Molecular Neurobiology

https://doi.org/10.1007/s12035-020-02145-4

Modulation of DNA Methylation and Gene Expression in Rodent

Cortical Neuroplasticity Pathways Exerts Rapid Antidepressant-Like
Effects
Amanda J. Sales 1,2 & Izaque S. Maciel 1 & Angélica C. D. R. Suavinha 3 & Sâmia R. L. Joca 3,4,5

Received: 21 April 2020 / Accepted: 22 September 2020

# Springer Science+Business Media, LLC, part of Springer Nature 2020

Abstract
Background Stress increases DNA methylation, primarily a suppressive epigenetic mechanism catalyzed by DNA methyltrans-
ferases (DNMT), and decreases the expression of genes involved in neuronal plasticity and mood regulation. Despite chronic
antidepressant treatment decreases stress-induced DNA methylation, it is not known whether inhibition of DNMT would convey
rapid antidepressant-like effects.
Aim This work tested such a hypothesis and evaluated whether a behavioral effect induced by DNMT inhibitors (DNMTi)
corresponds with changes in DNA methylation and transcript levels in genes consistently associated with the neurobiology of
depression and synaptic plasticity (BDNF, TrkB, 5-HT1A, NMDA, and AMPA).
Methods Male Wistar rats received intraperitoneal (i.p.) injection of two pharmacologically different DNMTi (5-AzaD 0.2 and
0.6 mg/kg or RG108 0.6 mg/kg) or vehicle (1 ml/kg), 1 h or 7 days before the learned helplessness test (LH). DNA methylation in
target genes and the correspondent transcript levels were measured in the hippocampus (HPC) and prefrontal cortex (PFC) using
meDIP-qPCR. In parallel separate groups, the antidepressant-like effect of 5-AzaD and RG108 was investigated in the forced
swimming test (FST). The involvement of cortical BDNF-TrkB-mTOR pathways was assessed by intra-ventral medial PFC
(vmPFC) injections of rapamycin (mTOR inhibitor), K252a (TrkB receptor antagonist), or vehicle (0.2 μl/side).
Results We found that both 5-AzaD and RG108 acutely and 7 days before the test decreased escape failures in the LH. LH stress
increased DNA methylation and decreased transcript levels of BDNF IV and TrkB in the PFC, effects that were not significantly
attenuated by RG108 treatment. The systemic administration of 5-AzaD (0.2 mg/kg) and RG108 (0.2 mg/kg) induced an
antidepressant-like effect in FST, which was, however, attenuated by TrkB and mTOR inhibition into the vmPFC.

Highlights
• DNMT inhibitors (5-AzaD and RG108) induce antidepressant-like
properties in rats
• Acute DNA methylation inhibition promotes rapid and sustained effects
in rats
• DNMT inhibitors increase BDNF-TrkB-mTOR signaling in the rat pre-
frontal cortex
Electronic supplementary material The online version of this article
(https://doi.org/10.1007/s12035-020-02145-4) contains supplementary
material, which is available to authorized users.

* Amanda J. Sales 3
Department of BioMolecular Sciences, School of Pharmaceutical
amanda.sales@usp.br Sciences of Ribeirão Preto, University of São Paulo, Ribeirão
Preto, SP, Brazil
* Sâmia R. L. Joca
samia@usp.br
4
Translational Neuropsychiatry Unit, Department of Clinical
1
Department of Pharmacology, School of Medicine of Ribeirão Preto, Medicine, Aarhus University, Aarhus, Denmark
University of São Paulo, Ribeirão Preto, SP, Brazil
5
2
FMRP-USP, Av Bandeirantes, 3900, Ribeirão Preto, SP 14049-900, FCFRP-USP, Av Café, sn, Monte Alegre, Ribeirão
Brazil Preto, SP 14040-903, Brazil

Conclusion These findings suggest that acute inhibition of stress-induced DNA methylation promotes rapid and sustained
antidepressant effects associated with increased BDNF-TrkB-mTOR signaling in the PFC.
Keywords DNA methylation . DNMT . Antidepressant . RG108 . 5-AzaD . RNAm
Introduction
Major depressive disorder (MDD) is a complex psychiatric
disorder with a lifetime prevalence of approximately 20%
[1] in which the stress is a recognized risk factor [2]. MDD
is characterized by several symptoms including anhedonia,
depressive mood, and suicidal thoughts [3]. Previous studies
strongly suggest that the neurobiology underlying MDD in-
volves genetic and epigenetic factors [4]. Candidate genes
consistently implicated in the MDD and in the mechanism
action of antidepressant drugs include those coding for
neurotrophins, as well as glutamate and serotonin signaling.
Amongst neurotrophins, brain-derived neurotrophic factor
(BDNF) plays a central role in depression neurobiology.
Reduced levels of BDNF and TrkB [5], its main receptor, have
been described in the prefrontal cortex (PFC) and the hippo-
campus (HPC) of depressed patients [6–10] and stressed ani-
mals [11–14]. This is thought to account for the impaired
neuroplasticity described in stress and depression [15, 16].
Accordingly, chronic antidepressant treatment increases
BDNF and TrkB signaling in the PFC and HPC and restores
stress-induced impaired neuroplasticity [17, 18]. Moreover,
infusion of BDNF or TrkB overexpression into those brain
regions promotes antidepressant-like effects [11, 12, 19–29].
The blockade of BDNF-TrkB signaling abrogates the behav-
ioral effect of antidepressants, thus indicating that the upreg-
ulation of BDNF may be a central mechanism in the antide-
pressant effect [25, 30–32].
Significant abnormalities in glutamatergic signaling, which
is crucial in regulating activity-dependent BDNF expression
and neuroplasticity [33, 34], are also described in depressed
patients [35–45]. Increased levels of NMDA receptors, partic-
ularly NMDA2a, have been described in the HPC of rodents
exposed to stress models of depression [46–53]. On the other
hand, chronic antidepressant treatment attenuates NMDA2a
levels and its inactivation or pharmacological blockade pro-
motes antidepressant properties in animals and depressed
humans [54–57]. In contrast to NMDA receptors, antidepres-
sants increase the signaling mediated by AMPA receptor
(AMPAR) in the HPC and PFC [58–60]. Of note, the rapid
and sustained antidepressant effects induced by ketamine have
been associated with NMDA blockade and AMPAR activa-
tion [55, 57, 61–63], with subsequent release of BDNF, and
activation of the mechanistic target of rapamycin (mTOR) in
the medial PFC (mPFC) [64–71]. Interestingly, animals ex-
posed to chronic stress and MDD patients show reduced
AMPA1 expression in the cortex and HPC [60, 72–74].
Mol Neurobiol
Decreased signaling through AMPAR has, thus, been linked
to impaired BDNF signaling and depression neurobiology.
Equally relevant to regulate BDNF levels and the antide-
pressant effect is the serotonergic 5-HT1A receptor [75–77].
Reduced levels of 5-HT1A have been described in stressed
animals and depressed humans [78–83]. In addition, increased
5-HT1A signaling is necessary for antidepressant action [84]
and the activation of cortical and hippocampal 5-HT 1A
heteroreceptors results in antidepressant-like effects [85–88].
Several genes associated with depression and chronic anti-
depressant treatment, including the ones mentioned above,
have their expression levels modulated by epigenetic mecha-
nisms, such as DNA methylation [89–94]. Catalyzed by DNA
methyltransferase enzymes (DNMT), DNA methylation re-
fers to the addition of a methyl group to the C5 position of
cytosine in cytosine-phosphate-guanine dinucleotides, leading
to changes in DNA packing and chromatin structure, thereby
modulating gene expression without altering the original
DNA sequence [95]. DNA methylation is believed to be a
key mechanism by which environmental experiences can
modify gene expression, resulting in long-lasting changes in
protein availability and brain function [92, 96].
Interestingly, chronic antidepressant treatment has been
shown to reverse stress-induced changes in DNA methylation
of genes believed to be relevant to the neurobiology of depres-
sion [97–99]. Moreover, recovery from clinical depression is
associated with changes in DNMT levels in blood cells [100],
pointing to a central role for DNA methylation in the antide-
pressant response. In accordance with those findings, we and
others have shown that direct inhibition of DNA methylation
by DNMT inhibitors (DNMTi), such as 5-AzaC, 5-AzaD, and
RG108, results in antidepressant-like effects in preclinical
tests [101–105].
In this regard, increased DNA methylation in Bdnf promot-
er, along with reduced mRNA and protein levels, has been
described in conditions of stress and depression [106–111].
Keller et al. (2011) demonstrated also that the hypermethyla-
tion in the TrkB (tyrosine kinase B) receptor gene, which
encodes for the major target of mature BDNF, and reduction
in TrkB protein levels is present in the cortex and HPC of
suicidal individuals [112, 113]. Similarly, methylome-wide
association studies have found MDD-methylation associa-
tions in pathways linked to neurotrophin signaling [110] and
neuronal plasticity [114].
Neurochemical alterations described in MDD may be a
result of epigenetic mechanisms since the expression of
NMDA, AMPA, and 5-HT1A is also regulated by DNA
Mol Neurobiol
methylation [115–117]. In fact, an important interplay be-
tween DNA methylation and these signaling mechanisms is
thought to be crucial in the control of synaptic plasticity [118,
119], which is dysfunctional in stressed animals as well as in
depressed patients [60, 77, 120].
Interestingly, activation of 5-HT1A, NMDA2a, AMPA,
and TrkB receptors have been proven to be central mecha-
nisms associated with fast antidepressant effect [67, 121,
122]. Numerous studies have shown that antidepressants at-
tenuate stress-induced DNA methylation and increase the ex-
pression of BDNF, TrkB, 5-HT1A, and AMPA in the brain
[98, 102, 103]. However, it is not known, whether disinhibi-
tion of DNA methylation could elicit fast antidepressant ef-
fects, and whether this effect may be accompanied by in-
creased expression of BDNF, TrkB, 5-HT1A, NMDA, and
AMPA.
The aim of this study, therefore, was to test the hypothesis
that the pharmacological inhibition of DNA methylation by
DNMT inhibitor drugs would promote fast and sustained an-
tidepressant effects, which could be associated with increased
expression of genes associated with BDNF and TrkB signal-
ing pathway.
Materials and Methods
Animals
Male Wistar rats (250–300 g, 7–8 weeks old) were pur-
chased from the animal facility of the University of São
Paulo (Campus of Ribeirão Preto) and brought to the
animal house associated with the Laboratory of
Neuropsychopharmacology, where they remained for
1 week before the start of the experiments. The animals
were kept under standard conditions of temperature (24
± 1 °C) and 12-h/12-h light/dark cycle (lights on at
06:00 AM), with free access to food pellets (Nuvilab
CR1, Quintia S.A. Brazil) and tap water. The allocation
was randomly made in pairs in acrylic boxes (41 × 34 ×
16 cm) covered with 3 cm of shavings that were
changed three times per week. During the LH test, the
rats were singly housed (between pretest and test ses-
sions). Handling and behavioral testing were performed
between 8 AM and 2 PM.
All experimental procedures were in accordance with
the guidelines of the Brazilian College of Animal
Experimentation (COBEA), which are compliant with
international laws and policies. All efforts were made
to minimize animal suffering and reduce the number
of animals used. All behavioral protocols were approved
by the local ethical committee for the use of animals
(CEUA n° 12.1.235.53.2 and n° 10.1.136.53.2). A total
of 452 animals were used in this study.
Stereotaxic Surgery and Brain Microinjection
The stereotaxic surgery and brain microinjection were per-
formed as described earlier [123]. Briefly, rats were anesthe-
tized with 2,2,2 tribromoethanol 2.5% (i.p., 1 ml/kg) and fixed
in the stereotaxic equipment. Two stainless steel guide cannu-
las (23 G1) were implanted bilaterally 1 mm above the
vmPFC (coordinates AP + 3.3 mm from bregma, ML +
1.9 mm from the medial suture, and DV − 2.4 mm from the
skull with a lateral inclination of 22°) according to the rat brain
atlas [124]. The cannulas were fixed to the skull using jew-
eler’s screws and acrylic dental cement. After the surgery, rats
received an intramuscular injection of oxytetracycline antibi-
otic (200 mg/kg) and subcutaneous injection of flunixin
meglumine anti-inflammatory (50 mg/kg). The animals were
housed in Plexiglas boxes (2 rats/box) and observed daily
during a week (recovery period), after which the behavioral
procedures were initiated.
For microinjection, a stainless steel injection cannula was
connected via polyethylene tubing (PE-10) to a 2-μl Hamilton
syringe. The injection cannula was 1 mm longer than the
guide cannula to reach the mPFC microinjection site. Drugs
were slowly injected into the intended site (0.2 μl each site)
over a minute to allow diffusion.
At the end of the experiments, the rats were anesthetized
with chloral hydrate 5% (i.p., 1 ml/kg), and 0.5 μl of 1%
Evan’s blue dye was bilaterally injected into the vmPFC as a
site marker. The brains were perfused with 10% formalin and
they were postfixed for 24 h at 4 °C. Brain sections of 40 mm
were cut using a cryostat (CM-1900; Leica, Wetzlar,
Germany). The injection sites were determined using the rat
brain atlas of Paxinos and Watson (2013) as a reference
(Fig. 1).
Forced Swimming Test
The forced swimming test (FST) used was conducted as pre-
viously described [101]. Rats were individually placed to
swim in acrylic cylinders (height 40 cm, diameter 30 cm),
containing 25 cm of water with controlled temperature (24 ±
1 °C), during 15 min (pretest, PT, session). At the end of the
session, the animals were gently dried and returned to their
home cage. Twenty-four hours later, the animals were submit-
ted to the swimming test (T) session for 5 min in which the
immobility time was registered. The immobility was defined
as the absence of animal movements except those necessary to
hold head above the water. The water was changed after each
trial to avoid the influence of alarm substances [125].
Open Field Test
Rats were individually placed in a square open field arena
(70 × 70 × 40 cm) and allowed to freely explore it for 5 min.

