Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

Contents lists available at ScienceDirect

Biocatalysis and Agricultural Biotechnology

journal homepage: www.elsevier.com/locate/bab

Host induced gene silencing of Sclerotinia sclerotiorum effector

genes for the control of white mold
M.R. Maximiano a, b, d, e, L.S. Santos b, c, C. Santos a, b, d, e, F.J.L. Aragão b, S.C. Dias d, f,
O.L. Franco a, d, e, A. Mehta b, *
a
Programa de Pós Graduação em Ciências Biológicas (Imunologia e DIP/Genética e Biotecnologia, Universidade Federal de Juiz de Fora, MG, Brazil
b
Embrapa Recursos Genéticos e Biotecnologia, Brasília, DF, Brazil
c
Centro Universitário do Distrito Federal, Brasília, DF, Brazil
d
Centro de Analises Proteômicas e Bioquímicas, Programa de Pós-Graduação em Ciências Genômicas e Biotecnologia, Universidade Católica de
Brasília, Brasília, DF, Brazil
e
S-Inova Biotech, Pós-Graduação em Biotecnologia, Universidade Católica Dom Bosco, Campo Grande, MS, Brazil
f
Pós-graduação em Biologia Animal, Instituto de Biologia, Universidade de Brasília, Campus Darcy Ribeiro s/n - Asa Norte, Brasília – DF – Brazil

A R T I C L E I N F O A B S T R A C T

Keywords: Sclerotinia sclerotiorum (Lib.), the causal agent of white mold, is a necrotrophic fungus with
HIGS worldwide distribution. This fungus can infect more than 600 agricultural crops, causing damage
RNAi worth hundreds of millions of dollars annually. The control of white mold is usually performed
Disease control using integrated management practices. Nevertheless, after the establishment of the disease,
Transgenic plant chemical compounds need to be used, increasing production costs and offering environmental
risks. In this study, we used Host Induced Gene Silencing (HIGS) in an attempt to control white
mold. Specific vectors were constructed to express a silencing hairpin (dsRNAs) of the pathogen
effector genes Ss-caF1 (putative Ca2+ binding protein), SspG1d (endopolygalacturonase) and SsiTL
(integrin). The results showed a reduction in the severity of the symptoms in Arabidopsis thaliana
transgenic plants and a delay in the occurrence of early symptoms. The results obtained for the
control of S. sclerotiorum support the potential of HIGS in the generation of plants resistant to
phytopathogenic fungi. It is also possible to suggest that the effector genes Ss-caF1, SspG1d and
SsiTL are not only involved in the interaction but also play important roles during the host
colonization and infection process.

1. Introduction
Sclerotinia sclerotiorum (Lib.), the causal agent of white mold, is a phytopathogenic necrotrophic filamentous fungus (Bolton et al.,
2006) with a worldwide distribution, due to its capacity to adapt to different environmental conditions (Farr, 2014). The fungus is able
to infect a broad range of host species, from economically important crops to weeds found in the fields (Derbyshire et al., 2017; Ito and
Parisi, 2010; Reis and Lopes, 2007; Steadman, 1983). Crop infestations by S. sclerotiorum may cost several hundred million dollars
annually in pre and post-harvest losses (Peltier et al., 2012).
The control of white mold consists of integrated management practices such as the use of healthy seeds, elimination of crop residues
and field weeds, crop rotation and the use of tolerant plants (Reis and Lopes, 2007; Williams, 2007; Wyenandt, 2008). Biological

* Corresponding author. Embrapa Recursos Genéticos e Biotecnologia, PBI, Av. W/5 Norte Final, CEP 70770-917, Brasília, DF, Brazil.
E-mail address: angela.mehta@embrapa.br (A. Mehta).

https://doi.org/10.1016/j.bcab.2022.102302
Received 30 September 2021; Received in revised form 22 December 2021; Accepted 1 February 2022
Available online 4 February 2022
1878-8181/© 2022 Elsevier Ltd. All rights reserved.
M.R. Maximiano et al. Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

control with Trichoderma spp., an antagonist of S. sclerotiorum, has also been evaluated and used as an alternative for the control of
white mold (Boat et al., 2018; Sumida et al., 2018). However, chemical compounds are still massively used, increasing the cost of
production and offering the risk of environmental contamination (Gorgen, 2009; Harveson et al., 2010). In recent years, the need for
the development of efficient control measures, free from environmental contamination and damage to non-target species, as well as
reduced production costs, has increased (Gill and Garg, 2014; Özkara et al., 2016).
In this context, an alternative to control S. sclerotiorum is the use of Host-Induced Gene Silencing (HIGS), an approach based on the
ability of eukaryotes to suppress gene transcripts in a process known as post-transcriptional gene silencing (PTGS) (Ghag, 2017; Koch
and Kogel, 2014; Yin and Hulbert, 2015). Several studies have reported the use of HIGS for the control of insects (Ibrahim et al., 2017),
nematodes (Huang et al., 2006), virus (Aragao and Faria, 2009), parasitic plants (Tomilov et al., 2008) and fungi (Andrade et al.,
2016).
The efficiency of HIGS in silencing genes during an in vivo interaction between filamentous fungus and tobacco plants has been
demonstrated (Andrade et al., 2016; Tinoco et al., 2010; Yin and Hulbert, 2015, 2018; Zhou et al., 2016; Zhu et al., 2017). The pioneer
work done by Andrade et al. (2016) that showed the silencing of the constitutive chitin synthase gene in S. sclerotiorum opened new
doors for the selection of specific targets, such as genes involved in the plant-pathogen interaction. This gene selection can improve the
specificity and efficiency of the control of specific phytopathogens in several cultures without affecting other organisms (Andrade
et al., 2016; Yin and Hulbert, 2018; Zhou et al., 2016; Zhu et al., 2017).
There are several molecular mechanisms involved in the plant-necrotrophic fungal interactions, which show complex recognition
and signaling systems between organisms (Dodds and Rathjen, 2010). Various molecules involved in this process are called effectors,
which may serve as virulence molecules that act on host cell modulation and promote susceptibility to the pathogen (Dodds and
Rathjen, 2010; Franceschetti et al., 2017; Jones and Dangl, 2006). Effectors of necrotrophic pathogens can include several molecular
species, such as non-ribosomal peptides (PNRs), polyketides (PKSs), proteins, alkaloids, terpenes, or other metabolites (Vleeshouwers
and Oliver, 2014; Wang et al., 2014).
S. sclerotiorum has some known effectors such as Ss-caF1, a putative Ca+ binding protein (Wang et al., 2009; Xiao et al., 2014);
SSV263, a hypothetical protein (Liang et al., 2013); SspG1d, an endopolygalacturonase (Zuppini et al., 2005); SsiTL, an integrin (Zhu
et al., 2013); and SsSSVP1, a protein not yet characterized (Lyu et al., 2016). The plant targets of these effectors are still not clear,
except for SspG1d, that targets iPG-1 - a protein involved in the signaling process of Ca 2+ ionophore in the plant cell (Wang et al., 2009)
- and SsSSVP1, which targets QCR8 - a subunit of the mitochondria cytochrome b-c1 complex, capable of deactivating its biological
function and causing the death of plant cells (Lyu et al., 2016). In this study, we propose the use of HIGS to silence specific effector
genes with the potential to modulate plant-pathogen interaction and thus control white mold disease.

