represent standard deviation.
From Figures 3-19B, 3-21, and 3-23C, the following can be observed. In Phase II, there was
overall improvement in the TIN removal rate (p=0.002), and efficiency (p=0.018), however the NAR
was lower (p<0.001) and the influent COD/ NH4+-N was not statistically different (p= 0.55). The ratio
of TIN removal rate to COD removal rate in both phases were not statistically different (p=0.075).
In Phase III, the TIN removal rate (p= 0.001), efficiency (p= 0.004) and ratio of TIN
removal rate to COD removal rate were higher than Phase II (p=0.003) for the similar influent
COD/NH4+-N (p=0.99). In fact, the ratio of TIN removal rate: COD removal rate in Phase III
was similar to Phase IV (p= 0.25) and the TIN removal efficiency was slightly higher in Phase
IV compared to Phase III (p=0.001) for a higher influent COD/ NH4+-N (p=0.002). The
increased NAR during Phase III (0.3±0.11) compared to Phase II (0.05±0.025) and Phase IV
(0.11±0.06) could explain the improvement of the TIN removal rate for the influent COD/NH4+-
N that was less than or equal to. This also highlights the importance of NOB out-selection.
During Phase V, the influent COD/NH4+-N (12.3±0.95), NAR (0.6±0.22) and TIN
removal rate (210±43 mgN/L/d) and efficiency (89±11%) were highest among all phases.
However, the ratio of the TIN removal rate to COD removal rate was similar to Phase III (p=
0.23). In intermittently aerated systems, COD that is not used for NOx reduction is oxidized
aerobically; therefore maintaining influent COD/NH4+-N at an optimum level is important. The
ratio of NH4+-N and NOx-N was maintained around 1 mg N/L as intended by the AVN controller
during Phases II, III, IV, and V of the study (Figure 3-19A).

3.2.3.1.1 NOB Out-Selection in AVN CSTR
NOB out-selection was inferred through ex situ AOB and NOB activity measurements,
NAR, and targeted molecular analysis for bacterial populations. The AOB activity was greater
than NOB activity (AOB: 391±124 mg N/L/d, NOB: 233±151 mg N/L/d, p< 0.001) during the
entire study. Further, the results of targeted molecular analysis for AOB, NOB (Nitrobacter sp.
and Nitrospira sp.) and total bacterial population clearly showed that NOB population declined
during the period of low NOB activity (Figure 3-22), which supports the NOB out-selection
observed.
Phase: I II III IV V A
MLSS (mg/L): 3055 985 3913 460 4141 708 4550 948 3925 382
1e+13 amoA
Nb 16S
1e+12 Ns 16S
Abundance (copies/ml)
Total 16S
1e+11
1e+10
1e+9
1e+8
1e+7
0 50 100 150 200 250 300 350
700 Max AOB rate B
Max NOB rate
600
Activity (mgN/L.d)
500
400
300
200
100
0
0 50 100 150 200 250 300 350
Days
Figure 3-22. Trends of Microbial Populations (AOB, NOB and Total Bacteria) Presented as Copies of DNA per mL of Sample
from Targeted qPCR (A) and Weekly Maximum AOB and NOB Activities (B).
3-28
The dominant NOB were Nitrospira sp. which were 20 times more prevalent that
Nitrobacter sp. The correlation of amoA abundance with AOB activity and Nitrospira sp.
abundance with NOB activity can be seen in Figure 3-23.
NOB out-selection inferred from
NAR and AOB/NOB activities was 1e+10
variable during the study (Figures 3-22 A
and 3-23). Therefore, variability in NOB
out-selection warranted further
amoA (copies/ml)
1e+9
investigation. It was surmised that
r ² = 0.24
aggressive operation towards limiting the
SRT for AOB is a key factor for washing 1e+8
out NOB. Under the AVN strategy, if the
AOB are pushed towards washout, the
aerobic fraction increases for the same
1e+7
influent COD/N. The trends of aerobic 100 200 300 400 500 600 700
fraction and NAR in Figure 3-19C Maximum AOB rate (mgN/L.d)
demonstrate that aggressive operation 1e+11
B
(combination of SRT and nitrogen loading
rate) resulted in a higher aerobic fraction
Ns 16S (copies/ml)
and NAR. Further, the ratio of nitrogen 1e+10

loading rate and maximum AOB rate
(NLR/Max AOB rate) were analyzed for r ² = 0.51
different phases of the study to assess 1e+9
variable NOB out-selection. This ratio
captures how aggressively the system is
operated towards AOB washout and is the 1e+8
result of variation in the systems SRT and 0 100 200 300 400 500 600
NLR. Maximum NOB rate (mgN/L.d)
C
In Phase I, it was observed that the 1.8 NLR/Max AOB rate 1.0
NLR/Max AOB rate was greater than 1 1.6 NAR
and the NOB out-selection characterized 1.4 0.8
NLR/Max AOB rate
by NAR was greater than 0.5 (Figure 1.2

3-23C). In Phase II and Phase IV 1.0
0.6
NAR
NLR/Max AOB rate was around 0.7 and 0.8
the NAR remained below 0.12 (Figure 0.4
0.6
3-23C). In Phase III and Phase V, the 0.4 0.2
NLR/Max AOB rate was close to 1 which 0.2
coincided with higher NAR (>0.3) and
0.0 0.0
better NOB out-selection (Figures 3-22 Phase I Phase II Phase III Phase IV Phase V
and 3-23C).
Figure 3-23. Correlation Between A) amoA Abundance and Maximum AOB Rates (Weekly Averages);
B) Nitrospira sp. Abundance and Maximum NOB Rates (Weekly Averages); C) Different Phases of the Study Showing
Variability and Relationship Between NLR/Max AOB Rate Ratio and NAR.
Error bars represent standard deviation.

3.2.3.1.2 Settling Performance
The settling characteristics of the AVN CSTR showed a SVI of 150±38 mL/g. Moreover,
there was seasonal variation in settling characteristics; during summer months settling was poor
compared to other seasons (Figure 3-24). The weekly analysis of filaments showed Thiothrix was
the dominant filaments during periods of poor settling (data not shown). Thiothrix related
bulking was observed in the A-stage (Miller et al., 2012), which was believed to stem from high
sulfide and organic acids in the influent raw wastewater during high temperature periods. The
potential carryover of sulfide and Thiothrix as well as reproduction of sulfide and organic acids
in the over-sized A-stage clarifier might explain poor settling due to Thiothrix. High NO2- levels
did not adversely affect the settling performance (Figure 3-24).
Nitrite accumulation has been linked with poor sludge settleability (Blackburne et al.,
2008; Ma et al., 2009) although the cause of filamentous bulking due nitrite is not understood
clearly (Guo et al., 2013). Nitric Oxide (NO) which is an intermediate of denitrification and NO2-
a precursor, was hypothesized to inhibit the floc-formers over filamentous organisms by Casey et
al. (1994). The validity of this hypothesis was questioned by Martins et al. (2004). Despite poor
overall settling, NO2- accumulation did not negatively impact settling in this study. In fact,
periods of good settling were marked by higher amounts of effluent NO2- (Figure 3-24). Further,
bulking was not persistent throughout the study which suggests that operational parameters were
not responsible for poor settling.
3-30
250 12
SVI
NO2-N 10
200
NO2-N (mgN/L)
150
SVI (ml/g)
100
4
50
2
0 0
Winter Spring Summer Fall
(17±1.1) ºC (20.3±1.9) ºC (26.7±1.4) ºC (24.3±2.7) ºC
Figure 3-24. Seasonal Variation in SVI, Nitrite Levels and Temperature During the Entire Study.
3.2.3.2 Anammox MBBR Performance
The anammox MBBR was operated in three phases over a period of 385 days. The
anammox MBBR received the effluent of the AVN CSTR (Startup: 0-78 days, Phase I: 79-253
days) and non-nitrifying HRAS plant final effluent (FNE) spiked with NO2--N (Phase II: 286-
385 days). During startup, the anammox MBBR was operated with a temporary clarifier to
recycle sludge back to the MBBR (Startup: 0-78 days). This strategy was not entirely successful
as most of the seed sludge floated and washed out from the clarifier in the first week of
operation. Despite unintentional wasting of seed sludge, AMX activity was maintained, as seen
from the NH4+-N removal (0.025±0.021 g N/m2/d), throughout the startup period (Figure 3-25A).

Figure 3-25. Temporal Trends During the Study: A) NH4+-N, NO2--N, and NO3--N Removal Rate; B) COD Removal Rate, Ratio
of NO2--N Removal Rate: NH4+-N Removal Rate, and NOx-N Removal Rate: NH4+-N Removal Rate.
NH4+-N removal in the anoxic conditions of the anammox reactor was attributed to the
AMX activity (release of NH4+-N due to biomass decay and heterotrophic uptake of NH4+-N
during denitrification were assumed not to impact overall NH4+-N removal). NO2--N in AVN
CSTR effluent feeding anammox reactor was 0.73±0.62 mg N/L during startup (Figure 3-26A).
In fact, NO2--N accumulation in AVN CSTR was limiting AMX activity during startup as near
complete NO2--N removal was observed (effluent NO2--N= 0.13±0.11 mg N/L, Figure 3-26B).
Since the influent NH4+-N (6.13±2.86 mg N/L) was much greater than the NO2--N, the overall
TIN removal through the AMX pathway was limited (Figure 3-26 A).
3-32
Figure 3-26. Temporal Trends During the Study:
A) Influent NH4+-N, NO2--N, and NO3--N, B) Effluent NH4+-N, NO2--N, and NO3-N.
The anammox MBBR was not fed between days 254-285, however, there was instant
AMX activity during initiation of Phase II (Figures 3-25 and 3-26). In Phase II, plant FE, which
contained NH4+-N (26± 2.45 mg N/L), was spiked with varying concentrations of NO2- -N and
fed to the anammox MBBR. During Phase II, influent NO2--N concentrations were increased
over time, however, NO2--N breakthrough was not observed (Figure 3-26B). As the NO2--N
input was increased, AMX responded with greater NH4+-N removal and subsequent TIN removal
rates (Figure 3-27). There was slight reduction in the NO2--N removal rate when the NO2--N
loading rate was increased up to 0.34 g N/m2/d during Phase II (Figure 3-27B).

Start up Phase I Phase II
0.7 1.2
A TIN removal rate
Maximum AMX activity (gN/m2/d)

0.6 Maximum AMX activity
TIN removal rate (gN/m2/d)

1.0
0.5
0.4 0.8
0.3 0.6
0.2
0.4
0.1
0.0 0.2
0 40 80 120 160 200 240 320 360 400
Days
0.4
B Phase II
NO2-N removal rate (gN/m2/d)
0.3
0.2
0.1
0.0
0.0 0.1 0.2 0.3 0.4
NO2-N loading rate (gN/m2/d)

Figure 3-27. A) Trends of the TIN Removal Rate and the Maximum AMX Activity (Phase I and Phase II) B) NO2--N Loading
Rate Compared to the NO2--N Removal Rate During Phase II at Influent NH4+-N Concentration of 26±2.5 mg N/L.
3.2.3.2.1 AMX Activity and N Removal Rates
The results of the maximum AMX tests conducted on day 136 (Phase I) and day 366
(Phase II) are presented in Figure 3-28.
3-34
0.88 gTIN/m2/d
0.36 gTIN/m2/d
Figure 3-28. Maximum AMX Activity Test Results: A) During Phase II on Day 366; B) During Phase I on Day 136.
The trends of maximum NH4+-N and NO2- -N removal rates and NO3--N production rates
can be seen in Figure 3-29A. The theoretical AMX stoichiometry ratios proposed by Strous et al.
(1998) for NO2--N removed to NH4+-N removed and NO3--N produced to NH4+-N removed is 1.32
and 0.26, respectively. Maximum AMX activity measurements reveal that in Phase I, the ratio of
NO2--N removed to NH4+-N removed was 1.47±0.17 which is greater than 1.32 (p<0.001), while
the ratio of NO3- -N produced to NH4+-N removed was 0.266±0.033, which is not statistically not
different from 0.26 (p=0.454) (Figure 3-29B). In Phase II, the ratio of NO2--N removed to NH4+-N
removed was 1.27±0.10, which is statistically not different from 1.32 (p=0.168), while the ratio of
NO3--N produced to NH4+-N removed was 0.243±0.025, which is less than 0.26 (p=0.032) (Figure
3-29B). The influent NH4+-N and NO2--N were much higher in Phase I compared to Phase II
(Figure 3-26A). TIN removal rates were lower during startup (0.056±0.042 g N/m2/d) and Phase I
(0.065±0.032 g N/m2/d) compared to Phase II (0.024±0.013 g N/m2/d) (Figure 3-25A). The
maximum AMX activities measured during Phase I and Phase II were higher than the actual TIN
removal rates during the same periods (Figure 3-25A). Maximum AMX activity over 1.0 g N/m2/d

was observed towards the end of Phase II (Figure 3-25A). The bi-weekly measurements (day 337
to 385) show that biomass density remained stable around 3.2±0.2 g TSS/m2. However, there was
an increase in maximum specific AMX activity from 0.21 g N/g TSS/d to 0.33 g N/g TSS/d during
the same time. The AMX reactor was not fed between Phase I and Phase II (day 254 to 285),
which resulted in a drop in maximum AMX activity from 0.63 g N/m2/d to 0.30 g N/m2/d.
However, with the increase in NO2--N loading, the maximum activity increased from 0.30 g
N/m2/d to 1.05 g N/m2/d during Phase II (day 286 to 385).
Phase I Phase II
Maximum NH4-N removal rate
A
Ammonia, Nitrite removal rate (gN/m2/d)
0.8 Maximum NO2-N removal rate 0.16

Maximum NO3-N production rate
Nitrate production rate (gN/m2/d)

0.7 0.14
0.6 0.12
0.5 0.10
0.4 0.08
0.3 0.06
0.2 0.04
0.1 0.02
0.0 0.00
120 160 200 240 320 360 400
1.8
B
1.6
AMX stoichiometric ratio
1.4
1.2
1.0
(NO2-N: NH4-N) removal rate
0.8
NO3-N production rate: NH4-N removal rate
0.6
0.4
0.2
0.0
120 160 200 240 320 360 400
Days
Figure 3-29. Temporal Trends of A) Maximum NH4+-N, NO2--N Removal Rate and NO3--N Production Rate During Weekly
Maximum AMX Activity Test; B) AMX Stoichiometric Ratio of NO2--N Removal Rate to NH4+-N Removal Rate and NO3--N
Production Rate to NH4+-N Removal Rate.
3.2.3.2.2 Nitrate Removal and AMX Contribution

There were two major observations regarding nitrate removal and AMX contribution:
-
1) NO3 -N removal as opposed to production during Startup and Phase I of the study and 2) The
3-36
ratio of NO2--N removed to NH4+-N removed less than the generally accepted ratio of 1.32
(Figure 3-25), which highlighted NO3--N removal in anammox MBBR and AMX’s involvement.
NO3--N removal rates during Start up and Phase I were 0.02±0.021 g N/m2/d and
0.02±0.014 g N/m2/d, respectively (Figure 3-25A). The influent NO3--N during Startup
(3.41±1.92 mg N/L) and Phase I (1.82±1.51 mg N/L) were greater than during Phase II
(0.34±0.22 mg N/L) (Figure 3-26 A). The ratio of NOx-N removal rate to NH4+-N removal rate
was greater than the ratio of NO2--N removal rate to NH4+-N removal rate during Start up and
Phase I (Figure 3-25B). Significant COD removal by the anammox MBBR was observed during
the study (Figure 3-25B). The COD removal rate during Start up and Phase I were 0.22±0.37
g/m2/d and 0.58±0.52 g/m2/d, respectively, compared to a COD removal rate of 0.29±0.16
g/m2/d during Phase II. The higher NH4+-N removal compared to NO2--N removal compared to
expected AMX stoichiometry can result from either: i) NO3--N being converted to NO2--N
which was there available for AMX metabolism, or ii) NH4+-N uptake by heterotrophic
denitrifiers assimilation during NO3--N and NO2- -N reduction to N2. Since NO3--N removal
compared to NH4+-N removals were much higher than would be expected from the heterotrophic
uptake of NH4+-N (calculations not shown), it is highly likely that NO3--N being converted to
NO2--N was used by AMX, which resulted in higher TIN removal rates.
3.3 Discussion
The following subsections discuss the A-stage high-rate activated sludge process, the B-
stage AVN, and the B-stage AVN CSTR with anammox MBBR processes.
3.3.1 A-Stage High-Rate Activated Sludge Process
The initial operation (January to July 2012) of the A-stage under continuous aeration
using a DO setpoint demonstrated that the A-stage is capable of 50-60% sCOD removal and 60-
70% pCOD removal. This dataset established the maximum removal efficiencies under typical
operating conditions (30 min HRT, 3-12 hr SRT, and DO>0.2 mg/L) in a single CSTR reactor.
This data also provided some insight into the sensitivity of COD removal when operational
parameters were varied and the impact of seasonal loads and fractionation on performance.
However, the A-stage has been susceptible to poor settling (SVI>200) attributed to high influent
sulfides and VFAs and high effluent TSS (TSS>100 mg/L) attributed to reactor design and
hydraulics.
3.3.2 B-Stage AVN
This subsection explains how this study showed that single-stage nitrogen removal is
possible. It also describes the important role of volume control in balancing total N removal.
Research limitations regarding the benefits of nitration-denitration in terms of carbon utilization
are also explained.
3.3.2.1 Single-Tank Nitrogen Removal
It was shown that internal recycle was not necessary for improved performance in terms
of nitrogen removal within the AVN concept of intermittent aeration. Researchers believed that
an intermittently aerated single-stage nitrification/denitrification system can be an efficient way
to maximize nitrogen removal while minimizing aeration volume, aeration demand,
supplemental carbon and alkalinity addition (Hao and Huang, 1996; Bishop et al., 1976;
Batchelor, 1982). However, due to the complexity associated with controlling nitrification and
denitrification in the same reactor, application of such a system was limited to simulation studies
(Batchelor, 1982). Further, the need for sophisticated instrumentation, control and automation

(ICA) prevented single-stage nitrogen removal from being implemented at any significant scale
in the past. In this study, through the use of accurate sensors and process control strategies,
single-stage nitrogen removal was shown possible. In fact, it was also demonstrated that
managing aerobic and anoxic volumes (aeration duration control) dynamically to deal with non-
steady influent results in efficient nitrogen removal.
One such example is the optimum aerobic volume control concept (OAV-control
concept), which is a control strategy that is capable of adjusting the aerobic and anoxic volume
required for complete nitrification and subsequent maximization of denitrification (Svardal et al.,
2003). It uses the measured airflow rate and DO concentration to change the aerobic volume to
the NH4+-N load. Therefore, the anoxic volume is maximized with the goal of complete
nitrification.
The OAV-control concept was implemented successfully at the Linz-Asten WWTP
(Austria), where effluent NH4+-N of <1 mg N L and 70% to 80% total nitrogen removal was
achieved. This strategy also demonstrated the capacity to deal with NH4+-N peak loads. Another
example is the BioDenitro (nitrification-denitrification) system that cycles the tank volumes
through aerobic and anoxic conditions, utilizing the full reactor volume for nitrification and
denitrification (Ingildsen, 2002). The Himmark WWTP (Denmark) was able to increase the
treatment capacity by 33% with the BioDenitro concept that involved a control scheme based on
on-line NH4+-N sensors to adjust the relative length of the aerobic and anoxic phases, and
improvements to the aeration and SCADA systems (Ingildsen, 2002). The Marselisborg WWTP
(Denmark) is an A/B system, where B-stage is operated as BioDenitro. The Marselisborg plant,
operating under COD-limited conditions, has a similar aeration control scheme and was able to
reduce average effluent total nitrogen from 7.8 mg N/L to 5.1 mg N/L (Sorensen et al., 1994).
3.3.2.2 Aeration Schemes for Optimized N Removal
The ammonia-based strategy in AVN is based on volume control as opposed to the more
commonly seen aeration intensity control with DO setpoints. Although the two controllers are
different because of their different goals, they both involve limiting complete nitrification for
increased denitrification and aeration energy savings. NH4+-N and NO2- -N oxidation follows a
typical Monod curve, which suggests a linear increase in nitrifier activity with increasing DO to
a certain point (e.g., 2 mg O2/L) and increasing DO beyond this point has no added benefit since
the nitrification rate is kinetically limited by the nitrifier concentration.
The nitrifier concentration in a system is determined by the average influent NH4+-N load
and can only change in a matter of days. Therefore, the NH4+-N control based on increasing the
aeration intensity is limited by the aerated fraction of nitrifiers in a system. However, this
limitation can be alleviated by increasing the aerated volume such that more nitrifiers are active.
The use of volume control (e.g., switching swing zones) is often based on the influent
+
NH4 -N load, also known as feedforward control. Feedforward volume control could be a robust
tool to provide protection against the influent peak NH4+-N loads compared to feedback control
which might be slower to react in such situations. The researchers’ aeration strategy of cycling
the reactor through controlled aerated and un-aerated periods based on effluent NH4+-N provided
the similar control authority as volume control. Further, the DO was set at 1.6 mg O2/L based on
the finding that the AOB rates were higher than NOB rates at this DO (Regmi et al., 2014b);
similar observations were made in a bench-scale study at the DC Water Blue Plains AWTP (Al-
Omari et al., 2012) and at the full-scale pilot at the Strass WWTP (Wett et al., 2012). Therefore,
in this study’s strategy, aeration intensity was not changed by changing DO setpoints, and rather
3-38
the aerobic volume was changed while the DO setpoint was a constant (1.5 mg O2/L).
Furthermore, low DO operation has been linked with high emissions of N2O (Kampschreur et al.,
2009) and favoring filamentous microorganisms, which could adversely impact sludge
settleability (Martins et al., 2004).
The primary advantages of volume control are the ability to provide control authority
during the high NH4+-N loads by increasing the active nitrifiers in the systems and to provide
denitrification and aeration savings during low NH4+-N loads. Therefore, volume control can
play an important role in balancing total N removal by better utilizing the plant capacity for both
nitrification and denitrification. This flexibility and optimization is not available in conventional
systems where nitrification and denitrification volumes are fixed regardless of the influent loads
and operating conditions.
3.3.2.3 NOB Out-Selection and TIN Removal Efficiency
Nitritation-denitritation achieved through out-selection of NOB has been associated with
a reduction in the amount of internal and supplemental carbon and energy required for nitrogen
removal. However, internal carbon and energy savings can only be realized if the excess influent
carbon is diverted away from the nitrogen removal step through the use of a carbon redirection
step. If not, redirected carbon will be oxidized aerobically, which precludes the benefits of
nitritation-denitritation. The researchers showed that the use of online controllers (developed in
this study) allows measured control over the aerobic SRT to meet the desired effluent NH4+-N
setpoint. The implication of controlling aerobic SRT to the minimum that is required to meet the
target effluent NH4+-N quality allows the overall system to be operated at an aggressive total
SRT. It is clear that in an intermittent aeration system maintaining an AOB/NOB rate differential
causes NO2-N to accumulate during the aerated period which is consumed by heterotrophs during
the subsequent un-aerated period. As a result, NOB growth is limited due to the NO2- -N
consumption by heterotrophs. Therefore, operating at an aggressive SRT could cause a slight
AOB wash-out, however, it eliminates NOB that were already limited in terms of their preferred
substrate.
In this study NOB out-selection did not result in higher nitrogen removal efficiencies for
a similar influent COD/NH4+-N ratio in an intermittently aerated system. This could result from
the fact that longer periods with a high degree of NOB out-selection and concurrent high AOB
rates were not sustained. Due to a limitation of the data during this study, the benefits of
nitritation-denitritation in terms of carbon utilization were inconclusive. However, NOB out-
selection and nitrite accumulation allows for downstream anammox polishing, which can provide
additional nitrogen removal without aeration and supplemental carbon addition (Regmi et al.,
2014a.
The following sections discuss the nitrogen removal performance and the kinetic and
metabolic out-selection of NOB over AOB in the AVN CSTR and the feasibility of Anammox
nitrogen polishing in an MBBR.
3.3.3.1 AVN CSTR Nitrogen Removal Performance
The TIN removal rate 0.15 kg/m3/d observed in this study (influent at COD/N ~6.7 at
25°C) was comparable to short-cut nitrogen removal rates that were reported in the full-scale
plants at the Strass WWTP (TN removal rate ~0.5-1.1 kg/m3/d, influent COD/N~ 15 at 9-19°C)
and in the Changi water reclamation plant (WRP) (Total N removal rate ~0.13 kg/m3/d, influent
COD/N ~7.5 at 28-32ºC). In the Strass WWTP, AOB and AMX were bioaugmented from a

sidestream deammonification reactor (Wett et al., 2012), while in the Changi WRP, higher N
removal rates have been suspected to result from a very short aerobic SRT of 2.5 days in
combination with anaerobic ammonia oxidation by free cell AMX (Cao et al., 2013). A summary
of these comparisons is provided in Table 3-5. During anaerobic batch testing (data not shown)
of AVN CSTR samples, AMX activity was not detected. Therefore, AMX were not expected to
contribute significantly to N-turnover.
3-40
Table 3-5. Comparison of Performance and Strategies used by Recent Studies to Achieve NOB Out-Selection in Mainstream Conditions.
CSTR Strass WWTP Changi WRP SBR SBR RBC

Reference
De Clippeleir et al.,
This Study Wett et al., 2012 Cao et al., 2013 Gao et al., 2013 Hu et al., 2013 2013
COD/N 6.7 15 7.5 2.5 0 2

Temperature (ºC) 25 9-19 28-32 12-27 12 15
N loading rate (kg/m3·d) 0.25 0.55-1.6 0.17 N.R. 0.025 1.4
Total N removal rate (kg/m3·d) 0.15 0.5-1.1 0.13 N.R. 0.028 0.5
Nitrite accumulation (mgN/L) 1.85 1-3 1.1 5-25 0 7
Ammonia residual (mgN/L) 7.3 2-3 1.7 5-25 7 1-4
Aeration pattern cyclical (in time) cyclical (in space) cyclical (in space) cyclical (in time) N/A cyclical (in space)
Frequency of aeration (min) 6-12 5 - 50-200 N/A 1
DO setpoint during aeration 1.6 1.7 1.4-1.8 2-7 0 8
Total SRT (days) 6.5 10 5 30-40 N.C. N.C.
Aerobic SRT (days) 3.2 7 2.5 - N.C. N.C.
Notes:
N.C: Not controlled.
N/A: Not applicable.
SBR: Sequencing batch reactor.
N.R: Not reported.
CSTR: Continuously stirred-tank reactor.
RBC: Rotating biological contactor.
SBR: Sequencing batch reactor.
Mainstream Deammonification 41
3.3.3.2 Kinetic Out-Selection of NOB Over AOB
Oxygen half saturation coefficients for AOB and NOB were evaluated, as no real
consensus exists in mainstream conditions. The Monod curves for both groups are given in
Figure 3-30, showing a half saturation coefficient of 0.16 and 1.14 mg O2/L for NOB and AOB,
respectively. It was therefore confirmed that the strategy of operating at a DO >1.5 mg O2/L
would help to increase the AOB/NOB activity differential under aggressive SRT operation.
400
300
Activity (mgN/L.d)
200
AOB rate
100 NOB rate
Monod model NOB fit
Monod model AOB fit
0
0.0 0.5 1.0 1.5 2.0
DO (mg/L)
Figure 3-30. Dissolved Oxygen Monod Curves for AOB (Model: Ko = 1.16 mg O2/L, rmax = 576.3 mg N/L/d) and NOB (Model:
Ko = 0.16 mg O2/L, rmax = 254.6 mg N/L/d) showing that NOB are Well Adapted at Low DO Compared to AOB.
Under the AVN strategy, the AVN CSTR was operated transiently at a DO equal to or
greater than 1.5 mg O2/L. Although the hypothesis that low DO operation favors AOB over NOB
is very widespread (Sin et al., 2008), this study confirmed other research results pointing in the
opposite direction (Daebel et al., 2007; Manser et al., 2005) for systems like this study, which
were selectively enriched with Nitrospira sp. rather than Nitrobacter sp., Nitrospira are known
for successful adaptation in most nitrifying ecosystems and hypoxic environmental niches
(Lücker et al., 2010). Additionally, Nitrospira sp. has been reported to lack common protection
mechanisms against oxidative stress which might be attributed to the hypothesis from Lücker
that Nitrospira sp. evolved from an anaerobic or microaerophilic origin.
The earlier reports of higher oxygen affinity of AOB compared to NOB might have
considered Nitrobacter sp., which function as r-strategists (higher specific growth rates and low
substrate affinity), as opposed to Nitrospira sp., which function as K-strategists (lower specific
growth rates and higher substrate affinity). Therefore, our strategy of intentionally operating at a
3-42
high DO concentration (≥1.5 mg O2/L) to provide competitive advantage for AOB over NOB
(especially Nitrospira sp.) would be justified against other reports in literature that might have
overlooked Nitrospira sp. completely.
The use of transient anoxia has been a common approach to achieve NOB out-selection
(Li et al., 2012; Ling, 2009; Pollice et al., 2002; Rosenwinkel et al., 2005; Zekker et al., 2012).
Transient anoxia allows for a measured approach to control the aerobic SRT, as well as to
introduce a lag-time for NOB to transition from the anoxic to aerobic environment, either due to
nitrite limitation (Knowles et al., 1965; Chandran and Smets, 2000) or by an enzymatic lag
(Kornaros and Dokianakis, 2010).
Kornaros showed a delay in NOB recovery and NOB lag adaptation in aerobic conditions
following transient anoxia lasting 1.5 hr to 12 hr (the delay in recovery was shown to be a
function of the length of anoxic disturbance), thus confirming the observations of the usefulness
of transient anoxia by many others (Alleman and Irvine, 1980; Katsogiannis et al. 2003; Sedlak,
1991; Sliverstein and Schroeder, 1983; Yang and Yang, 2011; Yoo et al., 1999). However, the
low nitrite in the beginning of the aerobic phase was not discussed as a factor for the lag in NOB
activity. Although transient anoxia has been used successfully in high strength wastes (Wett,
2007) and the ability to use it in low strength wastes has been suggested (Peng et al., 2004), the
control features associated with transient anoxia remains a challenge for NOB out-selection.
The influent COD in the AVN CSTR provided conditions for NO2- to be consumed by
heterotrophs, while no NH4+ oxidation takes place during the anoxic phase (data not shown). By
consuming NO2- in anoxic conditions, heterotrophs restrict NO2- availability for NOB in the
aerobic phase. Further, over many cycles this can potentially limit NOB population as a result of
lower substrate utilization by NOB compared to substrate utilization by AOB.
Lemaire et al. (2008) attributed this positive feedback as one of the primary mechanisms
for NOB out-selection in aeration duration controlled SBR treating abattoir wastewater. The
AVN aeration controller used in the AVN CSTR successfully allowed maintenance of residual
NH4+ (7.3±4.4 mgNH3-N/L) throughout the study, allowing the AOB growth rate to be close to
the maximum. Free ammonia (FA) concentration levels in the AVN CSTR were too low to cause
NOB inhibition since FA was 0.0314±0.0189 mgNH3-N/L compared to 0.1 – 0.8 mgNH3-N/L
that is considered inhibitory (Anthonisen et al., 1976). Similar trends have also been observed in
the mainstream deammonification testing at the Strass WWTP, which showed higher NOB out-
selection (indicated by less NO3- production) during late December where effluent NH4+ levels
were high (NH4+ setpoint =2.5 mg N/L compared to normal NH4+ setpoint = 1.5 mgN/L) at
significantly higher loadings and low temperatures; therefore lowering the SRT to its minimum
(Wett et al., 2012). Alternating aerobic and anoxic conditions and maintaining residual NH4+ has
proven effective for NOB out-selection in recent studies in mainstream conditions (Table 3-5).
3.3.3.3 Metabolic Out-Selection of NOB Over AOB
The AVN CSTR was operated at a relatively low total SRT (6.5±4.3 days) during the
study period. The intent of limiting the SRT of the system was to operate very close to the AOB
washout SRT, such that NOB were out-selected. It is very important to recognize that
heterotrophic denitrification pressure, high DO, and intermittent aeration, provides unfavorable
conditions for NOB, without adversely affecting the AOB population. However, it was surmised
that the ability of the system to be operated at aggressive SRTs would out-select NOB over
AOB.