Fig. 1 Photomicrographs of a representative histological section and
canulae-tip placements within the ventral medial prefrontal cortex
(vmPFC). a Representative coronal brain sections of the rat brain show-
ing bilateral microinjection sites in the vmPFC. The dots represent the
injection sites visualized by the dye injection. b Representative photomi-
crographs of the injection sites into the vmPFC
Mol Neurobiol
The exploratory activity was videotaped and the number of
crossings between the quadrants of the arena was measured.
Before each test, the open field was cleaned with 70% ethanol
solution.
Learned Helplessness
The experiments were done in acrylic boxes of active avoid-
ance for rats divided in two compartments (307 × 333 ×
540 mm; EP11 model, Insight, Brazil) separated by a central
wall with an opening communicating the two compartments.
The floor consisted of stainless steel grids through which
footshocks were applied to the animals. In the first day (day
1), rats were exposed to the pretest (PT) session in which they
received inescapable footshocks (IS, stressed group, 40
shocks, 0.4 mA, duration of 10s, in intervals from 30 to
90 s) or no shocks (30 min habituation in the shuttle box,
Hab). Six days later (day 7), all animals were submitted to
the test session (T, 30 escapable footshocks, ES; 0.4 mA, du-
ration of 10 s, preceded by sound stimulus during 5 s, 60 dB,
670 Hz), when the following behaviors were registered: the
number of escapes/avoidance, number of escape failures, and
number of intertrial crossings [103]. During testing, animals
were able to interrupt the shock delivery/escape by crossing to
the other side of the chamber. If the animal failed to escape
during the shock, the trial was registered as an escape failure.
Collection and Sample Processing
Animals were euthanized at indicated times after the experi-
ments by decapitation preceded by anesthesia with 5% chloral
hydrate (10 ml/kg). Dorsal HPC, ventral HPC, and vmPFC
(including prelimbic and infralimbic cortices) were rapidly
dissected on a cooled dish and stored at − 80 °C for further
analysis. Additionally, the naïve group (no stress nor pharma-
cological treatment) was run in parallel as a control for the
molecular analyses. The brain samples were homogenized in
lysis buffer (137 mM NaCl, 20 mM Tris-HCl pH 8.0, 10%
glycerol). One-half of the sample was used for DNA methyl-
ation analysis and the other half for mRNA analysis.
mRNA Expression by Quantitative RT-PCR
For quantitative PCR (qPCR), total mRNA of the sample was
extracted using a kit (SV Total RNA Isolation System,
Promega) according to the manufacturer’s instructions and
treated with DNAse I (provided in the kit). The amount of
RNA was quantified using a nanophotometer (P360 Implen)
and its degree of purity was determined by the ratio of absor-
bances measured at 260 and 280 nm (A260/A280). Values
between 1.75 and 2.0 were considered suitable for use. The
mRNA was reverse transcribed using a kit (#4374966,
LifeTechnologies), according to the manufacturer’s
Mol Neurobiol
instructions. DNA amplification reactions were run in tripli-
cate using the TaqMan assays in StepOnePlus™Real-Time
PCR Systems (Applied Biosystems). The primers were
BDNF IV (forward primer: GGTGTAGGCTGGAA
TAGACTCTTG; reverse primer: GGAAAAGGATGGTC
ATCACTCTTCT), TrkB (#Rn01441749_m1), 5-HT 1A
(#Rn00561409_s1), NMDA2a (#Rn00561341_m1), and
AMPA1 (#Rn00709588_m1). PCR conditions were 50 °C
for 2 min (incubation) and 95 °C for 10 min (polymerase
activation), followed by 40 cycles of 95 °C for 15 s and
60 °C for 1 min (denaturation and annealing/extension). The
mRNA expression levels were calculated using 2−ΔΔCT meth-
od. The internal standards were YWHAZ
(#Rn00755072_m1), ACTB (#Rn00667869_m1), and
HPRT1 (#Rn01527840_m1) [126]. The results were normal-
ized by the geometric mean of the reference genes, which
were previously verified for stability throughout treatment
conditions. Amplicon sequences of predesigned TaqMan
gene expression assays are provided in the Supplemental ma-
terials (Table 1).
DNA Methylation Analysis by meDIP and qPCR-RT
For analyzing gene-specific DNA methylation changes, geno-
mic DNA was extracted using Wizard Genomic DNA
Purification kit (#A1120, Promega Corporation, USA), ac-
cording to the manufacturer’s protocol and sonicated (Sonics
Vibracell; 6 pulses, 20 s of duration, interval between pulses
of 40 s and amplitude 40%) to random fragments of 200–
1000 bp [127]. One part of non-sonicated DNA was stored
for control of sonication and an aliquot of DNA fragments
from each sample was stored for normalization of results in
the ratio of no-immunoprecipitated total DNA (input) [128].
Immunoprecipitation of methylated DNA was performed
using a rabbit monoclonal 5-methylcytosine antibody
(5 μg/ml, #ab214727, Abcam) for 2 h at 4 °C. DNA was
purified by Wizard Clean-up System kit (#A7280, Promega
Corporation, USA) according to the manufacturer’s instruc-
tions. TaqMan probes were used for BDNF IV (forward prim-
er: GGTGTAGGCTGGAATAGACTCTTG; reverse primer:
GGAAAAGGATGGTCATCACTCTTCT) and TrkB (#Rn
04338713_g1). Immunoprecipitated (IP) and input DNA were
analyzed by qRT-PCR using TaqMan assays
(LifeTechnologies) and a StepOnePlus real-time PCR system
(Applied Biosystems). PCR conditions were 50 °C for 2 min
(incubation) and 95 °C for 10 min (polymerase activation),
followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min
(denaturation and annealing/extension). YWHAZ
(#Rn06427373_s1), ACTB (#Rn01412977_g1), and HPRT1
(#Rn01318746_g1) were used as an internal standard.
Relative methylated DNA was calculated via the 2−ΔΔCt meth-
od and it was measured in triplicate. The gene-specific DNA
methylation levels were expressed by IP DNA/input DNA
[127]. Amplicon sequences of predesigned TaqMan gene ex-
pression assays are provided in the Supplemental materials
(Table 1).
Drugs and Treatment
5-aza-2′-deoxycytidine (5-AzaD, nucleoside DNMT inhibi-
tor; Sigma-Aldrich, USA) was dissolved in sterile saline,
and N-phtalyl-L-tryptophan (RG108, non-nucleoside DNMT
inhibitor; Tocris Biosciences, UK) was diluted in 2% Tween
80 in sterile saline solution. Both drugs were intraperitoneally
administered at doses of 0.2, 0.4, and 0.6 mg/kg [102]. K252a
(TrkB receptor antagonist; Sigma-Aldrich, USA) was dis-
solved in sterile saline and administered in a dose of
10 pmol/0.2 μl/side [129]. Rapamycin (RAPA, mTOR
blocker; LC Laboratories, USA) was dissolved in 0.2 μl
DMSO and administered in the dose of 0.2 nmol/0.2 μl/side
[65]. Imipramine hydrochloride (IMI, a tricyclic
antidepressant; Sigma-Aldrich, USA) was dissolved in sterile
saline and injected i.p. at the dose of 15 mg/kg [101, 103].
Fluoxetine hydrochloride (a selective serotonin reuptake
inhibitor; Sigma-Aldrich, USA) was dissolved in 2% Tween
80 in sterile saline and injected i.p. at the dose of 20 mg/kg
[130]. All drugs were freshly prepared before use.
Experimental Design
The studies were conducted as four independent experiments,
all carried out between 8 AM and 2 PM. Animals were dis-
tributed to different treatment groups and experimental condi-
tions in a randomized order to avoid potential circadian influ-
ences. The behavioral analysis was performed by experi-
menters that were blind to the different treatment conditions.
Experiment 1: Antidepressant-Like Effects Induced by DNMTi
in the LH Paradigm
To evaluate whether acute treatment with DNMTi would in-
duce fast and/or sustained antidepressant effects in the LH,
rats received an i.p. injections of 5-AzaD (0.6 mg/kg),
RG108 (0.6 mg/kg), or vehicle (10 ml/kg), immediately after
the PT. Additional groups of animals were submitted to the PT
and received a systemic injection of the 5-AzaD (0.2 mg/kg),
RG108 (0.6 mg/kg), or vehicle 1 h before T (day 7). On day
7th, all animals were submitted to the T session (Fig. 3a). A
total of 122 animals were used in this experiment (5-AzaD and
vehicle, 70 animals, Fig. 3b–d; RG108 and vehicle, 52 ani-
mals, Fig. 3e–f).
As a control experiment to demonstrate that the LH
model is not sensitive to an acute intervention with a
conventional monoaminergic antidepressant, rats were
submitted to the PT session and, immediately later
(day 1), received systemic injections of imipramine