2. Materials and methods

2.1. Selection of target genes
The selection of Ss-caF1 (SS1G_02486), SspG1d (SS1G_10167) and SsiTL (SS1G_14133) as the target genes was performed based on
the literature data and in the previous analysis of gene expression of several effectors of S. sclerotiorum during in vitro interaction with
different hosts (Maximiano et al., 2020).

2.2. Vector construction and plant transformation

The synthesis and cloning of the specific gene fragments in the sense and antisense orientation into the vector pRNAi-psiuK were
performed by Epoch Company. Selection of the dsRNA sequence was performed by Mfold (Zuker, 2003) and the sequences with the
most negative difference in Gibb’s free energy (ΔG; Kcal/mol) were chosen. Additionally, a cutoff of 400 base pairs was also applied to
facilitate the hairpin-dsRNA formation. Off-targets were predicted by siRNA Finder (https://www.genscript.com/tools/sirna-target-
finder) (Luck et al., 2019) and dscheck (http://dscheck.rnai.jp/) (Naito et al., 2005) tools, which did not identify hits in Arabdopsis
thaliana and human. Fragments of SspG1d (GenBank accession n◦ . AF501307.1) in position 693 to 1008, SsiTL (GenBank accession n◦
XM_001584800.1) in position 331 to 730 and Ss-caF1 (GenBank accession n◦ XM_001596216.1) in position 71 to 470 were selected
and cloned 5 ’→ 3’ (sense) between the SacI and EcoRI restriction sites and 3 ’→ 5’ (antisense) between the BstBI and HindIII restriction
sites. The intraspecific sequence of the Pyruvate Orthophosphate Dikynase (PDK) gene from Flaveria trinervia was inserted between the
fragments, constituting the sequence referred to as intron-hairpin. The intron-hairpin sequence was generated under the control of the
constitutive promoter of cauliflower mosaic virus, CaMV35S. The bar gene was inserted into the vector for resistance selection through
herbicides such as glufosinate ammonium. The vectors generated were named pRNAi-psiuK-Effector-Ss-caF1, pRNAi-psiu­
K-Effector-SspG1d and pRNAi-psiuK-Effector-SsiTL, and were transfected into Agrobacterium tumefaciens GV3101 by electroporation
(Sambrook et al., 1989). Arabidopsis thaliana (L.) Heynh. Columbia-0 transformation was performed using the floral dip method
(Clough and Bent, 1998).

2.3. Screening of transgenic plants

Plants transformed by floral dip were conditioned in a controlled environment at 21 ◦ C with a photoperiod of 12 h until maturation
and collection of the seeds (T0). The T0 seeds were germinated in soil and maintained under the same conditions. This process was
repeated to obtain homozygous plants of at least three transgenic lines. The plants were analyzed for the presence of the intron-specific
hairpin by selection with the herbicide glufosinate ammonium (20 mg.L− 1), for 15 days.

2
M.R. Maximiano et al. Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

2.4. Molecular characterization of transgenic plants

After screening of transgenic plants by resistance against herbicide, leaves of selected plants were collected and DNA and RNA
isolation was performed (Doyle and Doyle, 1990; Simms et al., 1993). PCR was carried out to confirm the presence of the dsRNA in
each transgenic line using 100 ng of genomic DNA, 1 U of polymerase DNA (Taq DNA polymerase® GE Healthcare Life Sciences), 1X
PCR reaction buffer (GE Healthcare Life Sciences), 1 μM of each primer, 250 μM dNTPs and 2.5 mM MgCl2. The reaction was carried
out in a Veriti 96 Well Thermal Cycler (Applied Biosystems) with a program of 95 ◦ C for 3 min; 30 cycles of 95 ◦ C for 30 s, 55 ◦ C for 30 s
e 72 ◦ C for 40 s; and a last step of 72 ◦ C for 5 min. Specific primers for each vector/gene were used (Table 1). The PCR products were
visualized on 1% agarose gel, stained with ethidium bromide.
Northern blotting was performed to confirm the presence of specific siRNA in transgenic plants. DIG High Prime DNA Labeling and
Detection Starter Kit II (Roche Applied Science) was used. Total RNA (30 μg) was purified and separated on a 15% acrylamide gel, and
transferred to Biodyne® nylon membrane (Hybond-N+; Life Technologies) according by Panwar et al. (Panwar and Bakkeren, 2013).
Northern hybridizations were carried out using the PCR amplified ~200-bp fragment from each specific gene, labeled with
digoxigenin (DIG)-11- deoxyuridine triphosphate (dUTP) using a DIG-High Prime DNA Labeling (Roche Applied Science) according to
the manufacturer’s instructions. Following hybridization with the probe, chemiluminescence substrate CSPD was used for immuno­
logical detection of hybridization signals using X-ray film (Carestream).