The use of AVN strategy allowed control of the aerobic SRT of the system such that
NH4+ oxidation was always maintained at the optimum level for a given influent COD/TKN and
SRT, thus allowing the system to be run at the minimum SRT which eliminates NOB from the
system. The researchers clearly showed that when the system was operated aggressively
(NLR/Max AOB rate ~1), NOB out-selection was more rampant. The use of online aeration
controllers and intentional SRT control towards critical AOB washout demonstrated in this study
was a novel approach to out-select NOB in mainstream conditions.
3.3.3.4 Feasibility of Anammox N Polishing in an MBBR
In this study, the researchers showed, as a final polishing step, the startup of anammox
was immediate without any lag. However, the seed sludge used and N loading could be different
in a full-scale startup. One of the biggest drawbacks of the anammox based processes is the long
startup times resulting from the slow growth rates of AMX (van der Star et al., 2007). Unlike
one-stage deammonification systems, where AOB and AMX are required to be managed within
the same system requiring complex controls, AMX polishing was possible without process
control. The anammox step of the sidestream two-stage deammonification systems are prone to
NO2--N inhibition (Wett, 2007), which often requires a very strict control over the NO2--N
loading. The NO2--N levels that are expected in mainstream polishing applications can be
considered below inhibitory levels. As a final step, the anammox MBBR received low COD/N
ratio influent, therefore, heterotrophs were not able to out-compete AMX for NO2--N. The
retention of slow growing AMX, which is often the main challenge (Fernández et al., 2008), was
resolved by providing supporting material in the form of biofilm carriers.
The maximum AMX activities (from batch activity experiments) are much higher
compared to in-tank N removal rates, which suggest enrichment of the biofilm carriers. In fact,
the TIN removal rate was around 0.064±0.028 g N/m2/d during Phase I (day 136 to 253), while
the maximum AMX activity doubled over the same time (Figure 3-27 A). The trend of maximum
AMX activity continued to increase in both Phase I and Phase II (Figure 3-27A). The lower
decay rates (0.002-0.004/d) of AMX (Dapen-Mora et al., 2004; Udert et al., 2008; Ni et al.,
2009) and the effective retention through biofilm carriers may have contributed to such
enrichment. The process stability was demonstrated in Phase II of the study when the NO2--N
loading rate was increased rapidly without any loss of the NO2--N removal rate. This can be
attributed to the extra capacity that existed because of the AMX enrichment.
The N removal in anammox polishing was limited by the influent NO2--N/NH4+-N ratio
and not by the AMX retention and enrichment. It emphasizes the fact that to maximize benefits
of anoxic autotrophic N removal through anammox, greater stability of NOB suppression and a
tight control of the effluent NO2--N/NH4+-N ratio in a nitritation-denitritation system is needed.
3.3.3.5 Nitrate Removal in AMX MBBR
The influent COD to the anammox MBBR was mostly comprised of effluent TSS,
refractory and particulate COD fractions that were not degraded by the AVN CSTR (Startup +
Phase I) and HRAS plant (Phase II). However, COD removal was observed in the anammox
MBBR, and as a consequence, there was a limited heterotrophic contribution to the N removal
observed. It was reported that in the presence of a certain level of organic matter, AMX cannot
compete with heterotrophic denitrifiers due to their slower growth rate (Udert et al., 2008). Tang
et al. (2010) demonstrated that when the influent COD/NO2--N ratio was 2.9, heterotrophic
denitrification dominated over AMX in an upflow anaerobic sludge blanket (UASB) reactor.
Many studies lately have showed that with a ratio of COD/N less than 0.5 in the influent, AMX
3-44
can outcompete heterotrophic bacteria with mainly nitrite in the influent (Lan et al., 2011; Chen
et al., 2009; Xu et al., 2010).
Recently it was shown that AMX bacteria have the ability to use short-chain fatty acids
(SCFA) with NO3- as the electron acceptor (Guven et al., 2005; Kartal et al., 2008; Winkler et
al., 2012). AMX bacteria completely oxidize organic matter into CO2 without assimilation,
which results in a low biomass yield (Winkler et al., 2012). Ca. “Brocadia fulgida”, known for
its capability to use acetate with NO3- as the electron acceptor (Kartal et al., 2008) was not
detected in the anammox MBBR in this study. In an anoxic reactor, Guven et al. (2005) showed
that heterotrophs outcompete AMX for nitrate if the COD/N ratio exceeds 1. Since the anammox
MBBR was not fed external acetate (VFAs in upstream nitritation-denitritation effluent was
below detection) nor was Ca. “Brocadia fulgida” dominant (Figure 3-31), AMX using NO3--N
was not completely justified. In fact, the species of AMX remained unknown and further
investigation is ongoing. Therefore, the possibility of heterotrophs converting some fraction of
NO3--N to NO2--N under limited COD availability and AMX using this produced NO2--N with
NH4+-N cannot be overruled. Regardless of the exact pathway, this study has shown that NH4+-
N, NO2--N and NO3--N removal was possible in a mainstream fully anoxic anammox MBBR
with limited influent COD.
1e+11 1e+9
Ca. "Brocadia fulgida" abundance (copies/mL)

Unknown AMX
Unknow AMX abundance (copies/mL)
Ca. "Brocadia fulgida"
1e+10 1e+8
1e+9 1e+7
358th 372th 385th
Day
Figure 3-31. Abundances of AMX Species Identified During Phase II of the Study (Day: 358, 372, and 385).

3.4 Conclusions
This section discusses key findings that indicate:
 The A-stage can successfully achieve overall COD removals of 50-70%.
 Aeration control has been very effective to improve nitrogen removal.
3.4.1 A-Stage High-Rate Activated Sludge Process (HRAS)
This study has demonstrated that the A-stage can be successfully operated at a low sludge
age and low DO and still achieve overall COD removals of 50 to 70%. Future work includes:
1) determining the extent of COD oxidation and bioflocculation in the A-stage by off-gas
analysis and bioflocculation testing, respectively, 2) estimating the increased COD load
reporting to the digester from the A-stage and the associated potential increase in gas production,
and 3) eliminating filamentous bulking issues.
3.4.2 B-Stage AVN
Aeration control, based on direct measurement of NH4+-N in the bioreactor, has proven to
be highly effective to reduce aeration energy and increase denitrification capacity of biological
nitrogen removal (BNR) systems. In this study, a novel aeration strategy that controlled the
aerobic time (while maintaining anoxic time ≥ 25% total cycle time) based on the in situ effluent
NH4+-N setpoint was implemented. The success of this aeration strategy led to realized NOB
out-selection and nitrogen removal through the nitrite pathway at ambient temperature. NOB
out-selection did not improve the TIN removal efficiency, as was expected. However, the
advantages of NOB out-selection can be capitalized by employing downstream anammox
polishing, which offers efficient nitrogen removal without oxygen and supplemental carbon.
The benefits of volume control include: 1) control authority at high loads to attenuate
effluent NH4+-N peaks; 2) instant increase in nitrification capacity (not possible with increasing
DO setpoint); and 3) increased denitrification capacity and reduced aeration for nitrification at
low loads.
The model based feed-forward control is mostly used to achieve volume control, which
adds extra sensors and complexity. The aeration strategy used in this study achieved the benefits
of volume control without the drawback of feed-forward control. Therefore, this study
demonstrates a novel aeration strategy that expands the benefits of long established ammonia-
based aeration control.
Conclusions for the AVN CSTR with Anammox MBBR are provided separately below.
3.4.3.1 AVN CSTR
This study demonstrated that mainstream NOB out-selection in a continuous process is
possible without using known factors that aid NOB out-selection in sidestreams with high
strength ammonia. A novel aeration control strategy based on direct in situ measurement of
NH4+, NO3-, and NO2- was demonstrated to be capable of facilitating the proposed strategies and
exploiting NOB out-selection mechanisms. Therefore, this study presents a new paradigm in
biological nitrogen removal that utilizes a novel understanding of microbial communities and
advanced process control strategies. As we move closer to mainstream nitrite shunt-based
processes, the findings of this study are expected to help existing BNR plants optimize for cost-
effective and efficient nitrogen removal.
3-46
3.4.4 Anammox MBBR
This study demonstrated mainstream application of anammox as nitrogen polishing in an
anoxic MBBR. The startup was fast and did not rely on a high degree of NOB out-selection in
the feeding of a nitritation-denitritation system. A highly stable nitrogen removal performance
was demonstrated within a wide range of influent nitrogen species concentrations. The
production of NO3--N limits the applicability of anammox to meet stringent nitrogen permits,
however, in this study it was showed that NO3--N removal is possible. Although, the exact
pathway of NO3--N removal remained unclear, it will be explored in future research. Therefore,
this study shows for the first time that anammox nitrogen polishing in an MBBR is possible for
nitritation-denitration systems, however, anammox polishing is not strictly limited by the extent
of NOB out-selection.

3-48
CHAPTER 4.0
PROCESS MODELING
This modeling chapter provides a summary of simulation studies, evaluations, and
parameter calibration with regard to mainstream deammonification process. The modeling work
includes the following topics:
 Subsection 4.1: Process Units Modeling and Conceptual Model Configuration Setups.
 Subsection 4.2: Biokinetic Model Formulation.
o Plant-wide two-step nitrification/denitrification model.
o Green House Gas four-step nitrification/denitrification model.
 Subsection 4.3: Key Model Parameter Measurement and Calibration.
 Subsection 4.4: Simulation Studies and Evaluations:
o Energy balances – a comparison between conventional mainstream nitrogen removal.
process nitrification/denitrification, nitrite shunt, and deammonification.
o NOB Out-selection mechanisms.
o Anammox Enrichment Simulation Evaluation
4.1 Process Units Modeling and Conceptual Model Configuration Setups
This section provides information on the setup of the conceptual model configuration,
including the idealized whole plant flowsheet, the mainstream deammonification (MDA) unit
processes (cyclone, seeding], and seed quantity estimation.
4.1.1 Conceptual Model Configuration Setup
A conceptual configuration was created to investigate the general principles of
mainstream deammonification independent of a specific plant configuration. Configurations
were developed using Sumo® (Simulator platform by Dynamita, France) in several steps which
are described here.
4.1.1.1 Idealized Whole Plant Flowsheet
The idealized whole plant flowsheet is shown in Figure 4-1 and consists of the following
components:
 The liquid line outlined in light blue, specifically: influent, primary settler, symbolically
represented anoxic and aerobic activated sludge reactors (for the actual performance tests, a
more detailed reactor configuration was used), final clarifier, deammonified effluent, and a
cyclone to increase the SRT of anammox organisms.
 The solids line containing a thickener (combined primary sludge and WAS), digester, and a
centrifuge.
 Side-stream treatment of digester liquors, with anammox retaining cyclone (highlighted in
light red).

Figure 4-1. Idealized Whole Plant Flowsheet.
Seeding of sidestream AOBs to the mainstream is indicated from the overflow of the
cyclone by a blue arrow. Seeding of sidestream anammox organisms is indicated by a red arrow
from the effluent (mixed liquor) of the sidestream SBR.
For the evaluation runs, the key parameters affecting the main-stream deammonification process
are the amount of AOB, AMX transferred from the sidestream, and the activity loss due to the
temperature shock (Wett et al., 2010b). Other performance parameters are of secondary
importance.
4.1.1.2 Mainstream Deammonification (MDA) Process Units [Cyclone, Seeding]
In this evaluation, the sludge processing and sidestream treatment were not simulated
directly to avoid unnecessary model complexity and to have a better control over the seed
amounts transferred. Instead, two influent units were employed to represent the transferred seed
(Figure 4-2). The expected amounts of AOB and AMX seed were calculated based on the
algorithm described below and shown in Table 4-1.
Figure 4-2. Conceptualized AOB and Anammox Seeding.
4-2
Table 4-1. AOB and AMX Seed Estimation.
VSS to Digester 1000 lbs/d

Vss destruction 50% %
N content 6% %
N released in digestion 30.0 lbs/d

N nitrited in sidestream 50% %
AOB sidestream yield 0.15 g COD/g N

AOB sidestream decay 0.17 1/d
AOB sidestream SRT 7 d
AOB sidestream grown 1.03 lbs COD/d
Anammox sidestream yield 0.11 G COD/g N

Anammox sidestream decay 0.01 1/d
Anammox sidestream SRT 70 d
Anammox sidestream grown 0.97 lbs COD/d
Side -> Main activity retained 50% %

AOB activity transferred 0.51 lbs COD/d
Anammox activity transferred 0.49 lbs COD/d

4.1.1.3 Seed Quantity Estimation
The amount of AOB and AMX activity was estimated from a hypothetical 1000 lbs/d
VSS loaded into an anaerobic digester. AOB or anammox activity present in the activated sludge
was assumed to diminish in the digestion process (as the most conservative scenario). Nitrogen
released in the digestion process can be calculated based on VSS destruction (50% in the
example) and the nitrogen content of VSS, which would heavily depend on the primary/
secondary sludge mixture. In this example, 6% was used. This results in 30 pounds of nitrogen
released per 1000 pounds of VSS loading to the digester.
In a sidestream deammonification process approximately 50% of ammonia is oxidized to
nitrite (i.e., nitritation), therefore the yields of AOB and AMX biomasses in the sidestream were
based on 15 pounds of ammonia per day. Yield and decay coefficients, as well as the biomass
specific SRT affect the amount of active biomass generated through Equation 6:
Equation 6:
𝑁 𝐹 ∗𝑌
𝑋𝐵𝐼𝑂 = 1+𝑏∗𝑆𝑅𝑇
Where XBIO AOB or AMX biomass, lbs COD/d
FN Ammonia oxidized to nitrite, lbs N/d
Y Biomass yield, lbs COD / lbs N
b decay coefficient, 1/d
SRT Solids residence time, d
The SRT of the AOBs is equivalent to the system SRT (7 days in the example), while the
SRT of AMX is higher, by the fraction of retention in the cyclone. The cyclone was simulated
using an assumed mass flow split (i.e., 90%) for anammox and a flow proportional mass flow
split for all other variables. The underflow containing most of the AMX biomass is returned to
the sidestream and this increases the residence time of the anammox biomass. At 90% assumed
retention, AMX SRT is 7/(1-0.9) = 70 days for 7 days of system SRT.
While AOBs have an assumed higher yield but much higher decay coefficient, in spite of
the shorter SRT, their production comes out to about the same value as AMX which decays very
slowly. For every 1000 lbs of VSS loaded to the digester, about 1 pound COD of AOB and AMX
activity is created in the sidestream process. Considering that not all of this activity can be
transferred to the mainstream, due to temperature shock and other effects, simulations were
performed using 50% activity retention, the values as shown in Table 4-1.
4.2 Bio-Kinetic Model – Structure and Formulation
This section provides information on the structure and formulation of the bio-kinetic
model, including the plant-wide, two-step nitrification /denitrification model and the greenhouse
gas (GHG) model which is a four-step nitrification/denitrification model
4.2.1 Plant-Wide Model – Two-Step Nitrification/Denitrification Model
There are three requirements that need to be considered for simulating a main-stream
deammonification process realistically. These are summarized as the following:
 The model must be able to match the amount of COD and nutrient capture in the enhanced
primary clarifiers or A-stage. If a predictive simulator is not required to model primary
clarifier performance for example (i.e., actual percent captures are available), these amounts
can be simulated in the model with a relatively simple empirical phase separation unit and
4-4
using the proper N content for the various fractions of the solids. Predictive (mechanistic)
models need to consider settling, colloidal flocculation and the nitrogen content of various
fractions. They are more data intensive.
 The biokinetic model must be able to recognize the complex role of nitrite in the
nitrification/denitrification/deammonification reaction chains. This means effectively
describing at least three separate autotrophic biomasses, AOBs, NOBs, and anaerobic
ammonia oxidizers (Anammox). In addition, in the presence of electron donors and lack of
oxygen, separate denitritation and denitratation reactions are required. Careful consideration
and suppression of model artifacts (such as nitrite looping where nitrite is oxidized to nitrate
and reduced back to nitrite and so forth, preference switches, etc.) is needed. In addition,
diffusion and floc structure, in lack of a detailed mechanistic description, is represented by
half saturation coefficients which may require choosing it based on environmental conditions
(Shaw et al., 2013), reaction rate and rheology.
 An equilibrium model capable of determining the species concentration, ionic strength

corrections and pH in a given solution (reactor matrix) is required and must interact with a
gas transfer model of non-ionic components. This is required for handling NO2 and free NH3
inhibition as well.
The amount of autotrophic activity transferred from the sidestream and the mainstream
requires special consideration. There were few modeling attempts to reliably predict the activity
transfer (e.g., Wett et al., 2010b), but these models are not incorporated into a standard
engineering practice yet. Temperature and temperature differential between sidestream and
mainstream play an important role in determining the activity transfer.
Two proprietary models were used in this evaluation, the whole-plant model embedded in
BioWin©, and Sumo2 in the Sumo© software. BioWin is a well-known process simulator. The
complete description of the Sumo2 reactions and stoichiometry goes beyond the objectives of
this chapter, but the list of relevant states and reactions for mainstream deammonification is
provided in Tables 4-2 and 4-3.

Table 4-2. Components Relevant to Mainstream Deammonification in Sumo2.
Symbol Name Unit

SVFA VFAs g COD/m3
SB Readily biodegradable substrate (non-VFA) g COD/m3
CB Colloidal biodegradable substrate g COD/m3
XB Slowly biodegradable substrate g COD/m3
Su Soluble unbiodegradable organics g COD/m3
Cu Colloidal unbiodegradable organics g COD/m3
Xu Particulate unbiodegradable organics g COD/m3
XE Endogenous decay products g COD/m3
XOHO Ordinary heterotrophs g COD/m3
XAOB Aerobic ammonia oxidizers g COD/m3
XNOB Nitrite oxidizers g COD/m3
XAMX Anammox organisms g COD/m3
SNHx Total ammonia g N/m3
SNO2 Nitrite g N/m3
SNO3 Nitrate g N/m3
SN2 Dissolved Nitrogen g N/m3
SN,B Soluble biodegradable organic N (from SB) g N/m3
CN,B Colloidal biodegradable organic N g N/m3
XN,B Particulate biodegradable organic N g N/m3
SN,U Soluble unbiodegradable organic N g N/m3
CN,U Colloidal unbiodegradable organic N g N/m3
XN,U Particulate unbiodegradable organic N g N/m3
SPO4 Orthophosphate g P/m3
SP,B Soluble biodegradable organic P (from SB) g P/m3
CP,B Colloidal biodegradable organic P g P/m3
XP,B Particulate biodegradable organic P g P/m3
SP,U Soluble unbiodegradable organic P content g P/m3
CP,U Colloidal unbiodegradable organic P content g P/m3
XP,U Particulate unbiodegradable organic P g P/m3
content
SO2 Dissolved oxygen g O2/m3
SCO2 Total inorganic carbon g CO2/m3
XINORG Inorganic suspended solids g TSS/m3
SCAT Sodium (strong cation) g/m3
SAN Chloride (strong anion) g/m3
4-6
Table 4-3. Reactions Relevant to Mainstream Deammonification.
No. Reaction
1 OHO growth on VFAs, O2
2 OHO growth on VFAs, NO2
3 OHO growth on VFAs, NO3
4 OHO growth on SB, O2
5 OHO growth on SB, NO2
6 OHO growth on SB, NO3
9 OHO decay
25 AOB growth
26 AOB decay
27 NOB growth
28 NOB decay
29 Anammox growth
30 Anammox decay
35 CB flocculation
36 CU flocculation
37 CN,B flocculation
38 CN,U flocculation
39 CP,B flocculation
40 CP,U flocculation
41 XB hydrolysis
42 XN,B hydrolysis
43 XP,B hydrolysis
44 SN,B ammonification
45 SP,B conversion to PO4
46 XE conversion
48 NO2 assimilative reduction
49 NO3 assimilative reduction

4.2.2 GHG Model – Four-Step Nitrification/Denitrification Model
A four-step nitrification/denitrification model was developed in Sumo (Sumo-N)
(De Clippeleir et al., 2014) to simulate full-scale Strass plant performance including N2O
emissions. The focus of this model is the detailed description of the fate of nitrogen species and
N2O generation by heterotrophic and autotrophic reaction pathways. The list of state variables
are listed in Table 4-4 and the relevant reactions are listed in Table 4-5.
Table 4-4. List of State Variables for the SUMO-N Model Including GHG Emissions.
Symbol Name Unit

Sa Readily biodegradable substrate g COD/m3
XB Slowly biodegradable substrate g COD/m3
SU Soluble unbiodegradable organics g COD/m3
XU Particulate unbiodegradable organics g COD/m3
XE Endogenous decay products g COD/m3
XOHO Ordinary heterotrophs g COD/m3
XAOB Aerobic ammonia oxidizers g COD/m3
XNOB Nitrite oxidizers g COD/m3
XAMX Anammox g COD/m3
XENZ,NOB No catalyzing enzyme in AOBs -
XENZ,NOB N2O catalyzing enzyme in NOBs -
SNHX Total ammonia g N/m3
SNO2 Nitrite g N/m3
SNO3 Nitrite g N/m3
SNO Nitric oxide g N/m3
SN2O Nitrous oxide g N/m3
SN2 Dissolved Nitrogen g N/m3
SN,B Soluble biodegradable organic N g N/m3
XN,B Particulate biodegradable organic N g N/m3
SN,U Soluble unbiodegradable organics N content g N/m3
XN,U Particulate unbiodegradable organics N content g N/m3
XN,E Endogenous product N content g N/m3
XN,BIO Biomass N content g N/m3
XINORG Inorganic suspended solids g TSS/m3
SO2 Dissolved oxygen g O2/m3
GNO NO gas ppm
GN2O N2O gas ppm
GO2 O2 gas ppm
4-8
Table 4-5. Rate Expressions Used in the Sumo-N Model to Describe the Kinetics for NO and N2O Production by AOB.
Processes
By AOB Rate Expression
NO2  NO µAOB *XAOB*Msat(SO2;k02,AOB)*Msat(SNHx;kNHX,nut)*ƞNO2,AOB*XENZ,AOB*Msat(SNO2;kNO2,AOB)

NO  N2O µAOB *XAOB*Msat(SO2; k02,AOB)*Msat(SNHx;kNHX,nut)*ƞNO2,AOB*Msat(SNO;kNO,AOB)
Enzyme activation µENZ,AOB*XAOB*Msat(SNO2;kNO2,AOBENZ)*Max(0;(1-XENZ,AOB)/((1-XENZ,AOB)+kscaling))*(kscaling+1)
Enzyme decay bENZ,AOB *Msat(XENZ,AOB)*Msat(SO2;kO2,AOBENZ)
Notes:
Msat(var; k)=var / (k + var)
4.3 Key Model Parameter Measurements and Calibration

Key model parameters affecting NOB out-selection, greenhouse gas emissions and
operational strategies are evaluated in the following sections. Default values are proposed based
on data and experimental results from the demonstration studies.
4.3.1 Key Model Parameters – Significance to Operation Strategies
Based on the operational strategies for NOB out-selection and the goal of maintaining a
maximum differential between the AOB and NOB specific growth rates and maximizing the
growth rates of organisms competing with NOBs over nitrite (i.e., heterotrophs and anammox),
the half saturation of the substrates involved in the nitrogen removal reactions are important for
the out-selection process. Figure 4-3 demonstrates, via Monod rate expressions, the target for
substrate levels at which the process should be operating to achieve nitrogen short cut via nitrite
reduction pathway. It is crucial to determine the values of these half constants to be able to
model the competition between the various organisms over common substrates.
AOB AMX NOB AOB AMX NOBOHO NOB AOB OHO

4.0 4.04.0 4.0
process rates [1/d]
process rates [1/d]
Specific Growth Rates
Specific Growth Rates
3.5 3.53.5 3.5

3.0 3.03.0 3.0
2.5 2.52.5 2.5
[1/d]
[1/d]
2.0 2.02.0 2.0

1.5 1.51.5 1.5
1.0 1.01.0 1.0
0.5 0.50.5 0.5
0.0 0.00.0 0.0
0 0.5 1 1.5 2 2.5 3 3.5 4 0 0 0.50.5 1 1 1.5
1.5 22 2.5 33 3.5
3.5 4 4 0 0.5 1 1.5 2 2.5 3 3.5 4
NH4-N [mg/L] NO2-N [mg/L]

NH4-N [mg/L]/NO2-N [mg/L] O2 [mg/L]
Figure 4-3. Monod Expressions Describing Rate and Substrate Affinities and Competition
Under Pilot Target Operational Conditions for NH4+-N, NO2--N and DO.
Target ranges are those where AOB rates are higher than NOB rates.
Blue circles and arrows represent shifting from low effluent levels (circles) to the target range (rectangles).

4.3.2 Key Model Parameters – Calibration
Table 4-6 presents a list of parameters for the two-step nitrification/denitrification model
used in the whole plant model to simulate the nitrite shunt and anammox reactions. The oxygen
half saturation concentrations for AOB, NOB and anammox were modified using model
calibrated values. The values were based on actual measurements from the SBR reactors at
DC Water. Details of model calibration using SBR data is presented later on in this section.
Table 4-6. Autotrophic Biomass Parameters in the Two-Step Nitrification/Denitrification Model.
Default Parameters - Jones et al., 2007.
Parameter AOB NOB Anammox
Max. spec. growth rate [1/d] (0.9) (0.7) (0.1)

Arrhenius on max. spec. growth rate (1.072) (1.06) (1.1)
Substrate (NH4) half sat. [mgN/L] (0.7) – (2)
Substrate (NO2) half sat. [mgN/L] – (0.1) (1)
Aerobic decay rate [1/d] (0.17) (0.17) (0.019)
Anoxic/anaerobic decay rate [1/d] (0.08) (0.08) (0.0095)
Nitrous acid inhibition constant [mmol/L] (0.005) (0.075) –
NO2--N inhibition constant [mgN/L] – – (1000)
NO2--N toxicity constant [L/(d mgN)] (0.016)
DO half sat. [mg O2/L] 0.4 (0.25) 0.14 (0.5) 0.05 (0.01)
Bicarbonate switch [mmol/L] 0.75 (0.1) (0.1) (0.1)
Yield [mg COD/mgN] (0.15) (0.09) (0.114)
Note:
Bolded parameter values are calibrated and values in parentheses are default.
4.3.3 Dissolved Oxygen Half Saturation Concentrations for AOB and NOB Growth
(KO,AOB; KO,NOB) and Oxygen Inhibition Half Saturation Concentration for
Anammox Growth (KiO,AMX)
The process model was used to simulate the SBR performance under three aeration
scenarios to explore the model’s ability to predict NOB out-selection potential under each
scenario (refer to Figure 1-5, Section 1.3.1.2.3). The first aeration scenario was low constant DO
where DO level was maintained at approximately 0.08 mg/L during the aeration phase. The
second scenario was low DO and intermittent aeration where the DO level was maintained at
approximately 0.15 mg/L and then was allowed to drop to zero.
Finally, the third scenario was high DO and intermittent aeration. The operation was
similar to the second scenario except the DO level was maintained at 1.5 mg/L instead of
0.15 mg/L. Nitrogen profiles, gathered after operating the SBRs for at least one system SRT,
were compared to model output. DO half saturation constants for the three main biomass
populations (i.e., AOB, NOB, and anammox) were modified to calibrate the model output to the
data.
4-10
Figure 4-4 compares the three aeration scenarios and shows the model simulation results
for each scenario.
I-b
I-a I-c
II-b
II-a II-c
III-b
III-a III-c
Figure 4-4. Model Output versus Data for Three Aeration Regimes.
Notes: I) low constant DO; II) low DO/Intermittent; and III) high DO/Intermittent.
“a” = profiles under normal cycle operation, “b” = DO profile under normal operation, and “c” = anaerobic activity profiles.
Under low DO operation, the SBRs were operated under SRT limited conditions (near
minimum SRT required to maintain critical AOB population) where ammonia removal was
minimal in the range of 2-3 mg N/L. This translates to minimal nitrite production and thus nitrite
limiting conditions. The competition among OHO, anammox and NOB populations over nitrite
would be most critical for NOB repression. Thus, the composition of biomass and the availability
of nitrite would determine the fate of NOBs. As for the OHOs, they are always present and their
level depends on substrate availability. The anammox enrichment, however, depends mainly on
seeding from bioaugmentation.
Initial simulations with anammox KO,I (oxygen inhibition half saturation concentration)
set to 0.4 mg/L (value used for sidestream anammox reaction) showed complete repression of

NOBs. Reducing this parameter to 0.05 mg/L was adequate to maintain NOB in the system as
was observed in the bench-scale experiments (see Figures 4-4.I.a and 4-4.II.a). The researchers
hypothesized that the difference in oxygen impact on anammox activity between sidestream
systems and these bench-scale experiments could be related to the difference in loading rates
(and thus biomass activity) between sidestream and mainstream applications. Because, in
sidestream applications the higher rates are associated with higher half saturation concentrations
(Shaw et al., 2013). The nitrite feed concentration during the two low DO scenarios was high.
That partially compensated for low nitrite production from SRT-limited AOB.
4.3.3.1 Inorganic Carbon Half Saturation for AOB (KCO2)
The default inorganic carbon half saturation concentration for all autotrophic biomass
reported in the Jones et al. (2007) was set at 0.1 mmol/L while for sidestream application the
recommended parameter was 4 mmol/L for AOB in line with recommendations by Wett et al.
(2005). The reasoning was to eliminate the impact of inorganic carbon at typical residual
concentrations observed in nitrogen removal systems.
However, in bench-scale shallow reactors, CO2 stripping is much greater than full-scale
reactors and may become limiting to autotrophic bacteria (Wett et al., 2003). In addition,
Guisasola et al. (2007) suggested that AOB were limited by inorganic carbon availability at
concentrations as low as 3mmol/L while the NOB were not limited even at concentrations below
0.1 mmol/L. In this modeling exercise, a value of 0.75 mmol/L for KCO2 was used based on a
calibration using ammonia removal profiles in the DC Water deammonification continuous flow
reactor (not part of this study). The researchers observed that the removals were lower at these
conditions than expected by the model using the default inorganic carbon half saturation
concentration (i.e., 0.1 mmol/L). To model the impact of inorganic carbon on AOB and NOB
separately, new equations describing the growth and decay of AOB were introduced to the
model.
4.3.3.2 N2O Emissions – Four-Step Nitrification/Denitrification Model
The Strass plant (Austria) was modeled using the same four-step nitrification/
denitrification and GHG model (Sumo-N in the Sumo simulator) as described in the GHG
workshop at WWTMod 2012. The four-step model contains the Hiatt and Grady (2008)
heterotrophic denitrification model and the autotrophic denitrification concept (Mampaey et al.,
2013), extended by the nirK enzyme indicator. The latter concept was originally based on the
observation that during transition periods from anoxic to aerobic conditions, GHG-emissions first
tend to increase; and then at continued aeration, concentrations decrease. Enzyme measurements
(Yu et al., 2010) indicated during periods of nitrite availability, a corresponding accumulation
(specifically of NirK known to catalyse NO-formation) and a more pronounced depletion of the
enzyme at increasing DO concentrations. The enzyme-activity growth- and decay-approach is a
method to describe the dynamics of NO-formation depending on preceding process conditions.
The model configuration mimicking the Strass plant is depicted in Figure 4-5. The model
calibration consisted of setting up the plant configuration with the proper loading and DO values,
and adjusting half saturation values to match N2O release proportions (Table 4-7).
4-12
Figure 4-5. Configuration of the Strass Mainstream Deammonification Process in Sumo.
Table 4-7. Parameters used in the GHG Model in Sumo-N for the Strass Case Study.
Parameter Symbol Value Unit
O2 half saturation coefficient for AOB kO2,AOB 0.4 mg O2/L

O2 half saturation coefficient for NOB k02,NOB 0.4 mg O2/L
O2 inhibition coefficient OHO kO2,OHO 0.05 mg O2/L
NO2 half saturation coefficient for AOB kNO2,AOB 0.2 mg NO2-N/L
NO2 half saturation coefficient for NOB kNO2,NOB 0.2 mg NO2-N/L
NO2 half saturation coefficient for OHO kNO2,OHO 1 mg NO2-N/L
NO half saturation coefficient for AOB kNO,AOB 0.001 mg NO-N/L
NO half saturation coefficient for OHO kNO,OHO 0.001 mg NO-N/L
N2O half saturation coefficient for OHO kN2O,OHO 0.1 mg N2O-N/L
NO2 nirk enzyme half saturation AOB kNO2,AOBENZ 0.1 mg NO2-N/L
O2 half saturation for enzyme decay in AOB kO2,AOBENZ 0.1 mg O2/L
Maximum enzyme activation rate µENZ,AOB 1 d-1
Correction factor for NO production by AOB ȠNO2,AOB 1 -
Correction factor for N2O production by AOB ȠNO,AOB 1 -
Maximum growth rates for AOB µAOB 0.9 d-1
Maximum growth rates for NOB µNOB 0.7 d-1
Maximum growth rates for OHO µOHO 6 d-1
Oxygen profiles were calibrated by adjusting the kLaO2 to 240, 280 and 350/d for DO
setpoints of 1, 2, and 3 mg O2/L respectively. Due to the fact that this experiment was done at
full-scale (less defined boundaries) and the complexity of NOB out-selection during mainstream
deammonification (Al-Omari et al., 2014), simulated nitrite accumulation values were slightly
lower than the observed values. Nitrite concentrations of 0.3, 1.3, and 1.7 mg NO2-N/L were

obtained by the model at 1, 2, and 3 mg O2/L, respectively, while an increase of 0.5 to 4 mg
NO2-N/L was observed during the experiment. Although absolute nitrite levels were lower, the
model showed the stepwise increase in N2O emission with increasing DO setpoint and thus
increasing AOB-NOB differential (Figure 4-6).
It should be noted that the N2O emissions obtained in this experiment were very high (3,
9 and 15% of N load at 1, 2, and 3 mg O2/L) and were intentional during this experiment. It was
not the attempt of this experiment to minimize emission but rather to test potential conditions
which would increase the emissions. Moreover, no adaptation of the system towards the transient
condition applied in this experiment (oxygen and loading) was allowed, further maximizing the
potential effect. The emissions observed in this experiment are not expected during long-term
mainstream deammonification operation because optimal balances between NOB out-selection
and anoxic nitrite removal by anammox (or denitrification) will decrease nitrite accumulation,
especially at the transition between anoxic to aerobic conditions. Moreover, adaptation can occur
which further decreases the emissions (Yu et al., 2010).
Figure 4-6. Modeled versus Observed N2O Emission at Increasing DO Setpoints

and Subsequently Higher Nitrite Accumulation.
4-14
4.4 Simulation Studies and Evaluations
Simulations performed to evaluate energy balances, AVN versus ammonia-based control,
and NOB out-selection mechanisms are summarized below.
4.4.1 Energy Balances – A Comparison Between Conventional Mainstream
Nitrogen Removal Process Nitrification/Denitrification, Nitrite Shunt, and
Deammonification
Three conceptual scenarios were simulated under winter and summer conditions:
 Conventional nitrification/denitrification.
 Nitrite shunt.
 Mainstream deammonification.
The objective of the simulations was to generate a method for consistent comparison of
energy efficiency of various process configurations, using the three key operational modes listed
above as test examples.
The following assumptions were used in the analysis for all three concepts:
 NOBs are repressed. This analysis does not deal with the actual mechanism of NOB
repression, which can be varied for different configurations and site conditions.
 Activity retention for both ammonia oxidizers and anammox when transferring activity from
the warmer sidestream to mainstream was set at 50%. This is a very site specific and
complex issue, and guidance is provided elsewhere in this report for activity estimation.
 The TSS removal in the primary or A-stage was varied between the scenarios to maintain a
similar level of effluent TN. This was required to provide a consistent baseline for the
comparison of energy savings.
The final conceptual configuration used in the analysis as developed in Sumo© is shown in
Figure 4-7. The swing zone was anoxic in the summer, and aerated during winter (12ºC)
conditions, bringing the aerobic sludge fraction from 60 to 80%. A total SRT of 7 days was used,
and 90% cyclone efficiency for AMX retention.
Figure 4-7. Conceptual WWTP Configuration Used for the Three Scenarios.