(15 mg/kg), fluoxetine (20 mg/kg), or vehicle (10 ml/
kg). During the following 6 days, the animals received
the administration of the drugs or vehicle and on day
7th, 1 h after the last injection, all animals were sub-
mitted to the T session in the LH (Fig. 2a). The animals
that received antidepressant drugs were divided in two
groups: (1) acute (ac), animals received 6 injections of
the vehicle and only one injection of the drug on the
7th day; and (2) repeated (rep), animals received seven
injections of the drug. A total of 114 animals were used
in this experiment (imipramine and vehicle, 58 animals,
Fig. 2b–d; fluoxetine and vehicle, 56 animals, Fig. 2e–
g).
Experiment 2: DNMTi Effects on Gene Expression in the PFC
and HPC of LH Animals
To evaluate if stress and/or DNMT inhibition could regulate
the expression of relevant genes (5HT1A, TrkB, BDNF,
AMPA, NMDA), rats were subjected to the PT (day 1) and,
immediately after or 1 h before euthanasia (day 7), received
i.p. injection of RG108 (0.6 mg/kg) or vehicle (10 ml/kg). On
day 7, the brain regions (PFC, dorsal HPC, and ventral HPC)
were dissected for molecular analysis using qPCR-RT
(Fig. 4a). An independent group of untreated and non-
stressed animals (naive control) was run in parallel for exper-
imental control. A total of 40 animals were used in this
experiment.
Fig. 2 Antidepressant drugs attenuated the behavioral changes induced
by footshocks stress. a Experimental scheme. b–d Imipramine (n = 9–10/
group). e–g Fluoxetine (n = 8–10/group). b and e Repeated antidepressant
treatment increased the number of escapes, (c and f) decreased the
Mol Neurobiol
Experiment 3: Changes in DNA Methylation in Response
to RG108 Treatment in LH Animals
To evaluate if the changes in gene expression levels were
associated with changes in DNA methylation, rats were sub-
jected to the PT in LH (day 1) and, immediately after PT (day
1) or 1 h before euthanasia (day 7), received i.p. injection of
RG108 (0.6 mg/kg) or vehicle (10 ml/kg). On day 7, the PFC
was dissected for molecular analysis using meDIP and qPCR-
RT (Fig. 5a). An independent group of untreated and non-
stressed animals (naive control) was run in parallel for exper-
imental control. A total of 40 animals were used in this
experiment.
Experiment 4: The Role of PFC BDNF-TrkB-mTOR Signaling
in the Antidepressant-Like Effect Induced by DNMTi
To further evaluate the potential fast antidepressant ef-
fect of DNMTi, the effects of a single administration of
DNMTi were investigated in rats subjected to the FST,
which usually requires 3 administrations in 24 h [101].
Rats were subjected to the FST (PT session; 15 min)
and immediately (0 h; Fig. 6a) or 23 h later (Fig. 6d)
received intraperitoneal (i.p.) injections of DNMTi (5-
AzaD or RG108; 0.2 and 0.4 mg/kg) or vehicle
(10 ml/kg). As a positive control for the experiment,
independent groups of rats were subjected to the PT
and received three injections of imipramine (15 mg/kg),
number of failures, and (d and g) did not change the number of
crossings. Veh, vehicle; ac, acute treatment; rep, repeated treatment. *
p < 0.05, rep vs veh stressed groups; # p < 0.05, stressed vs habituated
groups
Mol Neurobiol
0 h, 5 h, and 23 h after the PT. Twenty-four hours after
PT, the animals were subjected to the test (T; 5 min)
when the immobility time was measured. A total of 112
animals were used in this experiment (0 h, 5-AzaD,
imipramine, and vehicle: 38 animals, Fig. 6; RG108,
imipramine, and vehicle, 19 animals, Fig. 6c; 23 h, 5-
AzaD, imipramine, and vehicle, 39 animals, Fig. 6e;
RG108, imipramine, and vehicle, 16 animals, Fig. 6f).
To evaluate if the BDNF-TrkB-mTOR signaling could be
important for the antidepressant-like effect induced by
DNMTi, rats were submitted to the PT and T, 24 h later.
One hour before the test, animal received intra-vmPFC bilat-
eral injections of rapamycin (RAPA, 0.2 nmol/0.2 μl/side),
K252a (10 pmol/0.2 μl/side), or vehicle (0.2 μl/side) followed
by an i.p. injection of RG108 (0.2 mg/kg) or vehicle (10 ml/
kg) (Fig. 6j). A total of 28 animals were used in this
experiment.
To investigate possible unspecific locomotor effects in-
duced by DNMTi, 5-AzaD (0.2 mg/kg), RG108
(0.2 mg/kg), or their vehicle (10 ml/kg) were administered
intraperitoneally to independent groups of rats. The ani-
mals were submitted to the OFT 24 h (sustained effect) or
1 h (rapid effect) after the injection, and the number of
crossings was measured for 5 min. Experimental scheme
is shown in Fig. 6g. A total of 36 animals were used in
this experiment (5-AzaD and vehicle, 18 animals, Fig. 6h;
RG108 and vehicle, 18 animals, Fig. 6i).
Statistical Analyses
All statistical analyses were performed with the Prism 7.0
software from GraphPad (La Jolla, CA, USA). Two-way anal-
ysis of variance (ANOVA) followed by Bonferroni’s test was
used to investigate the behavioral changes in the LH (factors,
treatment and condition). In the case of significant interaction
between factors, specific post hoc comparisons in each condi-
tion were performed with the help of the Dunnett’s test. The
differences in mRNA expression and DNA methylation levels
between naïve and vehicle groups were analyzed by Student’s
t test and 1-way ANOVA was used in stressed groups (vehicle
and RG108 treatments). In FST and OFT, 1-way ANOVA
followed by Dunnett’s test was performed. Differences were
regarded as significant if p < 0.05. F-values and degrees of
freedom are presented for ANOVAs, and t values are present-
ed for Student’s t test. Data are shown as means ± standard
error of means (S.E.M.). Animals that had injection site out-
side the vmPFC were excluded from the statistical analysis.
Results
The statistical data are shown in Supplemental materials
(Tables 2–5).
DNMTi Results in Fast and Sustained Antidepressant-
Like Effects in LH
In order to evaluate possible fast antidepressant effects in-
duced by DNMTi in the LH, we first investigated if our be-
havioral protocol was sensitive to the effect of antidepressants
only after repeated treatment, as described in the literature.
Therefore, we assessed the effects of two different antidepres-
sants after acute and repeated treatment in animals exposed to
LH.
Our results revealed that a significant interaction between
factors was observed in all behavioral analysis (see Table 2 for
details); the effect of each treatment was analyzed separately
in stressed and in non-stressed groups. No effect of the drugs
was observed in the non-stressed groups, in any of the vari-
ables analyzed (p > 0.05, one-way ANOVA). However, in the
stressed groups, only the repeated treatment with imipramine
and fluoxetine attenuated the stress effects in the number of
escapes (p < 0.05, Dunnets, Fig. 2b and e; Table 1) and in the
number of failures (p < 0.05, Dunnets, Fig. 2c and f; Table 2).
These results indicate that only the repeated administration of
conventional monoaminergic drugs can induce antidepressant
effects in our protocol, with no observable effect of the single
injection.
Based on that, we next investigated the effects of a single
administration of the two pharmacologically different
DNMTi, at two different time points. We observed that the
single administration of 5-AzaD increased the number of es-
capes (p < 0.05, Dunnets, Fig. 3b; Table 2) and decreased the
number of failures (p < 0.05, Dunnets, Fig. 3c; Table 2) in
stressed animals, without changing the behavior of the non-
stressed ones. Similarly, RG108 attenuated the behavioral
changes induced by stress in LH by increasing the number
of escapes (p < 0.05, Dunnets, Fig. 3e; Table 2) and decreas-
ing the number of failures (p < 0.05, Dunnets, Fig. 3f;
Table 2).
In all treatment conditions, no significant changes were
observed in the number of intertrial crossings (Figs. 2d, g,
and 3d and g; Table 2). Altogether, the results indicate that
the acute administration of pharmacologically different
DNMTi induces fast and sustained antidepressant effects in
the LH.
BDNF IV and TrkB Transcript Levels Are Reduced in
Stressed Animals
Since both 5-AzaD and RG108 induced antidepressant effects
after a single i.p. administration, we next investigated if this
effect could be associated with changes in the expression level
of BDNF IV and TrkB, which are known to mediate the fast
antidepressant effect of other drugs. In the PFC, the mRNA
for BDNF IV and TrkB were significantly decreased in
stressed rats (Fig. 4b–c; Table 3), but no significant stress-