2.5. Sclerotinia sclerotiorum bioassay and symptom evaluation of transgenic lines

The bioassay was performed using the transformed homozygous plants, cultivated in a controlled environment at 21 ◦ C with a
photoperiod of 12h, approximately 30 days after germination. The fungus S. sclerotiorum, isolated from bean fields of the state of Goiás,
Brazil, was grown in synthetic PDA (potato dextrose agar) for 7 days at 28 ◦ C. A total of 1–2 sclerotia were collected from solid media
and inoculated in 100 ml of PDB (potato dextrose broth), kept at 28 ◦ C and agitation at 180 rpm in the dark, for 3 days. The OD600 was
adjusted to 0.8 and 500 μL of culture were inoculated at the center of the plant rosettes. Three biological replicates (independent
events), with 6 technical replicates each, were used for the bioassay. The control group was composed of 3 biological replicates of
untransformed plants (wild type), with 6 technical replicates each. The plants were conditioned in a humid chamber, under 24 ◦ C ±
2 ◦ C in the dark. These plants were monitored and evaluated at 24 h after inoculation (hai), 48 hai, 72 hai, and 168 hai.
To evaluate the symptoms of white mold, a severity scale (Supplementary Table 1) was adapted based on Knecht et al. (2010) and
Chang et al. (2018). This scale from 0 (no symptoms) to 20 (plant death), was used and then the disease severity index (DSI) formula
developed by Grau et al. (1982) was applied. A t-student test, with an alpha value of 0.05, was performed to infer the significance of
changes in DSI between plant populations.

2.6. Evaluation of target genes by qRT-PCR

During the bioassay with S. sclerotiorum, mycelium were collected 24, 48 and 72 h after inoculation (hai) and total RNA were
extracted using Trizol® (Chomczynski and Sacchi, 2006). The integrity of total RNA was confirmed by electrophoresis. Before cDNA
synthesis, RNA was treated with Turbo DNAse (Applied Biosystems/Ambion, Foster City, CA, USA) according to the manufacturer’s
instructions to eliminate any possible contamination with genomic DNA. cDNA was synthesized from 1 μg of total RNA using the kit Go
Script Reverse Transcription System (Promega, Madison, WI, USA) according to the manufacturer’s instructions.
The qRT-PCR experiments were performed in the thermal cycler 7300 Real-Time polymerase chain reaction (PCR) System (Applied
Biosystems, Foster City, CA, USA) as described by Maximiano et al. (2017). All experiments were performed using three independent
biological replicates, each with three technical replicates. The raw data of fluorescence for all runs were imported into the Real-time
PCR Miner software (Zhao and Fernald, 2005) in order to determine the quantification cycle value and the PCR efficiency. The analyses
of expression and statistics were performed using the Relative Expression Software Tool (REST) software (Pfaffl et al., 2002).

3. Results
3.1. Screening and molecular characterization of transgenic plants
Resistant plants screened by herbicide selection (Supplementary Fig. 1A) were cultivated for three generations to obtain

Table 1
Primers used in this study.

Gene Name Accession Forward Primer (5′ to 3′ ) Tm (◦ C) Reverse Primer (5′ to 3′ ) Tm (◦ C) Amplicon Size (pb)
a
Ss-caF1 SS1G_02486 AGAAACCTTTAACCGTGGAT 53.0 TCTCCTTCAGCAAATCAACT 53.0 219
SspG1a SS1G_10167 ATCCTCCACCATCAAGAACT 55.0 GTTGGAGAGAGTGACACCAG 57.0 208
SsiTLa SS1G_14133 TACAAGACACGGACTGTTGA 55.0 TTAGCGCTATAAGGTCCAAG 53.0 250
Ss-caF1b SS1G_02486 AGAGGATTTGATACATCCGGAG 57.1 TGTTCAACAACGGGCATCTT 58.3 108
SspG1b SS1G_10167 AACTGCTGCACCAAACGTTG 60.2 AAGCCTTGGACTTGATGGCA 59.9 110
SsiTLb SS1G_14133 CCCTTGAGAAACGTGCTCCA 60.2 TCACCAGTGGCGTCAATCAA 59.9 105
Actinc SS1G_08733 AAGCCGTCCTCTCCCTTTAC 59.1 ATGGCGTGAGGAAGTGAGAA 59.02 115
b tubulinc SS1G_04652 TGAAGGAGGTTGAGGACCAA 58.19 GGGGAGGAATGGAGCAAAG 57.8 108
a
Primers used in conventional PCR for screening transgenic plant.
b
Primers used in qRT-PCR.
c
Reference genes used in qRT-PCR.

3
M.R. Maximiano et al. Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

Fig. 1. Evaluation of transgenic plants [engineered to express dsRNA corresponding to the fungal Ss-caF1 (A) Ss-pG1d (B) and SsiTL (C) genes] and wild type Ara­
bidopsis thaliana challenged with Sclerotinia sclerotiorum at 24, 48, 72, and 168 h after inoculation (hai).