4.4.1.1 Conventional Nitrification/Denitrification
In this operational configuration no AOB or AMX seed was provided from the
sidestream, and nitrification/denitrification was carried all the way through to nitrate by
providing sufficient aerobic SRT for full nitrification. Key operating parameters and results are
shown in Table 4-8 for summer and winter conditions:
Table 4-8. Three Different Process Scenarios Including Feasible Carbon Redirection.
Conventional
Nitrite Shunt Deammonification
Nitre/Denite
Temp. (°C) 20 12 20 12 20 12
A: COD-elimination (%) 60 33 75 60 75 75
B: Total SRT (d) 7 7 7 7 7 7
Aerobic fraction (%) 60 80 60 80 60 80
B: COD/NH4-N 7.5 10.5 5.3 7.5 5.3 5.3
4.4.1.2 Nitrite Shunt

The nitrite shunt operating mode was simulated by artificially eliminating NOBs from the
reaction chain (growth-rate of NOBs was set to zero). In practice, as discussed elsewhere in this
report, this can be achieved through a combination of measures, but was not the intent of this
conceptual comparison. There was no seeding of AOBs or AMX in this operating mode.
4.4.1.3 Mainstream Deammonification
In the mainstream deammonification operating mode, seeding of AOB and AMX from
the sidestream process to the mainstream train as calculated in Table 4-1 was activated. Due to
the increase in autotrophic N removal, higher chemically enhanced primary treatment (CEPT)
captures were used, resulting in more COD diverted for energy generation in anaerobic digestion
process (i.e., methane gas production). AMX SRT is approximately 10 times higher than system
SRT due to seeding and 90% cyclone AMX retention efficiency was assumed.
Figures 4-8, 4-9, and 4-10 show the model output from the three concepts comparing
them for biomass composition, effluent inorganic nitrogen species, specific oxygen demand and
sludge production, respectively. The three operating modes generate different amounts of oxygen
demand and potential for energy recovery as indicated by sludge COD that can be diverted to
anaerobic digestion. The lower the oxidation state of the intermediate nitrogen species, the lower
the amount of electron donor required for reducing oxidized nitrogen, and the higher the
potential for approaching an energy neutral operating mode.
4-16
100
XAOB XNOB XAMX
80
(mg COD/L)
60
40
20
0
Nitre/Denite Nitrit-Shunt Deammonification
Figure 4-8. Simulated Biomass Compositions in the Mixed Liquor for All Three Scenarios.
10
SNHx SNO2 SNO3
8
(mg N/L)
0
Nite/Denite Nitrit-Shunt Deammonification
Figure 4-9. Simulated Effluent Inorganic Nitrogen Fraction for All Three Process Options.
Figure 4-10. Three Operating Modes: Comparison of Energy Use Indicated by Specific OUR and
Potential for Energy Recovery from Sludge Production as COD.

4.4.2 AVN versus Ammonia-Based Control Simulation Evaluation
In this section, a comparison between two process control strategies was evaluated,
namely AVN (AOB versus NOB) [Refer to Chapter 3.0] and ammonia-based control. Under
ammonia-based control, target effluent ammonia is maintained using an online probe located in
the process effluent. A simulation of the B-stage AVN pilot reactor at HRSD (Refer to
Section 3.1.3) using average loading conditions to reach steady state, was used as the starting
point for dynamic simulation.
The model was able to predict average NH4+-N, NO3--N and NO2--N. To allow controller
performance comparison, the model simulation of the pilot was operated with both strategies
(i.e., AVN versus ammonia-based control) side by side. Lacking an advanced controller
simulator that is able to mimic the AVN control strategy for dynamic input, the reactor influent
flowrate was modified to reflect a step change in influent mass loading (kg/d) by +25% of the
average loading rate for 12 hours and -25% of the mass loading rate for the following 12 hours.
In an AVN control mode, the aeration time was manually adjusted as the loading changed so that
the balance between NH4+-N and NOx-N was maintained. The aeration time was reduced by
0.49 min during the low loading step and increased by 0.65 min during the high loading step.
Under the ammonia-based control, the aeration time was manually adjusted as the load changed
so that effluent NH4+-N concentration was maintained constant. The aeration time was reduced
by 1.63 min during the low loading step and increased by 3.25 min during the high loading step.
Figure 4-11 shows the simulation output of the AVN and ammonia control modes.
Comparing the two simulation outputs reveals that nitrogen removal efficiency was
increased by approximately 17.5% under the AVN control. Also, the stable alkalinity level in the
reactor for the AVN simulation compared to that for the ammonia-based control is noteworthy. It
is important to realize that the controller under the AVN strategy controls the NH4+-N removal
rate based on denitrification capacity, i.e., the aerobic SRT is adjusted so that NH4+-N is nitrified
only if the same amount of nitrogen can be removed via denitrification. This balancing action
allows for more efficient use of the biodegradable carbon for nitrogen removal, recovery of
alkalinity, and applying SRT pressure on NOB.
In the ammonia-based control simulation, aeration was increased during high loading
conditions to maintain the effluent NH4+-N level. By increasing aeration time, more COD was
aerobically oxidized and more alkalinity was consumed. As alkalinity was consumed, NH4+-N
oxidation rates slow, due to inorganic carbon limitation. In return, the controller increased the
aeration time even further, which caused more COD oxidation and alkalinity suppression. The
cycle continued until the NH4+-N concentration could not be reduced any further.
Table 4-9 summarizes the comparison between AVN and ammonia-based controls with
regard to nitrogen removal, oxygen demand and NOB levels. The comparison reveals that an
8.6% reduction in NOB concentration was achieved. This incremental reduction can be
significant when combined with other incremental reductions due to other mechanisms that are
discussed in this section.
4-18
Aeration time, min 6.01 7.15 6.01 7.15
Aeration time, min 4.88 9.75 4.88 9.75
Figure 4-11. Simulation Output for AVN (top) and Ammonia-Based (bottom) Controls
for B-Stage Pilot Reactor at HRSD with 12-Minute Cycle.
Table 4-9. Comparison between AVN and Ammonia-Based Control Strategies in Terms of Total Nitrogen
Removal, Oxygen Demand, and NOB Supression for Simulated HRSD Pilot Reactor.
(1) (2)
AVN Ammonia % Change
Control Control [(1-2)/2]

Total Nitrogen Removal, (mgN/L) 28.9 24.6 17.5%
Oxygen consumed, (mg/L) 936 1024 -8.6%
NOB Concentration, (mg/L) 39.1 42.8 -8.6%

4.4.3 NOB Outselection Mechanisms
Mechanisms for outselection of NOB are discussed below. They include transient anoxia,
AOB Seeding/Selective Retention/SRT Pressure, and substrate competition
4.4.3.1 Transient Anoxia
Transient anoxia is a term used to describe the aeration state dynamics where the process
reactor is intermittently aerated either by turning the air flowrate on and off (in time) or by
creating a spatial sequence of anoxic and oxic zones in the reactor (in space). The use of transient
anoxia is a commonly used approach for NOB out-selection (Li et al., 2012; Ling, 2009; Pollice
et al., 2002; Rosenwinkel et al., 2005; Zekker et al., 2012). In the context of controlling the
nitrogen process towards out-selection of NOB, transient anoxia provides means to control the
aerobic SRT, as well as to introduce a lag-time for NOB to transition from the anoxic to aerobic
environment, either due to NO2--N limitation (Knowles et al., 1965) or by an enzymatic lag
(Kornaros and Dokianakis, 2010).
The mechanism that was explored using a kinetic model was the lag in NOB growth
when nitrite was not available. This occurs usually at the beginning of the aeration portion of the
intermittent aeration cycle. Figure 4-12 shows the nitrogen profiles before and after switching on
the airflow. Nitrite half saturation constant for NOBs of 0.1 mgN/L was used in this simulation.
When air was introduced, ammonia was removed via AOBs, whose growth rate was near
maximum level (i.e., no substrate limitation). On the other hand, NOB growth rate started at zero
when nitrite was not available and increased as the nitrite level increased in the reactor. The lag
in growth rate depends on the nitrite half saturation constant. The figure indicates that the shorter
the air is turned on, the lower the growth rate of NOBs. Thus, the difference between the NOB
and AOB growth rates widens which allows a more reliable NOB out-selection.
Figure 4-12. Simulated NOB Growth Lag Based on Nitrite Availability.
Two SBR experiments were designed to evaluate the impact of the frequency of transient
anoxia on NOB out-selection. The difference between the two SBRs was the frequency of
turning the air on and off during the intermittent aeration where SBR-A was operated in a 15 min
cycle and SBR-B was operated in a 45 min cycle. The length of the “air on” portion of the cycle
4-20
was determined based on maintaining effluent ammonia level above 1 – 2 mgN/L. NH4+, NO2-,
NO3- and COD (HACH DR2800 Spectrophotometer) where monitored using grab samples
collected throughout one cycle of operation to determine overall nitrogen removal performance.
In addition, anammox, AOB and NOB maximum activities were measured by monitoring NH4+,
NO2- and NO3- under ideal conditions.
Figure 4-13 compares the nitrogen profiles for high and low transient anoxia frequencies
in SBR-A and SBR-B, respectively. It appears from the results that the frequency of turning the
air on and off did not have an apparent impact on total nitrogen removal efficiency. Some nitrite
residual in the range between 0.1 – 0.4 mg N/L was observed. While the researchers anticipated
that shortening the aeration period would help limit NOB activity, it is just as important to allow
for long enough anoxic periods to allow for the removal of nitrite and thus maintaining low NOB
activity. As seen in Figure 4-12, the low frequency reactor had higher NO2- concentrations due to
longer aeration periods. However, if the anoxic period is not long enough, or available COD is
not enough to remove all the nitrite before it enters the consequent aerobic period, nitrite out
selection will not be as effective. The model illustrates this where it predicts more effective NOB
out-selection with longer anoxic breaks (Figure 4-14) when nitrite level entering the aeration
period was low and thus limited NOBs growth rates as was illustrated earlier in the lag phase
simulation.
COD/N=4.6 COD/N=4.6
COD/N=1.5 COD/N=1.5
Figure 4-13. SBRs In Situ Nitrogen Profiles at COD/N=1.5 and COD/N=4.6 under 45 min Aeration Cycle Frequency (left
charts) and under 15 in Aeration Cycle Frequency (right charts).

20 1 20 1
18 18
16 0.8 16 0.8
CONC. (mg/L)
Nitrite-N mg/L
Nitrite-N mg/L
Conc. mgN/L
14 14
12 0.6 12 0.6
10 10
8 0.4 8 0.4
6 6
4 0.2 4 0.2
2 2
0 0 0 0
12:00 14:00 16:00 12:00 14:00 16:00
Nitrate N Ammonia N Nitrite N Nitrate N Ammonia N Nitrite N
Figure 4-14. Simulated Impact of Transient Anoxia Frequency on NOB Out-Selection.
4.4.3.2 AOB Seeding/Selective Retention/SRT Pressure

Seeding AOB from a sidestream process that utilizes a shortcut nitrogen removal process
can be beneficial to enhance NOB out selection in mainstream processes with the aim of
achieving nitrite shunt. Figure 4-15 illustrates the concept of seeding a mainstream tank with
AOB rich waste from a sidestream process where the difference in critical SRT for AOB and
NOB increases with the AOB seed mass introduced to the mainstream tank. If the ratio of the
AOB seeded mass to the AOB critical mass in mainstream (i.e., mass of AOB formed at critical
SRT) is 20%, as illustrated in the figure, the critical SRT for AOB will decrease which will allow
the process to run at even lower SRT to washout only NOBs.
2.0
SRT(AOB)_crit
1.8
SRT(NOB)_crit 1  M critical 
1.6 SRTcritical  *  
d SRTcrit ( m  b)  M seed  M critical 
1.4
Assumptions:
1.2
SRT (d)
SRTSide = SRT side-stream = 10 days

1.0
0.8 AOB maximum specific growth rate (µm, AOB) = 0.9 d -1;
0.6 NOB maximum specific growth rate (µm, NOB) = 0.7 d -1
0.4 Decay rate (b) = 0.17 d-1

0.2 Neglect SRT impacts by seeding
0.0 Neglect AOB-activity loss due to Temperature-gap
0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 2.0
Mseed / Mcrit (-)
Figure 4-15. Bio-Augmentation versus SRT Conceptual Model.
4-22
Researchers assumed that 20% of the influent load is recycled back and treated in the
sidestream process. Simulations of the HRSD pilot reactor were considered with: 1) 50% seeding
activity assuming that 50% of activity is lost due to the difference in temperature between
sidestream and mainstream processes (Wett et al., 2011) and 2) 100% seeding activity assuming
no loss of activity were examined. The system SRT was reduced to maintain the same NH4+-N
removal rate in the system. Figure 4-16 shows the simulation output for AOB and NOB under
both seeding conditions. The simulation showed that the gap between AOBs and NOBs widened
with increased AOB seeding rate as evident by the AOB/NOB ratios.
Figure 4-16. Simulation of HRSD Pilot Reactor with AVN Control

Showing 100% and 50% Seed Mass Rates and SRT Variation.

Simulations of the DC Water continuous flow pilot reactor (not part of this report) (Al-
Omari et al., 2014) are compared to the actual measurement in Figure 4-17. The overall profiles
of NH4+-N, NO2--N, NO3--N were closely predicted by the model. The model utilized activity
measurement of retained sludge from the sieve mechanisms to assess AOB, NOB and anammox
retention efficiency. The model predicted minor improvement in NOB out-selection with an
AOB/NOB ratio of 1.8 compared to 1.6 for fully nitrifying systems. One explanation for the low
NOB outselection efficiency would be the effect of the inorganic carbon limitation switch on
AOB growth and the other would be the NOB retention by the sieve where NOBs may have
attached onto the anammox granules. To address the impact of these two factors, the retention of
the various organisms was modified in the model to reflect an ideal separation of granular
anammox bacteria and AOBs and NOBs and the depth of the reactors in the model was adjusted
to mimic that of full-scale tank depth.
20 5
NH3 (model) NH3 (measured)
Ammonium and nitrate (mgN/L)
18 NO3 (model) NO3 (measured)

16 NO2 (model) NO2 (measured) 4
14
Nitrite (mgN/L)
12 3
10
8 2
6
4 1
2
0 0
D1 D2 D3 D4 D5 D6 D7 D8 D9 D10 P8
Cell number in Pilot
Figure 4-17. Simulation and Measured Profile of the DC Water Pilot Reactor.
4-24
Table 4-10 presents a comparison between the pilot reactor performance with and without
these hypothetical improvements. The model predicted an AOB/NOB ratio of 7.1 when both
retention and tank depth are optimized. The optimized model was then used to determine the
potential savings in carbon addition in the form of acetate between conventional
nitrification/denitrification system and a system with nitrogen shortcut (i.e., repressed NOB).
The model showed that for nitrogen removal efficiency of approximately 90% and
effective (i.e., 70%) NOB out-selection, the acetate saving due to nitrogen shortcut was 60%
compared to conventional nitrification/denitrification. As a result of this modeling exercise,
alkalinity was increased in the pilot reactor where the effluent concentration increased from
150 mg/L as CaCO3 to approximately 200 mg/L as CaCO3 and nitrite shunt was observed almost
immediately Figure 4-18 shows the actual results from the pilot reactor, which validates the
model findings.
Table 4-10. Impact of Selective Retention and Tank Depth on NOB Outselection
Improved Improved Selective

Selective Retention+Deep
Parameter Pilot Retention Tankage
Anammox Retention 73 90 90
Efficiency, %
AOB Retention 35 20 20
Efficiency, %
NOB Retention 52 20 20
Efficiency, %
Tank Depth, m 0.3 0.3 9.0
ABO/NOB Ratio 1.8 2.9 7.1
Figure 4-18. Mainstream Pilot Reactor Effluent Quality.

4.4.3.3 Substrate Competition (OHO/NOB on O2; NOB/OHO/AMX on NO2)
Earlier, Figure 4-13 compared two reactors; one was fed at COD/N ratio of 1.5, and the
other at 4.6. The figure showed a better total nitrogen removal at higher COD/N ratio which was
expected due to higher potential for denitrification. A model was run with feed rbCOD of
1.4 mg/L (representing the COD/N of 1.5), and then with 30 mg/L to simulate the impact of
biodegradable carbon content in the SBR feed. The model showed a reduction in AOB and NOB
activity with higher reduction in the latter when rbCOD was increased. A closer look at the first
part of the cycle where rbCOD was present showed that nitrite availability had a higher impact
on NOB specific growth rates than the rapid transition into anoxia indicated by the more rapid
reduction in DO concentrations (Figure 4-19).
AOB, NOB, Anammox, mgCOD/L

14 4 100 300
Dissolved Oxygen, mg/L

12 rbCOD = 1.4 mg/L 90
80 250
3
OHO, mgCOD/L
CONC. (mg/L)
10 70 200
8 60
2 50 150
6
40
4 30 100
1
2 20 50
10
0 0
12:00 14:00 16:00 0
12:00 14:00 16:00
Nitrate N Ammonia N Nitrite N DO OHO AOB NOB Anammox
AOB, NOB, Anammox, mgCOD/L
14 4 100 300
Dissolved Oxygen, mg/L
12 rbCOD = 30 mg/L 90
80 250
3
OHO, mgCOD/L
CONC. (mg/L)
10 70 200
8 60
2 50 150
6
40
4 30 100
1
2 20 50
10
0 0
12:00 14:00 16:00 0
12:00 14:00 16:00
Nitrate N Ammonia N Nitrite N DO OHO AOB NOB Anammox
Notes [left chart]:

- The “0” subscript refers to
simulation with rbCOD of 30
mg/L
- The “1” subscript refers to
simulation with rbCOD of 1.4
mg/L
- NOB = NOB specific growth
rate
Figure 4-19. Simulated Impact of Biodegradable COD on NOB Out-Selection.
4-26
4.4.4 Anammox Enrichment Simulation Evaluation
Figure 4-20 displays the flow-scheme of the main plant including the setup of the
cyclone. The BioWin-model of this configuration has been used to evaluate all key factors on
anammox accumulation – i.e., seeding, cyclone-recovery, growth and temperature. Table 4-11
summarizes the individual impacts of these factors. Starting from the control case-study assumed
anammox trace – concentrations of 0.05 mg COD/L in the raw wastewater yields 0.5 mg/L in the
mixed liquor. Seeding as operated at Glarnerland adds another 4.2 mg/l and the cyclone doubles
this contribution. Growth and temperature impacts depend heavily on operation mode and nitrite
availability.
Influent L1-1 L1-2 L1-3 L1-4 L1-5 L1-6 Lane 1 eff
WAS1
Sidestream PS
L2-1 L2-2 L2-3 L2-4 L2-5 L2-6 Lane 2 eff
Cyclone WAS2
Sidestream waste
Figure 4-20. Configuration of Two Independent Mainstream Liquid Lanes in Glarnerland,

Lane 2 with Anammox Accumulation by Seeding from the Sidestream and by the Cyclone.
Table 4-11. Evaluation of Individual Impact Factors on Anammox Accumulation.
Key Factors for Anammox Accumulation Biomass Composition

Scenarios Cyclone AOB
Seeding Temperature Anammox
Selectivity (mg/L)
Yes/No (oC) (mg/L)
(%)
0 Control Scenario No 0 16.5 0.5 51.2
1 Seed Scenario Yes 0 16.5 4.7 54.1
2 Cyclone Scenario Yes 74 16.5 8.7 54.1
3 Growth Scenario Yes 74 16.5 9.11 54
4 Temperature Yes 100 25 10.77 50
Scenario

4-28
CHAPTER 5.0
CONCEPT STUDIES
This chapter starts with a summary of the key findings from the pilot and demonstration
facilities and synthesizes the general principles and considerations for facilities wanting to
implement short-cut nitrogen removal. The first section describes the “recipe” for achieving
short-cut nitrogen removal (i.e., the critical elements for the process design) and is followed by a
section that describes the control elements for short-cut nitrogen removal. The next section
describes various design considerations and then a Decision Matrix based on effluent drivers and
influent COD/TN (C/N) ratio.
Following the initial sections, nine different water resource recovery facility concept
studies are presented. Using the decision matrix, plausible modifications to the facilities are
proposed to enable them to achieve short-cut nitrogen removal. In developing concepts for each
of the facilities it is recognized that further research, cost-benefit analyses and detailed
investigations are needed before they could be implemented. The intent of this chapter is,
therefore, not to prescribe plans for the facilities, but to show plausible paths forward for these
facilities and ones similar to them. The chapter finishes with a summary of the concept studies
and some general conclusions.
5.1 Recipe for Suspended Growth Short-Cut Nitrogen Removal
A primary focus of short-cut nitrogen removal is to maximize AOB activity while
preventing NOB from becoming established. In order to achieve mainstream deammonification,
AMX bacteria must also be retained in the system. Multiple operational strategies are required
for NOB out-selection in mainstream treatment, making up a “recipe” with the following
elements:
1) Residual ammonia (>2 mg/L): Maintaining residual ammonia at all locations within the
aeration tank ensures high AOB activity and continuous DO competition for NOB. Facilities
with a lower ammonia limit will require a polishing step to remove ammonia.
2) High operational DO (> 1.5 mg/L): The higher DO not only maintains high AOB rates, but
also manages the relative substrate affinities of AOB and NOB towards NOB out-selection.
3) Sufficient alkalinity: Insufficient HCO3- can inhibit AOB growth and needs to be avoided
(along with any other potentially inhibitory chemicals or environmental conditions).
4) COD pressure and transient anoxia: Restrict aeration and rapidly transition to anoxia at
the end of ammonia oxidation such that NOB are deprived of DO when nitrite is available.
COD exerts pressure on NOB by providing competition for nitrite during the anoxic period.
5) Limiting aerobic SRT: Is useful for high ammonia oxidation rates while washing out
pressured NOB. The intent of limiting the SRT of the system was to operate very close to the
AOB washout SRT, such that NOB are out-selected. It is very important to recognize that
COD pressure, high DO, and intermittent aeration provide unfavorable conditions for NOB
without adversely affecting the AOB population. However, it is the ability of the system to
be operated at a very low SRT that eliminates NOB over AOB.

6) Bioaugmentation: AMX can be bioaugmented from sidestream deammonification process,
which provides competition in concert with heterotrophs for nitrite with NOB during anoxia.
Similarly, AOB can be bioaugemented from the sidestream deammonification reactor in the
form of the light flocular material in the overflow, if hydrocyclone is used for AMX
retention. When AOB is bioaugmented from the mainstream reactor, the SRT required for
maintaining a desired ammonia oxidation can be lowered, thus introducing SRT pressure on
NOB.
5.2 Process Control
A critical element in the design of short-cut nitrogen removal is the process control used
to implement the principals of the short-cut nitrogen recipe. Two control concepts are described
here briefly.
1) Ammonia-Based Aeration Control (ABAC): Ammonia measurements are used to control
aeration, either through adjustment of DO setpoints and/or adjustment of aeration timings.
2) Ammonia Versus NOx (AVN) Control: An extension of ABAC to include nitrite
measurement and adjust control set points to maintain an equal balance of ammonia and
nitrite that is amenable for anammox bacteria to carry out deammonification.
5.3 Considerations for Implementing Short-Cut Nitrogen Removal or Mainstream
Deammonification
There are many factors that must be considered in the deciding whether or not to
implement short-cut nitrogen removal or to attempt mainstream deammonification. The
following sections describe briefly some of the most pertinent factors.
5.3.1 Operating Costs
The main driver for considering short-cut nitrogen options is the possibility of reducing
operating costs, including reductions in 1) electricity, 2) carbon, and 3) alkalinity. The extent of
the cost savings depends on the magnitude of existing costs including the unit cost of electricity,
carbon, and alkalinity.
5.3.2 Effluent Criteria
Effluent criteria are another important consideration. If a facility is required to meet a low
effluent TN, in addition to likely requiring additional carbon and alkalinity to reach the limits,
the control approach must be sufficiently robust to ensure those limits can be achieved reliably.
The recipe for short-cut nitrogen removal includes the need to maintain a residual ammonia of
approximately 2 mg/L and so a facility with a lower ammonia limit will require a polishing step
to remove ammonia.
Another consideration, not addressed directly in the current research, is linking nitrogen
removal with biological phosphorus removal. On a positive note, short-cut nitrogen reduces the
consumption of carbon for nitrogen removal and therefore liberates that carbon for phosphorus
removal. On the negative side, the control approaches proposed using modulation of aerobic and
anoxic conditions may not be conducive to biological phosphorus removal.
5.3.3 Sludge Treatment
A fundamental consideration for implementing mainstream deammonification is the
presence of ammonia-rich sidestreams from anaerobic digestion. If a sidestream is available, then
sidestream deammonification is a good process choice to reduce plant nitrogen loads and to
5-2
provide seed material that can be used to augment deammonification in the mainstream. This is
especially useful when operating the mainstream at a marginal SRT to put stress on NOBs.
5.3.4 C/N at Different Points in Treatment
Through the course of the research, the carbon to nitrogen ratio has emerged as a key
metric for short-cut nitrogen removal. If the influent contains excess carbon (high C/N) to
denitrify all nitrate produced in complete nitrification to meet the effluent limits for nitrate or
TN, then there is no carbon driver to use short cut processes, and energy and reduction is the
main driver for cost savings. If carbon is limited, then a nitrite shunt coupled with heterotrophic
denitritation becomes an attractive proposition to alleviate the need for additional carbon. If the
C/N ratio is still lower, then a process that incorporates partial or full deammonification becomes
increasingly more viable.
5.3.5 Technological Approaches
Several technologies can be considered for short-cut nitrogen including suspended
growth systems, attached growth [moving bed biofilm reactor (MBBR), rotating biological
contactor (RBC), or biological aerated filters (BAF)], integrated fixed-film activated sludge
(IFAS) or granular activated sludge. The choice of technology depends on several
considerations. In this study, the main consideration is the ability to fit the treatment approach in
with existing process trains and technology in order to maximize the use of existing
infrastructure and minimize capital costs.
5.3.6 Equipment Requirements
An important consideration in moving from lab and pilot scale testing of short-cut
nitrogen processes are the requirements for specific equipment. Granule retention is a significant
consideration for deammonification processes based on suspended growth and can be achieved
either through cyclones, or retention sieves. Process control using intermittent aeration requires
fast actuators, accurate valve positioning and consideration of the impact that rapid airflow
changes have on the aeration system blowers.

5.4 Decision Matrix for Control/Approach
Two overriding considerations in deciding which approach to take for short-cut nitrogen
removal are: 1) the effluent drivers, and 2) the COD:TN (C/N) ratio of the influent to the
process. Table 5-1 is a matrix that compares Effluent Drivers to the C/N ratio to give suggested
use of bioaugmentation, a recommended control approach and the need for some form of
polishing stage. The ratios are provided for guidance only and the specific C/N ratio for a
treatment facility with a given configuration may still work for values outside of those suggested.
Systems with a very high C/N ratio should consider a “carbon diversion” to channel carbon away
from secondary treatment, for example by capturing more carbon in a primary or “A” stage to be
sent to anaerobic digestion.
Table 5-1. Decision Matrix for Implementing Short-Cut Nitrogen Removal.

C/N Ratio (COD:TN)
Moderate Very high C/N
Effluent Drivers Low C/N (0-5) C/N (5-10) High C/N (8-15) (15+)*
Low ammonia
No TN ABAC
No/high ammonia limit Bioaugmentation

Moderate TN AVN

AVN & Reaeration or
Moderate TN AVN ABAC
Anammox Polishing or Reaeration
Low TN AVN
Anammox Polishing
Notes:
* - Consider carbon diversion
AVN = Ammonia versus NOx control
ABAC = Ammonia-based aeration control (must include robust control for low ammonia limits)
"Low Ammonia" limit = limit <2 mg/L (limits less than 1 mg/L may have other considerations)
Moderate TN = limit 6 -12 mg/L, Carbon Addition not needed
Low TN = limit <6 mg/L
Polishing: Post anoxic treatment, anammox
5-4
5.5 Concept Studies
In the following sections, nine concept studies are presented in which the design
considerations and Decision Matrix described earlier in this chapter were used to develop
concepts that potentially could be applied at each facility. Table 5-2 is a list of the facilities for
which concept studies are provided. Each concept study write-up has a similar structure, namely:
1) Facility Description; 2) Permit Limits and Treatment Goals; 3) Existing Plant Performance
and Operational Challenges; 4) Wastewater Composition; 5) Pathway to Mainstream
Deammonification; 6) Plant Infrastructure and Capacity Considerations; 7) Operational Cost
Considerations; 8) Next Steps.
Table 5-2. List of Concept Studies.
# Facility
1 Chesapeake Elizabeth Treatment Plant (CETP), VA
2 Blue Plains Advanced Wastewater Treatment Plant (AWTP), DC
3 H.L. Mooney Advanced Water Reclamation Facility (HLM AWRF), VA
4 Robert W. Hite Treatment Facility (TF), CO
5 Egan Reclamation Plant (WRP), IL
6 McDowell Creek Wastewater Treatment Plant (WWTP), NC
7 Sacramento Regional Wastewater Treatment Plant (SRWTP), CA
8 Howard F. Curren Advanced Wastewater Treatment Plant
(HFCAWTP), FL
9 Danbury Water Pollution Control Plant (WPCP), CT
5.5.1 HRSD Chesapeake Elizabeth

This section presents plausible modifications to the Chesapeake Elizabeth Treatment
Plant that could enable them to achieve short-cut nitrogen removal based on the design
considerations and decision matrix presented above. It is recognized that further research, cost-
benefit analyses and detailed investigations are needed before they could be implemented.
5.5.1.1 Facility Description
Hampton Roads Sanitation District owns and operates the 24 mgd Chesapeake Elizabeth
Treatment Plant (CETP) serving much of Virginia Beach and portions of Norfolk. The plant was
originally designed in 1965 as an 8 mgd contact-stabilization plant with preliminary treatment,
conventional activated sludge (CAS) with BOD removal only, a chlorine contact tank and
effluent pump station. In 1971, the plant was expanded to its current capacity of 24 mgd with the
addition of grit tanks and CAS expansion. Dewatering and incineration facilities were
constructed in 1972. Several additional projects have been completed at the plant since 1972
including additional final settling tanks in 1978, odor control in 1982, chemical phosphorus
removal facilities in 1990 and upgrades to the disinfection and effluent pumping facilities in
1992. CETP is unique in the HRSD system as being the only treatment plant not employing
primary clarifiers, although space was reserved both from a site plan and hydraulic perspective.
Figure 5-1 presents an aerial view of CETP.

Figure 5-1. CETP Aerial View.
Figure 5-2 presents a simplified process flow diagram of CETP.
Figure 5-2. CETP Simplified Flow Schematic.
5-6
5.5.1.2 Permit Limits and Treatment Goals
Table 5-3 contains the current 2015 National Pollutant Discharge Elimination System
(NPDES) permit limits for the CETP.
Table 5-3. CETP NPDES Permit Requirements.
Limit
Permit No. VA0081264Parameter Monthly Weekly Minimum Maximum

Average Average
Flow, million gallons per day (mgd) NL N/A N/A NL

pH (SU) N/A N/A 6.0 9.0
BOD5 (mg/L; kg/d) 30.02,725 45.04,088 N/A N/A
Total Suspended Solids (mg/L; kg/d) 302,725 304,088 N/A N/A
Total Residual Chlorine, mg/L 0.2 2.4 N/A N/A
Fecal Coliform (N/CML) 200 N/A N/A N/A
Total Phosphorus, year-to-date (mg/L) NL N/A N/A N/A
Notes:
Outfall 001 – Chesapeake Bay
Outfall 002, 003, 004: Little Creek Harbor to Chesapeake Bay
N/A = Not Applicable
NL = No Limitation, however reporting is required
Although CETP does not have a TN limit or an ammonia limit, they are one of the HRSD
treatment plants in the James River bubble permit and the only remaining major plant that does
not remove nitrogen. Many of the treatment plants in the James River will soon achieve 5 mg/L
effluent TN.
Table 5-4 presents the James River Bubble permit nitrogen limits.
Table 5-4. James River Bubble Permit Mass Limits.
Effluent Nitrogen
Year (million lbs/year)
2011 6.0
2017 4.4
2021 3.4
In order to achieve the 2021 effluent limits, CETP must remove nitrogen, although not to
a specific level to contribute to the bubble permit. Depending on the type of process selected,
however, the system must be operated efficiently to achieve performance typical of the process.
Therefore, a monthly average effluent TN likely between 5 and 8 mg/L would be required.
Conventional primary clarifiers, single-sludge nitrogen removal, and denitrification filters could

be considered but they require external carbon addition, increasing operating costs. Mainstream
deammonification offers an opportunity to reduce both capital and operating costs.
5.5.1.3 Existing Plant Performance and Operational Challenges
There are no known performance or operational challenges relevant to short-cut nitrogen
removal.
5.5.1.4 Wastewater Composition
Table 5-5 provides a summary of the wastewater composition for the CETP.
Table 5-5. Wastewater Composition for CETP.
Annual Maximum Maximum

Parameter
Average Month Week
Plant Influent
Current Flow, ML/d (mgd) 83.4(22) 91(24) 114(30)
BOD, mg/L 236 250 272
COD1, mg/L 575 610 660
TKN, mg/L 36 40 45
COD/TKN 16 16 16
TSS, mg/L 154 175 205
Temperature, °C
Alkalinity, mg/L as CaCO3
5-8
5.5.1.5 Pathway to Mainstream Deammonification
As identified earlier in the report, there are a number of steps that can be taken to position
a treatment plant to achieve operation for deammonification in the mainstream wastewater
treatment process. Some of these practices are well established while others are being
researched. Table 5-6 summarizes some of the pertinent considerations in selecting the process
design elements for mainstream deammonification for CETP.
Table 5-6. Process Design Elements.
Consideration Design Elements
Sidestream Liquors Available Incinerators do not produce sidestream liquors. The lack of a sidestream will avoid
overloading the mainstream deammonification.
Chemical Addition The plant currently adds Ferric Chloride for chemical phosphorus removal.
Energy Separate energy and demand charges complicate electrical cost but average cost of
electricity is about $0.05 per kWh. Future energy cost reduction could be a driver for
considering mainstream deammonification at CETP.
Effluent Limits CETP currently has no TN limit but anticipates significant reduction in the future
requiring external carbon. The low effluent TN suggests that full nitrification/partial
denitrification, nitrite shunt, ammonia-based aeration control or deammonification in
either mainstream or side-stream should be considered. Also, a polishing step might
be required (additional aeration at the end of biological treatment for nitrification of
residual ammonia that will remain if the main aeration zone is operated with
ammonia-based aeration control).
Plant temperature Winter marginally low temperatures (less than 14°C) may make mainstream
deammonification challenging.
C/N The primary effluent C/N ratio is about 12 which is a medium level. There should be
adequate carbon for full nitrification/partial denitrification or nitrite shunt.
Inhibitory compounds No known inhibitory compounds.
Bio-P CETP does not currently operate for enhanced biological phosphorus removal
(EBPR), but adds ferric chloride for chemical phosphorus removal.
Influent flow peaks Influent peaks approach 50 mgd but are well-managed and should present only
minor problems for implementing nitrogen removal technologies.