Fig. 3 DNMTi induced rapid and sustained antidepressant-like effects in
rats submitted to the learned helplessness. a Experimental scheme. b–d 5-
AzaD (n = 11–12/group). e–g RG108 (n = 8–10/group). b and e Acute
DNMTi treatment increased the number of escapes, (c and f) decreased
Fig. 4 Footshocks stress reduced BDNF IV and TrkB mRNA levels in
prefrontal cortex. a Experimental scheme. b–f Prefrontal cortex, PFC. g–
k Dorsal hippocampus, dHPC. l–p Ventral hippocampus, vHPC. In PFC,
(b) BDNF IV mRNA (n = 9–10/group) and (c) mRNA TrkB (n = 8–10/
group) expressions were reduced by footshocks stress. None change was
observed in (d) 5-HT1A mRNA (n = 8–10/group), (e) NMDA2a mRNA
(n = 8–10/group), and (f) AMPA1 mRNA (n = 8–10/group) expressions.
No alteration also has been observed in dHPC, (g) BDNF IV mRNA (n =
Mol Neurobiol
the number of failures, and (d and g) did not change the number of
crossings. Veh, vehicle group. * p < 0.05, DNMTi treatments vs veh
stressed groups; # p < 0.05, stressed vs habituated groups
9–11/group), (h) TrkB mRNA (n = 5–6/group), (i) 5-HT1A mRNA (n =
9–10/group), (j) NMDA2a mRNA (n = 9–11/group), and (k) AMPA1
mRNA (n = 9–11/group). Similarly, no alteration has been observed in
vHPC, (l) BDNF IV mRNA (n = 9–11/group), (m) TrkB mRNA (n = 8–
10/group), (n) 5-HT1A mRNA (n = 8–11/group), (o) NMDA2a mRNA
(n = 8–11/group), and (p) AMPA1 (n = 8–11/group). Veh, vehicle. *
p < 0.05, vehicle vs naïve groups
Mol Neurobiol
induced changes were apparent in mRNA 5-HT1A (Fig. 4d;
Table 3) NMDA2a (Fig. 4e; Table 3) and AMPA1 (Fig. 4f;
Table 3). Interestingly, the levels of transcripts were not mod-
ified in RG108 treated rats when compared with the stressed
control group (Fig. 4; Table 3). Moreover, no changes in tran-
scripts levels were observed in response to stress or RG108
treatment in both dorsal HPC (Fig. 4g–k; Table 2) and ventral
HPC (Fig. 4l–p; Table 3).
DNA Methylation Levels in BDNF IV and TrkB in
Stressed Animals
To further investigate if the changes in the transcript levels
could reflect changes at the DNA methylation levels, we next
investigated stress and treatment effect on the methylation
levels in BDNF IV and TrkB in the PFC. Results showed that
stress increased and RG108 treatment attenuated DNA meth-
ylation levels in BDNF IV and TrkB (p < 0.05; Fig. 5 b–c;
Table 4).
DNMTi Induces Rapid and Sustained Antidepressant-
Like Effects in the FST: Participation of TrkB-mTOR
Signaling
To further confirm the results observed in the LH test, we
investigated the effects of acute DNMTi administration in
animals submitted to the FST. The results indicated that both
5-AzaD and RG108, at both time points (immediately after PT
or 1 h before T), induced antidepressant-like effects in rats
submitted to the FST (p < 0.05; Fig. 6b–f, Table 5). None of
the treatments resulted in significant effects on the number of
crossings in the OFT (Fig. 6h–i, Table 5).
Administration of RAPA or K252a into the vmPFC
prevented the antidepressant effect induced by systemic
RG108 administration 1 h before the FST (Fig. 6k, Table 5),
thus indicating that BDNF-TrkB-mTOR activation is in-
volved in the rapid antidepressant effect of DNMTi.
Fig. 5 RG108 treatment attenuated BDNF IV and TrkB DNA
methylation changes induced by stress. a Experimental scheme. The
stress increased and the RG108 treatment attenuated this change in (b)
Discussion
The main findings in this work are that single administration
of two distinct inhibitors of DNMT (5-AzaD and RG108)
induces rapid and sustained antidepressant-like effects in
two different animal models, the LH and the FST.
Interestingly, intra-mPFC administration of a TrkB antagonist
or an mTOR inhibitor abolished the antidepressant-like effect
induced by systemic administration of RG108. We also ob-
served that treatment with RG108 attenuated stress-induced
effects on DNA methylation in the expression of BDNF IV
and TrkB in the PFC. Collectively, these data suggest that the
antidepressant-like effects induced by DNMTi could involve
rapid disinhibition of BDNF and TrkB expression, leading to
further downstream activation of mTOR in the PFC.
Our findings are consistent with previous studies showing
that systemic administration of both RG108 and 5-AzaD has
the potential to induce an antidepressant-like effect in rats and
mice subjected to the FST [101, 102]. However, here, we
show the first evidence that the acute administration of a
DNMTi promotes an antidepressant-like effect in the LH, a
behavioral paradigm insensitive to acute administration of an-
tidepressant drugs [103, 131]. Earlier studies with intracere-
bral drug administration strongly suggest the involvement of
cortical and limbic brain regions in such effects, in that direct
administration of DNMTi into the nucleus accumbens [104],
the HPC [101], or ventrolateral orbital cortex [105] induces
significant antidepressant-like effects. Interestingly, previous
studies have shown that distinct subtypes of DNMT
(DNMT1, DNMT3a, and DNMT3b) are expressed in the
adult rodent HPC and PFC, where they play important roles
in transcription regulation of genes associated with synaptic
plasticity, cognition, and behavioral responses to stress
[132–135]. Moreover, in stressed animals, altered levels of
DNMT1 and DNMT3a have been described in the PFC and
HPC of animals [103], suggesting that changes in DNMT
levels and/or activity could contribute to aberrant DNA
BDNF IV, and (c) TrkB DNA methylation levels in PFC (n = 10/group).
Veh, vehicle. * p < 0.0, veh vs naïve groups; # p < 0.05 RG108 vs vehicle
groups