4
M.R. Maximiano et al. Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

homozygous plants (Supplementary Fig. 1B) and screened by PCR (Supplementary Figure 2 A). Northern blotting analyses showed
siRNA detectable bands of the expected size range (<30 nt) in transgenic plants (Supplementary Figure 2 C).

3.2. Symptom evaluation of transgenic lines and analysis of target genes by qRT-PCR
Transgenic lines were challenged against the fungus and the symptoms were evaluated (Fig. 1). Scores were attributed according to
the presence of symptoms (Supplementary Fig. 3) and used to evaluate the disease severity index (DSI) (Fig. 2 A and Supplementary
Table 2). The results showed the presence of typical white mold symptoms in all evaluated plants (Fig. 1), however, a reduction in the
DSI in transgenic plants was observed when compared to the wild type (Fig. 2 B).
Plants expressing the intron-hairpin gene Ss-caF1 presented a low DSI of only 5.28 at 24 hai, but increased to 43.33, 58.06 and
73.61 at 48 hai, 72 hai and 168 hai, respectively. Transgenic A. thaliana plants expressing the Ss-caF1 silencing cassette had a sig­
nificant reduction of almost 87% in the disease severity at 24 hai. Even though the symptoms increased within the next days, a lower
DSI was observed in the transgenic plants when compared to WT (non-transgenic) plants (Fig. 2 A).
The reduction in DSI of transgenic plants expressing the intron-hairpin SspG1d at the first hours after inoculation, showed a
decrease in the DSI of almost 37% at 24 hai, when compared to the control. However, as the disease symptoms progressed a DSI of
45.28, 55.00, and 83.61 was observed at 48 hai, 72 hai, and 168 hai, respectively. In our study a reduction of only 6.23% in the severity
of symptoms was obtained when compared to the control, even though a successful down regulation of this gene was observed (Fig. 2
C).
Plants transformed with the intron-hairpin gene SsiTL showed a promising result on all evaluated time points. At the first 72 hai,
plants presented a reduction of DSI of approximately 20% compared to the control. However, these plants presented a DSI of only
60.00 (almost 30% reduction compared to control plants) at the final evaluation time. Consequently, a higher number of plants
survived, with 67% of plants alive at 168 hai. Interestingly, RT-qPCR analysis revealed that all genes in all sampled times were down
regulated (Fig. 2 C).

4. Discussion
In the last years, RNAi technology by dsRNAs, such as HIGS, has been extensively employed in agriculture to improve several traits,
including the control of several phytopathogens (Koch and Kogel, 2014; Nowara et al., 2010; Quoc and Nakayashiki, 2015; Van de
Wouw and Idnurm, 2019). This potential application can be employed for the development of resistant plants against filamentous
fungus, and contribute to reduce the use of chemical compounds (Das and Sherif, 2020).

Fig. 2. A. Disease Severity Index (DSI) of white mold in transgenic Arabidopsis thaliana at 24, 48, 72, and 168 h after inoculation (hai). B. Relative DSI reduction in
transgenic plants at 24 hai, 48 hai, 72 hai, and 168 hai. (*) in bars represent statistical significance (p < 0.05). C. Relative gene expression of target genes in Sclerotinia
sclerotiorum at 24 hai, 48 hai, and 72 hai (recovered from transgenic plants). The gene expression values were calculate using REST software (ΔΔCt method) and
normalized to the reference gene actin and β-tubulin. Each value represents the mean of three independent experiments with three technical replicates, mean ± std
error values (expressed in log2). (*) in bars represent statistical significance (p < 0.05).