CETP conducted a multi-year, substantial pilot facility to determine the most effective
mainstream deammonification configuration to apply, a major component of this research program
and described in detail elsewhere in this report. After attempting several configurations, an A-B
process was determined to be the most effective, with the following systems operating in series:
 A-stage high rate activated sludge process with an ultra short 0.5 day solids retention time.
 B-stage AVN bioreactor.
 B-stage fixed-film deammonification reactor.
 B-stage aerobic ammonia polishing reactor.
Figure 5-3 presents a process flow diagram of this configuration.
Figure 5-3. CETP AVN/Mainstream Deammonification Reactors.
Table 5-7 presents equipment requirements to convert the CETP to an A-B process with
B-stage being AVN process followed by fixed-film mainstream deammonification and aerobic
polishing, which is referred to as AVN+.
Table 5-7. Equipment Requirements.
Function Equipment
A-stage Requires the construction of new high-rate conventional activated

sludge process, however
Anammox retention Fixed-film media
Rapid aeration changes Accurate valves & Meters required in aeration zones
Blower operating ranges must be checked to ensure they can meet the
required airflow ranges, especially in having sufficient turn-down for
very low airflow requirements.
Control AVN control
Reactor Configuration Modification of existing 3-pass MLE reactors to include likely 2 passes
of AVN control reactors. Modification of the first half of the third-pass
consisting of a screened reactor for fixed-film medial retention.
5-10
5.5.1.6 Plant Infrastructure and Capacity Considerations
CETP uses incinerators to manage solids and lacks anaerobic digesters. Therefore, there
is little carbon diversion from the nitrogen removal process for energy production. However, the
existing aeration tank capacity would require short-cut nitrogen removal to achieve adequate
nitrogen removal. The A-B process with the B-stage operated at reduced carbon loading and
short-cut nitrogen removal could be suitable process for achieving TN limits. Since, anaerobic
digesters are not available, there is no possibility of sidestream bioaugmentation to facilitate
mainstream short-cut nitrogen removal. The configuration proposed for CETP nitrogen removal
is presented in Figure 5-4.
Ferric Chloride RAS
Screening & Secondary Anammox To Chesapeake

Influent A-stage Clarifiers AVN process MBBR Chlorine
Grit Removal Clarifiers
Bay
Gravity Sludge
Centrifuge
Thickeners Holding Incinerator Ash to Landfill
Tank Dewatering
Figure 5-4. Plan Schematic for CETP Upgrade.

5.5.1.7 Operational Cost Considerations
An assessment of the potential cost benefits of the A-B AVN Controller followed by
fixed-film deammonification was carried out. Figure 5-5 presents the results of that assessment
which shows an approximately $250k/year power cost savings by applying the A-B
configuration compared to conventional nitrification/denitrification. The CETP pilot did not
require external carbon or alkalinity to achieve an effluent nitrogen of 3-5 mg/L. Conventional
nitrification/denitrification would require carbon, but HRSD would likely not add alkalinity.
Therefore, a savings of $330k/year in external carbon could be achieved.
$1,400,000
$1,200,000
$1,000,000
$800,000
$600,000
$400,000
$200,000
$-
Nit/Denit Shunt Deamm
Electricity $863,429 $694,664 $617,952
Carbon $328,500 $197,100 $-
Alkalinity $- $- $-
Figure 5-5. CETP Operating Cost Comparison.
5.5.1.8 Next Steps

Implementation of the mainstream A-B process with B-stage as AVN+ process has been
piloted as part of this effort and achieved excellent results. Detailed preliminary engineering
could begin with information acquired from the pilot study.
5-12
5.5.2 DC Water Blue Plains
Plausible modifications to the Blue Plains AWTP that could enable them to achieve
short-cut nitrogen removal based are described below. The concepts are based on the design
considerations and decision matrix presented above. Further research, cost-benefit analyses and
detailed investigations are needed before they could be implemented.
The District of Columbia Water and Sewer Authority (DC Water) Blue Plains AWTP is
located in the southern tip of the District of Columbia, serving wastewater treatment for
surrounding areas including parts of suburban Virginia and Maryland.
The current rated capacity of the Blue Plains AWTP is 370 mgd annual average flow and
the facility serves over two million people. Combined sewer (sanitary and storm) flows from the
District of Columbia and sanitary flows from portions of Fairfax County, Loudoun County in
Northern Virginia, Montgomery County, and Prince Georges County in Maryland are all treated
at Blue Plains. The current hydraulic capacity of the facility was determined to be sufficient to
provide for the wastewater treatment needs of the service area until the year 2050 [Blue Plains
Service Area (BPSA) Long-Term Planning Study 2013 Update].
On August 31, 2010, the U.S. EPA issued a modification to DC Water’s NPDES permit.
The permit modification included a total nitrogen effluent limit for Blue Plains of 4.689 million
pounds per year. The total nitrogen limit was developed by the EPA to achieve the goals of the
Chesapeake Bay Program for nutrient reductions. The combined discharge loads from both the
wastewater treatment plant effluent (002) and the combined sewer overflow (CSO) bypass
effluent (001) must meet the permitted load limits. This means that in a wet year, the wastewater
treatment process must achieve an effluent total nitrogen concentration of as low as 3.3 mg/L.
The existing nitrogen removal system is currently being upgraded and expanded to consistently
and reliably meet the proposed nitrogen discharge limit under all conditions. Upgrades are
expected to be complete and operational by June 2014. The NPDES maximum month permit
limit for TP discharge at Blue Plains is 1080 lbs/day, which equates to an effluent concentration
of less than 0.18 mg/L based on the 370 mgd flow and was not changed in the permit
modification.
The liquid treatment train at the Blue Plains AWTP is a two-stage activated sludge
process including aerated grit chambers, primary clarifiers, high-rate carbon removal activated
sludge (A-stage), secondary sedimentation tanks, tertiary nitrification, and denitrification
activated sludge (B-stage), nitrification/denitrification sedimentation tanks, post aeration,
filtration, disinfection, and dechlorination. The nitrification/denitrification process is currently
being upgraded to achieve the discharge limits described above. The plant operates chemical
phosphorus removal to achieve its TP permit limits. Ferric Chloride can be added at several
locations throughout the plant for phosphorus removal but the most significant impact is
observed in the primary clarification system with the successful operation of chemically
enhanced primary treatment (CEPT).
Solids handling processes are also currently undergoing upgrades (as of November 2013),
and the new processes will include thermal hydrolysis, mesophilic anaerobic digestion and belt
filter press dewatering to achieve a Class A biosolids product. Return flow from the new sludge
dewatering process will be treated separately using a sidestream deammonification process
(DEMON®) and treated stream will be returned to the head of the plant. Figure 5-6 shows the
schematic of the treatment processes after the upgrades. Until the new solids handling process is

commissioned, the primary sludge and WAS are thickened and dewatered, then stabilized with
the addition of lime for land application or other beneficial uses.
Figure 5-6. Process Schematic for Blue Plains.
Figure 5-7 shows an aerial photo of the Blue Plains AWTP with a simplified description
of the liquid treatment process.
Figure 5-7. Aerial Photo of the Blue Plains Advanced Wastewater Treatment Facility
with Simplified Process Flow Description.
5-14
Table 5-8 contains the NPDES permit limits for the Blue Plains AWTP complete
treatment outfall (002) and the new total nitrogen limits that will take effect as of January 1st
2015. The effluent limitations are set as daily load limits except for the total nitrogen limit that is
an annual load limit. The equivalent concentrations presented in Table 5-8 are based on the
annual average design flow of 370 mgd.
Table 5-8. NPDES Permit Limits for Blue Plains AWTP.
Parameter Monthly Average Weekly Average Annual Average
cBOD5 5.0 mg/L 7.5 mg/L

TSS 7.0 mg/L 10.5 mg/L
NH4-N
Summer (5/1- 4.2 mg/L 6.1 mg/L
10/31)
Winter (11/1-2/14) 11.1 mg/L 14.8 mg/L
Winter (2/15-4/30) 12.8 mg/L 17.0 mg/L
4,377,580 lbs/ year
(3.8 mg/L daily
Total Nitrogen average)
Total Phosphorus 0.18 mg/L 0.35 mg/L
5.0 mg/L min. daily avg., not less than 4.0 mg/L at
Dissolved Oxygen any time
pH Within limits of 6.0 to 8.5 standard units
Fecal Coliform 126 cfu/100 mL –
Note: The fecal coliform limit is set as a maximum 30-day geometric mean for 5 samples minimum, and there is
no weekly limit.

The Blue Plains AWTP consistently achieves a very high quality effluent. In 2011, the
annual average effluent concentrations are as shown below in Table 5-9.
Table 5-9. Blue Plains AWTP Average Discharge Concentrations for 2011.
Parameter Annual Average
cBOD5 3 mg/L
TSS 1 mg/L
Total Nitrogen 4.1 mg/L
TKN 2 mg/L
NOx 2.1mg/L
Total Phosphorus 0.09 mg/L

Low Sustained Temperatures. Sustained low winter temperatures may pose a significant
challenge for the process. The average monthly winter temperatures have been as low as 10.5°C
in the past (January 2004).
Low Effluent Limits May Require Polishing Step. In the future, with the introduction of more
stringent effluent TN limits, the facility will need to consistently achieve very low effluent
ammonia and NOx concentration (< 1 mg/L) in order to comply with the overall effluent TN
limits. The challenge will be developing a robust strategy that optimizes the use of nitrite shunt /
deammonification while reliably achieving the very low effluent limits required. This poses a
challenge because the AOB and AnAOB rates decline low concentrations of ammonia and
ammonia and nitrite respectively. It is also possible that under conditions where there is less
competition from the AOB’s for oxygen, the NOBs could thrive. Furthermore, there will be
some residual nitrate that will require final polishing removal.
There are several potential strategies to address this issue but the reliability over a range of
operating conditions still needs to be verified. One approach may involve incorporating a post
aerobic and anoxic step after most of the nitrogen has been removing using nitrite shunt /
deammonification. The post anoxic step could use conventional carbon addition for polishing or
it could use attached growth AnAOB perhaps. Another approach could involve developing a
culture of organisms that can convert residual nitrate to nitrite and allow the AnAOB organism to
polish off the remaining ammonia and nitrite.
Low C:N Ratio in B-Stage Influent. Another challenge involves successful implementation of
the transient anoxia conditions to support NOB repression. The deammonification process has
been proven most effective when the organisms experience cyclical aerobic and anoxic
environments. It is important that the dissolved oxygen (DO) concentrations drop rapidly when
the mixed liquor enters an anoxic zone so that there is not low DO high nitrite; a condition that
could potentially provide the NOB with a competitive advantage for growth. One mechanism to
achieve this rapid depletion of DO is to facilitate heterotrophic oxidation of the biodegradable
organic carbon (COD). However, if there is limited COD available, as is the case at Blue Plains,
it may be difficult to rapidly deplete the DO.
Since Blue Plains operates CEPT and also has a two sludge system, the secondary HRAS system
effluent is generally very deficient in biodegradable COD with the COD:TKN ratio is generally
in the order of 1-3 (see Section 5.5.2.4). The B-stage (nitrification/denitrification activated
sludge system) is where the nitrite shunt / mainstream deammonification process would be
implemented. Since the influent to the B-stage has such a low organic carbon level, it will be
difficult to quickly deplete DO. Also, due to the B-stage tank configuration, which is plug flow,
it will be necessary to install additional baffles and adjust the aeration and mixing systems;
possibly installing both step-feed piping/channels to the anoxic zones and CEPT effluent bypass
to enhance the COD concentrations for DO depletion.
5-16
The wastewater composition presented in Table 5-10 is extracted from the operational
data from the period between 2005 and 2008, which was the period used for the development of
the basis of design for the recent upgrades. Maximum and minimum monthly average values are
based on the 30-d rolling average, instead of the monthly average according to the calendar. At
Blue Plains, coagulant is added upstream of the primary clarifiers for phosphorus removal, which
generates suspended solids. The reported Primary influent TSS values were calculated by
subtracted out the estimated solids generated as a result of the known iron addition.
Table 5-10. Wastewater Composition.
Based on 2005, 2006, and 2008 Data.
Parameter Annual Average Maximum Monthly Minimum Monthly Peak Daily

Primary Influent
Flow, ML/d (mgd) 311.5 389 262 827
BOD, mg/L 170 235 133 513
COD1, mg/L 346 470 266 1026
TN2, mg/L 34 35.1 20.1 48.8
COD/TN 10 13.4 13.2 21.0
TSS3, mg/L 182 251 117 612
Temperature, °C 20.2 26.3 14.9
Alkalinity4, mg/L CaCO3 160
Primary Effluent
BOD 97.0 123 70.4 480
COD1, mg/L 194 246 141 960
TN2 28.3 36.1 22.0 57.3
COD/TN 6.9 6.8 6.4 16.8
TSS 82.3 128 50.3 828
Secondary Effluent
Flow, ML/D ( mgd) 302 367 256 499
BOD, mg/L 25.3 49.5 8.3 99.4
COD1, mg/L 50.6 99.0 16.6 199
TN, mg/L 22.2 28.5 15.5 47.9
COD/TN 2.3 3.5 1.1 4.2
TSS, mgL 20.7 28.2 13.3 91.0
Temperature, °C 20.2 26.3 14.9
Alkalinity4, mg/L CaCO3 160
NO2-N & NO3-N, mg/L 0.36 1.4 0.05 2.84
Notes:
1 COD not measured. COD/BOD5 ratio of 2.0 is assumed.
2 NO2-N and NO3-N not measured in primary influent, assumed negligible due to the extensive collection system which is likely
bringing incoming wastewater in a septic condition. Therefore the reported values are equal to TKN.
3 Corrected for the suspended solids from iron addition upstream of the sampling point.
4 Alkalinity in influent not measured, estimated average used for process modeling is reported.

Table 5-11 summarizes pertinent process considerations in selecting the process design
elements for mainstream deammonification for the Blue Plains AWTP.
The Blue Plains AWTP has a low C/N ratio between 1:1.1 and 1:3.5 entering the B-stage
nitrification/denitrification process where mainstream deammonification could potentially be
implemented. Two options for the control of NOB are intermittent aeration and spatial alteration
of aerobic and anoxic conditions. The B-stage reactor can be converted to first achieve nitrite
shunt by controlling NOB, after which AnAOB can be introduced from the sidestream treatment
and biomass retained with hydrocyclone to implement the mainstream deammonification.
Sidestream Liquors Blue Plains is in the process of implementing the first CAMBI thermal hydrolysis system in North America
Available followed by mesophillic anaerobic digesters and belt filter press dewatering. The new filtrate sidestream
is expected to be highly concentrated with ammonia concentrations in the order of 2500 to 3000 mg/L.
The average filtrate flow is expected to be approximately 0.8 mgd at commissioning and is projected to
increase up to 1.1 mgd as the influent flows and loads increase to design capacity. The filtrate will be
treated using a sidestream DEMON process which will not only remove the nitrogen load but also
develop both AOB and anammox seed organisms for mainstream deammonification. A DEMON pilot
study was performed using CAMBI-MAD centrate from another facility in 2010 which indicated that there
are expected to be some inhibitory compounds in the filtrate that significantly reduce both the AOB and
AnAOB kinetic rates. Dilution among other strategies was observed to mitigate the inhibition significantly.
The cause of the inhibition was not specifically identified but other studies are underway to better
understand this issue.
Chemical Addition The plant uses ferric chloride for phosphorus reduction. Methanol is used for denitrification, and alkalinity
is supplied as sodium hydroxide when alkalinity in the wastewater is not sufficient for nitrification.
Energy Nitrification/denitrification process is the single largest user of energy at Blue Plains, taking up
approximately 27% of the total energy requirement, which accounts for approximately 0.14 kWh/m3.
Effluent Limits The current annual average treatment goal is TN < 7.5 mg/L however the plant is undergoing an upgrade
to meet a new annual total nitrogen mass permit limit that requires it to achieve an effluent TN
concentration of <3 mg/L under some operating conditions.
Plant temperature Winter low temperatures occur in February to March. In 2011, the lowest sustained monthly average
temperature was 14ºC. In colder years the sustained monthly average winter low temperature was as low
as 11ºC.
C/N The C/N ratio in the secondary effluent entering the nitrification/denitrification process is expected to be in
the range between 1:1.1 and 1:3.5.
Inhibitory Sidestream from digested sludge treated with thermal hydrolysis appears to contain inhibitory substance,
compounds and sidestream will be diluted by the plant effluent prior to the treatment.
Phosphorus Phosphorus removal is by chemical precipitation. Ferric chloride is added upstream of the influent
removal screens at an estimated dosing rate of 6.3 mg/L as Fe. Precipitated phosphorus is removed in the
primary clarifiers. The plant has the ability to add ferric chloride at multiple locations throughout the plant
(secondary clarifiers, nit/ denit clarifiers, final filters) but generally does not need to operate multi-point
chemical addition.
Influent flow peaks The peaking factor for peak day is in the order of 2.80 according to the flows and loads report which
examined data between 2005 - 2008. Peaking factor for the maximum monthly average flow is 1.33.
5-18
The first step to the implementation of mainstream deammonification at Blue Plains will
be to convert the existing nitrification/denitrification process to nitrite shunt. Once NOB is
controlled, retention of AnAOB is implemented with hydrocyclones to convert the reactor to the
deammonification process. Following considerations are made for the conversion:
 Nitrite shunt using ABAC.
 Bioaugmentation of AerAOB and AnAOB from sidestream treatment.
 Final polishing to reduce the effluent ammonia, nitrite, and nitrate to a TIN of less than
2mg/L is anticipated. Multiple approaches for final polishing are under consideration.
 Anaerobic zone not required for Blue Plains (chemical P removal).
As mentioned above, B-stage reactor will receive wastewater with a low C/N ratio. The
low carbon content will make a quick depletion of dissolved oxygen when the DO concentration
in the aerobic phase is controlled at DO > 1.5 mg/L to promote higher AOB growth rates over
those of NOB. Because the reactor is a plug flow configuration, the downstream of the B-stage
reactor will have lower residual ammonia level, below 2 mg/L. It is preferred to maintain the
residual ammonia to higher than 2 mg/L. Table 5-12 summarizes equipment requirements to
achieve implementation.
Function Equipment
Anammox Retention Hydrocyclones (other mechanisms are under evaluation)

Rapid Aeration Changes Additional baffles to allow for sequential aerobic/anoxic zones in Stages
2 and 4. Step feed of effluent from A-stage to the anoxic zones.
Control Sequential aerobic/anoxic zone and step feed of A-stage effluent for
DO and organic carbon control to suppress NOB growth. Step feed will
also feed ammonia along the B-stage reactor.
Reactor Configuration Modification of existing B-stage reactor with additional baffles and step-
feed piping or channels. The existing fine bubble aeration grid will be
used to aerate the oxic zones, while mixers will be used to keep the
anoxic zones mixed. This may require modifications to the aeration grid
to turn off the air in the anoxic zones and the relocation or installation of
new mixers. Hydrocyclones will be installed on the WAS line for
retention of the anammox. Piping from the sidestream reactor will be
installed to direct the AOB and AnAOB seed to the B-stage influent
channel or RAS pipeline.

The proposed mainstream deammonification strategy for the Blue Plains AWTP is
outlined below.
 Install and operate sidestream DEMON and waste both excess AerAOB and AnAOB from
the sidestream to bio-augment mainstream (Figure 5-8).
 Install cyclones on mainstream to retain AnAOB in mainstream and selectively waste
flocculent NOBs.
 Modify nitrification/denitrification reactors to allow for sequential aerobic / anoxic zones by
installing baffles in Stages 2 and 4 (Figure 5-9).
 Modify the aeration / mixing mechanisms in the sequential aerobic / anoxic zones. There are
two options under consideration for the aerobic zone modifications:
o Continue to operate the fine bubble aeration system in the aerobic zones and install
hyperbolic mixers in the anoxic zones to maintain good mixing of the AnAOB granules
(Figure 5-10).
o Alternatively, if demonstration testing indicates that the fine bubble aeration grid mixing
is insufficient to maintain the AnAOB in suspension or if AnAOB are settling below the
aeration grid, install “Invent” hyperclassic aerator mixer type units (or similar) in the
aerobic zones along with a variable frequency drive (VFD) and motor operated IRIS
valves and air flow meters for process air control (Figure 5-9). This arrangement would
also better facilitate time cycled aeration if it is preferred.
o Operation of cyclical aeration in all zones (switching aeration on and off) using the AVN
controller developed by HRSD (Regmi et al., 2014b) has also been considered, to date
there is no evidence that this will be required and the sequential zone aeration was
considered simpler to implement. One aspect of continued evaluation at the pilot scale
relates to determining the optimal aerobic / anoxic cycle time to successfully out-select
the NOBs.
 Add step-feed capability to introduce soluble carbon from the A-stage effluent to rapidly
deplete the DO in anoxic zones and to maintain sufficient NH3-N for AnAOB reaction.
 Install on-line ammonia and NOx analyzers at the end of Stage 5B in one tank on the east and
one tank of the west side to monitor the ammonium and NOx at the end of Stage 5B to
determine if the last four swing zones (4A, 4B, 5A, 5B) should operate in cyclical or fully
aerobic mode to bring the ammonia down to the desired set point before entering the post
anoxic polishing zones (Figure 5-10).
 Provide for methanol, ethanol and acetate chemical addition in the channel leading to the
post anoxic tanks for either conventional OHO polishing using methanol or polishing by
Brocadia Anammoxidans or methyloversatilis using acetate or a blend of methanol / ethanol.
5-20
1 2 6
To Filtration,
CEPT HRAS Nit/Denit Disinfection &
Discharge
Influent RAS
WAS
Gravity Belt RAS WAS

Thickening
Primary Sludge
3
CAMBI-MAD
Advanced
Digestion 4
ANAMMOX / AOB
Bioaugmentation
5 Dewatering
Ammonia Rich
DEMON
Recycle
Sidestream
Biosolids
Figure 5-8. Option 2 Proposed Flow Schematic.
1. Add Slide Gate in

existing Step-feed
channle to zone 3b
(anoxic)
2. Additional Step-
feed channel with
slide gates to
zone 2b (anoxic)
3. Additional
baffles in stages
2 and 4
4a. Use aeration grids
in aerobic zones
and mixers in
anoxic zones
or
4b.Install aerator
mixers in all zones
for refined control
Each stage has own air drop & DO meter
Figure 5-9. Option 2 Proposed Reactor Modifications.

Provide Step Feed Capability to Multiple Anoxic Zones
1B 2A 3B 4A 5B
Anox Aer Anox Aer Anox
1A 2B 3A 4B 5A
Aer Anox Aer Anox Aer
Figure 5-10. Spatially Sequenced Aeration Schematic with Step-Feed

Capability to Multiple Zones.

A high-level assessment of the potential cost benefits of nitrite shunt and
deammonification was carried out and a comparison of the potential costs is shown in Figure
5-11. 40% cost savings may be achieved through the nitrite shunt and up to 80% operating cost
savings achieved if mainstream deammonification is established. The most significant savings
are due to reduced carbon requirements.
Figure 5-11. Comparison of Potential Operating Costs of Nit/Denit versus Nitrite Shunt versus Deammonification.
5-22
5.5.2.8 Next Steps
To manage risk and optimize capital investment, DC Water is proposing a step-wise
approach toward progressively implementing the process as follows:
 Laboratory scale work to verify the concept and develop the control strategy.
 Demonstration scale work to resolve the full-scale operational artifacts and demonstrate the
control strategy.
 Full-scale implementation in the existing nitrification tanks at Blue Plains.
This approach will enable DC Water to have "checkpoints" to re-assess the cost-benefit-
risk at each stage before making major investments. The approach is illustrated in Figure 5-12.
Bench Scale Report Acceptable ROI
Large Scale Demonstration Report Acceptable ROI Project is cost positive
Full Scale Implementation
Figure 5-12. Step-Wise Approach Towards Progressively Implementing

Mainstream Deammonification.
The goal of the study phase of the project is to investigate and evaluate the viability of
the process, determine operating parameters, provide estimates for capital and operating costs,
optimize process control strategies and prepare DC Water staff for the operation and
maintenance of this innovative process. The demonstration unit considered for the Blue Plains
will involve either the conversion of one full-scale reactor or a temporary large scale demo
facility, with Invent hyperboloid mixer, fine bubble diffuser, SBR feed pump, decanter, WAS
pump, blowers, and instrumentation for the process control. The goal of subsequent phases of the
project is to implement the process at full-scale; thereby reducing methanol and power
consumption at Blue Plains.

5.5.3 H.L. Mooney AWRF
This concept study presents plausible modifications that could enable achievement of
short-cut nitrogen removal based on the design considerations and decision matrix presented
earlier in this chapter. Further research, cost-benefit analyses and detailed investigations are
needed before they could be implemented.
The H.L. Mooney Advanced Water Reclamation Facility (HLM AWRF) is owned and
operated by the Prince William County Service Authority (PWCSA). The HLM AWRF provides
wastewater treatment for about 48,000 residences in the eastern portion of Prince William
County located in northern Virginia south of Washington, D.C. The plant discharges its treated
effluent into Neabsco Creek, a tributary of the Potomac River and the Chesapeake Bay.
Construction of the HLM AWRF was completed in 1979 with a sewage treatment
capacity of 12 mgd. The first major upgrade to the Facility was completed in 1997, which also
increased treatment capacity to 18 mgd. The PWCSA completed an upgrade of the HLM AWRF
in 2010 to help further safeguard the Chesapeake Bay through more intensive nitrogen and
phosphorus removal. The project also expanded the Facility’s treatment capacity to 24 mgd to
accommodate continuing growth in the County with the plant site now bordered by residential
neighborhoods. The plant uses biological nitrogen removal and chemical phosphorus removal to
achieve an effluent TN limit of 3 mg/L on an annual average basis and a TP limit of 0.18 mg/L
on a monthly average basis.
The treatment process begins with influent pumping by two offsite wastewater pumping
stations. Preliminary treatment consists of pre-aeration, screening and grit removal after which
wastewater flows through in-line equalization basins where 2 to 8 MG of equalization volume is
available.
After equalization, wastewater flows to primary clarifiers. Primary effluent is split
equally among five parallel secondary treatment aeration basins (AB) of which four are in-
service at current flows and loads. Swing zones allow the aeration basins to be configured in
MLE mode or as a 4-stage Bardenpho treatment process. One aeration basin can be operated as
an independent system with dedicated final clarifiers and return sludge flow and this system is
used to test operational and process changes.
Tertiary treatment consists of twenty-two denitrification filters. The filters are designed to
operate with methanol addition for denitrification, but can also be operated without chemical
addition and provide conventional tertiary filtration. Filtered effluent flows through UV
irradiation and cascade aeration prior to discharge into Neabsco Creek.
The HLM AWRF solids handling train consists of gravity thickening of primary sludge
and WAS either separately or together (currently together). Thickened sludge is pumped into one
of two Solids Holding Tanks before being dewatering in high-speed centrifuges. Centrate, which
can contain elevated ammonia concentrations, is returned to the Primary Influent. Dewatered
cake is oxidized in a Fluidized Bed Incinerator (FBI). Ash from the incineration process is dried
in on-site ash ponds and then removed to the local landfill along with grit and screenings.
Chemicals used at the plant include ferric chloride which is added to primary influent to
improve settling and solids removal in the primary clarifier and for chemical phosphorus
removal. Ferric chloride can also be added to the secondary clarifiers. Methanol is added for
denitrification to the post-anoxic zone in the aeration basins or to the denitrification filters. Lime
5-24
is added to primary effluent to provide sufficient alkalinity for nitrification and to meet effluent
pH limits. Polymer is used in gravity thickening and centrifuge dewatering.
Figure 5-13 shows the schematic of the HLM AWRF and Figure 5-14 provides an aerial
view of the plant.
Figure 5-13. Process Schematic for H. L. Mooney AWRF.
Figure 5-14. Aerial Photo.

Table 5-13 contains the current Virginia Pollutant Discharge Elimination System
(VPDES) permit limits for the HLM AWRF.
Table 5-13. Current VPDES Permit Limits for HLM AWRF.
Parameter Month Average Weekly Daily Max
cBOD5 5 8
TSS 6 9
NH4-N:
Apr-Oct 1.0 4.1
Nov-Jan No limit No limit
Feb-Mar 4.6 5.5
Total Nitrogen 3 (annual average)
Total Phosphorus 0.18 0.27
Chlorine Residual Non detect
Dissolved Oxygen >6
pH 6<pH<9
E. coli 126 per 100 mL
The HLM AWRF has seasonal ammonia limits with no ammonia limit during some
winter months. However achieving an annual average total nitrogen concentration of 3 mg/L
requires a high level of ammonia removal year round and winter nitrification is required.
The HLM AWRF is operating at about 13 mgd average annual flow and achieves all
effluent quality criteria including stringent TN and TP limits. The plant has achieved several
National Association of Clean Water Agencies (NACWA) Peak Performance Awards for permit
compliance.
An operational challenge for the Mooney plant when implementing short-cut nitrogen
removal will be controlling DO in the bioreactors. The plant is operating at 55% of design flow
and with a primarily domestic and commercial wastewater, loadings to the plant decrease at
night as low as 30% of the daily average load. Air valves and air flow meters are sized for design
conditions and are difficult to control and measure air flow at current conditions. The FBI is
operated about 15 hours a day so centrate ammonia loads are intermittent. Centrate has high
ammonia and soluble COD content due to biological activity in the sludge storage tanks which
results in fermentation.
5-26
Table 5-14 provides the wastewater composition for the HLM AWRF.
Table 5-14. Wastewater Composition (2013 Data).

Plant Influent
Flow, ML/d( mgd) 50.3 (13.3) 55.2 (14.6) 47.7 (12.6) 89.3 (23.6)
BOD, mg/L 274 315 227
COD1, mg/L 590 677 490
TKN, mg/L 48.0 51.6 45.0
COD/TN 12.3 13.1 10.9
TSS, mg/L 292 357 180
TP, mg/L 6.7 7.9 6.0
Temperature, °C 20.5 15.4 134
Alkalinity
NO2-N & NO3-N, mg/L 0 0 0
Primary Effluent2 Design2 / Update3
BOD, mg/L 82 / 102
COD, mg/L 213 / 201
TKN, mg/L 49.8 / 33.3
COD/TN 4.3 / 6.0
TSS, mg/L 59 / 51
TP, mg/L na / 2.0
Notes:
1 COD measured Aug/Sept 2013.
2 Process modeling calibration sampling October/December, 2006. TKN average 2000 to 2006.
3 Process modeling calibration sampling August/September, 2013.
4 Design minimum month temperature. Minimum temperatures occur in Feb/Mar.

elements for mainstream deammonification for the HLM AWRF.
Sidestream Liquors Available Without anaerobic digestion, sidestream deammonification is not feasible.
Sidestream nitritation may be possible, but is unproven.
Chemical Addition The plant currently adds lime for alkalinity, methanol for carbon and ferric chloride for
phosphorus removal and CEPT Reduction of methanol usage and chemical cost is a
major driver at the HLM AWRF.
Energy The average cost of electricity including all charges and fees, is $0.068 per kWh.
Effluent Limits Current annual average TN limit is 3 mg/L. Low effluent ammonia requirements
would tend to suggest a polishing step for ammonia removal be provided.
Plant Temperature Winter low temperatures (13°C) are somewhat low and make attached-growth a
good consideration.
C/N The C/N ratio is 10-13 which is sufficient for full nitrification/denitrification. However
primary clarification removes carbon and bypassing primary treatment is not
available. Primary effluent C/N ratio is 4-6 with CEPT and design guidance would
suggest is suitable for short cut nitrogen removal.
Inhibitory Compounds No known inhibitory compounds
Phosphorus Removal TP removal to 0.18 mg/L is required. Bio-P is desired but not necessary. Chemical
phosphorus removal is compatible with short-cut nitrogen removal.
Influent Flow Peaks The current maximum daily flow peaking factor is about 2. The use of equalization
basins mitigates peak flow events.
MLSS Settleability Plant experiences frequent periods of poor settling and elevated SVI making MLSS
concentrations above 2,800 mg/L difficult to achieve consistently under current
conditions.
The HLM AWRF primary effluent has a C/N ratio of 4-6 after ferric addition to primary
clarifiers (CEPT) which achieves about 80% TSS removal and 50% BOD5 removal. The plant
has a low effluent TN limit (3 mg/L) which requires a low effluent ammonia concentration
(<0.5 mg/L) throughout the year.
Potential reductions in chemical costs for carbon (methanol) and alkalinity (lime) pose a
significant driver towards shortcut nitrogen removal technologies. Energy costs at $0.068/kWh,
are relatively low, reducing the magnitude of potential cost savings due to reduced energy
requirements. Further, the plant currently operates only one of six blowers for much of the time
and uses a second blower intermittently during peak load events. Modifications to the blower
facility, such as installing a new, smaller blower or a blower with greater turndown ability,
would be needed to realize the potential energy savings if innovative nitrogen technologies were
implemented. At current operating conditions, and with existing blower equipment, a reduction
in oxygen demand that reduces or eliminates the need to turn on a second blower would provide
a measurable reduction in energy costs.
5-28
Design guidance would suggest that nitrite shunt using ABAC is a good, immediately
implementable option to reduce oxygen demand to the level where one blower could satisfy the
oxygen demand. This will reduce energy costs while ensuring effluent ammonia limits are
achieved. Supplemental carbon addition could also be reduced through simultaneous
nitrification/denitrification (SND). As long as ammonia is completely removed in the aeration
basins, the existing denitrification filters can be available to polish any remaining nitrate.
In the future, as costs for chemicals and energy increase, it can be anticipated that a
breakpoint will be realized and implementing mainstream deammonification will become feasible
as the savings in operating costs outweigh the cost of any new equipment and process
modifications. With low winter wastewater temperatures and without bioaugmentation from a side
stream process, use of the AVN controller followed by fixed film deammonification appears to be
the most suitable option for the HLM AWRF, based on the process developed and piloted at
HRSD’s CETP.
A phased approach to implementing nitrogen removal technologies is recommended for the
HLM AWRF beginning with ABAC and moving towards deammonification as flows and loads
increase, and as the cost of chemicals and energy increase. An advantage of the phasing strategy is
that the time allows knowledge and operating experience gains to be incorporated into design.
5.5.3.5.1 Option 1: Aeration-Based Ammonia Control (ABAC)
Aeration-based ammonia control (ABAC) provides the potential to save energy by
requiring only one blower to be operated at current flows and loads. The following is
recommended for this option:
 Simultaneous nitrification/denitrification (SND) or nitrite shunt using ABAC.
 Bioaugmentation is not required.
 Ammonia polishing is not required, existing denitrification filters are available to polish
nitrate.
 Compatible with chemical phosphorus removal.
Figure 5-15 presents a schematic of the proposed system. The equipment requirements
for this option are considered in Table 5-16.
Figure 5-15. HLM AWRF ABAC Reactors.