Fig. 6 DNMTi induced rapid and sustained antidepressant-like effect and
TrkB/mTOR inhibition blocked this behavioral effect induced by RG108
in forced swimming test. a, d, g, and j Experimental schemes. b, e, and h)
5-AzaD. c, f, and i RG108. Immediately or 23 h after the PT, (b and e) 5-
AzaD (n = 9–11/group) and (c and f) RG108 (n = 4–5/group) administra-
tion result in reduced immobility time in FST, similar to the imipramine
methylation and gene expression changes associated with
stress and stress-related psychiatric disorders. Indeed, the
Mol Neurobiol
(IMI; 3 injections). Imipramine treatment (3 injections) was used for
positive control. h and i No alteration has been indicated in the number
of crossings (n = 6/group). k The pretreatment with rapamycin (RAPA) or
K252a blocked the immobility time reduction induced by RG108 (n = 7/
group). * p < 0.05, drug treatments vs vehicle or vehicle/vehicle
analysis of biological material (saliva, blood, or post-mortem
brains) from depressed humans showed DNA methylation
Mol Neurobiol
changes compared with healthy controls [136–139].
Specifically, Poulter and coworkers (2008) demonstrated that
victims of suicide had altered levels of DNMT1 and DNMT3b
in several brain regions, including cortex and amygdala, sug-
gesting alterations of both enzymes in the pathology of de-
pressive disorder [136]. Interestingly, there is evidence that
DNMT1 may play a more fundamental role than DNMT3,
in that conditional forebrain deletion of DNMT1 induced an-
tidepressant and anxiolytic phenotype, whereas deletion of
DNMT3a did not induce any behavioral changes [140]. In
contrast, overexpression of DNMT3a in the nucleus accum-
bens and in the mPFC induced depressive-like and anxiogenic
behavior in mice, respectively [141]. Accordingly, in a previ-
ous study from our group, increased DNMT3a and DNMT3b
expression, along increased DNA methylation, was found in
the PFC of helpless animals, an effect that was abolished by
chronic, but not acute, antidepressant administration [103].
Interestingly, there are studies showing that repeated treat-
ment with antidepressants decreases DNMT levels and DNA
methylation in the brain of animals exposed to different
models of depression [103] and that clinical remission induced
by chronic antidepressant treatment is associated with normal-
ization of DNMT levels in blood cells of previously depressed
patients [99]. It is therefore likely that the behavioral effect
induced by chronic antidepressant treatment may be associat-
ed with reversing aberrant DNA methylation in brain regions
involved in depression neurobiology. Therefore, 5-AzaD and
RG108 would trigger antidepressant effects by directly
targeting DNMTs and hence inhibiting stress-induced DNA
methylation.
Both RG108 and 5-AzaD are non-selective inhibitors of
DNMTs. 5-AzaD is a nucleoside analogue that, following
incorporation into DNA, traps DNMTs by covalent binding
of the enzyme to DNA, blocking methyltransferase activity
irreversibly [142]. RG108 is a non-nucleoside inhibitor that
binds to the active site of DNMT1, and presumably to
DNMT3, and blocks the enzyme transiently [143–145]. The
two chemically unrelated drugs are capable of inhibiting
DNMTs by different mechanisms, providing greater assur-
ance that the results observed with the administration of these
drugs would be related to inhibition of DNA methylation rath-
er than to unspecific mechanisms. Given the ability of both
drugs to bind to the catalytic domain of different DNMT sub-
types, it is possible that the antidepressant effect observed
herein results from the inhibition of different DNMTs (1, 3a,
and 3b) and subsequent disinhibition of gene expression in
different brain regions involved in depression neurobiology.
However, future studies should test selective inhibitors to as-
sess the specific contribution of each DNMT subtype to the
effects observed in this work.
A key finding here is that acute intervention with DNMTi
promotes fast antidepressant effects, observed as a significant
attenuation of escape failures in animals receiving a single
injection of DNMTi. On the other hand, repeated administra-
tion with fluoxetine or imipramine was required to promote a
significant antidepressant effect in the LH, leaving acute in-
jections ineffective. This evidence is in full agreement with
previously published papers indicating that the LH is not sen-
sitive to acute interventions with conventional monoaminergic
antidepressants [81, 103, 130], but it responds to single ad-
ministration with ketamine, a fast-acting antidepressant drug
[146]. Therefore, the results observed in the LH suggest that
DNMT inhibition promotes fast antidepressant effects.
The mechanisms involved in this remarkable effect remain
elusive and warrant further investigation. However, it can be
proposed that inhibition of DNA methylation shortly after
stress exposure could favor changes that result in sustained
effects, as observed in this work. This could be attributed to
rapid and long-lasting changes in the expression of genes pro-
moting synaptic plasticity and adaptation to stress, since the
drug is expected to be completely eliminated from the body
when the behavioral testing takes place (time half-life of
RG108, 4 h [147]; and 5-AzaD, 40 min [148]). Indeed, pre-
clinical works show that the behavioral effect of rapid-acting
antidepressants involves an immediate increase in cortical [65,
149, 150] and hippocampal [151–153] neuroplasticity.
Ketamine is shown to rapidly increase the levels of BDNF
and synaptic proteins in the HPC and PFC of animals exposed
to stress models of depression [154]. As DNA methylation
regulates transcription of genes involved in neuroplasticity,
including BDNF and its receptor, TrkB, it can be hypothe-
sized that the antidepressant effect induced by RG108 could
be mediated by a decrease in DNA methylation of genes in-
volved in synaptic plasticity with subsequent increase in their
transcript levels.
The expression levels of other genes in the HPC and PFC,
which have been shown to be regulated by DNA methylation
and are central to the antidepressant effect, were also investi-
gated herein, such as 5-HT1A, NMDA, and AMPA [78, 80,
92, 93, 106–109, 112, 115, 116, 155, 156]. However, we did
not detect any changes in the mRNA levels of 5-HT1A,
NMDA2a, and AMPA1, suggesting that they may not be di-
rectly involved in the effects of DNMTi, or that our experi-
mental design did not allow for the detection of such alter-
ations. Evaluation of DNA methylation and transcript levels at
different time points after stress could provide additional im-
portant information about that.
The main finding in our work is that exposure to
footshocks in the LH paradigm increased DNA methylation
and reduced mRNA levels of BDNF exon IV and TrkB in the
PFC. This is in line with previous evidence showing that LH
exposure increased global DNA methylation and DNMT3
expression in the PFC [103]. RG108 treatment attenuated
BDNF and TrkB DNA methylation changes induced by stress
but failed to affect BDNF and TrkB transcript levels.
However, inhibition of mTOR, as well as TrkB antagonism,