5
M.R. Maximiano et al. Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

The use of HIGS to promote gene silencing in filamentous fungi was initially proposed by Tinoco et al. (2010) in transgenic plants of
Nicotiana tabacum cv. xanthi, which expressed a dsRNA that targeted the uidA reporter gene. This dsRNA processed by the RISC system
at the plant could generate siRNAs. The generated siRNAs were acquired by the filamentous fungus Fusarium verticillioides, capable of
expressing the uidA gene during the plant-pathogen interaction. The uidA gene expressed in the fungus was silenced, thus demon­
strating that it was possible to use HIGS to silence genes in filamentous fungi.
The first study to demonstrate silencing of a specific gene in S. sclerotiorum using HIGS was performed by Andrade et al. (2016).
These authors generated transgenic plants of Nicotiana tabacum able to silence chitinase synthase gene and observed a decrease in the
severity of symptoms (55.5%–86% at 72 hai) and a delay in their appearance after infection with S. sclerotiorum, as observed in this
work. However, chitinase is a common gene, shared by several fungi and therefore may also cause gene silencing in non-target or­
ganisms. In this study, we have targeted previously validated potential effectors of S. sclerotiorum in an attempt to verify their role in
virulence and develop a method for the control of white mold.
Our results showed that plants expressing the intron-hairpin gene Ss-caF1 presented a reduction of DSI during evaluation. Ss-caF1
can play a key role in appressoria formation and sclerotia development (Xiao et al., 2014). Mutants of S. sclerotiorum with depleted
Ss-caF1 presented an increased sensitivity to saline and osmotic stress, abnormal development of sclerotia, reduced melanization and
size, and inability to germinate (Xiao et al., 2014; Xu et al., 2018). Moreover, these mutants were also not able to produce appressoria
and consequently were unable to induce lesions on Brassica napus leaves (Xiao et al., 2014). Interestingly, this gene was downregulated
during in vitro interaction with MEVM-Beggarticks (culture media based in vegetal extract of Beggarticks). Additionally, during this
interaction, an incomplete formation of the sclerotia was observed (Maximiano et al., 2020). Although these in vitro studies suggested
that the decrease in Ss-caF1 expression can be involved in morphological defects in sclerotia formation and general development in
germination phase, their role remain unclear (Mbengue et al., 2016).
In this study, the results reinforce the involvement of this gene in the initial infection phase. The result obtained here may indicate
the role of Ss-caF1 in the disease establishment, and may provide a delay in disease development, since the transgenic A. thaliana plants
expressing the Ss-caF1 silencing cassette had a significant reduction of almost 87% in the disease severity at 24 hai.
Plants expressing the intron-hairpin SspG1d presented a reduction in DSI of transgenic only in the first hours after inoculation.
SspG1d gene encodes an endopolygalacturonase (PGs) (Zuppini et al., 2005), a component of the group of pectinolytic enzymes. These
enzymes act on the degradation of the host cell wall, crucial to the colonization of the plant tissue and determinant in pathogenicity
and virulence of S. sclerotiorum. Li et al. (2004) demonstrated that the expression of SspG1d can be induced by abiotic stress, such as
nutritional starvation and Zuppini et al. (2005) reported that this gene can be related to the induction of host programmed cell death
(PCD), favoring the penetration of pathogens by the leaf cuticle and the expansion of the lesion. However, a host intracellular
increment of Ca2+ was also observed, suggesting the existence of a signaling pathway mediated by these ions induced by the PGs
secreted by the pathogen.
This hypothesis was further confirmed by yeast two-hybrid assays on the cDNA library of B. napus, and the protein IPG-1 was
detected in the host (Wang et al., 2009). This protein was characterized as targeting SspG1d, and the authors inferred that the PG-IPG-1
complex may be related to a defense signaling pathway (Wang et al., 2009). Interestingly, a previous study evaluating the expression of
genes involved in the early stage of S. sclerotiorum-B. napus interaction revealed an increase in the expression of SspG1d at 48 hai, and
suggests that this phenomena occurs in response to changes in environmental pH, and that SsPG1 expression is involved in sclerotia
development (Seifbarghi et al., 2017). Nevertheless, results of our study suggest that S. sclerotiorum could bypass the down regulation
of this gene using alternative strategies for infection establishment.
Plants transformed with the intron-hairpin gene SsiTL showed a promising result during evaluation. SsiTL encodes an integrin and
can be related to the suppression of the signaling pathways of jasmonic acid and ethylene, increasing the susceptibility of the host. In a
study performed by Zhu et al. (2013), an increase in SsiTL expression was observed at the first 12 h of infection in A. thaliana plants. In
addition, when SsiTL was silenced, the host developed resistance to the fungus, and an increase in expression of host defense genes
during the first hours of interaction was also observed. Moreover, these mutants presented an anomalous hyphae growth, and the
development and germination of sclerotia were affected. Additionally, a recent study showed that SsITL effector interacts with a
chloroplast-localized calcium-sensing receptor, CAS, in chloroplasts inhibiting SA accumulation in the initial phase of infection, thus
facilitating the infection of S. sclerotiorum (Tang et al., 2020). All this information may support the results obtained in this study,
showing that suppressing SsiTL expression in the pathogen may be an effective control of white mold.
Several studies reported gene silencing in fungi using HIGS (Andrade et al., 2016; Ghag et al., 2014; Govindarajulu et al., 2015;
Panwar et al., 2013; Yin and Hulbert, 2018; Yin et al., 2011).
However, most of them are related to biotrophic fungi, which establish long periods of interaction with the host for nutrition by
cellular products, without causing their death (Delaye et al., 2013). This characteristic enables the transfer of RNAi molecules pro­
duced and stored by hosts for the pathogen (Cai et al., 2018).
The interaction of S. sclerotiorum with the host is more aggressive, relying on the secretion of several enzymes and toxins for the
degradation of the host cell wall, and was considered necrotrophic for several years (Bolton et al., 2006). However, recent studies
designated S. sclerotiorum as a hemibiotrophic phytopathogen due to the evidence that, at the beginning of infection, there is a short
biotrophic phase, which may last only a few hours (Kabbage et al., 2015). This feature allows the transfer of siRNAs from the host to the
pathogen in the early hours of infection and may explain the higher reduction of DSI at the first 24 hai, for Ss-caF1 and SsiTL target
genes in this study.
One of the major challenges faced by performed studies aiming at the evaluation of the efficacy of RNAi by dsRNAs for plant disease
control was the experimental condition. Most of these studies were carried out using approaches such as detached leaves, co-
inoculation of dsRNAs with target viruses, and others (Das and Sherif, 2020). Here, this challenge was bypassed by the

6
M.R. Maximiano et al. Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

development of model plants engineered to express dsRNA corresponding to the fungal Ss-caF1, Ss-pG1d, and SsiTL effector genes.
These transgenic lines were challenge with S. sclerotiorum during 168h, and the obtained results confirmed the high potential of HIGS
in S. sclerotiorum control.

5. Conclusion
In the present work, we were able to generate transgenic Arabidopsis thaliana plants producing siRNAs capable of silencing specific
effector genes of S. scletoriorum. These plants, when challenged with the fungus, showed a decrease in the intensity of white mold
symptoms and increased the overall survival rate of plants. The results here obtained support the potential of HIGS in the generation of
resistant plants against phytopathogenic fungi and suggest that the effector genes Ss-caF1, SspG1d, and SsiTL play an important role in
the interaction during host colonization and infection. Moreover, the association between this study and the data available in the
literature may suggest that the host resistance to white mold is conditioned not only by a single gene but by a multigenic regulation
complex, although additional studies would be necessary to evaluate the effects of multiple HIGS on the same plant.