Table 5-16. Option 1 Equipment Requirements.
Function Equipment
Anammox retention Although anammox retention is not required, use of a cyclone may
improve MLSS settling characteristics.
Rapid aeration changes Accurate valves & meters required in aeration zones
required airflow ranges, especially in having sufficient turn-down for low
airflow requirements.
Diffusers are membrane, fine-bubble and can be operated with
intermittent aeration. Mixers in existing swing zones can be used to
decouple aeration and mixing requirements. Mixers can be installed in
other zones if poor mixing is observed.
Control Ammonia-based Control
Reactor Configuration Aeration basins can be operated in MLE mode to maximize
denitrification in first anoxic zones. Aerator/mixers can be installed in
first anoxic zones to maximize nitrification volume.
5.5.3.5.2 Option 2: Deammonification (Single- or Dual-Stage)

As chemical and energy costs rise, and when flows and loads to the plant increase,
savings in operating cost will begin to compare favorably to the capital cost of implementing a
deammonification technology at the HLM AWRF. To implement, the existing aeration basins
can be converted to operate for nitrite shunt (promoting nitritation rather than full nitrification)
by using ammonia versus nitrite control (AVN controller) to promote approximately equal
concentrations of ammonia and nitrite. The AVN controller effluent can be expected to contain a
TIN concentration of 5 or 6 mg/L depending on the time of the year and temperature. The TIN
would be polished in a downstream fixed film deammonification process. Two options for fixed-
film deammonification, a single-stage and a two-stage option, can be considered to leverage
HLM AWRF’s existing tankage and infrastructure.
For a single-stage configuration, a fixed-film anammox polishing zone can be installed in
the end of the existing aeration basin volume to remove the ammonia and nitrite remaining from
the upstream AVN controller zones. A re-aeration zone for ammonia removal polishing and
nitrogen gas stripping would complete nitrogen removal treatment prior to secondary
clarification and tertiary filtration. In this one-stage process, the AVN controller zones could
conceptually occupy the first two thirds of the basin volume with the last third occupied by
fixed-film and re-aeration zones.
For a dual-stage configuration, the existing denitrification filters could be modified to
become autotrophic denitrification filters, cultivating anammox on the sand media rather than
methanotrophs. In this option the entire aeration basin volume is converted to the AVN
controller. An ammonia polishing step may be needed after the anammox filters. This
configuration is experimental and a pilot study would be recommended prior to implementation.
For this option, the following is recommended:
 AVN controller to achieve approximately equal concentrations of nitrite and ammonia into
the anammox media zone (either fixed-film in aeration basin or anammox filters).
5-30
 Bioaugmentation is not provided.
 Ammonia polishing is required in a re-aeration zone.
 All of this is compatible with chemical phosphorus removal.
Schematics of the single-stage and dual-stage configurations are provided in
Figures 5-16 and 5-17, respectively. Table 5-17 summarizes equipment requirements to achieve
implementation.
Figure 5-16. HLM AWRF Single-Stage AVN/Mainstream Deammonification Reactor.
Figure 5-17. HLM AWRF Dual-Stage AVN Reactor/Anammox Filters.

Function Equipment
Anammox Retention New Fixed Film media in aeration basins or sand in existing
denitrification filters (experimental).
Rapid Aeration Changes Accurate valves & air flow meters required in AVN zones.
required airflow ranges and have sufficient turn-down for low airflow
requirements.
Diffusers are membrane fine-bubble and therefore can be operated
with zero airflow.
Control AVN Control in aeration basins using ammonia and nitrite analyzers
Reactor Configuration Modifications to the third and fourth passes of the aeration basin to
provide a screened reactor for fixed film media retention. Provide an
anaerobic zone for the fixed film by removing aerators and installing
mixers. Multiple media zones may be needed.
Baffling potentially required to prevent back-mixing from AVN zone.

Rough sizing of the position of the ammonia probe for Option 1 is shown on the plan
view schematic (Figure 5-18). The ammonia probe is positioned at the end of the third pass to
ensure effluent limits are met. Sizing of the zone needs to be checked and the positioning of the
ammonia probes needs to be confirmed during testing.
Figure 5-18. Plan View Schematic for Option 1 (ABAC).
5-32
Sizing of an unaerated IFAS zone(s) for Option 2 (Single-Sludge) are shown on the
second plan view schematic (Figure 5-19). An ammonia probe and nitrite probe are positioned at
the end of the main aeration zone for the AVN control. A second ammonia probe is positioned at
the end of the third pass to ensure effluent limits are met. Sizing of the anaerobic zones and the
sizing and need for sub-partitioning of the IFAS zones needs to be checked during detailed
design.
Figure 5-19. Plan Schematic for Option 2 (Single-Stage Deammonification).

A high-level assessment of the potential costs and benefits of nitrite shunt and
deammonification was carried out. Figure 5-20 shows the outputs of that assessment which
shows a potential 28% reduction in electricity use when changing from nitrification/
denitrification to nitrite shunt and an overall reduction of 41% in changing to full
deammonification (i.e., an additional 13%). The HLM AWRF adds carbon (methanol) and
alkalinity (lime) and therefore would derive significant benefits from chemical reductions.
Energy savings in shifting to the nitrite shunt are significant and will require little capital
investment. Full deammonification would require major modifications to the aeration basins or
denitrification filters and a breakpoint for the additional capital cost will be justified as operating
costs for chemicals and energy increase in the future.
Figure 5-20. HLM AWRF Comparison of Potential Operating Costs of Nit/Denit

versus Nitrite Shunt versus Deammonification.
5-34
5.5.3.8 Next Steps
Implementation of an ammonia-based control system, for Option 1, is relatively low risk
and can be tested before fully implemented using the following steps:
 In the independent test train, install, and test an ABAC system and test a cyclone to improve
mixed liquor settling characteristics.
 Implement ABAC and cyclone for settling on the entire plant.
Option 2 (mainstream deammonification) requires further research and development
before it can be tested and installed on the main plant. The following steps are recommended:
Pilot testing in the independent test train of the AVN control system to produce an
effluent with equal concentrations of nitrite and ammonia. A re-aeration zone in the aeration
basins will be needed to polish ammonia and denitrification filters will be needed on-line to
polish nitrite/nitrate.
 Pilot testing of an unaerated IFAS zone in concert with AVN control.
 Carry out process modeling and an economic analysis of the AVN and IFAS system
compared to ABAC.
 As plant flows approach design values, the aeration basin volume may not be sufficient and a
dual-stage approach may be needed. An approach to test this mode could be to isolate three
to four denitrification filters to operate with the independent test aeration basin in AVN
mode. A re-aeration tank for ammonia polishing, or ammonia polishing in the anammox
filter, would be required.
Option 2 has similarities with the pilot test work on mainstream deammonification being
carried out by HRSD. It is recommended that PWCSA work closely with HRSD to share
knowledge on how to set up the pilot and in interpreting.

5.5.4 Robert White Treatment Facility
The Denver Metro Wastewater Reclamation District owns and operates The Robert W.
Hite Treatment Facility (RWHTF) located in northeast Denver, Colorado near the confluence of
Sand Creek and the South Platte River. Constructed in 1966, the RWHTF currently serves nearly
1.7 million people in a 715 square mile service area that includes Denver and 45 water and
sanitation districts in several of its suburbs. The RWHTF treats on average 150 mgd of
wastewater, discharging it into the nearby South Platte River. For nine months of the year the
treated effluent constitutes nearly 85% of the river's flow northeast of the plant.
The RWHTF is located on a 134-acre site, eight miles northeast of downtown Denver.
The main site is bordered on the north and west by the South Platte River and along the east by
Sand Creek within Commerce City. The ancillary site north of the South Platte River lies within
unincorporated Adams County. Figure 5-21 provides an aerial view of the site identifying the
major attributes of the site.
Figure 5-21. RWHTF Aerial View.
5-36
The RWHTF consists of two separate liquid stream treatment trains, referred to as the
North Complex and South Complex. The next paragraphs describe the biological treatment
systems. Solids handling occurs in a common facility which includes anaerobic digestion and
therefore produces an ammonia-laden centrate, also described in more detail below. Figure 5-22
presents a simplified flow schematic of the process configuration.
Figure 5-22. RWHTF Simplified Flow Schematic.
The North Secondary Complex includes 12 parallel activated sludge trains with paired
aeration basins and clarifiers. The activated sludge trains reduce BOD, TSS, ammonia, and nitrate
plus nitrite (NOx) to meet blended effluent discharge criteria. The aeration basins are configured in
a three-pass layout in a MLE configuration. These facilities remove TN typically to approximately
10 mg/L dependent on the influent readily biodegradable carbon available. The A-Pass consists of
three anoxic zones (A1-A3) for denitrification and one swing zone (A4) that can be used as an
anoxic zone for denitrification or an aerobic zone for nitrification. Zones A5 and A6 are aerobic for
nitrification. The B and C-Passes are each operated aerobically for nitrification and BOD
reduction. Primary effluent, treated sidestream effluent (treated sidestreams include centrate and a
portion of the RAS flows), and the remainder of the RAS flow is mixed at the head of the main
influent channel and evenly distributed to each aeration basin. A portion of the mixed liquor from
the end of each basin is returned to the anoxic zones at the head of A-Pass to provide some of the
required nitrate return for denitrification. Secondary influent flow is regulated into each aeration
basin using modulating weir gates to provide an equal distribution of feed to each operating
activated sludge train. The North Secondary process operates at SRTs in the range of four to six
days, with longer sludge ages being required at lower mixed liquor temperatures.

Centrate treatment is provided using sidestream nutrient removal basins (SNRB). The
SNRB system will partially nitrify centrate prior to introducing centrate to the activated sludge
aeration basins. The degree of centrate nitrification in the SNRB without supplemental chemical
addition is anticipated to be approximately 50%. Additional centrate nitrification up to about 90%
can be achieved in the SNRB with supplemental alkalinity addition. Denitrification of centrate can
also be provided in the SNRB, if desired, by operating the anoxic zones. Denitrification of centrate
in the SNRB will require the addition of supplemental carbon using acetic acid. The SNRB also
serve to inventory mixed liquor suspended solids (MLSS) at RAS concentrations. With all four
SNRBs on-line, approximately 25% of the solids in the North Secondary Complex will reside in
the SNRB. This allows operations staff to maintain the required nitrification SRT at reduced MLSS
concentrations in the aeration basins. Reduced MLSS in the aeration basins reduces the SLR to the
secondary clarifiers, effectively increasing the capacity of the North Secondary Complex.
The South Secondary Complex has historically used a high-purity oxygen system (HiPOS)
process to provide basic activated sludge secondary treatment for BOD and TSS reduction, without
nitrification or denitrification. With the completion of the South Secondary Improvements Project
(PAR 1085) in mid-2014, the South Secondary Complex will consist of a BNR process similar to
the North Complex that will provide for nitrification and denitrification, while allowing flexibility
for conversion to a Bio-P removal process when required in the future.
The activated sludge process will consist of newly constructed aeration basins consisting of
eight zones. Zones 1 and 2 will be operated in either anaerobic or anoxic mode and will be
equipped with mixers. Zones 3 and 4 will always be operated in anoxic mode and will also be
equipped with mixers. Zone 5 will have the capability to be operated in either anoxic or oxic mode
and will be equipped with both aeration diffusers and mixers. Zones 6, 7, and 8 will always be
operated in the oxic mode and will be equipped with aeration diffusers. As part of the South
Secondary Improvements Project, the existing physical structure of the existing HiPOS basins will
be largely maintained. The northern portion of the HiPOS basins will be retrofitted into two
smaller sized aeration basins termed “Stage 5” (due to its potential function as the fifth stage of the
Bardenpho process that the secondary treatment may be converted to in the future). For the near-
term process configuration, Stage 5 will provide additional aeration volume to the six aeration
basins, thereby providing additional treatment. Both of the Stage 5 basins will be equipped with
aeration diffusers. The South Secondary process operates with an SRT of approximately one day.
In the South Secondary SNRB process, centrate is combined with RAS for the nitrification
of ammonia prior to entering the aeration basins. Thus, the ammonia load into the aeration basins
will be significantly reduced, thereby allowing for increased capacity of the remaining system.
Each of the three SNRBs will consist of two equally sized zones separated by a zone wall. Each
zone will be equipped with aeration diffusers. The SNRB effluent is combined with mixed liquor
recycle (MLR) and can be sent to either Zone 1, 2, or 3 of the aeration basins. During normal
operation, SNRB effluent from one basin will be split in half over symmetrical effluent weirs to
two aeration basins. However, if an aeration basin or a SNRB is taken out of service, the isolation
valves on the SNRB effluent header can be opened and flow distributed equally to the number of
aeration basins in service using modulating control valves and flow meters.
5-38
The RWHTF generates primary solids and waste activated sludge. The residual solids
generated during primary and secondary treatment are handled by means of the following biosolids
processes:
 Gravity thickening of primary solids.
 DAF thickening of WAS.
 Pre-and post-digestion storage.
 Two-phase mesophilic anaerobic digestion.
 Centrifuge dewatering of digested solids.
 Scum/grease thickening.
 Cogeneration facility for biogas processing – operated by Suez Energy Generation North
America, Incorporated (Suez).
Table 5-18 contains the current 2015 NPDES permit limits for RWHTF.
Table 5-18. RWHTF NPDES Permit Requirements.
Limit
Parameter 30-Day 7-Day Daily
Average Average Maximum
Flow, (mgd)
Outfall 001C (South Platte) 220 – Report
Outfall 003A (Burlington Canal) Report – Report
5-Day Carbonaceous BOD, mg/L
Outfall 001C+Outfall 003A 17.0 25.0 –
Total Suspended Solids, mg/L –
Outfall 001C+Outfall 003A 30.0 45.0
E. Coli, number per 100 mL
Outfall 001C 126 252 –
Total Residual Chlorine, mg/L
Outfall 001C 0.011 – 0.019
pH (minimum-maximum), mg/L
Outfall 001C+Outfall 003A – – 6.0 – 9.0
Oil & Grease, mg/L
Outfall 001C+Outfall 003A – – 10.0
Dissolved Oxygen (DO)(minimum), mg/L – 5.0 3.0
Total Ammonia, mg-N/L
January 4.60 – 6.31
February 4.47 – 6.17
March 4.22 – 8.29
April 4.13 – 9.21
May 3.08 – 11.21
June 2.77 – 12.67
July 2.37 – 10.37
August 2.04 – 10.13
September 2.72 – 9.14
October 3.34 – 9.18
November 3.54 7.84
December 4.64 7.97
Nitrate plus Nitrite, mg-N/L – 8.68 –

Applying traditional conventional activated sludge technologies, effluent ammonia in the
range of 2.0-5.0 mg/L, requires achieving full nitrification producing an effluent ammonia of less
than 1.0 mg/L. Some technologies under development using Anammox microorganisms and
some developed in this study, combined with the application of accurate sensors, allows a
treatment facility to operate to achieve greater than 1.0 mg/L effluent ammonia by limiting the
oxygen available to the nitrification consortium bacteria. RWHTF might adopt this strategy
initially until more stringent effluent nutrient requirements are imposed.
RWHTF will be able to comply with the Colorado Department of Public Health (CDPH),
Water Quality Control Commission Regulation 85 TIN limit of 15 mg-N/L upon completion of
South Secondary Improvements (PAR 1085) project in 2014. Effluent quality improvements will
then focus on TP removal. RHWTF is assuming CDPH Regulation 31 TN and TP values listed
in Table 5-19 will become final water quality criteria in 2022. For planning purposes, the first
year an end-of-pipe effluent TN limit of 2.01 mg-N/L could be established is 2025 (without a
compliance period). This assumes that the Regulation 31 nutrient criteria are incorporated in the
South Platte River Basin standards (Regulation 38). There is essentially no upstream dilution in
the South Platte River, and/or the dilution water has a TN content higher than 2.01 mg N/L.
Achieving this standard can challenge any existing nitrogen removal process.
Table 5-19. RHWTF Water Quality Criteria.
Regulation 85 Regulation 31
Parameter
(Effluent Standards) (In-Stream Values)
TP, mg P/L 1 0.17

TIN, mg N/L 15 N/A
TN, mg N/L N/A 2.01
Attached Algae Chlorophyll a, mg/m2 N/A 150

RWHTF historically operated the South complex as high-purity activated sludge and did
not nitrify. As the reconfiguration comes into service, both complexes now operate in an MLE
configuration with the potential for centrate sidestream treatment with conventional
nitrification/denitrification or potential conversion to various other sidestream treatment
technologies using anammox.
Although the winter temperatures are not as extreme as in some colder climates, the
winter wastewater temperature of approximately 14oC could present limitations for mainstream
deammonification. Other challenges include implementing biological phosphorus removal and
reliably achieving low effluent ammonia concentrations if operating for AVN with mainstream
fixed-film deammonification.
5-40
Design annual average and maximum month wastewater flow and composition is shown
in Table 5-20.
Table 5-20. Wastewater Composition (Plant Design Data).
North South
Parameter Annual Maximum Annual Maximum

Average Month Average Month
Plant Influent
Current Flow, ML/d (mgd) 327.4 (86.5) 435.3 (115) 142.0 (37.5) 151.5 (40)
BOD, mg/L 288 323 367 411
COD1, mg/L 742 830 770 862
TKN, mg/L 46.3 52 48.0 54
COD/TKN 16.0 16 16.0 16
TSS, mg/L 269 290 349 376
Temperature, °C 14°C 22°C 14°C 22°C
Alkalinity, mg/L as CaCO3 230 – 235 –
Primary Effluent2
BOD 218 235 203 219
COD 422 447 400 423
TKN 39.4 42 36.0 38
COD/TN 11 11 11 11
TSS 98 103 130 137
Notes:
From Master Plan Process Modeling TM.

design elements for mainstream deammonification for the RWHTF.
Sidestream Liquors Available Centrifuges dewater anaerobically digested sludge and centrate is high in ammonia
and phosphorus. The centrate is currently treated in a in a dedicated aerobic/anoxic
nitrification/denitrification sidestream treatment process. This basin could easily be
for operation of a sidestream deammonification process.
Chemical Addition The plant currently does not add external carbon, but could be required to in the
future with anticipated stringent effluent requirements.
Energy Separate energy and demand charges complicate electrical cost but average cost of
electricity is about $0.07 per kWh. Future energy cost reduction could be a driver for
considering mainstream deammonification at RWHTF.
Effluent Limits RWHTF currently has a moderate TN limit that it anticipates being reduced
significantly in the future requiring external carbon. The low effluent TN suggests that
full nitrification/partial denitrification, nitrite shunt, ammonia-based aeration control or
deammonification in either mainstream or side-stream should be considered. Also, a
polishing step might be required (additional aeration at the end of biological treatment
for nitrification of residual ammonia that will remain if the main aeration zone is
operated with ammonia-based aeration control).
Plant temperature Winter low temperatures (less than 10°C) may make mainstream deammonification
challenging.
adequate carbon for full nitrification/partial denitrification or nitrite shunt. However it is
noted that operation for biological phosphorus removal also consumes a portion of
the available carbon.
Inhibitory compounds No known inhibitory compounds
Bio-P RWHTF does not currently operate for enhanced biological phosphorus removal
(EBPR), without an effluent TP currently in the permit. A pilot of anaerobic RAS
EBPR did prove effective and may be a component of future effluent TP compliance.
Influent flow peaks Influent peaks approach 160 mgd but are well-managed and should present only
minor problems for implementing nitrogen removal technologies.
5-42
The RWHTF primary effluent has a C/N ratio of 11. The plant has an effluent ammonia
limit and a reasonable nitrate plus nitrite limit. The plant anticipates a potential reasonable
effluent TN limit and an effluent TP limit in the near future and plans to implement EBPR with
chemical addition for backup. The plant employs sidestream nitrification-denitrification reactors
to reduce the recycle loads from anaerobic digestion and has piloted both suspended growth and
fixed-film sidestream deammonification reactors. Plans to implement a sidestream configuration
in the upcoming years should minimize recycles nitrogen.
An option for the RWHTF could be to convert the MLE process to nitrite shunt using the
AVN controller in the majority of the existing bioreactors. This configuration would likely
produce 5 or 6 mg/L of TIN, depending on the time of the year and temperature, with roughly
equamolar parts of NH4 and NO2. This would likely satisfy the RWHTF permit, but additional
treatment steps could provide a factor of safety without increasing the operating cost
significantly. Following the AVN Control Reactors a fixed-film anammox polishing zone could
remove the NH4 and NO2, followed by a reparation zone for ammonia polishing and N2 gas
stripping. In the three-pass reactors, two passes could be configured in AVN control while the
third pass could be split between anammox polishing and reparation as a first approximation for
the design, Figure 5-23 presents a schematic of the configuration.
Figure 5-23. RWHTF AVN/Mainstream Deammonification Reactors.
This configuration provides the benefit of achieving a low effluent TN (lower than
presently being considered) while avoiding the use of denitrification filters and the associated
carbon requirements. It also completes all TN removal upstream of the filter, providing
operational benefits avoiding TP limitations in the denitrification filter.
Finally, if sidestream fixed-film deammonification is implemented, this allows for
bioaugmentation from the sidestream process to the mainstream process, although additional
study of this fixed-film bioaugmentation would be required.

Table 5-22 presents equipment requirements to convert the process to AVN control
reactors followed by fixed-film mainstream deammonification.
Function Equipment
Anammox Retention Fixed-film media

Rapid Aeration Changes Accurate valves and meters required in aeration zones
Control AVN control
Reactor Configuration Modification of existing three-pass MLE reactors to likely include two
passes of AVN control reactors. Modification of the first half of the third-
pass consisting of a screened reactor for fixed-film medial retention.

Modifications to RHWTF considered the implementation of sidestream treatment
technologies by including sidestream nitrification/denitrification reactors. These reactors
minimize the impact of centrate recycle streams on the main treatment plant and could be
retrofitted fairly easily into several more cost-effective sidestream deammonification
technologies. These reactors increase the probability that mainstream deammonification could
have a future role at RHWTF.
5-44
An assessment of the potential costs and benefits of AVN Controller followed by fixed-
film deammonification was carried out for both the Regulation 85 effluent requirement and for
Regulation 31 effluent requirements. Figure 5-24 presents the results of that assessment for the
Regulation 85. Effluent which shows a potential $1.0 MM/year (21% reduction) power cost
savings by changing operation from nitrification/denitrification to nitrite shunt with the AVN
controller and a reduction of 33% by changing operation to completely to mainstream
deammonification. RWHTF does not require carbon to achieve Regulation 85 effluent
requirements and does not require alkalinity.
$5,000,000
$4,500,000
$4,000,000
$3,500,000
$3,000,000
$2,500,000
$2,000,000
$1,500,000
$1,000,000
$500,000
$-
Electricity $4,667,225 $3,663,159 $3,206,766
Carbon $- $- $-
Alkalinity $- $- $-
Figure 5-24. RHWTF Regulation 85 Operating Cost Comparison.

Figure 5-25 presents the results of that assessment for the Regulation 31 Effluent which
also shows a potential $1.0 MM/year (21% reduction) power cost savings by changing operation
from nitrification/denitrification to nitrite shunt with the AVN controller and a reduction of 33%
by changing operation completely to mainstream deammonification. For Regulation 31 effluent,
supplemental carbon addition would be required.
$7,000,000
$6,000,000
$5,000,000
$4,000,000
$3,000,000
$2,000,000
$1,000,000
$-
Electricity $4,667,225 $3,663,159 $3,206,766
Carbon $1,642,500 $985,500 $-
Alkalinity $- $- $-
Figure 5-25. RHWTF Regulation 31 Operating Cost Comparison.
5.5.4.8 Next Steps

Implementation of sidestream deammonification is relatively low risk and is planned in
the near future. Pilot facilities have already been completed and performed well.
Implementation of the mainstream AVN control system for nitrite could be piloted full-
scale in one bioreactor train with aerobic polishing. This should allow the entire system to
achieve Regulation 85 effluent limits during the pilot operation. Upon demonstrating that the
AVN controller works well at this scale, a reactor could be converted to AVN, fixed-film
deammonification and aerobic polishing and isolated from the remaining reactors to demonstrate
the process effectiveness before proceeding to full-scale.
5-46
5.5.5 Egan WRP
earlier in this chapter. Further research, cost-benefit analyses, and detailed investigations are
The Metropolitan Water Reclamation District of Greater Chicago's (MWRDGC) John E.
Egan Water Reclamation Plant (WRP) serves the drainage basin in the northwest Cook County.
The plant discharges its treated effluent into the Salt Creek. The Egan WRP has a liquid
treatment facility as well as a sludge handling and treatment facility which treats waste activated
sludge from the District’s Kirie WRP.
The liquid treatment part of the facility includes a raw sewage pumping station that has a
total of six centrifugal pumps with a total pumping capacity of 120,000 gpm. These pumps are
preceded by coarse screening to prevent any damage to the raw sewage pumps. The plant also
receives wet weather flow, and has the ability to send the primary treatment effluent directly to
the outfall when the influent flow exceeds the plant’s maximum practical flow. In situations of
emergency, excess raw wet weather flow may also be directed to the outfall.
During regular operation, the pumped flow is degritted in the aerated grit chambers and
sent to four primary settling tanks that are also called storm settling tanks. The scum from the
primary settling or storm settling tanks is pumped to a scum collection tank using two centrifugal
pumps. The sludge from the primary settling tanks is pumped directly to the anaerobic digesters
using one centrifugal pump, one piston pump and/or two peristaltic pumps. The effluent from the
primary/storm settling tanks is then split between two parallel secondary treatment basins –
North Aeration Tanks and South Aeration Tanks. The North and the South tanks have two
aeration tanks each. The aeration tanks have the provision of being used as a conventional
activated sludge system or a three-pass, step-feed system. Downstream of the aeration tanks
there are four final settling tanks in each of the North and South basins. The scum from the final
settling tanks is sent back to the plant headworks. The secondary effluent from the final settling
tanks is dosed with sodium hypochlorite to provide disinfection and to maintain a chlorine
residual after the tertiary filters.
The RAS from the final settling tanks is combined with the primary effluent at the head
of the first pass of the respective aeration tank. The WAS from the final settling tanks is split
from the return sludge line and pumped to the pre-GBT sludge holding tank.
The effluent from the secondary treatment is sent to tertiary treatment that consists of
twelve dual-media filters. The filter effluent flow is dosed with sodium bisulfite to dechlorinate
the filter effluent. This dechlorinated effluent is sent to the plant outfall.
The Egan WRP has its own biosolids handling and processing facility that includes
gravity belt thickeners, anaerobic digesters, centrifuges and an offsite land application or
biosolids processing program. The plant includes four mesophilic, anaerobic digesters, out of
which two have fixed covers and two have the Dystor® design. Each digester is 110 ft. in
diameter with a side water depth of 34 ft. The digester gas is collected near the top of the digester
cover domes, and may be used as fuel by the sludge heaters. The digested sludge is pumped into
a sludge holding tank, from which it is pumped to three solid bowl scroll-type centrifuges using
three centrifugal feed pumps. Polymer and ferric chloride is dosed to the centrifugal feed line to

improve dewatering of the digested sludge in the centrifuges. These dewatered biosolids from the
centrifuges are then hauled off to lagoons [Lawndale Avenue Solids Management Area
(LASMA)] or to the farms for land application for further processing. Some sludge and/or
centrate is also sent to the North Side WRP through the interceptor system.
The Egan WRP is rated for a design average flow of 30 mgd. The design maximum flow
to the plant is 50 mgd, while the maximum practical flow to the plant is 60 mgd. The plant can
receive a total storm flow of 140 mgd, with 80 mgd of the storm flow receiving only primary
treatment and chlorination prior to being sent to the outfall. During the year 2008, the average
influent flow measured at the Egan WRP was 30.4 mgd, which is close to the design average
flow to the plant. The maximum day flow measured at the plant in year 2008 was 105.7 mgd.
Figure 5-26 shows the schematic of the facility, showing the linkages between the Egan,
Kirie and O’Brien WRP (digested sludge liquors currently go to O’Brien).
Hypochlorite
Excess Flow
RAS Hypochlorite
Primary/ Activated
Screening & Storm Secondary
Influent Sludge
Clarifiers
Filters To Salt Creek
Grit Removal Tanks Nitrification
Gravity
Belt
Thickeners Kirie WAS
Anaerobic
Digesters
Centrifuge
Dewatering
Cake for Disposal
Centrate
To O’Brien WRP
Figure 5-26. Process Schematic for Egan WRP.
5-48
Figure 5-27 shows an aerial photo of the Egan WRP and Figure 5-28 is an aerial photo
detail of the aeration basins including an indication of the direction of flow.
Secondary
Clarifiers
Aeration
Batteries
Digester Primary/Storm
s Clarifiers
North
Battery
South
Battery
Figure 5-28. Aerial Photo (Aeration Basin Detail including Flow Directions).

Table 5-23 contains the current NPDES permit limits for the Egan WRP.
Table 5-23. Current NPDES Permit Limits for Egan WRP.

cBOD5 10 20
TSS 12 24
NH4-N 1.5 (Apr-Oct) 3 (Apr-Oct)
3.6 (Nov-Feb) 8 (Nov-Mar)
2.3 (Mar) 5.7 (Mar)
Chlorine Residual 0.05
Dissolved Oxygen >6
Fecal Coliform 400 per 100 mL (May-Oct)
Egan WRP is facing a future Total Phosphorus limit of 1 mg/L and it is planned that
biological phosphorus removal be used to meet this limit in order to facilitate phosphorus
recovery also.
Egan WRP has seasonal ammonia limits as shown in Figure 5-29 and significant seasonal
temperature variations which make March and April a critical period for meeting effluent limits.
Future ammonia limits may be lower as the U.S. EPA in-stream concentration limits for
ammonia are lowered.
Figure 5-29. Monthly Temperatures and Seasonal Ammonia Limits.
5-50
Low temperatures during the transition from winter to summer ammonia limits will be a
significant limitation for mainstream deammonification.
Other process limitations on site include: uneven flow splits between North and South
Batteries during high flows (the plant was originally a two-sludge system and so there is a 5-ft.
difference in elevation between the batteries); poor solids capture efficiency in some tertiary
filters if overloaded.
in Table 5-24. Minimum monthly and peak daily values are also shown.
Table 5-24. Wastewater Composition (2008 Data).

Plant Influent
Flow, ML/d (mgd) 115 (30.4) 139 (36.7) 97 (25.5) 400 (105.7)
BOD, mg/L 167 188 166 772
COD1, mg/L 381 442 365 1700
TN, mg/L 27.9 26.3 29.1 70.3
COD/TN 13.7 16.8 12.6 24.2
TSS, mg/L 207 247 183 2146
Temperature, °C 17 21 133
Alkalinity
NO2-N & NO3-N, 2.7 3.0 2.0 3.0
mg/L
Primary Effluent2
BOD 102 117
COD 226 284
TN 22.9 22.5
COD/TN 9.9 12.6
TSS 82 88.8
Notes:
1 COD not measured. Derived from influent characterization.
2 Based on process modeling
3 Minimum temperatures occur in March/April which coincides with tighter ammonia limits.

elements for mainstream deammonification for the Egan WRP.

Sidestream Liquors Available The digester processes sludge from both Egan and Kirie and therefore
significant sidestream liquors are available. The liquors currently go to the
O’Brien WRP, but will be split between Kirie and Egan before sidestream
treatment is available starting the end of this year. Sidestream treatment
using the Anitamox process is proposed for Egan, to remove the nitrogen load
and provide potential seeding material for mainstream deammonification.
Chemical Addition The plant does not currently add carbon or alkalinity
Energy The average cost of electricity is $0.075 per kWh. Reduction of energy costs is
the major driver for considering mainstream deammonification at Egan.
Effluent Limits Currently no TN limit. Low effluent ammonia limit would tend to suggest a
polishing step should be included.
Plant temperature Winter low temperatures (13°C) coincide with the commencement of tighter
summer ammonia effluent limits. Somewhat low temperatures make attached
growth a good consideration.
C/N The C/N ratio is 10-12 which is a medium level and the plant does not have a
total nitrogen or nitrate limit. The C/N is sufficient for full nitrification/
denitrification or nitrite shunt.
Bio-P Bio-P will be needed at Egan in the near future.
Influent flow peaks Peak flows are capped at just over 225 ML/d (60 mgd )
5-52
The Egan WRP primary effluent has a C/N ratio of 10, the plant has no TN limit, but a
relatively low effluent ammonia limit. Design guidance suggests that a nitrite shunt using ABAC
be considered to reduce energy costs while ensuring effluent ammonia limits are achieved. There
is also a desire to implement Bio-P, and so the control strategy should be tested in conjunction
with Bio-P. Currently, mainstream deammonification would not be recommended for the Egan
WRP. If TN limits are added in the future or the marginal improvement in energy savings are
deemed to be worthwhile, then mainstream deammonification could be considered. Two options
are therefore proposed for Egan.
5.5.5.5.1 Option 1: Ammonia-Based Control Only
For this option, the following is recommended for Egan:
 Nitrite shunt using ABAC.
 Bioaugmentation is not required.
 Polishing is not required.
 Anaerobic zone added for Bio-P.
Figure 5-30 is a schematic of the proposed system, including a new anaerobic zone for
bio-P. The equipment requirements for this option are considered in Table 5-26.
oni Pro e
Pri r
en
oni -B e er ion
on ro
R To ri ier

Function Equipment
Anammox Retention None required

Rapid Aeration Changes Accurate valves & Meters required in aeration zones
Diffusers are ceramic fine-bubble and therefore need to be operated
continuously (i.e., low airflow OK, but not zero airflow).
Control Ammonia-based Control
Online phosphorus monitoring
Reactor Configuration Anaerobic zone created by removing aerators and installing mixers.
Baffling potentially required to prevent back-mixing from aeration zone.

5.5.5.5.2 Option 2: Mainstream Deammonification Using IFAS
This option can be considered if future TN limits are a concern or the marginal
improvements to energy efficiency are deemed worthwhile. This option consists of the following:
 Nitrite shunt using ammonia versus nitrite aeration control (AVN).
 Bioaugmentation is not required, but media from the sidestream AnitaMox plant could be
used for start-up. Also, media could be moved between sidestream and mainstream during
the winter time to keep the media viability higher and to augment performance during tighter
ammonia limit periods at the end of the winter.
 Polishing through re-aeration is required.
 Anaerobic zone added for Bio-P.
Figure 5-31 is a schematic of the proposed system, including a new anaerobic zone for
bio-P and IFAS zone(s). The equipment requirements for this option are listed in Table 5-27.