blocked the rapid antidepressant-like effect induced by acute
RG108 treatment in the rat FST, thus suggesting that BDNF-
TrkB-mTOR signaling in the PFC is involved in the
antidepressant-like behavior induced by RG108, but in a man-
ner which cannot be detected on the transcript levels. Further
studies are required to in-depth determine the mechanisms
involved. Again, it is possible that changes at different time
points might have occurred which have not been investigated
in the present study.
BDNF is a neurotrophin widely expressed in the CNS as-
sociated with cell survival and differentiation, organization,
and maintenance of neural activity, and it is closely associated
with the neurobiology of depression [12, 93, 157–159].
Relevant to the present work, it has been shown that stress
exposure can alter DNA methylation levels and modulate
BDNF expression in different brain structures. For example,
rats subjected to reduced maternal care have increased DNA
methylation levels in BDNF IV accompanied by reduced
levels of this protein in the PFC [160]. Activation of the
BDNF main receptor, TrkB, activates intracellular signaling
cascades including mitogen-activated protein kinases/
extracellular signal-related kinases (MAPK/ERK), phospholi-
pase Cγ (PLCγ1)/PKC, and the phosphatidyl inositol kinase
(PI3K)/AKT/mTOR. Administration of a TrkB agonist, 7,8
dihydroflavone (7,8 DHF) can induce an antidepressant-like
effect in mice exposed to the FST and TST and increase PSD-
95 (postsynaptic density protein 95) levels, a marker of syn-
aptogenesis, in the PFC and HPC of socially defeated mice
[161]. Also, bilateral 7,8 DHF infusion into the medial PFC
(infralimbic) induces an antidepressant-like effect in rats sub-
mitted to LH, suggesting that the activation of TrkB receptor
in the PFC triggers behavioral adaptation to stress and antide-
pressant effect [162]. Intriguingly, DNA methylation in the
TrkB gene has been linked to the effects of stress, and studies
of the cortex of suicidal individuals demonstrated increased
DNA methylation accompanied by reduced TrkB expression
[163], further substantiating the role of BDNF-TrkB pathway
as crucial in depression.
In addition to DNA methylation, mRNA levels can also be
acutely modulated during stress response [164]. However, in
this work, we failed to attenuate stress effects on BDNF and
TrkB mRNA levels in the rat PFC using RG108 treatment.
Several possible explanations exist. Since the design of the
study was cross-sectional and not longitudinal, it is possible
that the time of analysis does not coincide with the ideal mo-
ment for identifying changes in mRNA levels. For example, it
has been shown that mRNA changes in rats chronically
stressed for 21 days are absent, while decreased protein ex-
pression of NMDA2a and NMDA2b (24 h after stress) in the
frontal cortex could still be detected [165]. Therefore, it can be
speculated that changes in mRNA levels at another time point
could have happened, but remained undetected in our work. In
this context, it is a limitation of the present study that we did
Mol Neurobiol
not measure mRNA levels at other time points, nor protein
levels at the moment when behavioral changes were observed.
As we chose to euthanize the animals at the moment that they
would have been exposed to the test in the LH, we were
unable to evaluate how the molecular changes would correlate
with the behavior. Such studies should be performed in future
work, as it could reveal important differences in DNA meth-
ylation and transcript levels in animals that are susceptible and
resilient to stress, and well as animals that respond and do not
respond to antidepressants.
It is also important to consider that changes in DNA meth-
ylation levels do not always correspond to changes in gene
expression, since other steps in the expression-process (for
example splicing and translation) may also be regulated epi-
genetically [166]. Indeed, recent evidence indicates that DNA
methylation can also be functionally silent, i.e., that it does not
necessarily result in equivalent changes in gene expression
[167]. Furthermore, rapid demethylation and de novo methyl-
ation after any given treatment intervention can impair the
observation of changes in DNA methylation levels and sub-
sequent gene expression changes in each moment [167]. Of
note, the assays performed in the intra exon region may not
correlate with DNA methylation in the promoter region of
genes neither with corresponding gene transcription changes.
The lack of more details on the gene sequence analyzed due to
the use of predesigned assays also makes the in-depth inter-
pretation of the results more difficult, thus remaining as a
limitation of the present study.
In conclusion, our pharmacological data provides
strong evidence that acute intervention with inhibitors
of DNA methylation attenuates stress-induced DNA
methylation on BDNF and TrkB in the PFC and elicits
rapid antidepressant-like effects. Furthermore, BDNF-
TrkB signaling in the PFC is required for the
antidepressant-like effect induced by DNMT inhibition.
Our data provide convincing evidence that inhibition of
DNA methylation could constitute a novel approach to
rapid and sustained antidepressant effects.
Acknowledgments The authors acknowledge Prof. Francisco Silveira
Guimarães for his helpful contribution to the statistical analysis and
Flávia Fiacadori Salata for her technical assistance. We are thankful to
Prof. Gregers Wegener for his comments and suggestions on the
manuscript.
Authors’ Contributions A.J.S. performed experiments, analyzed data,
and wrote the paper. I.S.M. and AC.D.R.S. performed experiments.
S.R.L.J. designed the experiments, supervised the project, and contribut-
ed with writing the paper. All authors discussed the results, implications,
and commented on the manuscript at all stages.
Funding This work was supported by research grants from the Research
Foundation of the State of São Paulo (FAPESP, grant numbers: S.R.L.J.,
2011/17281-7; 2012/17626-7; A.J.S., 2015/01955-0), CNPQ (304780/
2018-9; 06648/2014-8).
Mol Neurobiol
Compliance with Ethical Standards
Conflict of Interest The authors declare that they have no competing
interests.
References
1. Vigo D, Thornicroft G, Atun R (2016) Estimating the true global
burden of mental illness. Lancet Psychiatry 3(2):171–178. https://
doi.org/10.1016/S2215-0366(15)00505-2
2. Pittenger C, Duman RS (2008) Stress, depression, and
neuroplasticity: a convergence of mechanisms.
Neuropsychopharmacology 33(1):88–109. https://doi.org/10.
1038/sj.npp.1301574
3. American Psychiatric Association (2013) Diagnostic and statisti-
cal manual of mental disorders, Fifth Edn. Arlington, VA
4. Shadrina M, Bondarenko EA, Slominsky PA (2018) Genetics
factors in major depression disease. Front Psychiatry 9:334.
https://doi.org/10.3389/fpsyt.2018.00334
5. Yang T, Nie Z, Shu H, Kuang Y, Chen X, Cheng J, Yu S, Liu H
(2020) The role of BDNF on neural plasticity in depression. Front
Cell Neurosci 14:82. https://doi.org/10.3389/fncel.2020.00082
6. Dunham JS, Deakin JF, Miyajima F, Payton A, Toro CT (2009)
Expression of hippocampal brain-derived neurotrophic factor and
its receptors in Stanley consortium brains. J Psychiatr Res 43(14):
1175–1184. https://doi.org/10.1016/j.jpsychires.2009.03.008
7. Emon MPZ, Das R, Nishuty NL, Shalahuddin Qusar MMA,
Bhuiyan MA, Islam MR (2020) Reduced serum BDNF levels
are associated with the increased risk for developing MDD: a
case-control study with or without antidepressant therapy. BMC
Res Notes 13(1):83. https://doi.org/10.1186/s13104-020-04952-3
8. Guilloux JP, Douillard-Guilloux G, Kota R, Wang X, Gardier
AM, Martinowich K, Tseng GC, Lewis DA et al (2012)
Molecular evidence for BDNF- and GABA-related dysfunctions
in the amygdala of female subjects with major depression. Mol
Psychiatry 17(11):1130–1142. https://doi.org/10.1038/mp.2011.
113
9. Thompson Ray M, Weickert CS, Wyatt E, Webster MJ (2011)
Decreased BDNF, trkB-TK+ and GAD67 mRNA expression in
the hippocampus of individuals with schizophrenia and mood dis-
orders. J Psychiatry Neurosci 36(3):195–203. https://doi.org/10.
1503/jpn.100048
10. Tripp A, Oh H, Guilloux JP, Martinowich K, Lewis DA, Sibille E
(2012) Brain-derived neurotrophic factor signaling and subgenual
anterior cingulate cortex dysfunction in major depressive disorder.
Am J Psychiatry 169(11):1194–1202. https://doi.org/10.1176/
appi.ajp.2012.12020248
11. Duman RS (2002) Pathophysiology of depression: the concept of
synaptic plasticity. Eur Psychiatry 17(Suppl 3):306–310. https://
doi.org/10.1016/s0924-9338(02)00654-5
12. Duman RS, Monteggia LM (2006) A neurotrophic model for
stress-related mood disorders. Biol Psychiatry 59(12):1116–
1127. https://doi.org/10.1016/j.biopsych.2006.02.013
13. Smith MA, Makino S, Kvetnansky R, Post RM (1995) Stress and
glucocorticoids affect the expression of brain-derived neurotroph-
ic factor and neurotrophin-3 mRNAs in the hippocampus. J
Neurosci 15(3 Pt 1):1768–1777
14. Taliaz D, Stall N, Dar DE, Zangen A (2010) Knockdown of brain-
derived neurotrophic factor in specific brain sites precipitates be-
haviors associated with depression and reduces neurogenesis. Mol
Psychiatry 15(1):80–92. https://doi.org/10.1038/mp.2009.67
15. Koshimizu H, Kiyosue K, Hara T, Hazama S, Suzuki S, Uegaki K,
Nagappan G, Zaitsev E et al (2009) Multiple functions of
precursor BDNF to CNS neurons: negative regulation of neurite
growth, spine formation and cell survival. Mol Brain 2:27. https://
doi.org/10.1186/1756-6606-2-27
16. Woo NH, Teng HK, Siao CJ, Chiaruttini C, Pang PT, Milner TA,
Hempstead BL, Lu B (2005) Activation of p75NTR by proBDNF
facilitates hippocampal long-term depression. Nat Neurosci 8(8):
1069–1077. https://doi.org/10.1038/nn1510
17. Sen S, Duman R, Sanacora G (2008) Serum brain-derived neuro-
trophic factor, depression, and antidepressant medications: meta-
analyses and implications. Biol Psychiatry 64(6):527–532. https://
doi.org/10.1016/j.biopsych.2008.05.005
18. Shimizu E, Hashimoto K, Okamura N, Koike K, Komatsu N,
Kumakiri C, Nakazato M, Watanabe H et al (2003) Alterations
of serum levels of brain-derived neurotrophic factor (BDNF) in
depressed patients with or without antidepressants. Biol
Psychiatry 54(1):70–75. https://doi.org/10.1016/s0006-3223(03)
00181-1
19. Koponen E, Lakso M, Castren E (2004) Overexpression of the
full-length neurotrophin receptor trkB regulates the expression of
plasticity-related genes in mouse brain. Brain Res Mol Brain Res
130(1–2):81–94. https://doi.org/10.1016/j.molbrainres.2004.07.
010
20. Rantamaki T, Hendolin P, Kankaanpaa A, Mijatovic J, Piepponen
P, Domenici E, Chao MV, Mannisto PT et al (2007)
Pharmacologically diverse antidepressants rapidly activate brain-
derived neurotrophic factor receptor TrkB and induce
phospholipase-Cgamma signaling pathways in mouse brain.
Neuropsychopharmacology 32(10):2152–2162. https://doi.org/
10.1038/sj.npp.1301345
21. Saarelainen T, Hendolin P, Lucas G, Koponen E, Sairanen M,
MacDonald E, Agerman K, Haapasalo A et al (2003) Activation
of the TrkB neurotrophin receptor is induced by antidepressant
drugs and is required for antidepressant-induced behavioral ef-
fects. J Neurosci 23(1):349–357
22. Shirayama Y, Chen AC, Nakagawa S, Russell DS, Duman RS
(2002) Brain-derived neurotrophic factor produces antidepressant
effects in behavioral models of depression. J Neurosci 22(8):
3251–3261 20026292
23. Ye Y, Wang G, Wang H, Wang X (2011) Brain-derived neuro-
trophic factor (BDNF) infusion restored astrocytic plasticity in the
hippocampus of a rat model of depression. Neurosci Lett 503(1):
15–19. https://doi.org/10.1016/j.neulet.2011.07.055
24. Altar CA, Whitehead RE, Chen R, Wortwein G, Madsen TM
(2003) Effects of electroconvulsive seizures and antidepressant
drugs on brain-derived neurotrophic factor protein in rat brain.
Biol Psychiatry 54(7):703–709. https://doi.org/10.1016/s0006-
3223(03)00073-8
25. Autry AE, Monteggia LM (2012) Brain-derived neurotrophic fac-
tor and neuropsychiatric disorders. Pharmacol Rev 64(2):238–
258. https://doi.org/10.1124/pr.111.005108
26. Molteni R, Calabrese F, Cattaneo A, Mancini M, Gennarelli M,
Racagni G, Riva MA (2009) Acute stress responsiveness of the
neurotrophin BDNF in the rat hippocampus is modulated by
chronic treatment with the antidepressant duloxetine.
Neuropsychopharmacology 34(6):1523–1532. https://doi.org/10.
1038/npp.2008.208
27. Nibuya M, Nestler EJ, Duman RS (1996) Chronic antidepressant
administration increases the expression of cAMP response ele-
ment binding protein (CREB) in rat hippocampus. J Neurosci
16(7):2365–2372
28. Russo-Neustadt A, Beard RC, Cotman CW (1999) Exercise, an-
tidepressant medications, and enhanced brain derived neurotroph-
ic factor expression. Neuropsychopharmacology 21(5):679–682.
https://doi.org/10.1016/S0893-133X(99)00059-7
29. Russo-Neustadt AA, Alejandre H, Garcia C, Ivy AS, Chen MJ
(2004) Hippocampal brain-derived neurotrophic factor expression