Funding
This research was sponsored by Empresa Brasileira de Pesquisa Agropecuária (Embrapa), Conselho Nacional de Desenvolvimento
Científico e Tecnológico (CNPq), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) - Finance Code 001,
Fundação de Apoio a Pesquisa do Estado de Mato Grosso do Sul (FUNDECT) and Fundação de Apoio à Pesquisa do Distrito Federal
(FAPDF) - Process number 0193.001459/2016.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to
influence the work reported in this paper.

Author contributions
Maximiano, M. R. planned, carried out the experiments and wrote the manuscript. Santos, L. S. carried out the bioassay and
contributed in molecular biology experiments. Santos, C. contributed in plant transformation. Aragão, F. J. L. contributed in vector
design. Dias, S. C. assisted in the target gene selection. Franco, O. L. planned and supervised the work. Mehta, A. conceived the study
and was in charge of overall direction and planning. All authors provided critical feedback and helped shape the research, analysis and
manuscript.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.bcab.2022.102302.

References
Andrade, C.M., Tinoco, M.L.P., Rieth, A.F., Maia, F.C.O., Aragão, F.J.L., 2016. Host-induced gene silencing in the necrotrophic fungal pathogen Sclerotinia sclerotiorum.
Plant Pathol. 65, 626–632.
Aragao, F.J., Faria, J.C., 2009. First transgenic geminivirus-resistant plant in the field. Nat. Biotechnol. 27, 1086–1088.
Boat, M.A.B., Iacomi, B., Sameza, M.L., Boyom, F.F., 2018. Fungicide tolerance and effect of environmental conditions on growth of Trichoderma spp. with
antagonistic activity against Sclerotinia sclerotiorum causing white mold of common bean (Phaseolus vulgaris). Int. J. Innov. Approaches Agric. Res. 2, 226–243.
Bolton, M.D., Thomma, B.P., Nelson, B.D., 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Mol. Plant Pathol.
7, 1–16.
Cai, Q., Qiao, L., Wang, M., He, B., Lin, F.-M., Palmquist, J., Huang, S.-D., Jin, H., 2018. Plants send small RNAs in extracellular vesicles to fungal pathogen to silence
virulence genes. Science 360, 1126–1129.
Chang, H.X., Sang, H., Wang, J., McPhee, K.E., Zhuang, X., Porter, L.D., Chilvers, M.I., 2018. Exploring the genetics of lesion and nodal resistance in pea (Pisum
sativum L.) to Sclerotinia sclerotiorum using genome-wide association studies and RNA-Seq. Plant direct 2, e00064.
Chomczynski, P., Sacchi, N., 2006. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty-something years
on. Nat. Protoc. 1, 581–585.
Clough, S.J., Bent, A.F., 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743.
Das, P.R., Sherif, S.M., 2020. Application of exogenous dsRNAs-induced RNAi in agriculture: challenges and triumphs. Front. Plant Sci. 11, 946.
Delaye, L., García-Guzmán, G., Heil, M., 2013. Endophytes versus biotrophic and necrotrophic pathogens—are fungal lifestyles evolutionarily stable traits? Fungal
Divers. 60, 125–135.
Derbyshire, M., Denton-Giles, M., Hegedus, D., Seifbarghy, S., Rollins, J., van Kan, J., Seidl, M.F., Faino, L., Mbengue, M., Navaud, O., Raffaele, S., Hammond-
Kosack, K., Heard, S., Oliver, R., 2017. The complete genome sequence of the phytopathogenic fungus Sclerotinia sclerotiorum reveals insights into the genome
architecture of broad host range pathogens. Genome Biol. Evol. 9 (3), 593–618.
Dodds, P.N., Rathjen, J.P., 2010. Plant immunity: towards an integrated view of plant-pathogen interactions. Nat. Rev. Genet. 11, 539–548.
Doyle, J.J., Doyle, J.L., 1990. Isolation ofplant DNA from fresh tissue. Focus 12, 39–40.
Farr DFR, A.Y., 2014. Fungal Databases, Systematic Mycology and Microbiology Laboratory. ARS, USDA.
Franceschetti, M., Maqbool, A., Jimenez-Dalmaroni, M.J., Pennington, H.G., Kamoun, S., Banfield, M.J., 2017. Effectors of filamentous plant pathogens:
commonalities amid diversity. Microbiol. Mol. Biol. Rev. 81, 1–17.
Ghag, S.B., 2017. Host induced gene silencing, an emerging science to engineer crop resistance against harmful plant pathogens. Physiol. Mol. Plant Pathol. 100,
242–254.