Function Equipment
Anammox Retention IFAS Media in an unaerated portion of the last pass.
Rapid Aeration Changes Accurate valves & Meters required in aeration zones
Blower operating ranges must be checked to ensure they
can meet the required airflow ranges, especially in having
sufficient turn-down for very low airflow requirements.
Diffusers are ceramic fine-bubble and therefore need to be
operated continuously (i.e., low airflow OK, but not zero
airflow).
Control Ammonia versus nitrite-based Control, using ammonia
and nitrite analyzers
Online phosphorus monitoring
Reactor Configuration Retention sieves used to keep IFAS media in the last pass
zone. Aerators removed and mixers installed in this zone.
Upstream baffle may be required. Multiple IFAS zones
may be required to prevent excessive media migration.
Anaerobic zone created by removing aerators and
installing mixers. Baffling potentially required to prevent
back-mixing from aeration zone.
5-54
Rough sizing of an anaerobic zone and position of ammonia probe for Option 1 are
shown on the aerial plot (Figure 5-32). The ammonia probe is positioned at the end of the third
pass to ensure effluent limits are met. The size of the zone should be checked and the positioning
of the ammonia probes should be confirmed during testing.
Sizing of an anaerobic zone and unaerated IFAS zone(s) for Option 2 are shown on the
second aerial plot (Figure 5-33). An ammonia probe and nitrite probe are positioned at the end of
the main aeration zone for the AVN control. A second ammonia probe is positioned at the end of
the third pass to ensure effluent limits are met. Sizing of the anaerobic zones and the sizing and
need for sub-partitioning of the IFAS zones to be checked during detailed design.
Ammonia
Probe
Anaerobic Zone
Anaerobic Zone
Ammonia
Probe
Figure 5-32. Aerial Photo for Option 1 (North Battery Detail).
Ammonia
Probe Ammonia &
Unaerated IFAS Zone(s) Nitrite Probes
Anaerobic Zone
Anaerobic Zone
Ammonia
Unaerated IFAS Zone(s) Ammonia &
Nitrite Probes
Probe
Figure 5-33. Aerial Photo for Option 2 (North Battery Detail).

shows a potential 22% reduction in electricity use moving from nitrification/denitrification to
nitrite shunt and an overall reduction of 33% in moving to deammonification (i.e., an additional
10%). The Egan plant does not add carbon, nor does it add alkalinity and therefore there are no
cost benefits from those perspectives.
investment. In order to move to full deammonification would require some additional capital cost
which may not be justified by the marginal additional savings.
5-56
5.5.5.8 Next Steps
Implementation of an ammonia-based control system, for Option 1, is relatively low risk
and can be tested before fully implementing using the following steps:
 Install and test an ABAC system on one train.
 Test the ABAC system in conjunction with Bio-P.
 Implement Bio-P and ABAC on the full plant.
 Pilot testing of an AVN control system to produce an effluent with equalimolar nitrite and
ammonia.
 Pilot testing of an unaerated IFAS zone in concert with AVN control.
 Pilot testing of bio-P in conjunction with AVN and IFAS.
 Carry out process modeling and an economic analysis of the AVN and IFAS system
compared to ABAC for Egan WRP.
 Investigate opportunities to implement mainstream deammonification at other District
facilities, including incorporation of Bio-P.
carried out by HRSD. It is recommended that the District work closely with HRSD to share
knowledge on how to set up the pilot and in interpreting the results.

5.5.6 McDowell Creek WWTP
needed before the modifications could be implemented.
The McDowell Creek Waste Water Treatment Plant (WWTP) is owned and operated by
Charlotte-Mecklenburg Utilities (CMU) and serves the northwest area of Mecklenburg County.
Initially constructed in the early 1980s, the plant was expanded and upgraded several times over
the years. In 1999, the plant was upgraded for nutrient removal to reduce nitrogen and
phosphorus loads to Mountain Island Lake, one of the City of Charlotte’s drinking water
supplies. In response to continued growth and development in the service area, the McDowell
plant was further upgraded and expanded to 12 mgd. The new facilities were commissioned in
2007 and 2008.
The McDowell treatment facilities currently include influent pumping, screening and grit
removal, primary clarification, activated sludge process designed for biological nutrient removal,
secondary clarifiers, deep-bed filters, ultraviolet disinfection, and cascade post-aeration. Waste
activated sludge is sent to an aerated holding basin and is thickened using gravity belt thickeners.
Primary sludge and thickened WAS are pumped to mesophilic anaerobic digesters for
stabilization. Digested solids are dewatered using belt filter presses (BFPs).
The BFPs are typically operated during the week on day shift. The filtrate is high in
ammonia and phosphorus and is equalized in a separate tank prior to blending it with the plant
influent for treatment in the liquid stream processes. The plant has a “day tank” for equalization
of diurnal flow variations as well as a large storm flow equalization basin for use during peak
wet weather events. Finally, a 3-mgd microfiltration membrane facility can be operated to
provide high quality water for reuse as well as discharge to Mountain Island Lake.
The McDowell Creek WWTP is rated for a design average flow of 10 mgd, with a
monthly average capacity of 12 mgd. The design maximum flow to the main plant is 20 mgd,
with the remainder being captured in the flow equalization facilities. Figure 5-35 shows the
schematic of the facility.
Storm Flow Day
Equalization Tank
Pumps, Screens Primary BNR Basins 1 & 2 Final

Influent Clarifiers Filters UV
& Grit Removal (UCT) Clarifiers
Cascade
Aeration
BNR Basins 3 & 4 Final

Filters UV
(5-stage BNR) Clarifiers
Filtrate
EQ Basin
Cake for Anaerobic Gravity Aerated

BFP WAS
Digesters Belt
Disposal Dewatering Thickeners Holding
Figure 5-35. Process Schematic for McDowell Creek WWTP.
5-58
McDowell has two BNR trains that made use of existing tanks during the original
upgrade in 1999 [Biological Treatment Basins (BTB) 1 and 2] and two newly constructed BNR
trains that were implemented as part of the 2007 upgrade (BTB-3 and 4). BTB-1 and 2 each
consist of a series of separate basins. These include an anaerobic basin consisting of four cells,
existing rectangular aeration basins retrofit to include anoxic and aerated zones, and the original
shallow clarifier basins were modified with diffusers to provide additional aeration zone volume.
Mixed liquor effluent from BTB-1 and 2 is directed to two final clarifiers prior to filtration.
Figure 5-36 shows an aerial photo of the McDowell Creek WWTP.
Figure 5-36. Plant Overview Photo of McDowell Creek WWTP.

During the expansion to 12 mgd, new BTB-3 and 4 were constructed. These BTBs were
designed to accommodate several operating modes, including the ability to operate in the
University of Cape Town (UCT) mode similar to the existing BTB-1 and 2. BTB-3 and 4 also
have cells which can be operated as post-anoxic zones for additional denitrification as well as a
re-aeration zone prior to sending mixed liquor to the clarifiers. Since plant flows are lower than
6 mgd, the plant staff generally operate BTB-3 and 4 while BTB-1 and 2 are on standby. Figure
5-37 shows an aerial photo detail of the biological treatment basins.
Figure 5-37. Aerial Photo of McDowell BNR Basins and Secondary Clarifiers.
5-60
Table 5-28 contains the current NPDES permit limits for the McDowell Creek WWTP.
Table 5-28. Current NPDES Permit Limits for McDowell Creek WWTP.
Seasonal Average Mass

Parameter Month Average Loading Rate Daily Max
Flow, MLD (mgd) 45.5 (12)

cBOD5, mg/L 4.2 (Apr-Oct)
8.3 (Nov - Mar)
TSS, mg/L 9
NH4-N, mg/L 1 (Apr-Oct)
2 (Nov-Mar)
TN, mg/L 4.5 (Apr – Oct) 450 (Apr – Oct)
5 (Nov – Mar) 500 (Nov – Mar)
TP, mg/L 0.27 (Apr – Oct) 27 (Apr – Oct)
0.32 (Nov – Mar) 32 (Nov – Mar)
Dissolved Oxygen, mg/L – >6
Fecal Coliform, MPN/100 mL 100

McDowell Creek WWTP has been operated for nitrogen and phosphorus removal for
about 15 years. When the plant was expanded to 12 mgd, seasonal mass loading limits were
developed to protect Mountain Island Lake, and these limits correspond to fairly stringent
concentrations at the 12 mgd flow. The plant has consistently met and exceeded its performance
requirements.
Generally, nitrification has never been a problem, even with the relatively stringent
ammonia limit of 1 mg/L. Denitrification also has been reliable, although there have been
fluctuations in ammonia and nitrate concentrations within the BNR basins depending on the
quantity of dewatering filtrate being bled back to the mainstream process. The higher nitrate
concentrations that result from periods of higher ammonia loads to the plant can adversely
impact the biological phosphorus removal process.
Phosphorus removal performance has always been excellent but has been sensitive to a
number of factors including variations in load due to dewatering filtrate return, lack of VFA in
the plant influent wastewater, relatively low alkalinity concentrations, and presence of glycogen
accumulating organisms in the activated sludge process. Charlotte-Mecklenburg Utilities has
access to low-cost waste sugar water which is used to supplement the biodegradable carbon and
VFA content of the primary effluent. In addition, acetic acid can be added if needed. Lime is
added to the primary effluent to supplement alkalinity. Dewatering filtrate is equalized in a
separate tank, and alum is added to the drains under the BFPs to minimize nuisance struvite
formation as well as control the phosphorus load that is returned back to the plant.
Although the winter temperatures are not as extreme as in some colder climates, the
winter wastewater temperature of approximately 14oC will likely present limitations for
mainstream deammonification. Other challenges include maintaining biological phosphorus

removal performance and reliably achieving low effluent ammonia concentrations if operating
for nitrite shunt or mainstream deammonification.
in Table 5-29. Peak daily flow is also provided.
Table 5-29. Wastewater Composition (Plant Design Data).
Maximum
Parameter Annual Average Monthly Peak Daily
Plant Influent
Current Flow,
ML/d (mgd) 18.9 (5) 22.7 (6) 37.8 (10)
Design Flow, ML/d
(mgd) 37.8 (10) 45.4 (12) 75.6 (20)
BOD, mg/L 255 255
1
COD , mg/L 650 650
TN, mg/L 38 38
COD/TN 17.1 17.1
TSS, mg/L 345 403
Temperature, °C 19 26 max, 14 min
Alkalinity
2
Primary Effluent
BOD 181 176
COD 336 349
TN 35 36
COD/TN 9.6 9.7
TSS 123 166
Notes:
1 COD measured only occasionally. Derived from influent characterization.
2 Based on process modeling.
5-62
design elements for mainstream deammonification for the McDowell Creek WWTP.
Sidestream Liquors Available Belt filter presses are used for dewatering the anaerobically digested sludge and
filtrate is high in ammonia and phosphorus. The filtrate is currently equalized in a
dedicated filtrate equalization basin. This basin could easily be retrofit for operation of
a sidestream deammonification process.
Chemical Addition The plant currently adds carbon for VFA supplementation for biological phosphorus
removal. Lime is added to the primary effluent for alkalinity supplementation. Alum is
added to the belt filter press drains for struvite control and can also be added if
needed for polishing of effluent when P concentrations are high. Reducing future
carbon needs (for additional denitrification to low limits) and better management of
the nitrogen and carbon balance for additional reliability in the bioP process would be
drivers for considering mainstream deammonification at McDowell.
Energy The average cost of electricity is about $0.06 per kWh. Reduction of energy costs is
another driver for considering mainstream deammonification at McDowell.
Effluent Limits McDowell currently has a moderate TN limit. As flows increase, the required
concentration to meet the seasonal mass loading limitation becomes more stringent.
The low effluent ammonia limit suggests that a polishing step should be included
(additional aeration at the end of biological treatment for nitrification of residual
ammonia that will remain if the main aeration zone is operated with ammonia-based
aeration control).
Plant temperature Winter low temperatures (14°C) may make mainstream deammonification
challenging.
adequate carbon for full nitrification/partial denitrification or nitrite shunt. However it is
noted that operation for biological phosphorus removal also consumes a portion of
the available carbon.
Bio-P McDowell currently operates for biological phosphorus removal and plans to continue
to do so in the future. The overall carbon balance for the BNR process is affected by
bioP, however, a waste sugar water source is used to supplement carbon.
Influent flow peaks Peak flows are capped at about twice the average flow. Peak flows above this level
are equalized in the day tank and storm flow equalization facilities.
The McDowell primary effluent has a C/N ratio of about 10. The plant has a TN limit,
low effluent ammonia limit and operates for biological phosphorus removal. Since the plant has
a filtrate equalization basin that could be upgraded for sidestream deammonification fairly easily,
this is the most promising first step on the pathway to mainstream deammonification. The
dewatering filtrate return flow contains about 25% of the ammonia load to the plant, and
removing this ammonia using a sidestream deammonification process would save energy
(compared to fully nitrifying this ammonia in the BNR basins), would reduce alkalinity
supplementation needs in the main plant, and would result in lower final effluent TN

concentrations because this portion of the ammonia would be removed without the need for
carbon supplementation.
As a second step, design guidance developed from the research completed under this
project would suggest that nitrite shunt using ABAC be considered to reduce energy costs while
ensuring effluent ammonia limits are achieved. Since McDowell operates for biological
phosphorus removal, this control strategy should be tested in conjunction with Bio-P to assess
whether any deterioration in phosphorus removal performance would occur.
Currently, mainstream deammonification would not be recommended for the McDowell
Creek WWTP. However, if TN limits become even more stringent in the future, or if energy
costs rise significantly – making the incremental improvement in energy savings worthwhile,
then mainstream deammonification could be considered. Three options are therefore proposed
for McDowell in a progressive sequence.
5.5.6.5.1 Option 1: Implement Sidestream Deammonification Process
For this option, the following would be considered:
 Retrofit the existing filtrate equalization basin for operation in SBR mode to achieve
deammonification. A small equalization well for filtrate may be needed to accommodate
batch operation of the SBR. Considering the overall plant layout and the ease of
bioaugmenting waste solids from the sidestream to the mainstream process in the future, a
suspended growth sidestream deammonification process is recommended.
 Continue to operate the mainstream process in the same manner as is currently the practice.
 The results will include significant reduction of the ammonia in the filtrate return to the plant.
This in turn will reduce the impact of the ammonia load on bioP performance, reduce the
lime consumption for alkalinity supplementation, reduce aeration energy consumption, and
will reduce the final effluent TN concentration.
The equipment requirements for this option are considered in Table 5-31.
Function Equipment
Anammox Retention Cyclones or screens are needed to separate the anammox from the
SBR waste solids so that they can be returned to the process.
Process Equipment Filtrate equalization basin would be equipped with blowers, fine bubble
membrane diffusers, and SBR decanter. Existing mixers would be
reused. New waste sludge pump would be needed.
Aeration Control Aeration control for sidestream process based on pH and dissolved
oxygen.
Reactor Configuration Single tank SBR for sidestream deammonification process. Mainstream
configuration and operation of BNR process would not change.
5-64
5.5.6.5.2 Option 2: Ammonia-Based Control (With or Without Bioaugmentation)
For this option, the following would be considered:
 Operate for nitrite shunt (nitritation and denitritation rather than full nitrification and
denitrification) using ABAC.
 Bioaugmentation is not required. However, if Option 1 is implemented first, it is
recommended that the waste solids from the sidestream process be sent directly to the
mainstream BNR basins. This will bring a continuous supply of ammonia oxidizing bacteria
to the BNR basins with very few nitrite oxidizing bacteria and this imbalance will assist with
promoting nitrite shunt.
 While operating using ABAC, the aerated zone effluent target ammonia concentration is
typically about 2 mg/L. Therefore, “polishing” to nitrify residual ammonia is likely needed to
ensure the stringent ammonia limit is met. This can be done with a re-aeration zone at the end
of the activated sludge process. At the McDowell plant, this capability exists within the
existing basin layouts. BTB-1 and 2 each have an additional aerated zone downstream from
the main aeration zone. BTB-3 and 4 also have re-aeration cells just upstream from the
clarifier splitter box.

Schematics of the two sets of biological treatment basins are shown in Figures Figure 5-
38 and 5-39. The equipment requirements for this option are considered in Table 5-32.
Ammonia Probe Re-aeration
for ABAC Polishing Zone
Anaerobic To
Zones Anoxic Zones Filters
Optional
VFA Feed Aerobic Final
Aerobic Clarifier
1 2 Zone
Zone
Primary
Effluent
Nitrified Optional
Primary Denitrified Recycle Alum Feed
Clarifiers Recycle
RAS WAS
Optional
Alum Feed
Plant Influent
Figure 5-38. Option 2 Proposed Flow Schematic for BTB-1 and 2.
Primary Air Supply

Clarifier ~
Acetic Acid or Ammonia Probe
No. 4
Sugar Water for ABAC
~ Re-aeration
Anoxic
Effluent Recyle
Polishing Zone
From BTB
Zone 1 Zone 6 No. 4
Lime Rate Control Zone 9 Zone 12 To
ANA ANX
Structure OX P-ANX
Zone 13
P-ANX
FC No. 4
Zone 2 Zone 5 Zone 10

ANA Zone 7
ANX P-ANX
OX
Zone 11 To
No.17
Zone 14
DB
REA
P-ANX Future
Zone 3 Zone 4 Zone 8
FC
ANX ANX OX No. 5
Legend
Sluice Gate - Open Oxic

Sluice Gate - Close Recycle
To / From DB No. 9
Slide Gate - Open
Rate Control Structure
Slide Gate - Close
RAS
…… Optional or Off-Line To BTB ~
No. 4 Air Supply
DB – Distribution Box
BTB – Biological Treatment Train
RAS
Final
Effluent Clarifier
FC- Final Clarifier
No. 3
White zones are off-line zones
FC No. 4 Sludge
Pumping Station
No. 2
Future FC No. 5 Sludge
WAS
Figure 5-39. Option 2 Proposed Flow Schematic for BTB-3 and 4.
5-66
Function Equipment
Anammox retention None required
Bioaugmentation Piping would be installed to convey waste solids from the sidestream
deammonification process described in Option 1 to the BNR basins. The
waste solids could be directed to the primary effluent junction box (prior
to splitting flow to BNR treatment) or to the final clarifier influent splitter
box.
Rapid aeration changes Accurate valves and meters required in aeration zones. Existing aeration
control system would need to be assessed as to how best to implement
ammonia-based control strategy.
required airflow ranges, especially in having sufficient turn-down for very
low airflow requirements.
Diffusers are fine bubble membranes, and could be operated
intermittently, however some settling of mixed liquor solids may occur.
Control A new, dedicated ammonia analyzer should be considered for each
basin for ammonia-based aeration control. The existing online nutrient
analyzer could continue to be used for monitoring of performance at
multiple locations (NH4-N, NO3-N, NO2-N, OP).
Reactor Configuration No changes to existing BTB configuration needed.
5.5.6.5.3 Option 3: Mainstream Deammonification Using Suspended Growth Process

This option can be considered if future TN limits become more stringent, or if power
costs rise making the improvements to energy efficiency worthwhile. This option consists of the
following:
 Operate for nitrite shunt (promote nitritation rather than full nitrification) but use ammonia
versus nitrite aeration control (or another scheme for nitrite oxidizing bacteria outselection)
to promote close to equal concentrations of ammonia and nitrite for deammonification.
Deammonification would take place in the post-anoxic zones.
 Bioaugmentation is needed for this option. If the new pipeline was not installed under Option
2, it should be added at this time to allow seeding of the mainstream process with AOB and
anammox from the sidestream process.
 Similar to Option 2, “polishing” to nitrify residual ammonia is likely needed to ensure the
stringent ammonia limit is met.

Figure 5-40 is a schematic of the proposed system. This system can fit well within the
existing BTB-3 and 4 basins. However either additional volume or retrofit work would be
needed to include post anoxic volume as part of BTB-1 and 2. The equipment requirements for
this option are listed in Table 5-33.
Ammonia Probe Ammonia Probe

Nitrite Probe
Primary
Effluent
Re-aeration
Unaerated
RAS Anaerobic Ammonia Versus Mixed Zone
and anoxic Nitrite Aeration for To
Bioaugment Control Deammonification
Clarifiers

Function Equipment
Anammox retention Cyclones or screening of waste activated sludge.
Rapid aeration changes Accurate valves & meters required in aeration zones. Existing aeration
control system would need to be assessed as to how best to implement
ammonia-based control strategy.
Diffusers are fine bubble membranes, and could be operated
intermittently, however some settling of mixed liquor solids may occur.
Control New, dedicated ammonia and nitrite analyzers should be considered
for each basin for ammonia-based aeration control. The existing online
nutrient analyzer could continue to be used for monitoring of
performance at multiple locations (NH4-N, NO3-N, NO2-N, OP).
Reactor Configuration Generally, the existing reactor configuration would remain the same.
The existing post anoxic zones available in BTB-3 and 4 would be used
for deammonification downstream of the main aeration zone (operating
with AVN control). Modifications would be needed in BTB-1 and 2 to
provide post-anoxic volume.

Under Option 1 the existing filtrate equalization basin would be upgraded for operation as a
sidestream deammonification SBR. This basin is shown in (Figure 5-41). Dissolved oxygen and
pH probes would be installed on a float system at the side of the SBR. Sidestream
deammonification is well proven and implementation of this option could be considered without
pilot testing. The existing filtrate basin volume is about 0.75 million gallons (2,800 m3). The
ammonia load in the filtrate is estimated at 1000 lbs/d (455 kg/d) for the 12 mgd plant capacity and
is about 400 to 500 lbs/d at the current plant flows. This corresponds to nitrogen loading rates of
0.16 kg/m3 which is at the low end of the operating range for sidestream deammonification SBRs.
5-68
A small equalization well for filtrate may be needed to accommodate batch operation of the SBR.
It may be possible to segregate a portion of the existing volume for this purpose.
Figure 5-41. Photograph of Filtrate Equalization Basin for Option 1.

Minor aeration basin modifications for Option 2 are
shown in Figures 5-42 and 5-43. An ammonia probe would be
positioned at the end of the main aeration zone for the ABAC
control. The existing online nutrient analyzer would continue to
be used for process performance monitoring.
Figure 5-42. Aerial Photo for Option 2

(BTB-1 and 2 Detail).
Figure 5-43. Aerial and Site Overview Photos for Option 2 (BTB-3 and 4 Detail).

shows a potential 14% reduction in electricity use moving from nitrification/denitrification to
nitrite shunt and an overall reduction of 25% in moving to deammonification (i.e., an additional
11%). The McDowell plant adds carbon as a substrate for biological phosphorus removal, and
also adds alkalinity. There may not be an immediate reduction in carbon requirements but
alkalinity savings would be realized during the transition to deammonification.
$350,000
$300,000
Annual Operating Cost Estimate
$250,000
$200,000
$150,000
$100,000
$50,000
$-
Electricity $119,000 $103,000 $89,000
Carbon $- $- $-
Alkalinity $192,000 $192,000 $-
Figure 5-44. Comparison of Potential Operating Costs of Nit/Denit versus

Nitrite Shunt versus Deammonification.
5.5.6.8 Next Steps
Implementation of sidestream deammonification, for Option 1, is relatively low risk and
could be implemented using the following steps.
 Complete detailed evaluation of operation improvements and cost savings against
implementation costs.
 Conduct pilot or bench testing at McDowell as needed to supplement findings from other
plants.
 Implement sidestream deammonification on the full plant.
Implementation of an ammonia-based control system, for Option 2, is also relatively low
risk and can be tested before fully implementing using the following steps:
 Install and test an ABAC system on one BNR train.
 Evaluate the impacts of ABAC on biological phosphorus removal and ability to meet
stringent ammonia limits.
5-70
 Install pipeline to convey waste solids from the sidestream process for bioaugmentation of
the mainstream basins (the additional AOBs will help promote nitrite shunt).
 Implement ABAC on BTB-3 and 4.
 Implement ABAC on BTB-1 and 2 as flows increase.
 Pilot testing of an AVN control system (or another scheme for nitrite oxidizing bacteria out-
selection) to produce an effluent with equalimolar nitrite and ammonia content. This could be
done initially on one treatment train. Consider initial testing of AVN followed by full
aeration polishing to reduce ammonia concentrations before discharge. The BTB not being
tested could be temporarily operated with supplemental carbon dosing to the post anoxic
zone to ensure the net TN limit is met with the blended effluent.
 With bioaugmentation in place, pilot test operation of post anoxic zone for deammonification
in concert with AVN control.
 Evaluate impacts on biological phosphorus removal.
 Carry out process modeling and an economic analysis of the AVN system with
bioaugmentation compared to continued operation with the current configuration.
 Investigate opportunities to implement mainstream deammonification at other CMU
facilities.
carried out by DC Water and at the Strass, Austria and Glarnerland, Switzerland facilities. It is
recommended that the Charlotte-Mecklenburg Utilities works closely with these utilities to share
knowledge and interpretation of the results.

5.5.7 Sacramento Regional WTP
The Sacramento Regional County Sanitation District (SRCSD) owns and operates the
Sacramento Regional Wastewater Treatment Plant (SRWTP) with a 181 mgd average dry
weather flow (ADWF) design flow located in Elk Grove, CA. On December 9, 2010, the
Regional Water Quality Control Board (RWQCB) adopted a new permit that takes effect in
December 2020. In addition to enhanced removal of suspended solids and organics to monthly
average limits of 10 mg/L BOD and 10 mg/L TSS, SRWTP is now required to remove nitrogen,
reduce ammonia to very low concentrations and meet Title 22 equivalency. Title 22 refers to the
State of California standards developed by the California Department of Public Health (CDPH)
for reclaimed waters and requires filtration (with upstream coagulation/flocculation) and
disinfection. The final effluent limitations for BOD5 and TSS, turbidity and total coliforms
become effective May 9, 2023, and final effluent limitations for Total Ammonia Nitrogen
become effective May, 11 2021.
A summary of the effluent limits in the adopted permit:
 Effluent TSS and BOD (10 mg/L monthly average, 20 mg/L daily max).
 Effluent Ammonia-N (Monthly average: Apr-Oct 1.5 mg/L, Nov-Mar 2.4 mg/L, Daily max
Apr-Oct 2.0, Nov - Mar 3.3 mg/L).
 Nitrate-N (10 mg/L monthly average).
 Turbidity (<2 NTU daily average).
 Total Coliform (2.2 MPN/100 mL, 7-day rolling median).
 Total Residual Chlorine (0.019 mg/L, 1-hour average).
 The permit also specifies Title 22 for reclaimed water treatment standards, or equal..
The adopted permit will require extensive infrastructure additions and an aggressive
schedule for the SRWTP to meet compliance requirements. Prior to designing and implementing
the infrastructure additions, a pilot study was recommended as a means to develop design criteria
for meeting the adopted permit requirements. The pilot study confirmed the ability of the piloted
treatment technologies to remove nitrogen and demonstrate Title 22 equivalency. In particular,
the adopted maximum daily ammonia limit (2.2 mg N/L) was anticipated to be difficult to
achieve. The pilot study was recommended as a confirmation tool. Pilot testing also offered
opportunities for SRWTP to demonstrate the ability to meet equivalent Title 22 treatment
performance requirements with site specific design criteria.
5-72
Figure 5-45 shows the simplified process schematic for the proposed SRWTP upgrade.
Raw influent wastewater flows through screening and is then pumped to aerated grit removal
facilities, and primary clarifiers. Peak flows in excess of 330 mgd are diverted to storage basins
after primary clarification and returned to the plant when the flow subsides. Primary effluent is
pumped to the new BNR process. The BNR process in designed for nitrogen and phosphorus
removal. Even though phosphorus removal is not required by permit, the District established an
annual phosphorus target to match the performance of the current high purity oxygen plant.
Filtration and disinfection using granular media filtration and chlorine disinfection are provided
to meet Title 22 equivalent treatment.
Storm Storage
RAS Chlorine Sulfur dioxide
Primary/ BNR
Screening & Clarifiers Secondary Disinfec-
Influent Nitrification/ Filtration
Grit Removal Clarifiers tion To American River
Denitrificaiton
WAS
Thickeners
Anaerobic Sludge Storage

Digesters Basins
Dredge to Land Application
Biosolids
Reuse Beneficial Use
Facility
Sidestream
Nitrification
Facility Flushing/Return
Figure 5-45. Process Schematic for Sacramento Regional Wastewater Treatment Plant (SRWTP).
WAS is thickened and anaerobically digested along with primary sludge. Digested sludge
is conveyed to Sludge Storage Basins (SSB) where the solids are retained for approximately four
years before dredging and land applying the solids on site to lined dedicated land disposal units.
A portion of the digested solids (approximately 30%) is sent to the Biosolids Recycling Facility
(BRF) for dewatering and thermal drying and transported for beneficial reuse.
Under the current plan, sidestream return flows from dewatering and decant from the
SSBs will be nitrified in an SBR based Sidestream Nitrification Facility before returning to the
influent. SSB return flows include decant from added new digested sludge, centrate from the
BRF, rain water, and flushing water (approximately 3 mgd) used to maintain a freshwater cover
for odor control and dilution for struvite control. The sidestream contains high levels of ammonia
as well as elevated levels of phosphorus and turbidity. Sidestream flows can be cold since the
SSBs are exposed to the ambient air and rain. The implementation of sidestream treatment is still
under development.

Figure 5-46 shows an aerial photo of the current SRWTP using high purity oxygen
(HPO) technology to meet BOD and TSS limits. The proposed future plant layout is outlined in
Figure 5-47. The new BNR basin will be constructed to the north side of the existing HPO plant.
This basin will completely replace the HPO aeration tanks that will be repurposed. Filtration,
disinfection, and sidestream treatment facilities are not shown.
Digester
s
Grit Basins &
HPO Primary
Tanks Clarifiers
Influent/
Effluent
Building
Secondary
Clarifiers
Figure 5-46. Aerial Photo (Current Plant).
5-74
Equalization
Air Activated Sludge
Stream
Side
Secondary Clarifier
(existing)
Disinfect
0 100 200 400 600 800 Filtration
Figure 5-47. Aerial Photo (Planned for 2020).

New BNR activated sludge, granular media filtration, chlorine disinfection and potential sidestream treatment (SBR)
noted in approximate locations as planned.
The BNR is designed (Black and Veach, 2013) for both biological nitrogen and
phosphorus removal using a 5-stage Bardenpho process with mixed liquor fermentation as the
base operational mode (Figure 5-48). Several swing zones are included to optimize nitrogen
removal. Eight biological treatment trains are available. RAS from 24 common secondary
clarifiers is returned to a RAS re-aeration basin that is designed to operate as a classifying
selector for foam control. A RAS anoxic zone is included to provide the ability to reduce nitrate
and DO before returning the RAS to the aeration trains.
DeOx
(1)
Primary
Effluent MLF Anaero- Anoxic Aerobic Swing Reaerate To
(1) bic (2) (3) (4) (7) (2) Clarifiers
RAS Classi-
Anox fying RAS
(1) Selector
WAS
Figure 5-48. Biological Nutrient Removal Process Schematic.

The numbers in parenthesis indicate the number of basins in series. Note that the basins are not all the same size.

Figure 5-49 shows the layout of the eight trains. The basin contains a total of 21 separate
zones to achieve phosphorus removal, fermentation, aeration (nitrification/BOD oxidation),
denitrification, deoxygenation, and reoxygenation. Internal recycle capability is provided to
return nitrates to the anoxic zones, and solids to the mixed liquor fermentation (MLF) zone. Step
feed capability between anaerobic and anoxic zones is available.
PE
To SC
An1 Sw1 Sw2 Sw3 Sw4 Sw5 Sw6 Sw7 ReOx
Ae5
An2 Ae4 Ae3
DeOx
An3 Ax1 Ax2 Ax3 Ax4 Ae1 Ae2
RAS
PreAx2 PreAx1 WAS CS
5-49. Biological Nutrient Removal Process Layout.

This represents one of eight proposed trains. RAS is returned from all trains to a selector basin
for foam control and denitrification/deoxygenation.

Table 5-34 contains the new NPDES permit limits for SRCSD. Currently the permit
requires only secondary treatment (BOD and TSS) with disinfection. The new limits will become
effective in 2021 and later. The plant is presently under design to meet the new permit limits.
Table 5-34. New NPDES Permit Limits for SRCSD (Effective December 2020).

cBOD5 10 15 20
TSS 10 15 20
NH4-N 1.5 (Apr-Oct) 2.0 (Apr-Oct)
2.4 (Nov-Mar) 3.3 (Nov-Mar)
NO3-N 10
TP Note d.
0.011 (4day)
Chlorine Residual 0.019 (1 hour)
Total Coliforma 2.2 MPN/100 mLb
Turbiditya Reuse
pH 6-8c
Notes:
(a) Reuse equivalency required: Turbidity 2 NTU (daily average); <5 NTU (95% within 24 hours); <10 NTU anytime;
5-log virus removal for disinfection
(b) 7-day Median
(c) Instantaneous range
(d) Total phosphorus has no permit limit but a target of 2.2 mg/L annual average
Filtration and disinfection are required to meet equivalent Title 22 (reuse) criteria. These
are shown in the table.
5-76
The existing HPO plant will be taken offline when the new BNR facilities are operational
in 2021. This case study focuses on the future design condition (with BNR) to identify potential
features to include into that design to facilitate future changes to achieve mainstream
deammonification, it appropriate.
Design annual average wastewater flow and composition is shown in Table 5-35.
Table 5-35. Wastewater Composition (2013 Facilities Planning).