following treatment with reboxetine, citalopram, and physical ex-
ercise. Neuropsychopharmacology 29(12):2189–2199. https://doi.
org/10.1038/sj.npp.1300514
30. Castren E, Rantamaki T (2010) The role of BDNF and its recep-
tors in depression and antidepressant drug action: reactivation of
developmental plasticity. Dev Neurobiol 70(5):289–297. https://
doi.org/10.1002/dneu.20758
31. Castren E, Rantamaki T (2010) Role of brain-derived neurotroph-
ic factor in the aetiology of depression: implications for pharma-
cological treatment. CNS Drugs 24(1):1–7. https://doi.org/10.
2165/11530010-000000000-00000
32. Siuciak JA, Boylan C, Fritsche M, Altar CA, Lindsay RM (1996)
BDNF increases monoaminergic activity in rat brain following
intracerebroventricular or intraparenchymal administration. Brain
Res 710(1–2):11–20. https://doi.org/10.1016/0006-8993(95)
01289-3
33. Wong YH, Lee CM, Xie W, Cui B, Poo MM (2015) Activity-
dependent BDNF release via endocytic pathways is regulated by
synaptotagmin-6 and complexin. Proc Natl Acad Sci U S A
112(32):E4475–E4484. https://doi.org/10.1073/pnas.1511830112
34. Sakata K, Martinowich K, Woo NH, Schloesser RJ, Jimenez DV,
Ji Y, Shen L, Lu B (2013) Role of activity-dependent BDNF
expression in hippocampal-prefrontal cortical regulation of behav-
ioral perseverance. Proc Natl Acad Sci U S A 110(37):15103–
15108. https://doi.org/10.1073/pnas.1222872110
35. Altamura CA, Mauri MC, Ferrara A, Moro AR, D’Andrea G,
Zamberlan F (1993) Plasma and platelet excitatory amino acids
in psychiatric disorders. Am J Psychiatry 150(11):1731–1733.
https://doi.org/10.1176/ajp.150.11.1731
36. Deutschenbaur L, Beck J, Kiyhankhadiv A, Muhlhauser M,
Borgwardt S, Walter M, Hasler G, Sollberger D et al (2016)
Role of calcium, glutamate and NMDA in major depression and
therapeutic application. Prog Neuro-Psychopharmacol Biol
Psychiatry 64:325–333. https://doi.org/10.1016/j.pnpbp.2015.02.
015
37. Frye MA, Tsai GE, Huggins T, Coyle JT, Post RM (2007) Low
cerebrospinal fluid glutamate and glycine in refractory affective
disorder. Biol Psychiatry 61(2):162–166. https://doi.org/10.1016/
j.biopsych.2006.01.024
38. Ghasemi M, Phillips C, Trillo L, De Miguel Z, Das D, Salehi A
(2014) The role of NMDA receptors in the pathophysiology and
treatment of mood disorders. Neurosci Biobehav Rev 47:336–
358. https://doi.org/10.1016/j.neubiorev.2014.08.017
39. Hashimoto K, Sawa A, Iyo M (2007) Increased levels of gluta-
mate in brains from patients with mood disorders. Biol Psychiatry
62(11):1310–1316. https://doi.org/10.1016/j.biopsych.2007.03.
017
40. Kim JS, Schmid-Burgk W, Claus D, Kornhuber HH (1982)
Increased serum glutamate in depressed patients. Archiv
Psychiat Nervenkrankheiten 232(4):299–304. https://doi.org/10.
1007/BF00345492
41. Levine J, Panchalingam K, Rapoport A, Gershon S, McClure RJ,
Pettegrew JW (2000) Increased cerebrospinal fluid glutamine
levels in depressed patients. Biol Psychiatry 47(7):586–593.
https://doi.org/10.1016/s0006-3223(99)00284-x
42. Mathews DC, Henter ID, Zarate CA (2012) Targeting the gluta-
matergic system to treat major depressive disorder: rationale and
progress to date. Drugs 72(10):1313–1333. https://doi.org/10.
2165/11633130-000000000-00000
43. Mauri MC, Ferrara A, Boscati L, Bravin S, Zamberlan F, Alecci
M, Invernizzi G (1998) Plasma and platelet amino acid concentra-
tions in patients affected by major depression and under
fluvoxamine treatment. Neuropsychobiology 37(3):124–129.
https://doi.org/10.1159/000026491
44. Mitani H, Shirayama Y, Yamada T, Maeda K, Ashby CR Jr,
Kawahara R (2006) Correlation between plasma levels of
Mol Neurobiol
glutamate, alanine and serine with severity of depression. Prog
Neuro-Psychopharmacol Biol Psychiatry 30(6):1155–1158.
https://doi.org/10.1016/j.pnpbp.2006.03.036
45. Naughton M, Clarke G, O’Leary OF, Cryan JF, Dinan TG (2014)
A review of ketamine in affective disorders: current evidence of
clinical efficacy, limitations of use and pre-clinical evidence on
proposed mechanisms of action. J Affect Disord 156:24–35.
https://doi.org/10.1016/j.jad.2013.11.014
46. Bartanusz V, Aubry JM, Pagliusi S, Jezova D, Baffi J, Kiss JZ
(1995) Stress-induced changes in messenger RNA levels of N-
methyl-D-aspartate and AMPA receptor subunits in selected re-
gions of the rat hippocampus and hypothalamus. Neuroscience
66(2):247–252. https://doi.org/10.1016/0306-4522(95)00084-v
47. Fitzgerald LW, Ortiz J, Hamedani AG, Nestler EJ (1996) Drugs of
abuse and stress increase the expression of GluR1 and NMDAR1
glutamate receptor subunits in the rat ventral tegmental area: com-
mon adaptations among cross-sensitizing agents. J Neurosci
16(1):274–282
48. Marsden WN (2011) Stressor-induced NMDAR dysfunction as a
unifying hypothesis for the aetiology, pathogenesis and comorbid-
ity of clinical depression. Med Hypotheses 77(4):508–528. https://
doi.org/10.1016/j.mehy.2011.06.021
49. Masrour FF, Peeri M, Azarbayjani MA, Hosseini MJ (2018)
Voluntary exercise during adolescence mitigated negative the ef-
fects of maternal separation stress on the depressive-like behaviors
of adult male rats: role of NMDA receptors. Neurochem Res
43(5):1067–1074. https://doi.org/10.1007/s11064-018-2519-6
50. McCarthy DJ, Alexander R, Smith MA, Pathak S, Kanes S, Lee
CM, Sanacora G (2012) Glutamate-based depression GBD. Med
Hypotheses 78(5):675–681. https://doi.org/10.1016/j.mehy.2012.
02.009
51. Moghaddam B (1993) Stress preferentially increases
extraneuronal levels of excitatory amino acids in the prefrontal
cortex: comparison to hippocampus and basal ganglia. J
Neurochem 60(5):1650–1657. https://doi.org/10.1111/j.1471-
4159.1993.tb13387.x
52. Sathyanesan M, Haiar JM, Watt MJ, Newton SS (2017) Restraint
stress differentially regulates inflammation and glutamate receptor
gene expression in the hippocampus of C57BL/6 and BALB/c
mice. Stress 20(2):197–204. https://doi.org/10.1080/10253890.
2017.1298587
53. Weiland NG, Orchinik M, Tanapat P (1997) Chronic corticoste-
rone treatment induces parallel changes in N-methyl-D-aspartate
receptor subunit messenger RNA levels and antagonist binding
sites in the hippocampus. Neuroscience 78(3):653–662. https://
doi.org/10.1016/s0306-4522(96)00619-7
54. Jaso BA, Niciu MJ, Iadarola ND, Lally N, Richards EM, Park M,
Ballard ED, Nugent AC et al (2017) Therapeutic modulation of
glutamate receptors in major depressive disorder. Curr
Neuropharmacol 15(1):57–70. https://doi.org/10.2174/
1570159x14666160321123221
55. Berman RM, Cappiello A, Anand A, Oren DA, Heninger GR,
Charney DS, Krystal JH (2000) Antidepressant effects of keta-
mine in depressed patients. Biol Psychiatry 47(4):351–354.
https://doi.org/10.1016/s0006-3223(99)00230-9
56. Trullas R, Skolnick P (1990) Functional antagonists at the NMDA
receptor complex exhibit antidepressant actions. Eur J Pharmacol
185(1):1–10. https://doi.org/10.1016/0014-2999(90)90204-j
57. Zarate CA Jr, Singh JB, Carlson PJ, Brutsche NE, Ameli R,
Luckenbaugh DA, Charney DS, Manji HK (2006) A randomized
trial of an N-methyl-D-aspartate antagonist in treatment-resistant
major depression. Arch Gen Psychiatry 63(8):856–864. https://
doi.org/10.1001/archpsyc.63.8.856
58. Krystal JH, Sanacora G, Duman RS (2013) Rapid-acting gluta-
matergic antidepressants: the path to ketamine and beyond. Biol
Mol Neurobiol
Psychiatry 73(12):1133–1141. https://doi.org/10.1016/j.biopsych.
2013.03.026
59. Du J, Suzuki K, Wei Y, Wang Y, Blumenthal R, Chen Z, Falke C,
Zarate CA Jr et al (2007) The anticonvulsants lamotrigine,
riluzole, and valproate differentially regulate AMPA receptor
membrane localization: relationship to clinical effects in mood
disorders. Neuropsychopharmacology 32(4):793–802. https://
doi.org/10.1038/sj.npp.1301178
60. Freudenberg F, Celikel T, Reif A (2015) The role of alpha-amino-
3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) recep-
tors in depression: central mediators of pathophysiology and anti-
depressant activity? Neurosci Biobehav Rev 52:193–206. https://
doi.org/10.1016/j.neubiorev.2015.03.005
61. Aan Het Rot M, Zarate CA Jr, Charney DS, Mathew SJ (2012)
Ketamine for depression: where do we go from here? Biol
Psychiatry 72(7):537–547. https://doi.org/10.1016/j.biopsych.
2012.05.003
62. Ionescu DF, Swee MB, Pavone KJ, Taylor N, Akeju O, Baer L,
Nyer M, Cassano P et al (2016) Rapid and sustained reductions in
current suicidal ideation following repeated doses of intravenous
ketamine: secondary analysis of an open-label study. J Clin
Psychiatry 77(6):e719–e725. https://doi.org/10.4088/JCP.
15m10056
63. Price RB, Mathew SJ (2015) Does ketamine have anti-suicidal
properties? Current status and future directions. CNS Drugs
29(3):181–188. https://doi.org/10.1007/s40263-015-0232-4
64. Koike H, Fukumoto K, Iijima M, Chaki S (2013) Role of BDNF/
TrkB signaling in antidepressant-like effects of a group II metab-
otropic glutamate receptor antagonist in animal models of depres-
sion. Behav Brain Res 238:48–52. https://doi.org/10.1016/j.bbr.
2012.10.023
65. Li N, Lee B, Liu RJ, Banasr M, Dwyer JM, Iwata M, Li XY,
Aghajanian G et al (2010) mTOR-dependent synapse formation
underlies the rapid antidepressant effects of NMDA antagonists.
Science 329(5994):959–964. https://doi.org/10.1126/science.
1190287
66. Liu RJ, Lee FS, Li XY, Bambico F, Duman RS, Aghajanian GK
(2012) Brain-derived neurotrophic factor Val66Met allele impairs
basal and ketamine-stimulated synaptogenesis in prefrontal cortex.
Biol Psychiatry 71(11):996–1005. https://doi.org/10.1016/j.
biopsych.2011.09.030
67. Autry AE, Adachi M, Nosyreva E, Na ES, Los MF, Cheng PF,
Kavalali ET, Monteggia LM (2011) NMDA receptor blockade at
rest triggers rapid behavioural antidepressant responses. Nature
475(7354):91–95. https://doi.org/10.1038/nature10130
68. Maeng S, Zarate CA Jr, Du J, Schloesser RJ, McCammon J, Chen
G, Manji HK (2008) Cellular mechanisms underlying the antide-
pressant effects of ketamine: role of alpha-amino-3-hydroxy-5-
methylisoxazole-4-propionic acid receptors. Biol Psychiatry
63(4):349–352. https://doi.org/10.1016/j.biopsych.2007.05.028
69. Hashimoto K (2011) Role of the mTOR signaling pathway in the
rapid antidepressant action of ketamine. Expert Rev Neurother
11(1):33–36. https://doi.org/10.1586/ern.10.176
70. Koike H, Iijima M, Chaki S (2011) Involvement of AMPA recep-
tor in both the rapid and sustained antidepressant-like effects of
ketamine in animal models of depression. Behav Brain Res
224(1):107–111. https://doi.org/10.1016/j.bbr.2011.05.035
71. Luscher B, Feng M, Jefferson SJ (2020) Antidepressant mecha-
nisms of ketamine: focus on GABAergic inhibition. Adv
Pharmacol 89:43–78. https://doi.org/10.1016/bs.apha.2020.03.
002
72. Beneyto M, Kristiansen LV, Oni-Orisan A, McCullumsmith RE,
Meador-Woodruff JH (2007) Abnormal glutamate receptor ex-
pression in the medial temporal lobe in schizophrenia and mood
disorders. Neuropsychopharmacology 32(9):1888–1902. https://
doi.org/10.1038/sj.npp.1301312
73. Duric V, Banasr M, Stockmeier CA, Simen AA, Newton SS,
Overholser JC, Jurjus GJ, Dieter L et al (2013) Altered expression
of synapse and glutamate related genes in post-mortem hippocam-
pus of depressed subjects. Int J Neuropsychopharmacol 16(1):69–
82. https://doi.org/10.1017/S1461145712000016
74. Toth E, Gersner R, Wilf-Yarkoni A, Raizel H, Dar DE, Richter-
Levin G, Levit O, Zangen A (2008) Age-dependent effects of
chronic stress on brain plasticity and depressive behavior. J
Neurochem 107(2):522–532. https://doi.org/10.1111/j.1471-
4159.2008.05642.x
75. Ferrari F, Villa RF (2017) The neurobiology of depression: an
integrated overview from biological theories to clinical evidence.
Mol Neurobiol 54(7):4847–4865. https://doi.org/10.1007/s12035-
016-0032-y
76. Kaufman J, DeLorenzo C, Choudhury S, Parsey RV (2016) The 5-
HT1A receptor in major depressive disorder. Eur
Neuropsychopharmacol 26(3):397–410. https://doi.org/10.1016/
j.euroneuro.2015.12.039
77. Yohn CN, Gergues MM, Samuels BA (2017) The role of 5-HT
receptors in depression. Mol Brain 10(1):28. https://doi.org/10.
1186/s13041-017-0306-y
78. Cheetham SC, Crompton MR, Katona CL, Horton RW (1990)
Brain 5-HT1 binding sites in depressed suicides.
Psychopharmacology 102(4):544–548. https://doi.org/10.1007/
bf02247138
79. Stockmeier CA, Shapiro LA, Dilley GE, Kolli TN, Friedman L,
Rajkowska G (1998) Increase in serotonin-1A autoreceptors in the
midbrain of suicide victims with major depression-postmortem
evidence for decreased serotonin activity. J Neurosci 18(18):
7394–7401
80. Carr GV, Lucki I (2011) The role of serotonin receptor subtypes in
treating depression: a review of animal studies.
Psychopharmacology 213(2–3):265–287. https://doi.org/10.
1007/s00213-010-2097-z
81. Joca SR, Padovan CM, Guimaraes FS (2003) Activation of post-
synaptic 5-HT(1A) receptors in the dorsal hippocampus prevents
learned helplessness development. Brain Res 978(1–2):177–184.
https://doi.org/10.1016/s0006-8993(03)02943-3
82. Pitchot W, Hansenne M, Pinto E, Reggers J, Fuchs S, Ansseau M
(2005) 5-Hydroxytryptamine 1A receptors, major depression, and
suicidal behavior. Biol Psychiatry 58(11):854–858. https://doi.
org/10.1016/j.biopsych.2005.05.042
83. Savitz JB, Drevets WC (2013) Neuroreceptor imaging in depres-
sion. Neurobiol Dis 52:49–65. https://doi.org/10.1016/j.nbd.2012.
06.001
84. Duman RS, Heninger GR, Nestler EJ (1997) A molecular and
cellular theory of depression. Arch Gen Psychiatry 54(7):597–606
85. Depoortere R, Papp M, Gruca P, Lason-Tyburkiewicz M,
Niemczyk M, Varney MA, Newman-Tancredi A (2019)
Cortical 5-hydroxytryptamine 1A receptor biased agonist, NLX-
101, displays rapid-acting antidepressant-like properties in the rat
chronic mild stress model. J Psychopharmacol 33(11):1456–
1466. https://doi.org/10.1177/0269881119860666
86. Newman-Tancredi A, Bardin L, Auclair A, Colpaert F,
Depoortere R, Varney MA (2018) NLX-112, a highly selective
5-HT1A receptor agonist, mediates analgesia and antidepressant-
like activity in rats via spinal cord and prefrontal cortex 5-HT1A
receptors, respectively. Brain Res 1688:1–7. https://doi.org/10.
1016/j.brainres.2018.03.016
87. Ago Y, Tanabe W, Higuchi M, Tsukada S, Tanaka T, Yamaguchi
T, Igarashi H, Yokoyama R et al (2019) (R)-ketamine induces a
greater increase in prefrontal 5-HT release than (S)-ketamine and
ketamine metabolites via an AMPA receptor-independent mecha-
nism. Int J Neuropsychopharmacol 22(10):665–674. https://doi.
org/10.1093/ijnp/pyz041