7
M.R. Maximiano et al. Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

Ghag, S.B., Shekhawat, U.K., Ganapathi, T.R., 2014. Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient
resistance against Fusarium wilt in banana. Plant Biotechnol. J. 12, 541–553.
Gill, H.K., Garg, H., 2014. Pesticides: Environmental Impacts and Management Strategies Pesticides-Toxic Aspects. IntechOpen.
Gorgen, C.A., 2009. Manejo do mofo branco da soja com palhada de Brachiaria ruziziensis e Trichoderma harzianum 1306. Dissertação (Mestrado) - Universidade
Federal de Goiás - Jataí (GO): 78.
Govindarajulu, M., Epstein, L., Wroblewski, T., Michelmore, R.W., 2015. Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of
lettuce. Plant Biotechnol. J. 13, 875–883.
Grau, C., Radke, V., Gillespie, F., 1982. Resistance of Soybean Cultivars to Sclerotinia sclerotiorum. Plant Diseases.
Harveson, R.M., Steadman, J.R., Urrea, C.A., 2010. Integrating planting dates and fungicide applications for managing white mold of dry beans in Western Nebraska.
Plant Health Prog. 11, 1–8.
Huang, G., Allen, R., Davis, E.L., Baum, T.J., Hussey, R.S., 2006. Engineering broad root-knot resistance in transgenic plants by RNAi silencing of a conserved and
essential root-knot nematode parasitism gene. Proc. Natl. Acad. Sci. Unit. States Am. 103, 14302–14306.
Ibrahim, A.B., Monteiro, T.R., Cabral, G.B., Aragão, F.J.L., 2017. RNAi-mediated resistance to whitefly (Bemisia tabaci) in genetically engineered lettuce (Lactuca
sativa). Transgenic Res. 26, 613–624.
Ito, M.F., Parisi, J.J.D., 2010. Mofo-branco: Doença que exige muita atenção, principalmente no período outono-inverno. JV Biotecnologia 1, 1–5.
Jones, J.D., Dangl, J.L., 2006. The plant immune system. Nature 444, 323–329.
Kabbage, M., Yarden, O., Dickman, M.B., 2015. Pathogenic attributes of Sclerotinia sclerotiorum: switching from a biotrophic to necrotrophic lifestyle. Plant Sci. 233,
53–60.
Knecht, K., Seyffarth, M., Desel, C., Thurau, T., Sherameti, I., Lou, B., Oelmuller, R., Cai, D., 2010. Expression of BvGLP-1 encoding a germin-like protein from sugar
beet in Arabidopsis thaliana leads to resistance against phytopathogenic fungi. Mol. Plant Microbe Interact. 23, 446–457.
Koch, A., Kogel, K.H., 2014. New wind in the sails: improving the agronomic value of crop plants through RNAi-mediated gene silencing. Plant Biotechnol. J. 12,
821–831.
Li, R., Rimmer, R., Buchwaldt, L., Sharpe, A.G., Seguin-Swartz, G., Hegedus, D.D., 2004. Interaction of Sclerotinia sclerotiorum with Brassica napus: cloning and
characterization of endo-and exo-polygalacturonases expressed during saprophytic and parasitic modes. Fungal Genet. Biol. 41, 754–765.
Liang, Y., Yajima, W., Davis, M.R., Kav, N.N.V., Strelkov, S.E., 2013. Disruption of a gene encoding a hypothetical secreted protein from Sclerotinia sclerotiorum
reduces its virulence on canola (Brassica napus). J. Indian Dent. Assoc. 35, 46–55.
Luck, S., Kreszies, T., Strickert, M., Schweizer, P., Kuhlmann, M., Douchkov, D., 2019. siRNA-finder (si-Fi) software for RNAi-target design and off-target prediction.
Front. Plant Sci. 10, 1023.
Lyu, X., Shen, C., Fu, Y., Xie, J., Jiang, D., Li, G., Cheng, J., 2016. A small secreted virulence-related protein is essential for the necrotrophic interactions of Sclerotinia
sclerotiorum with its host plants. PLoS Pathog. 12, e1005435.
Maximiano, M.R., Miranda, V.J., de Barros, E.G., Dias, S.C., 2020. Validation of an in vitro system to trigger changes in the gene expression of effectors of Sclerotinia
sclerotiorum. J. Appl. Microbiol. 131 (2), 885–897.
Maximiano, M.R., Oliveira-Neto, O.B., Franco, O.L., Mehta, A., 2017. Validation of an in vitro system for studies of pathogenicity mechanisms in Xanthomonas
campestris. FEMS Microbiol. Lett. 364.
Mbengue, M., Navaud, O., Peyraud, R., Barascud, M., Badet, T., Vincent, R., Barbacci, A., Raffaele, S., 2016. Emerging trends in molecular interactions between plants
and the broad host range fungal pathogens Botrytis cinerea and Sclerotinia sclerotiorum. Front. Plant Sci. 7, 422.
Naito, Y., Yamada, T., Matsumiya, T., Ui-Tei, K., Saigo, K., Morishita, S., 2005. dsCheck: highly sensitive off-target search software for double-stranded RNA-mediated
RNA interference. Nucleic Acids Res. 33, W589–W591.
Nowara, D., Gay, A., Lacomme, C., Shaw, J., Ridout, C., Douchkov, D., Hensel, G., Kumlehn, J., Schweizer, P., 2010. HIGS: host-induced gene silencing in the obligate
biotrophic fungal pathogen Blumeria graminis. Plant Cell 22, 3130–3141.
Özkara, A., Akyıl, D., Konuk, M., 2016. Pesticides, Environmental Pollution, and Health Environmental Health Risk-Hazardous Factors to Living Species. IntechOpen.
Panwar, V., Bakkeren, G., 2013. A high resolution short interfering RNA (siRNA) detection method from virus-infected plants. Bio-protocol 3 e940-e940.
Panwar, V., McCallum, B., Bakkeren, G., 2013. Host-induced gene silencing of wheat leaf rust fungus Puccinia triticina pathogenicity genes mediated by the Barley
stripe mosaic virus. Plant Mol. Biol. 81, 595–608.
Peltier, A.J., Bradley, C.A., Chilvers, M.I., Malvick, D.K., Mueller, D.S., Wise, K.A., Esker, P.D., 2012. Biology, yield loss and control of Sclerotinia stem rot of soybean.
J. Integrated Pest Manag. 3, B1–B7.
Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression
results in real-time PCR. Nucleic Acids Res. 30, e36.
Quoc, N.B., Nakayashiki, H., 2015. RNA Silencing in Filamentous Fungi: from Basics to Applications Genetic Transformation Systems in Fungi, vol. 2. Springer,
pp. 107–124.
Reis, A., Lopes, C.A., 2007. Epidemiologia e manejo do mofo-branco em hortaliças. Embrapa Hortaliças-Comunicado Técnico (INFOTECA-E) 1, 1–5.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a Laboratory Manual. Cold spring harbor laboratory press.
Seifbarghi, S., Borhan, M.H., Wei, Y., Coutu, C., Robinson, S.J., Hegedus, D.D., 2017. Changes in the Sclerotinia sclerotiorum transcriptome during infection of Brassica
napus. BMC Genom. 18, 1–37.
Simms, D., Cizdziel, P.E., Chomczynski, P., 1993. TRIzol: a new reagent for optimal single-step isolation of RNA. Focus 15, 532–535.
Steadman, J.R., 1983. White mold - a serious yield-limiting disease of bean. Plant Dis. 67, 346–350.
Sumida, C.H., Daniel, J.F., Araujod, A.P.C., Peitl, D.C., Abreu, L.M., Dekker, R.F., Canteri, M.G., 2018. Trichoderma asperelloides antagonism to nine Sclerotinia
sclerotiorum strains and biological control of white mold disease in soybean plants. Biocontrol Sci. Technol. 28, 142–156.
Tang, L., Yang, G., Ma, M., Liu, X., Li, B., Xie, J., Fu, Y., Chen, T., Yu, Y., Chen, W., Jiang, D., Cheng, J., 2020. An effector of a necrotrophic fungal pathogen targets the
calcium-sensing receptor in chloroplasts to inhibit host resistance. Mol. Plant Pathol. 21, 686–701.
Tinoco, M.L., Dias, B.B., Dall’Astta, R.C., Pamphile, J.A., Aragao, F.J., 2010. In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-
stranded RNA. BMC Biol. 8, 27.
Tomilov, A.A., Tomilova, N.B., Wroblewski, T., Michelmore, R., Yoder, J.I., 2008. Trans-specific gene silencing between host and parasitic plants. Plant J. 56,
389–397.
Van de Wouw, A.P., Idnurm, A., 2019. Biotechnological potential of engineering pathogen effector proteins for use in plant disease management. Biotechnol. Adv. 37
(6), 107387.
Vleeshouwers, V.G.A.A., Oliver, R.P., 2014. Effectors as tools in disease resistance Breeding against biotrophic, hemibiotrophic, and necrotrophic plant pathogens.
Mol. Plant Microbe Interact. 27, 196–206.
Wang, X., Jiang, N., Liu, J., Liu, W., Wang, G.L., 2014. The role of effectors and host immunity in plant-necrotrophic fungal interactions. Virulence 5, 722–732.
Wang, X., Li, Q., Niu, X., Chen, H., Xu, L., Qi, C., 2009. Characterization of a canola C2 domain gene that interacts with PG, an effector of the necrotrophic fungus
Sclerotinia sclerotiorum. J. Exp. Bot. 60, 2613–2620.
Williams, P.H., 2007. In: Rimmer, R.S., Shattuk, V.I., Buchwaldt, L. (Eds.), Black Rot, vol. 1, pp. 60–62.
Wyenandt, A., 2008. Controlling Black rot of cabbage and other crucifer crops. Plant & Pest Advisory 1, 1–6.
Xiao, X., Xie, J., Cheng, J., Li, G., Yi, X., Jiang, D., Fu, Y., 2014. Novel secretory protein Ss-caF1 of the plant-pathogenic fungus Sclerotinia sclerotiorum is required for
host penetration and normal sclerotial development. Mol. Plant Microbe Interact. 27, 40–55.
Xu, L., Li, G., Jiang, D., Chen, W., 2018. Sclerotinia sclerotiorum: an evaluation of virulence theories. Annu. Rev. Phytopathol. 56, 311–338.
Yin, C., Hulbert, S., 2015. Host induced gene silencing (HIGS), a promising strategy for developing disease resistant crops. Gene Technology 4, 130–131.
Yin, C., Hulbert, S.H., 2018. Host-induced gene silencing (HIGS) for elucidating Puccinia gene function in wheat. In: Ma, W., Wolpert, T. (Eds.), Plant Pathogenic Fungi
and Oomycetes: Methods and Protocols. Springer New York, New York, NY, pp. 139–150.