Plant Influent
Flow, ML/d (mgd) 685 (181)
BOD, mg/L 244
COD1, mg/L 508
TN, mg/L 37
COD/TN 13.7
TSS, mg/L 234
Temperature, °C
Alkalinity
NO2-N & NO3-N, mg/L
Primary Effluent2
BOD 165
COD 322
TN 39
COD/TN 8.3
TSS 101
Notes:
1 COD not measured. Derived from influent characterization.
2 Based on process modeling
3 Minimum temperatures occur in March/April which may coincide with tighter
ammonia limits.

elements for mainstream deammonification for SRCSD.
Table 5-36. Process Design Elements for SRCSD.
Sidestream Liquors Available Anaerobically digested primary and WAS is pumped to sludge storage basins
(SSBs). A small portion of the digested sludge is dewatered and dried for beneficial
reuse. Flushing water from the SSB contains high ammonia concentration.
Sidestream treatment is currently planned for the SSB return flow using a
conventional nitrifying SBR to generate nitrate that is directed to the headworks for
odor control. Converting the SBR to an anammox process is questionable due to
intermitted flow rates and the cold water temperatures of the SSB flushing water (as
low as 8 C). Final decision on sidestream treatment is pending.
Chemical Addition Process analysis showed that sufficient COD and alkalinity are available for stable
operation of the new BNR. However, future lower nitrogen and phosphorus limits
may require both carbon and alkalinity supplements.
Energy The average cost of electricity is $0.09 per kWh.
Effluent Limits There is no TN limit; the individual nitrate and ammonia limits result in a moderate
TIN limit around 10-13 mg/L. Nitrate limit is10 mg/L monthly. Low effluent ammonia
limit (1.8 mg/L monthly; 3.0 mg/L max day) would tend to suggest a polishing step
should be included.
Plant Temperature Winter low temperatures (16°C) may coincide with the commencement of tighter
summer ammonia effluent limits. Somewhat low temperatures make attached-growth
a consideration.
C/N The C/N ratio is around 8 which is a moderate level. The C/N is sufficient for full
nitrification/denitrification or nitrite shunt. Carbon is considered marginal for
conventional nitrification denitrification; a mixed liquor fermenter is included in the
design to generate VFAs for denitrification (or future BioP).
Implementation of chemical phosphorus removal (in primary) would reduce the
available COD in the PE and reduce the PE COD/N ratio to 6.0, i.e., in the moderate
range.
Inhibitory Compounds No known inhibitory compounds.
Phosphorus Removal Phosphorus removal is not required by permit; an effluent target phosphorus limit is
2.2 mg/L to match the current effluent TP concentration.
Influent Flow Peaks Peak flows are capped at 1,200 ML/d (330 mgd).
5-78
Two options for deammonification can be considered for SRWTP, depending if the
process is based on biological or chemical phosphorus removal.
Under the current design, biological phosphorus removal is used. The primary effluent
C/N ratio is 8 with a modest nitrate limit, but a relatively low effluent ammonia limit. Design
guidance would suggest that nitrite shunt using ABAC be considered to reduce energy costs
while ensuring effluent ammonia limits are achieved. Currently, mainstream deammonification
would not be recommended for SRCSD due to the inconsistent composition, flow, and low
temperature of the SSB return flows. However, sidestream nitrification reduces the ammonia
loading to the BNR. The ability to maintain biological phosphorus removal at the same time as
mainstream deammonification (operating under low DO conditions) is uncertain. This option
will require pilot testing to assess the process and establish design criteria.
By switching to chemical phosphorus removal, deammonification is more feasible.
Phosphorus removal can be achieved with chemical addition to the primary clarifier and effluent
filters. In addition, chemical addition to the primary clarifier influent will increase particle
capture and remove some colloidal COD at the same time. Under these conditions, the PE
COD/N ratio could be reduce to about 6.0 mg/mg – at the lower end of moderate range. Partial
phosphorus removal could also be accomplished in the nitrifying sidestream facility.
Using sequential aerated and unaerated basins with a space based design for
nitritation/deammonification as proposed by Stinson et al. (2013) appears the most attractive
option for SRWTP. This approach appears to simplify implementing mainstream
deammonification in the BNR configuration under design at SRWTP.
The following items are required to implement deammonification at SRWTP:
 Implement chemical phosphorus removal by adding chemical (alum or ferric) to meet
effluent TP targets in the sidestream or mainstream systems.
 Implement nitrite shunt as an interim step to evaluate potential aeration efficiency
improvement and lower carbon use in the existing process configuration.
 Implement ammonia versus NOx control (AVN) to create sequential nitritation and
deammonification zones
 Implement transient aeration to produce nitrite/ammonia for anammox.
 Include post aeration basin to polish residual ammonia before clarification
 Bioaugmentation may not be feasible. It could still be evaluated and implemented if
sidestream deammonification becomes feasible with the conditions at SRCSD (low
temperature, fluctuating flows and loads, high turbidity, etc.)
 Retain sidestream nitrification/denitrification process unless sidestream deammonification
becomes feasible.

Figure 5-50 is a schematic of the proposed process. The equipment requirements for this
option are considered in Table 5-37.
To SC
An1 Sw1 Sw2 Sw3 Sw4 Sw5 Sw6 Sw7 ReOx
Ae5
An2 Ae4B Ae4A Ae3
DeOx
PE
An3 Ax1 Ax2 Ax3 Ax4 Ae1 Ae2
RAS
PreAx2 PreAx1 WAS CS
Figure 5-50. Proposed Deammonification Flow Schematic for AVN.

The process requires step feed and realignment of aerobic and anoxic zones. Some equipment can be moved to new locations.
Basin designations from current BNR design is retained to show current design function of basin.
Function Equipment
Anammox retention Requires hydrocyclone, sieve, or other retention device.

Rapid aeration changes Reconfigure the aeration basin into a step feed alternating aerobic and anoxic
zone. Aerobic Zone 4 becomes anoxic and is divided into two equal sized
basins. Some equipment can be relocated with the new function of the zone.
Control Sequential aerobic/anoxic zone and step feed of reconfigured BNR basin for
DO and organic carbon control to suppress NOB growth. Step feed also adds
ammonia along for deammonification activity in the aerobic zones.
Reactor Configuration Significant rearrangement of reactor to accommodate step feed in piping and
hydraulic requirements. Only one zone (#4) will require new equipment.
Mixers and diffusers are currently planned.

The current process design is incorporating features to allow for ammonia-based blower
control. Converting the approach to favor nitrite shunt can be readily accommodated in the
process. The mainstream deammonification is expected to require similar basin volume – with
added chemical for phosphorus removal the BOD load to the basin is reduced allowing for
adequate solids retention and meeting aeration requirements.
Rough sizing of unaerated and aerated zones the basin layout is shown in Figure 5-50.
The ammonia probes are positioned in zone Ae2 to provide sufficient ammonia and at the end of
the third pass (Zone ReOx) to ensure effluent limits are met. Sizing of zone to be checked and
positioning of ammonia probes to be confirmed during pilot testing.
5-80
shows a reduction in electricity use and operational cost moving from nitrification/denitrification
to nitrite shunt.
Mainstream deammonification is less attractive due to the added cost for alum addition.
While the chemical addition is likely to increase the capacity in the available concrete and offset
some future capital requirements, those benefits have not been quantified for a complete
assessment.
investment. In order to move to full deammonification would require some additional capital cost
which may not be justified by the marginal additional savings.
The nitrite shunt may change the SVI. The capacity of the SRCSD facility is based on
settling biomass with an SVI no greater than 150 mL/g. Additional costs may be incurred for
polymer addition, RAS chlorination and other filament control techniques to ensure low SVI.
These costs have not been included in this analysis.
The operational costs shown in Figure 5-51 do not capture the carbon “credit” that comes
from implementing nitrite shunt or deammonification. With these two options, less carbon is
required for nitrogen removal, leaving a credit in carbon that can be used in other processes
(used for better or more reliable EBPR, increase energy recovery by diverting to digester gas,
etc.). The inherent value of this carbon is estimated at 30% of the energy cost.
$6,000,000
$5,000,000
$4,000,000
$3,000,000
$2,000,000
$1,000,000
$-
Electricity $3,922,863 $3,811,062 $3,039,098
Alum $- $- $2,625,536
Carbon $- $- $-
Alkalinity $694,055 $694,055 $-

5.5.7.8 Next Steps
Implementation of deammonification at SRWTP can be done in phases. The availability
of the BNR Pilot plant offers a low risk opportunity to test and evaluate nitrite shunt and
deammonification. The path towards nitrite shunt and deammonification could be as follows:
 Pilot test deammonification in the pilot plant.
 Carry out process modeling and business case evaluation of the ABAC and AVN for
SRWTP.
 Test CEPT to establish design criteria and performance criteria.
5-82
5.5.8 Howard F. Curren AWTP
The City of Tampa owns and operates the Howard F. Curren Advanced Wastewater
Treatment Plant (HFCAWTP). The HFCAWTP has a permitted treatment capacity of 96.0
million gallons per day (mgd) on an average annual daily flow (AADF) basis and it currently
treats an AADF of approximately 54 mgd. Currently, the permit for the plant issued by the
Florida Department of Environmental Protection (FDEP) requires high levels of cBOD5, TSS
and nutrient removal as well as dechlorination and post aeration. The final effluent is discharged
to Hillsborough Bay or used as reclaimed water for cooling and irrigation.
Currently, the liquid treatment train at the HFCAWTP includes screening, grit removal,
primary treatment, an A-stage for carbonaceous removal that features HPO technology, a
nitrification B-stage that utilizes conventional diffused aeration equipment, deep-bed
denitrification filters with methanol addition, disinfection via gaseous chlorination,
dechlorination by sulfur dioxide addition, and post aeration.
The residuals handling system at the plant receives sludge from the primary settling
facilities as well as excess biological solids from the carbonaceous and nitrification treatment
trains. The system includes gravity belt thickening facilities, a mixed sludge pumping station,
anaerobic digestion facilities with related gas recovery and cogeneration systems, dewatering
facilities that include belt filter presses and drying beds, and heat drying facilities. Treated
residuals from the heat drying system are hauled to a fertilizer company for further treatment and
blending. Dewatered solids that have not been through the heat drying process are disposed of by
land application. Figure 5-52 presents a simplified process schematic of the existing liquid
treatment and residuals handling facilities.
Preliminary Primary A-Stage A-Stage B-Stage B-Stage Denitrification Disinfection/

Treatment Settling Tanks HPOAS Settling Tanks Nitrification Settling Tanks Filters Reaeration
Thickening Anaerobic Dewatering

Digestion
Dewatered
Filtrate
Dewatered
Thickener Biosolids
Filtrate
Figure 5-52. Process Schematic of the Howard F. Curren Advanced Wastewater Treatment Plant.

Figure 5-53 shows an aerial photo of the HFCAWTP with a simplified description of the
liquid treatment process.
Preliminary
Dewatering
Treatment
A-Stage
HPOAS
Anaerobic
Digestion
Primary A-Stage
Treatment Settling Tanks
B-Stage Disinfection/
Nitrification Reaeration
B-Stage
Settling Tanks
Figure 5-53. Aerial Photo of the Howard F. Curren Advanced Wastewater Treatment Plant with
Simplified Process Flow Description.

Table 5-28 contains the permit limit for the HFCAWTP issued by the FDEP which
includes cBOD5, TSS, total nitrogen as well as dechlorination and post aeration. Further, the
FDEP Permit sets limits for recoverable nickel and a trihalomethane compound
(dichlorobromomethane), and it establishes requirements related to effluent toxicity.
Table 5-38. FDEP Permit Limits for Howard F. Curren AWTP.
Parameter Annual Average Monthly Average Weekly Average Single Sample

cBOD5 (mg/L) 5.0 6.25 7.50 10.00
TSS (mg/L) 5.0 6.25 7.50 10.00
Total Nitrogen (mg/L) 3.0 3.75 4.50 6.00
pH (SU) – – – 6.0 to 8.5
Nickel, total recoverable (µg/L) – – – 8.00
Dichlorobromomethane (µg/L) 35.0 – – –
5-84
The HFCAWTP consistently achieves a very high quality effluent. In 2011, the annual
average effluent concentrations are as shown below in Table 5-39.
Table 5-39. HCAWTP Average Discharge Concentrations for 2011.
cBOD5 1.5 mg/L

TSS 0.5 mg/L
Total Nitrogen 2.3 mg/L

Historical daily operational data for 2008 through 2011 for the HFCAWTP was reviewed
and the values are summarized in Table 5-40. Maximum monthly average values are based on
the 30-d rolling average, instead of the monthly average according to the calendar. Table 5-38
presents average values for primary influent, primary effluent including recycle streams and
A-stage effluent concentrations.
Parameter Annual Average Maximum Monthly

Primary Influent
Flow, mgd 54.2 69.3
BOD, mg/L 202 269
TN, mg/L 32.8 38
1
COD /TN 13.5 –
TP, mg/L 6.3 7.5
TSS, mg/L 137 197
Temperature, °C 25.3 –
4
Alkalinity , mg/L CaCO3 250 –
Primary Effluent
BOD 105 189
TN 30.0 32.5
1
COD /TN 7.7 –
TSS 120 80
TP 4.4 6.2
A-Stage Effluent
BOD, mg/L 45 60
TN, mg/L 26 33.3
TSS, mg/L 60 75.3
TP, mg/L 3.7 4.2
1
COD /TN 3.8 –
Temperature, °C 25.3 –
Alkalinity, mg/L CaCO3 160 –
NO2-N & NO3-N, mg/L 2.2 2.9
Notes:
1 COD not measured. COD/BOD5 ratio of 2.2 is assumed.

elements for mainstream deammonification at the HFCAWTP.
Sidestream Liquors Available Anaerobically digested dewatered filtrate is currently pumped to the primary
effluent junction box where it meets the primary effluent before entering the A-
stage reactors. The historical average filtrate flow is approximately expected to
be approximately 0.8 mgd at commissioning and is projected to increase up to
0.67 mgd and is projected to increase to approximately 1.2 mgd as the influent
flows and loads increase to design capacity. Sidestream treatment is planned
for the future; however, a specific technology has not been selected for the
AWTP. Because of the specific conditions in Florida, an annamox-type process
is very suitable for the HFCAWTP, which could provide benefits for the
implementation of mainstream de-ammonification thru bioaugmentation of
annamox.
Chemical Addition Methanol is used for denitrification, and alkalinity is supplied as sodium
hydroxide when alkalinity in the wastewater is not sufficient for nitrification.
Energy The A-stage HPOAS and the nitrification B-stage processes are the largest
user of energy at HFCWATP, taking up approximately 60% of the total energy
requirement.
Effluent Limits No changes in effluent requirements are anticipated at the AWTP.
Plant temperature Influent temperature is fairly constant with an annual average wastewater
temperature of 25°C and a minimum influent temperature of approximately
20°C. The maximum month influent temperature is approximately 27°C.
C/N The annual average C/N ratio in the secondary effluent entering the B-stage
process is approximately 3.8:1. However, modifications to the operation of the
A-stage are possible to modify the C/N to the B-stage.
Inhibitory compounds N/A
Phosphorus removal Phosphorus is currently not permitted at the AWTP and it is not expected in
future permits.
Influent flow peaks The peaking factor for peak day is in the order of 2.30 according to the flows
and loads report which examined data between 2008-2011. Peaking factor for
the maximum monthly average flow is 1.22.
Currently, the HFCAWTP has a relatively moderate C/N ratio entering the B-stage
nitrification process where mainstream deammonification could potentially be implemented.
Two options for the control of NOB are intermittent aeration and spatial alteration of aerobic and
anoxic conditions. The existing B-stage reactor can be converted to first achieve nitrite shunt by
controlling NOB population, after which AnAOB can be introduced from the sidestream
treatment and biomass retained using hydrocyclones to implement the mainstream
deammonification.
5-86
The first step to the implementation of mainstream deammonification at HFCAWTP will
be the implementation of sidestream treatment using an annamox-based system. Then, the
nitrification B-stage will be converted to operate under to nitrite shunt conditions. Once NOB is
controlled, retention of AnAOB is implemented with hydrocyclones to convert the reactor to the
deammonification process. The following considerations are made for the conversion:
 Implementation of sidestream treatment using the DEMON® technology.
 Nitrite shunt using ammonia-based aeration control.
 Bioaugmentation of AerAOB and AnAOB from sidestream treatment.
 Final polishing using the existing deep-bed filters to reduce the effluent ammonia, nitrite and
nitrate to a TN of less than 3mg/L.
Table 5-42 summarizes equipment requirements to achieve implementation.
Function Equipment
Sidestream Treatment Process New DEMON reactor to treat all the anaerobically digested dewatered
filtrate.
Anammox Retention Addition of hydrocyclones to the B-stage
Rapid Aeration Changes Changes to the aeration system and addition of baffles to create allow
for sequential aerobic/anoxic zones in B-stage.
Control Sequential aerobic/anoxic zone and step feed of A-stage effluent for
DO and organic carbon control to suppress NOB growth. Step feed will
also feed ammonia along the B-stage reactor.
Reactor Configuration Modification of existing B-stage reactor with additional baffles and step-
feed piping or channels. The existing fine bubble aeration grid will be
used to aerate the oxic zones, while mixers will be used to keep the
anoxic zones mixed. This may require modifications to the aeration grid
to turn off the air in the anoxic zones and the relocation or installation of
new mixers. Hydrocyclones will be installed on the WAS line for
retention of the anammox. Piping from the sidestream reactor will be
installed to direct the AOB and AnAOB seed to the B-stage influent
channel or RAS pipeline.

The proposed mainstream deammonification strategy for the HFCAWTP is outlined
below and shown schematically in Figure 5-54:
 Install and operate sidestream DEMON and waste both excess AerAOB and AnAOB from
the sidestream to bio-augment mainstream.
 Install cyclones on mainstream to retain AnAOB in mainstream and selectively waste
flocculent NOBs.
 Modify nitrification B-stage reactors to allow for sequential aerobic/anoxic zones).
 Modify the aeration / mixing mechanisms in the sequential aerobic/anoxic zones. Operation
of cyclical aeration in all zones (switching aeration on and off) using the AVN controller
developed by HRSD (Regmi et al., 2012) or any other aeration control strategy to
successfully out-select the NOBs.
 Add Step-Feed capability to introduce soluble carbon from the A-stage effluent to rapidly
deplete the DO in anoxic zones and to maintain sufficient NH3-N for AnAOB reaction.
 Install on-line ammonia and NOx analyzers at the end of B-stage.
 Provide for methanol to the deep-bed filters for either conventional OHO polishing using
methanol or polishing by Brocadia Anammoxidans or methyloversatilis using methanol.
Preliminary Primary A-Stage A-Stage B-Stage B-Stage Denitrification Disinfection/

Treatment Settling Tanks HPOAS Settling Tanks Nitrification Settling Tanks Filters Reaeration
Annamox
Seeding
Thickening Anaerobic Dewatering

Digestion
Dewatered
Thickener
Biosolids
Filtrate
Figure 5-54. Process Schematic of Upgrade.
5-88
A high-level assessment of the potential costs and benefits of nitrite shunt plus sidestream
treatment and mainstream deammonification was carried out and the results are presented in
Figure 5-55. It should be noted the energy costs presented in this analysis are those associated
with aeration to the nitrification B-stage only.
In the case of the HFCAWTP, mainstream deammonification is an attractive alternative
due to the potential savings associated with external carbon and alkalinity addition and energy
savings. Most of the energy savings will be associated with the conversion of the plant to nitrite-
shunt with an extra added benefit for deammonification. In addition, nitrite-shunt would offer
significant benefits associated to the addition of external carbon. It might be possible to
completely eliminate the addition of methanol with deammonification; however, because of
effluent polishing, the researchers have carried out a 90% methanol saving between the current
configuration and the deammonification alternative.
$9,000,000
$8,000,000
$7,000,000
$6,000,000
$5,000,000
$4,000,000
$3,000,000
$2,000,000
$1,000,000
$-
Electricity $3,290,320 $2,876,891 $2,294,152
Carbon $3,285,000 $1,478,250 $328,500
Alkalinity $1,110,488 $777,341 $111,049
5.5.8.8 Next Steps

Implementation of deammonification at HFCAWTP can be completed in phases.
However, field testing should be conducted to minimize the risks associated with the
implementation of deammonification. The path towards nitrite shunt and deammonification
could be as follows:
 Implementation of DEMON for sidestream treatment.
 Carry out process modeling and business case evaluation of the ABAC and AVN for
HFCAWTP.
 Investigate process limitations for nitrite shunt and deammonification associated with
meeting a very low effluent TN concentration.

5.5.9 Danbury WPCP
The City of Danbury owns a water pollution control plant (WPCP) that treats wastewater
from Danbury and Bethel, as well as from portions of Brookfield, Ridgefield and Newtown.
Treated effluent is discharged to Limekiln Brook, which is tributary to the Still River. The Still
River flows into Lake Lillinonah, a narrow impoundment on the Housatonic River. The
Housatonic River discharges to Long Island Sound. The plant was originally designed as primary
clarifiers followed by rock media trickling filters. The last major upgrade to the treatment plant
was done in 1993. At that time, activated sludge nitrification tanks were added to remove
ammonia from the plant effluent. Also, the facilities were upgraded to accommodate annual
average flows of up to 15.5 mgd, based on projected future growth in the service area. Due to
moderated growth, decreased industrial discharges and general water conservation trends, current
annual average flows have been much lower than what was forecast, and recently have been
approximately 9 mgd.
In 2002, due to concerns about hypoxia (low dissolved oxygen) in Long Island Sound,
the Connecticut Department of Energy and Environmental Protection (DEEP) issued the General
Permit for Nitrogen Discharges, which posted limits on effluent nitrogen for treatment plants
upstream of Long Island Sound. A nitrogen credits trading program was set up whereby
communities discharging above their nitrogen allocation were required to purchase nitrogen
credits. The General Permit requires Danbury to meet a plant discharge effluent limit of 442 ppd
nitrogen by 2014. In order to meet nitrogen discharge limits and reduce expenditures for
purchasing credits, Danbury implemented an interim plant upgrade in 2008, for nitrogen
removal. That upgrade included modifying the nitrification basins to achieve nitrogen removal
(denitrification) including the addition of methanol. The interim upgrade was designed for an
annual average flow of up to 11 mgd. On June 27, 2008, Connecticut DEEP issued a Consent
Order to Danbury, requiring the City to reduce total phosphorus from the treatment plant to
0.2 mg/L during the summer months. This is achieved using ferric chloride addition.
5-90
Figure 5-56 shows a schematic of the facility. Figure 5-57 shows an aerial photo of the
Danbury WPCP.
Figure 5-56. Process Schematic for Danbury WPCP.
Nitrogen Removal
Facility
Digester
s
Primary
Rock Media Clarifiers
Flow EQ
Trickling Filters

Table 5-34 contains the current NPDES permit limits for the Danbury WPCP.
Table 5-43. Current NPDES Permit Limits for Danbury WPCP.
BOD5, mg/L 30 (Oct-Jun) - 50 (Oct-Jun)
20 (Jul-Sep) - 30 (Jul-Sep)
TSS, mg/L 30 - 50
NH4-N, mg/L 4.0 (Nov-Apr) - -
1.9 (May, Oct) - -
1.7 (Jun) - -
1.5 (Jul-Sep) - -
Total Phosphorus 0.2 (May-Sep) -
Chlorine Residual, mg/L 0.01 (May-Sep) - 0.02 (May-Sep)
Fecal Coliform, # per 100 mL 200 (May-Sep) - 400 (May-Sep)
The 2008 Consent Order also required Danbury to prepare and submit a comprehensive
engineering report to address reducing both nitrogen and phosphorus to meet the future limits. In
discussions between March and June of 2011, Connecticut DEEP indicated that Danbury would
need to meet significantly more stringent seasonal effluent limits of 7.55 ppd of phosphorus. At an
average flow of 11 mgd, this is equivalent to an average total P limit of 0.08 mg/L. The annual
nitrogen discharge limit for 2014 is 442 ppd, which is 4.82 mg/L at an average flow of 11 mgd.
The influent has a low alkalinity and therefore addition of ferric salts for phosphorus
removal in addition to nitrification can suppress pH significantly (less than 6.5). Addition of lime is
used to offset pH swings. Digester pH can also swing and cause problems with “sour” digesters.
Design annual average and maximum monthly wastewater flow and composition is shown in
Table 5-44.
2009 Data.
Parameter Annual Average Maximum Monthly Minimum Monthly

Plant Influent
Flow, ML/d (mgd) 33.7 (8.9) 50.3 (13.3)
BOD, mg/L 241 193
COD1, mg/L 600 481
TN, mg/L 41 33
COD/TN 14.5 14.6
TSS, mg/L 261 243
Temperature, °C 15 27 10
Alkalinity 190
NO2-N & NO3-N, mg/L 0.0 0.0 0.0
Activated Sludge Influent2
BOD, mg/L 39
COD, mg/L 72
TN 28
COD/TN 2.6
TSS 17
5-92
elements for mainstream deammonification for the Danbury WPCP.
Sidestream Liquors The anaerobic digester liquors could be treated using Sidestream treatment using DEMON to
Available remove the nitrogen load and provide potential seeding material for mainstream deammonification.
Chemical Addition The plant adds methanol for denitrification and uses lime for alkalinity. Reducing these chemical
costs are a major driver for Danbury. The plant also uses ferric chloride for phosphorus removal. The
ferric dosing can occur at the primary tanks or nitrification stage. Methanol costs variable but average
$1.50/gallon. Lime costs ~ $0.15/lb.
Energy The average cost of electricity is $0.14 per kWh.
Effluent Limits Load based annual TN limit, equivalent 4.82 mg/L. Stringent summer ammonia limit
of 1.5 mg/L.
Plant temperature Low winter temperature of 10°C.
C/N The C/N ratio of the activated sludge plant influent is 2.6 which is a low level.
Phosphorus removal Seasonal chemical phosphorus removal.
Influent flow peaks Maximum flow through plant limited by TF pump station (28 mgd)
The existing secondary treatment consists of trickling filters (low energy treatment of
BOD and some nitrification) followed by activated sludge for nitrogen removal. The influent to
the activated sludge stage at Danbury has a very low C/N ratio of 2.6. Design guidance would
suggest that the AVN control followed by an anammox polishing step be considered to reduce
methanol, energy, and alkalinity costs while ensuring effluent ammonia limits are achieved. The
anammox polishing zone could be provided by modifying the existing post-denitrification zone
to incorporate IFAS (Figure 5-58).
Figure 5-58. Proposed Flow Schematic.

Sidestream deammonification should also be considered to remove sidestream ammonia
loads and to provide seed material for mainstream treatment. Table 5-46 summarizes equipment
requirements to achieve implementation.
Function Equipment
Anammox Retention Hydrocyclone or other means of retaining anammox bacteria on the

WAS line. Installation of IFAS media in post-anoxic zone to enable
fixed-film anammox growth.
Rapid Aeration Changes Accurate valves & Meters required in aeration zones.
Control Ammonia versus nitrite (AVN) control.
Online ammonia and nitrite analyzers.
Reactor Configuration Intermittent aeration in main reactor. Post reactor using IFAS for
anammox polishing.

Rough sizing of the post anammox polishing zone and position of ammonia and nitrite
probe for AVN are shown on the aerial plot (Figure 5-59). The size of the zones needs to be
checked and the position of the ammonia probes needs to be confirmed during trials.
Anammox
Polishing Zones
Amm/Nitrite
Probes
Figure 5-59. Aerial Photo of Nitrification Tanks Showing Proposed Modifications.
5-94
deammonification was carried out. Figure 5-60 shows the outputs of that assessment. It shows a
potential 30% reduction in overall operating costs moving from nitrification/ denitrification to
nitrite shunt and an overall reduction of 80% in moving to deammonification. The most
significant cost savings are due to eliminating the need for external carbon, followed by
eliminating the need for lime addition and finally, electricity savings.
$800,000
Annual Operating Cost Estimate
$700,000
$600,000
$500,000
$400,000
$300,000
$200,000
$100,000
$-
Electricity $250,000 $190,000 $140,000
Carbon $370,000 $220,000 $-
Alkalinity $90,000 $90,000 $-
Figure 5-60. Comparison of Potential Operating Costs of Nit/Denit, Nitrite Shunt versus Deammonification.
5.5.9.8 Next Steps

Implementation of mainstream deammonification would require the following steps:
 Install an AVN control system on each aeration basin.
 Add a hydrocyclone on the WAS line.
 Install IFAS media in the post anoxic zone.
 Consider installing sidestream deammonification to bioaugment anammox to the mainstream.

5.6 Summary
Table 5-47 summarizes the approach and potential savings for each of the concept studies
rounded to the nearest 10%. The results show that all of the facilities could realize significant
operational cost savings through implementing short-cut nitrogen control. The magnitude of the
savings and the benefit of mainstream deammonification versus nitrite shunt alone varies from site to
site, depending on the existing plant conditions, wastewater characteristics, and effluent requirements.
Table 5-47. List of Concept Studies.
# Facility Proposed Approach Potential Savings (%)
1 Chesapeake Elizabeth Treatment Mainstream Deammonification 50%
Plant
2 Blue Plains AWTP Mainstream Deammonification 80%
3 H.L. Mooney AWRF Mainstream Deammonification 80%
4 Robert W. Hite TF Mainstream Deammonification 50%*
5 Egan WRP Nitrite Shunt 30%
6 McDowell Creek WWTP Nitrite Shunt 20%
7 Sacramento Regional WTP Nitrite Shunt 30%**
8 Howard F. Curren AWTP Mainstream Deammonification 60%
9 Danbury WPCP Mainstream Deammonification 80%
Notes:
* Based on Regulation 31 effluent limits
**Based on “carbon credit” if it can be used for other processes or recovered in digesters
5.7 General Conclusions

 Short-cut nitrogen removal reduces significantly operational costs for energy and chemical use.
 For many facilities, the nitrite-shunt approach provides the most obvious pathway to reduce
operational costs as a first step.
 Mainstream deammonification is most beneficial – and therefore most worthwhile pursuing -
in facilities with a low wastewater C/N ratio coupled with a need to meet low nitrogen limits.
 Lower effluent nitrogen limits increase the benefits of short-cut nitrogen.
 Further research is required to incorporate biological phosphorus removal with short-cut
nitrogen removal.
An additional observation is that shifting more carbon away from secondary treatment
(e.g., to push more solids to anaerobic digestion for energy generation), decreases the C/N ratio
and increases the relevant benefit of carrying out mainstream deammonification. This combined
approach minimizes energy use and maximizes the potential for achieving net energy neutrality
at a water resource recovery facility.
The study of deammonification in the mainstream and sidestream is a rapidly developing
field. This report introduces concepts and challenges for mainstream deammonification. More
recent work performed by the project team and others can be found in current publications and
conference proceedings, notably:
 Shortcut nitrogen removal – nitrite shunt and deammonification prepared by the Shortcut
Nitrogen Removal Task Force of the Water Environment Federation and published by the
Water Environment Federation in 2015.
 Proceedings of the IWA Nutrient Removal and Recovery 2015: Moving Innovation Into
Practice, held May 18-21, 2015 in Gdansk, Poland.
5-96
REFERENCES
Alleman, J., Irvine, R. (1980). Storage-induced denitrification using sequencing batch reactor
operation. Water Research, 14, 1483-1488.
Al-Omari, A., Wett, B., Nopens, I., De Clippeleir, H., Han, M., Regmi, P., Bott, C., and Murthy,
S. (2014). Model-based evaluation of mechanisms and benefits of mainstream shortcut nitrogen
removal processes. Proceedings of WWTmod, Spa, Belgium.
Al-Omari, A., Wett, B., Han, H., Hell, M., Bott, C., Murthy, S. (2012). Full-plant
deammonification based on NOB-repression, AOB seeding, anammox seeding and successful –
retention. Proc. IWA Conf. On Nutrient Removal, Harbin.
Amman, R.I., Krumholz, L., Stahl, D.A. (1990). Fluorescent-oligonucleotide probing of whole
cells for determinative, phylogenetic, and environmental studies in microbiology. Journal of
Bacteriology, 172, 762-770.
Anthonisen, A C., Loehr, R.C., Prakasam, T.B., and Srinath, E.G. (1976). Inhibition of
nitrification by ammonia and nitrous acid Journal - Water Pollution Control Federation, 48(5),
835-52.
Batchelor, B. (1982). Kinetic analysis of alternative configurations for single-sludge
nitrification/denitrification. Journal (Water Pollution Control Federation), 54(11), 1493-1504.
Bishop, P.L., Zhang, T.C., Fu, Y.C. (1995). Effects of Biofilm Structure, Microbial Distributions
and Mass-Transport on Biodegradation Processes. Water Science and Technology, 31, 143-152.
Black and Veach. (2013). Preliminary Design Report - Echo Water Project AWTP Biological
Nutrient Removal Project. Sacramento Regional County Sanitation District. Dec 20, 2013.
Blackburne, R., Yuan, Z., and Keller, J. (2008b). Demonstration of nitrogen removal via nitrite
in a sequencing batch reactor treating domestic wastewater. Water Research, 42(8-9), 2166-
2176.
Cao, Y., Kwok, B.H., Yong, W.H., Chua, S.C., Wah, Y.L., Ghani, Y.A.B.D. (2013).
MainstreamPartial Nitritation–ANAMMOX Nitrogen Removal in the Largest Full-Scale
Activated Sludge Process in Singapore: process analysis, in: WEF/IWA Nutrient Removal
andRecovery 2013: Trends in Resource Recovery and Use, Vancouver, Canada, 28-31 July. p.
23.
Casey, T.G., Wentzel, M.C., Ekama, G.A., Loewenthal, R.E., and Marais, GvR. (1994). An
hypothesis for the causes and control of anoxic–aerobic (AA) filament bulking in nutrient
removal activated sludge systems. Water Science and Technology, 29(7), 203–12.
Chandran, K. and Smets, B.F. (2000). Single-step nitrification models erroneously describe batch
ammonia oxidation profiles when nitrite oxidation becomes rate limiting. Biotechnol Bioeng 68:
396-406.
Chen, H., Liu, S., Yang, F., Xue, Y., and Wang, T. (2009). The development of simultaneous
partial nitrification, ANAMMOX and denitrification (SNAD) process in a single reactor for
nitrogen removal. Bioresource Technology, 100(4), 1548-54.
Mainstream Deammonification R-1

Cho, S., Takahashi, Y., Fujii, N., Yamada, Y., Satoh, H., and Okabe, S. (2010). Nitrogen
removal performance and microbial community analysis of an anaerobic up-flow granular bed
anammox reactor. Chemosphere, 78, 1129-1135.
Coulter, W.H. (1956). High speed automatic blood cell counter and cell size analyzer, presented
at the. National Electronics Conf.Chicago.
Daebel, H., Manser, R., and Gujer, W. (2007). Exploring temporal variations of oxygen
saturation constants of nitrifying bacteria. Water Research, 41, 1094-1102.
Dapena-Mora, A., Campos, J.L., Mosquera-Corral, A., Jetten, M.S.M., and Méndez, R. (2004).
Stability of the ANAMMOX process in a gas-lift reactor and a SBR. J Biotechnol;110:159-70.
De Clippeleir, H., Takacs, I., Wett, B., Chandran, K., and Murthy, S. (2014) Estimation of
apparent nitrification kinetics as the key for reliable greenhouse gas emission prediction.
Proceedings of WWTmod 2014, Spa, Belgium.
De Clippeleir, H., Vlaeminck, S.E., de Wilde, F., Daeninck, K., Mosquera, M., Boeckx, P., et al.
(2013). One-stage partial nitritation/AMX at 15 °C on pretreated sewage: feasibility
demonstration at lab-scale. Applied Microbiology And Biotechnology, 97(23), 10199-210.
Doblander, C. and Lackner, R. (1996). Metabolism and detoxification of nitrite by trout
hepatocytes. Biochimica Et Biophysica Acta, 1289:270-274.
Erdal, U.G., Erdal, Z.K., and Randall, C.W. (2006). The mechanism of enhanced biological
phosphorus removal washout and temperature relationships. Water Environ Res. 78(7):710-5.
Fernández, I. Vázquez-Padín, J.R., Mosquera-Corral, A., Campos, J.L., Méndez, R. (2008).
Biofilm and granular systems to improve Anammox biomass retention, Biochemical Engineering
Journal, 42(3), 308-313.
Ferris, M.J., Muyzer, G., and Ward, D.M. (1996). Denaturing gradient gel electrophoresis.
Gao, D., Lu, J., and Liang, H. (2013). Simultaneous energy recovery and autotrophic nitrogen
removal from sewage at moderately low temperatures Applied Microbiology and Biotechnology.
doi:10.1007/s00253-013-5237-7.
Giraldo E., Jjemba P., Liu Y., and Muthukrishnan S. (2011). Presence and significance of
anammox spcs and ammonia oxidizing archea, AOA, in full-scale membrane bioreactors for total
nitrogen removal. IWA Conference Nutrient Recovery and Management, 2011.
Graham, D.W., Knapp, C.W., Van Vleck, E.S., Bloor, K., Lane, T.B., and Graham, C.E. (2007).
Experimental demonstration of chaotic instability in biological nitrification. ISME J 1(5),
385-393.
Guisasola, A., Petzet, S., Baeza, J.A., Carrera, L., and Lafuente J. (2007). Inorganic carbon
limitations on nitrification: Experimental assessment and modelling. Water Research, 41,
277-286.
Guo, J., Peng, Y., Yang, X., Gao, C., and Wang, S (2013). Combination process of limited
filamentous bulking and nitrogen removal via nitrite for enhancing nitrogen removal and
reducing aeration requirements. Chemosphere, 91(1), 68-75.
R-2
Güven, D., Dapena, A., Kartal, B., Schmid, M.C., Maas, B., van de Pas-Schoonen, K., et al.
(2005). Propionate oxidation by and methanol inhibition of anaerobic ammonium-oxidizing
bacteria Applied And Environmental Microbiology, 71(2), 1066-71.
Hao, O. and Huang, J. (1996). Alternating aerobic-anoxic process for nitrogen removal: Process
evaluation. Water Environment Research, 68(1), 83-93.
Hiatt, W.C. and Grady, C.P. (2008). An updated process model for carbon oxidation,
nitrification, and denitrification. Water Research 80(11), 2145-56.
Hu, Z., Lotti, T., de Kreuk, M., Kleerebezem, R., van Loosdrecht, M., Kruit, J., et al. (2013).
Nitrogen removal by a nitritation-AMX bioreactor at low temperature. Applied And
Environmental Microbiology, 79(8), 2807-12.
Ingildsen, P. (2002). Realising Full-scale Control in Wastewater Treatment Systems using in situ
Nutrient Sensors. Ph.D. thesis, University of Lund, Sweden.
Jenkins, D., Richard, M., and Daigger, G. (2004). Manual on the causes and control of activated
sludge bulking, foaming, and other solids separation problems. 3rd ed. CRC Press.
Jimenez, J.A. (2002). Kinetics of COD removal in the activated sludge process, including
bioflocculation, Ph.D. dissertation, University of New Orleans, New Orleans, LA.
Jones, R.M., Dold, P., Takács, I., Chapman, K., Wett, B., Murthy, S., and O'Shaughnessy, M.
(2007). Simulation for operation and control of reject water treatment processes. Proceedings of
WEFTEC, San Diego, CA, USA.
Kampschreur, M.J., Poldermans, R., Kleerebezem, R., van der Star, W.R.L., Haarhuis, R.,
Abma, W.R., Jetten, M.S.M., and van Loosdrecht, M.C.M. (2009). Emission of nitrous oxide and
nitric oxide from a full-scale single-stage nitritation-anammox reactor. Water Sci Technol 60,
3211-3217.
Kartal, B., van Niftrik, L., Rattray, J., van de Vossenberg, J.L.C.M., Schmid, M.C., Damsté, J.S.,
et al. (2008). Candidatus “Brocadia fulgida”: an autofluorescent anaerobic ammonium oxidizing
bacterium. FEMS Microbiology Ecology, 63(1), 46-55.
Katsogiannis, A.N., Kornaros, M., and Liberates, G. (2003). Enhanced nitrogen removal in SBRs
bypassing nitrate generation accomplished by multiple aerobic/anoxic phase pairs. Water
Science and Technology, 47(11), 53–59.
Kindaichi, T., Tsushima, I., Ogasawara, Y., Shimokawa, M., Ozaki, N., Satoh, H., et al. (2007).
In situ activity and spatial organization of anaerobic ammonium-oxidizing (anammox) bacteria
in biofilms. Appl. Environ. Microbiol. 73(15), 4931-4939.
Knowles, G., Downing, A.L., and Barrett, M.J. (1965). Determination of kinetic constants for
nitrifying bacteria in mixed culture, with the aid of electronic computer. Journal of General
Microbiology, 38, 263-278.
Koraris, M., Dokianakis, S.N., and Lyberatos, D.G. (2010). Partial Nitrification/Denitrification
Can Be Attributed to the Slow Response of Nitrite Oxidizing Bacteria to Periodic Anoxic
Disturbances. Environmental Science and Technology, 44 – 7245-7253.
Kornaros, M. and Dokianakis, S. (2010). Partial nitrification/denitrification can be attributed to
the slow response of nitrite oxidizing bacteria to periodic anoxic disturbances. Environmental
science and Technology, 44, 7245-7253.

Lan, C., Kumar, M., Wang, C., and Lin, J. (2011). Development of simultaneous partial
nitrification, anammox and denitrification (SNAD) process in a sequential batch reactor.
Bioresource Technology, 102(9), 5514-9.
Lemaire, R., Marcelino, M., and Yuan, Z. (2008). Achieving the nitrite pathway using aeration
phase length control and step-feed in an SBR removing nutrients from abattoir wastewater.
Biotechnology and Bioengineering, 100(6), 1228-1236.
Li, H., Zhou, S., Huang, G., and Xu, B. (2012). Partial nitritation of landfill leachate with
varying influent composition under intermittent aeration conditions. Process Safety and
Environmental Protection. 91, 4, 285-294.
Ling D. (2009). Experience from commissioning of full-scale DeAmmon® plant at
Himmerfjärden (Sweden). In: Proceedings of 2nd IWA specialized Conference on nutrient
Management in Wastewater treatment Processes. Lemtech Konsulting, Krakow, Poland,
September 2009.
Lopez, H., Puig, S., Ganigue, R., Ruscalleda, M., Balaguer, M.D., and Colprim, J. (2008). Start-
up and enrichment of a granular anammox SBR to treat high nitrogen load wastewaters. Journal
of Chemical Technology and Biotechnology, 83, 233-241.
Lücker, S., Wagner, M., Maixner, F., Pelletier, E., Koch, H., Vacherie, B., et al. (2010). A
Nitrospira metagenome illuminates the physiology and evolution of globally important nitrite-
oxidizing bacteria Proceedings of the National Academy of Sciences of the United States of
America, 107(30), 13479-84.
Ma, Y., Peng, Y., Wang, S., Yuan, Z., and Wang, X. (2009). Achieving nitrogen removal via
nitrite in a pilot-scale continuous pre-denitrification plant. Water Research, 43(3), 563-572.
Mamais, D. and Jenkins, D. (1992). The effects of MCRT and temperature on enhanced
biological phosphorus removal. Waf. Sci. Tech. Vol. 26, No. 5-6, pp. 955-965.
Mampaey, K., Beuckels, B., Kampschreur, M., Kleerebezem, R. Van Loosdrecht, M., and
Volcke, E. (2013). Modelling nitrous and nitric oxide emissions by autotrophic ammonia-
oxidizing bacteria. Environmental Technology.
Manser, R., Gujer, W., and Siegrist, H. (2005). Consequences of mass transfer effects on the
kinetics of nitrifiers. Water Research, 39(19), 4633-4642.
Martín-Cereceda, M., Alvarez, A.M., Serrano, S., Guinea, A. (2001). Confocal and Light
Microscope Examination of Protozoa and Other Microorganisms.
Martins, A.M.P., Heijnen, J.J., and Van Loosdrecht, M.C.M. (2004). Bulking sludge in
biological nutrient removal systems. Biotechnology and Bioengineering 86, 125-135.
Martins, A.M., Pagilla, K., Heijnen, J.J., and van Loosdrecht, M.C. (2004). Filamentous bulking
sludge – A critical review. Water research, 38(4), 793-817.
McClintock, S.A., Randall, C.W., and Pattarkine, V. (1993). Effects of Temperature and Mean
Cell Residence Time on Biological Nutrient Removal Processes. Water Environment Research
Vol. 65 (pp. 110-118).
Miller, M., Bunce, R., Regmi, P., Hingley, D., Kinnear, D., Murthy, S., Wett, B., and Bott, C.
(2012). A/B process pilot optimized for nitrite shunt: High rate carbon removal followed by
BNR with ammonia-based cyclic aeration control. Proceedings of the 85th Annual Water
R-4
Environment Federation Technical Exposition and Conference, New Orleans, LA Sep. 29-Oct. 3;
Water Environment Federation, Alexandria, VA.
Ni, B.-j., Chen, Y.-P., et al. (2009). Modeling a granule-based anaerobic ammonium oxidizing
(ANAMMOX) process. Biotechnology and Bioengineering, 103(3): 490-499.
Papadimitriou, C., Palaska, G., Lazaridou, M., Samaras, P., and Sakellaropoulos, G.P. (2007).
The effects of toxic substances on the activated sludge microfauna. Desalination, 211, 177-191.
Park S., An J., Potts J.R., Velamakanni A., Murali S., and Ruoff, R.S. (2011). Hydrazine-
reduction of graphite- and graphene oxide. CARBON (49) 3019-3023.
Peng, Y., Chen, Y., Peng, C., and Liu, M. (2004). Nitrite accumulation by aeration controlled in
sequencing batch reactors treating domestic wastewater. Water Science and Technology, 50,
35-43.
Podmirseg, S., Pumpel, T., Markt, R., Murthy, S., Bott, C., and Wett, B. (2014). Comparative
evaluation of multiple methods to quantify and characterise granular anammox biomass. Water
Research; 68:194-205.
Pollice, A., Tandoi, V., and Lestingi, C. (2002). Influence of aeration and sludge retention time
on ammonium oxidation to nitrite and nitrate. Water research, 36(10), 2541-2546.
Regmi, P. (2014a). Feasibility of mainstream nitrite oxidizing bacteria out-selection and
anammox polishing for enhanced nitrogen removal. Ph.D. Dissertation. Old Dominion
University. Norfolk, VA, USA.
Regmi, P., Miller, M.W., Holgate, B., Bunce, R., Park, H., Chandran, K., Wett, B., Murthy, S.,
and Bott, C.B. (2014b). Control of aeration, aerobic SRT and COD input for mainstream
nitritation/denitritation, Water Research, doi: 10.1016/j.watres.2014.03.035.
Rhine E.D., Sim G.K., Mulvaney R.L., and Pratt E.J. (1998). Improving the berthelot reaction for
determining ammonia in soil extracts and water. Soil Science Society of America Journal.
Madison, Wisconsin. Vol. 62, No. 2.
Rosenwinkel, K., Cornelius, A., and Thöle, D. (2005). Full-scale application of the
deammonification process for the treatment of sludge water. In: Proceedings of IWA specialized
Conference on nutrient Management in Wastewater treatment Processes and Recycle streams,
Krakow, Poland, September 2005.
Rotthauwe, J.H., Witzel, K.P., and Liesack, W. (1997). The ammonia monooxygenase structural
gene amoA as a functional marker: molecular fine-scale analysis of natural NH4+-oxidizing
populations. Appl. Environ. Microbiol. 63(12), 4704-4712.
Sedlak, R. (1991). Phosphorus and Nitrogen Removal from Municipal Wastewater: Principles
and Practice, 2nd ed.; Lewis Publishers: Ann Arbor, Michigan.
Shaw, A., Takács, I., Pagilla, K., and Murthy, S. (2013). A new approach to assess the
dependency of extant half saturation coefficients on maximum process rates and estimate
intrinsic coefficients. Water Research, 47/16, 5986-5994.
Shortcut Nitrogen Removal Task Force of the Water Environment Federation, (2015). Shortcut
Nitrogen Removal – Nitrite Shunt and Deammonification, Water Environment Federation.
ISBN: 978-1-57278-313-3

Silverstein, J. and Schroeder, E. (1983). Performance of SBR Activated Sludge Processes with
Nitrification/Denitrification. Journal of Water Pollution Control Federation, 55, 377-384.
Sin, G., Kaelin, D., Kampschreur, M., Takács, I., Wett, B., Gernaey, K.V., Rieger, L., Siegrist,
H., and van Loosdrecht, M. (2008). Modelling nitrite in wastewater treatment systems: A
discussion of different modeling concepts. Water Science and Technology, 58(6), 1155-1171.
Sinclair, P.R., Gorman, N., and Jacobs, J.M. (2001). Measurement of heme concentration.
Current Protocols in Toxicology. 00:8.3:8.3.1-8.3.7.
Sorensen, J., Thornberg, D.E., and Nielsen, M.K. (1994). Optimization of a Nitrogen-Removing
Biological Wastewater Treatment Plant Using On-Line Measurements. Water Environment
Research, 66(3), 236-242.
Stinson, B., Murthy, S., Bott, C., Wett, B., Bailey, W., Al-Omari, A., Bowden, G., Mokhayeri,
Y., and De Clippeleir, H. (2013). Roadmap Toward Energy and Chemical Optimization Through
The Use of Mainstream Deammonification at Enhanced Nutrient Removal Facilities. WEFTEC,
Chicago.
Strous, M., Heijnen, J., Kuenen J., and Jetten M. (1998). The sequencing batch reactor as a
powerful tool for the study of slowly growing anaerobic ammonium-oxidizing microorganisms.
Appl Microbiol Biotechnol, 50(5), 589-596.
Svardal, K., Lindtner, S., and Winkler, S. (2003). Optimum aerobic volume control based on
continuous in-line oxygen uptake monitoring Water science and technology : a journal of the
International Association on Water Pollution Research, 47(11), 305-12.
Tang, C., Zheng, P., Wang, C., and Mahmood, Q. (2010). Suppression of anaerobic ammonium
oxidizers under high organic content in high-rate Anammox UASB reactor. Bioresource
Technology, 101(6), 1762-8.
Udert, K.M., Kind, E. et al. (2008). Effect of heterotrophic growth on nitritation/anammox in a
single sequencing batch reactor. Water science and technology, 58(2): 277.
van der Star, W.R.L., Abma, W.R., Blommers, D., Mulder, J., Tokutomi, T., Strous, M., et al.
(2007). Startup of reactors for anoxic ammonium oxidation: experiences from the first full-scale
AMX reactor in Rotterdam. Water Research, 41(18), 4149-63.
Vlaeminck, S.E., Terada, A., Smets, B.F., De Clippeleir, H., Schaubroeck, T., Bolca, S.,
Demeestere, L., Mast, J., Boon, N., Carballa, M., and Verstraete, W. (2010). Aggregate size and
architecture determine microbial activity balance for one-stage partial nitritation and anammox.
Appl Environ Microbiol, 76, 900-9.
Wett, B. (2005). Solved upscaling problems for implementing deammonification of rejection
water. Water Science and Technology 53 (12), 121-128.
Wett, B. (2007). Development and implementation of a robust deammonification process. Water
Science and Technology, 56, 81–88.
Wett, B., Jimenez, J.A., Takacs, I., Murthy, S., Bratby, J.R., Holm, N.C., and Ronner-Holm, S.G.
(2011). Models for nitrification process design: one or two AOB populations? Water Science and
Technology, 64 (3) 568-78.
Wett B. and Rauch W. (2003). The role of inorganic carbon limitation in biological nitrogen
removal of extremely ammonia concentrated wastewater. Water Research 37, 1100-1110.
R-6
Wett, B. (2007). Development and implementation of a robust deammonification process. Water
Science and Technology, 56/7, 81-88.
Wett, B., Hell, M., Nyhuis, G., Puempel, T., Takacs, I., and Murthy, S. (2010a). Syntrophy of
aerobic and anaerobic ammonia oxidizers. Water Science and Technology, 61/8, 1915-1922.
Wett, B., Jimenez, J.A., Takács, I., Murthy, S., Bratby, J.R., Holm, N.C., and Rönner-Holm,
S.G.E. (2010b). Models for Nitrification Process Design: One or Two AOB Populations? Water
Science and Technology, 64/3, 568-578.
Wett, B., Podmirseg, S.M., Hell, M., Nyhuis, G., Bott C., and Murthy, S. (2012). Expanding
DEMON sidestream deammonification technology towards mainstream application. Proc. IWA
Conf. on Autotrophic Nitrogen Removal (SIDISA), Milano.
Winkler, M.H., Kleerebezem, R., and van Loosdrecht, M.C.M. (2012). Integration of anammox
into the aerobic granular sludge process for mainstream wastewater treatment at ambient
temperatures. Water Research, 46(1), 136-44.
Xu, Z., Zeng, G., Yang, Z., Xiao, Y., Cao, M., Sun, H., et al. (2010). Biological treatment of
landfill leachate with the integration of partial nitrification, anaerobic ammonium oxidation and
heterotrophic denitrification. Bioresource Technology, 101(1), 79-86.
Yang, S. and Yang, F. (2011). Nitrogen removal via short-cut simultaneous nitrification and
denitrification in an intermittently aerated moving bed membrane bioreactor. Journal of
Hazardous Materials, 195, 318-323.
Yoo, H., Ahn, K., Lee, H., Lee, K., Kwak, Y., and Song, K. (1999). Nitrogen removal from
synthetic wastewater by simultaneous nitrification and denitrification (SND) via nitrite in an
intermittently-aerated reactor. Water Research. 33, 145-154.
Yu, R., Kampschreur, M.J., van Loosdrecht, M.C.M, and Chandran, K. (2010). Mechanisms and
specific directionality of autotrophic nitrous oxide and nitric oxide generation during transient
anoxia. Envir, Sci. Technol. 44(4), 1313-1319.
Zekker, I., Rikmann, E., Tenno, T., Saluste, A., Tomingas, M., Menert, A., and Loorits, L.
(2012). Achieving nitritation and anammox enrichment in a single moving-bed biofilm reactor
treating reject water. Environmental technology, 33(4-6), 703-710.

R-8
WERF Subscribers
WASTEWATER UTILITY Colorado Kansas North Carolina
Aurora, City of Johnson County Cape Fear Public Utilities
Alabama Boulder, City of Wastewater Authority
Montgomery Water Works Centennial Water & Lawrence, City of Charlotte-Mecklenburg
& Sanitary Sewer Board Sanitation District Olathe, City of Utilities
Alaska Greeley, City of Kentucky Durham, City of
Anchorage Water & Littleton/Englewood Louisville and Jefferson Metropolitan Sewerage
Wastewater Utility Wastewater Treatment County Metropolitan District of Buncombe
Arizona Plant Sewer District County
Avondale, City of Metro Wastewater Old North State Water
Louisiana
Peoria, City of Reclamation District Company Inc.
Sewerage & Water Board
Phoenix Water Services Platte Canyon Water & Orange Water & Sewer
of New Orleans
Department Sanitation District Authority
Pima County Wastewater Maine Raleigh, City of
Connecticut
Reclamation Department Bangor, City of
Greater New Haven Ohio
Tempe, City of Portland Water District
WPCA Avon Lake Municipal
Arkansas Maryland Utilities
District of Columbia
Little Rock Wastewater Anne Arundel County Columbus, City of
DC Water
Calvert County Water, Dayton, City of
California Florida Sewerage Division Metropolitan Sewer District
Central Contra Costa Hillsborough County Public Howard County Bureau of of Greater Cincinnati
Sanitary District Utilities Utilities Northeast Ohio Regional
Corona, City of Hollywood, City of Washington Suburban Sewer District
Crestline Sanitation District JEA Sanitary Commission Summit County
Delta Diablo Miami-Dade County
Dublin San Ramon Services Massachusetts Oklahoma
Orange County Utilities
District Boston Water & Sewer Oklahoma City Water &
Department
East Bay Dischargers Commission Wastewater Utility
Orlando, City of
Authority Upper Blackstone Water Department
Palm Beach County
East Bay Municipal Utility Pollution Abatement Tulsa, City of
Pinellas County Utilities
District District
Reedy Creek Improvement Oregon
Encino, City of District Michigan Bend, City of
Fairfield-Suisun Sewer St. Petersburg, City of Ann Arbor, City of Clean Water Services
District Tallahassee, City of Gogebic-Iron Wastewater Gresham, City of
Fresno Department of Toho Water Authority Authority Lake Oswego, City of
Public Utilities Holland Board of Public Oak Lodge Sanitary District
Georgia
Irvine Ranch Water District Works Portland, City of
Atlanta Department of Saginaw, City of
Las Gallinas Valley Water Environment
Watershed
Sanitary District Wayne County Department Services
Management
Las Virgenes Municipal of Public Services
Augusta, City of Pennsylvania
Water District Wyoming, City of
Clayton County Water Philadelphia, City of,
Livermore, City of Minnesota
Authority Water Department
Los Angeles, City of Metropolitan Council
Cobb County Water University Area Joint
Montecito Sanitation Environmental Services
System Authority
District Rochester, City of
Columbus Water Works South Carolina
Napa Sanitation District Western Lake Superior
Gwinnett County Beaufort - Jasper Water &
Novato Sanitary District Sanitary District
Department of Water Sewer Authority
Orange County Sanitation Missouri
Resources Charleston Water System
District Independence, City of
Macon Water Authority Greenwood Metropolitan
Sacramento Regional Kansas City Missouri
Savannah, City of District
County Sanitation Water Services
District Hawaii Mount Pleasant
Honolulu, City & County of Department Waterworks
San Diego, City of Metropolitan St. Louis
San Francisco Public Idaho Spartanburg Water
Sewer District Sullivan’s Island, Town of
Utilities, City and Boise, City of
Nebraska Tennessee
County of Illinois
Lincoln Wastewater & Cleveland Utilities
San Jose, City of Greater Peoria Sanitary Solid Waste System Murfreesboro Water &
Sanitation Districts of Los District
Angeles County Metropolitan Water Nevada Sewer Department
Santa Barbara, City of Reclamation District of Henderson, City of Nashville Metro Water
Santa Cruz, City of Greater Chicago New Jersey Services
Santa Rosa, City of Sanitary District of Decatur Bergen County Utilities Texas
Silicon Valley Clean Water Authority Austin, City of
Indiana
South Orange County New York Dallas Water Utilities
Jeffersonville, City of
Wastewater Authority New York City Department Denton, City of
Stege Sanitary District Iowa El Paso Water Utilities
of Environmental
Sunnyvale, City of Ames, City of Protection Fort Worth, City of
Thousand Oaks, City of Cedar Rapids Water Houston, City of
Pollution Control Kilgore, City of
Facilities San Antonio Water System
Des Moines, City of Trinity River Authority
WERF Subscribers
Utah STORMWATER UTILITY
Salt Lake City Department EMA Inc. INDUSTRY
of Public Utilities California Environmental Operating
San Francisco Public Solutions Inc. American Water
Virginia
Utilities, City & County of Evoqua Water Bill & Melinda Gates
Alexandria Renew
Santa Rosa, City of Technologies Foundation
Enterprises
Sunnyvale, City of Gannett Fleming Inc. Chevron Energy
Arlington County
Colorado GeoSyntec Consultants Technology Company
Fairfax County
Aurora, City of GHD Inc. DuPont
Fauquier County
Global Water Advisors Inc. Eastman Chemical
Hampton Roads Sanitation Florida
Greeley & Hansen LLC Company
District Orlando, City of
Hazen & Sawyer P.C. Eli Lilly & Company
Hanover County Iowa
HDR Inc. InSinkErator
Hopewell Regional Cedar Rapids Water
Holmes & McGrath Inc. Johnson & Johnson
Wastewater Treatment Pollution Control
Jacobs Engineering Procter & Gamble
Facility Facilities
Group Inc. Company
Loudoun Water Des Moines, City of
KCI Technologies Inc. United Water Services LLC
Lynchburg Regional Kentucky
Kelly & Weaver P.C. Veolia Water North
Wastewater Treatment Sanitation District No. 1
Kennedy/Jenks Consultants America
Plant
Pennsylvania KORE Infrastructure, LLC Water Services Association
Prince William County
Philadelphia, City of, Larry Walker Associates of Australia
Service Authority
Richmond, City of Water Department LimnoTech
Rivanna Water & Sewer Tennessee McKim & Creed
Authority Chattanooga Stormwater MWH
Management NTL Alaska Inc. List as of 10/8/15
Upper Occoquan Service
Authority Washington OptiRTC, Inc.
Washington Bellevue Utilities PICA Corporation
Everett, City of Department Pure Technologies Ltd.
King County Department RainGrid, Inc.
Seattle Public Utilities
of Natural Resources Ramboll Environ
Wisconsin Ross Strategic
& Parks Stevens Point, City of
Puyallup, City of Stone Environmental Inc.
Seattle Public Utilities Stratus Consulting Inc./
STATE AGENCY Abt Associates
Sunnyside, Port of
Connecticut Department of Suez-Environnement
Wisconsin Synagro Technologies Inc.
New Water Energy and
Environmental Protection Tata & Howard Inc.
Kenosha Water Utility Tetra Tech Inc.
Madison Metropolitan Harris County Flood
Control District The Cadmus Group Inc.
Sewerage District The Low Impact
Milwaukee Metropolitan Urban Drainage & Flood
Control District, CO Development Center Inc.
Sewerage District Wright Water
Racine Water & Engineers Inc.
Wastewater Utility CORPORATE Zoeller Pump Company
Sheboygan, City of
Stevens Point, City of AECOM
Wausau Water Works Alan Plummer Associates Austria
Inc. Sanipor Ltd.
Australia
American Cleaning Institute
Cairns Regional Council
American Structurepoint, Canada
Coliban Water
Inc. Associated Engineering
Goulburn Valley Water
Aqua-Aerobic Systems Inc.
Queensland Urban Utilities
ARCADIS Norway
Yarra Valley Water
BCR Environmental Aquateam COWI AS
Wannon Water
Black & Veatch
Water Services Association
Corporation
of Australia
Brown and Caldwell
Canada Burns & McDonnell
Calgary, City of Carollo Engineers, P.C.
EPCOR CDM Smith
Lethbridge, City of CH2M
Metro Vancouver Clear Cove Systems, Inc.
Toronto, City of D&B/Guarino Engineers
Winnipeg, City of LLC
Denmark Effluential Synergies LC
VandCenter Syd
WERF Board of Directors
Chair Rajendra P. Bhattarai, Philippe Gislette James Anthony (Tony)
Kevin L. Shafer P.E., BCEE Suez Environnement Parrott
Metro Milwaukee Austin Water Utility Louisville & Jefferson
Sewerage District Julia J. Hunt, P.E. County Metropolitan
Paul L. Bishop, Ph.D., P.E., Trinity River Authority Sewer District
Vice-Chair BCEE of Texas
Glen Daigger, Ph.D., P.E., University of Rick Warner, P.E.
BCEE, NAE Rhode Island Douglas M. Owen, P.E., Washoe County
One Water Solutions, BCEE, ENV SP Community
LLC Scott D. Dyer, Ph.D. ARCADIS U.S. Services Department
The Procter & Gamble
Secretary Company Jim Matheson
Eileen J. O’Neill, Ph.D. Oasys Water
Water Environment Catherine R. Gerali
Metro Wastewater Ed McCormick, P.E.
Federation Water Environment
Reclamation District
Federation
Treasurer
Brian L. Wheeler
Toho Water Authority
WERF Research Council

Chair Donald Gray (Gabb), Ted McKim, P.E. BCEE Elizabeth Southerland,
Rajendra P. Bhattarai, Ph.D., P.E., BCEE Reedy Creek Ph.D.
P.E., BCEE East Bay Municipal Energy Services U.S. Environmental
Austin Water Utility Utility District Protection Agency
Carol J. Miller, Ph.D., P.E.
Vice-Chair Robert Humphries, Ph.D. Wayne State University Paul Togna, Ph.D.
Art K. Umble, Ph.D., P.E., Water Corporation of Environmental Operating
BCEE Western Australia James (Jim) J. Pletl, Ph.D. Solutions, Inc.
MWH Global Hampton Roads
Terry L. Johnson, Ph.D., Sanitation District Kenneth J. Williamson,
P.E., BCEE Water Ph.D., P.E.
Consulting, LLC Michael K. Stenstrom, Clean Water Services
Ph.D., P.E., BCEE
Mark W. LeChevallier, University of California,
Ph.D. Los Angeles
American Water
WERF Product Order Form
As a benefit of joining the Water Environment Research Foundation, subscribers are entitled to receive one complimentary copy of all final
reports and other products. Additional copies are available at cost (usually $10). To order your complimentary copy of a report, please write
“free” in the unit price column. WERF keeps track of all orders. If the charge differs from what is shown here, we will call to confirm the total
before processing.
________________________________________________________________________________________________
Name Title
________________________________________________________________________________________________
Organization
________________________________________________________________________________________________
Address
________________________________________________________________________________________________
City State Zip Code Country
________________________________________________________________________________________________
Phone Fax Email
Stock # Product Quantity Unit Price To t a l
Postage &
Method of Payment: (All orders must be prepaid.) Handling
VA Residents Add
q C heck or Money Order Enclosed 5% Sales Tax
q Visa q Mastercard q A m e rican Express Canadian Residents
Add 7% GST
______________________________________________________
Account No. Exp. Date
TOTAL
______________________________________________________
Signature
S h ip p in g & Ha n dli n g: To Order (Subscribers Only):

Amount of Order United States Canada & Mexico All Others
7 Log on to www. werf.org and click
on “Publications.”
Up to but not more than: Add: Add: Add:
Phone: 571-384-2100
$20.00
30.00
$7.50*
8.00
$9.50
9.50
50% of amount
40% of amount
( Fa x : 703-299-0742
40.00 8.50 9.50 WERF
50.00 9.00 18.00 Attn: Subscriber Services
60.00 10.00 18.00 635 Slaters Lane
80.00 11.00 18.00 Alexandria, VA 22314-1177
100.00 13.00 24.00
150.00 15.00 35.00 To Order (Non-Subscribers):
200.00 18.00 40.00
Non-subscribers may order WERF
More than $200.00 Add 20% of order Add 20% of order
publications either through WERF
* m i n i mum amount for all orders or IWAP (www.iwapublishing.com).
Visit WERF’s website at www.werf.org
Make checks payable to the Water Environment Research Foundation. for details.
INFR6R11_WEF-IWAPspread.qxd 9/9/2015 2:55 PM Page 1
Infrastructure

635 Slaters Lane, Suite G-110 n Alexandria, VA 22314-1177
Phone: 571-384-2100 n Fax: 703-299-0742 n Email: werf@werf.org
www.werf.org
WERF Stock No. INFR6R11
IWA Publishing
London SW1H 0QS
United Kingdom
Phone: +44 (0)20 7654 5500
Fax: +44 (0)20 7654 5555
Email: publications@iwap.co.uk
Web: www.iwapublishing.com
IWAP ISBN: 978-1-78040-785-2
Co-published by
October 2015

Mainstream Deammonification WERF 2015

Uploaded by

Copyright:

Available Formats

You might also like

Mainstream Deammonification WERF 2015

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Mainstream Deammonification WERF 2015

Uploaded by

Copyright:

Available Formats

INFR6R11_WEF-IWAPspread.

qxd 9/9/2015 2:55 PM Page 1

Water Environment Research Foundation

For more information, contact:

This report was co-published by the following organization.

The Water Environment Research Foundation, formed in 1989, is America’s leading

Mainstream Deammonification iii

This Project Was Jointly Funded By:

Mainstream Deammonification vii

Chesapeake Elizabeth Treatment Plant (CETP), VA

The research concludes that mainstream deammonification can be achieved. It is possible

Keywords: Deammonification, mainstream deammonification, anammox ammonia-oxidizing

1.0 Single-Stage Mainstream Deammonification with Bioaugmentation – Mainstream

2.0 Full-Scale Pilots at Strass WWTP ................................................................................ 2-1

4.0 Process Modeling ........................................................................................................... 4-1

ES- 1Decision Matrix for Implementing Short-Cut Nitrogen Removal .................................ES-5

Mainstream Deammonification xiii

Mainstream Deammonification xvii

Mainstream Deammonification xix

Mainstream Deammonification xxi

Mainstream Deammonification xxiii

Mainstream Deammonification xxv

Mainstream Deammonification xxvii

Mainstream Deammonification ES-1

Mainstream Deammonification ES-3

Moderate Very high C/N

No/high ammonia limit Bioaugmentation

Low ammonia Bioaugmentation

Mainstream Deammonification ES-5

SINGLE-STAGE MAINSTREAM DEAMMONIFICATION

Figure 1-1. Blue Plains AWTP A-B Flowsheet with Deammonification.

Mainstream Deammonification 1-1

Figure 1-2. Deammonification System Key Components.

Mainstream Deammonification 1-3

Figure 1-3. Deammonification SBR Experimental Setup.

NO sampling port LDO Acid/base and carbon source

1.3.1.2 SBR Operations

Mainstream Deammonification 1-5

Phase Duration Reactor Condition Action

React – post anoxic 4-cycle – 35 min Mixer is on.

Settle/Decant 4-cycle – 75 min Mixer is off.

Idle 5 min Mixer is on.

Total Cycle Time 4-cycle – 6 hr

Mainstream Deammonification 1-7

Figure 1-5. Aeration Regimes Schematics.

Mainstream Deammonification 1-9

Phase I – 15°C Phase II – 25°C Phase II – 25°C at High Intermittent DO

Mainstream Deammonification 1-11

Figure 1-7. Sieve Protocol for Anammox Retention.

Figure 1-8. SBRs Feed UV Disinfection Performance.

Mainstream Deammonification 1-13

Figure 1-9. DO/ORP and pH Meters.

Mainstream Deammonification 1-15

Sampling/ Preservation/ Holding

Figure 1-10. Typical Profile During Normal SBR Cycle.

Mainstream Deammonification 1-17

Figure 1-11. Typical Profile During an AMX Activity Test.

1.3.2.6 Ex Situ Tests

Mainstream Deammonification 1-19