8
M.R. Maximiano et al. Biocatalysis and Agricultural Biotechnology 40 (2022) 102302

Yin, C., Jurgenson, J.E., Hulbert, S.H., 2011. Development of a host-induced RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp. tritici. Mol. Plant
Microbe Interact. 24, 554–561.
Zhao, S., Fernald, R.D., 2005. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J. Comput. Biol. 12, 1047–1064.
Zhou, B., Bailey, A., Niblett, C.L., Qu, R., 2016. Control of brown patch (Rhizoctonia solani) in tall fescue (Festuca arundinacea Schreb.) by host induced gene silencing.
Plant Cell Rep. 35, 791–802.
Zhu, W., Wei, W., Fu, Y., Cheng, J., Xie, J., Li, G., Yi, X., Kang, Z., Dickman, M.B., Jiang, D., 2013. A secretory protein of necrotrophic fungus Sclerotinia sclerotiorum
that suppresses host resistance. PLoS One 8, e53901.
Zhu, X., Qi, T., Yang, Q., He, F., Tan, C., Ma, W., Voegele, R.T., Kang, Z., Guo, J., 2017. Host-induced gene silencing of the MAPKK gene PsFUZ7 confers stable
resistance to wheat stripe rust. Plant Physiol. 175, 1853–1863.
Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415.
Zuppini, A., Navazio, L., Sella, L., Castiglioni, C., Favaron, F., Mariani, P., 2005. An endopolygalacturonase from Sclerotinia sclerotiorum induces calcium-mediated
signaling and programmed cell death in soybean cells. Mol. Plant Microbe Interact. 18, 849–855.