88. Pham TH, Mendez-David I, Defaix C, Guiard BP, Tritschler L,
David DJ, Gardier AM (2017) Ketamine treatment involves me-
dial prefrontal cortex serotonin to induce a rapid antidepressant-
like activity in BALB/cJ mice. Neuropharmacology 112(Pt A):
198–209. https://doi.org/10.1016/j.neuropharm.2016.05.010
89. Jin HJ, Pei L, Li YN, Zheng H, Yang S, Wan Y, Mao L, Xia YP
et al (2017) Alleviative effects of fluoxetine on depressive-like
behaviors by epigenetic regulation of BDNF gene transcription
in mouse model of post-stroke depression. Sci Rep 7(1):14926.
https://doi.org/10.1038/s41598-017-13929-5
90. Takeuchi N, Nonen S, Kato M, Wakeno M, Takekita Y, Kinoshita
T, Kugawa F (2017) Therapeutic response to paroxetine in major
depressive disorder predicted by DNA methylation.
Neuropsychobiology 75(2):81–88. https://doi.org/10.1159/
000480512
91. Dwivedi Y, Rizavi HS, Conley RR, Roberts RC, Tamminga CA,
Pandey GN (2003) Altered gene expression of brain-derived neu-
rotrophic factor and receptor tyrosine kinase B in postmortem
brain of suicide subjects. Arch Gen Psychiatry 60(8):804–815.
https://doi.org/10.1001/archpsyc.60.8.804
92. Tsankova N, Renthal W, Kumar A, Nestler EJ (2007) Epigenetic
regulation in psychiatric disorders. Nat Rev Neurosci 8(5):355–
367. https://doi.org/10.1038/nrn2132
93. Krishnan V, Nestler EJ (2008) The molecular neurobiology of
depression. Nature 455(7215):894–902. https://doi.org/10.1038/
nature07455
94. Zhu K, Ou Yang TH, Dorie V, Zheng T, Anastassiou D (2019)
Meta-analysis of expression and methylation signatures indicates
a stress-related epigenetic mechanism in multiple neuropsychiatric
disorders. Transl Psychiatry 9(1):32. https://doi.org/10.1038/
s41398-018-0358-5
95. Jones PA, Takai D (2001) The role of DNA methylation in mam-
malian epigenetics. Science 293(5532):1068–1070. https://doi.
org/10.1126/science.1063852
96. Tognini P, Napoli D, Pizzorusso T (2015) Dynamic DNA meth-
ylation in the brain: a new epigenetic mark for experience-
dependent plasticity. Front Cell Neurosci 9:331. https://doi.org/
10.3389/fncel.2015.00331
97. Wang P, Lv Q, Mao Y, Zhang C, Bao C, Sun H, Chen H, Yi Z et al
(2018) HTR1A/1B DNA methylation may predict escitalopram
treatment response in depressed Chinese Han patients. J Affect
Disord 228:222–228. https://doi.org/10.1016/j.jad.2017.12.010
98. Le Francois B, Soo J, Millar AM, Daigle M, Le Guisquet AM,
Leman S, Minier F, Belzung C et al (2015) Chronic mild stress
and antidepressant treatment alter 5-HT1A receptor expression by
modifying DNA methylation of a conserved Sp4 site. Neurobiol
Dis 82:332–341. https://doi.org/10.1016/j.nbd.2015.07.002
99. Gassen NC, Fries GR, Zannas AS, Hartmann J, Zschocke J,
Hafner K, Carrillo-Roa T, Steinbacher J et al (2015)
Chaperoning epigenetics: FKBP51 decreases the activity of
DNMT1 and mediates epigenetic effects of the antidepressant
paroxetine. Sci Signal 8(404):ra119. https://doi.org/10.1126/
scisignal.aac7695
100. Higuchi F, Uchida S, Yamagata H, Otsuki K, Hobara T, Abe N,
Shibata T, Watanabe Y (2011) State-dependent changes in the
expression of DNA methyltransferases in mood disorder patients.
J Psychiatr Res 45(10):1295–1300. https://doi.org/10.1016/j.
jpsychires.2011.04.008
101. Sales AJ, Biojone C, Terceti MS, Guimaraes FS, Gomes MV, Joca
SR (2011) Antidepressant-like effect induced by systemic and
intra-hippocampal administration of DNA methylation inhibitors.
Br J Pharmacol 164(6):1711–1721. https://doi.org/10.1111/j.
1476-5381.2011.01489.x
102. Sales AJ, Joca SR (2016) Effects of DNA methylation inhibitors
and conventional antidepressants on mice behaviour and brain
Mol Neurobiol
DNA methylation levels. Acta Neuropsychiatrica 28(1):11–22.
https://doi.org/10.1017/neu.2015.40
103. Sales AJ, Joca SRL (2018) Antidepressant administration modu-
lates stress-induced DNA methylation and DNA methyltransfer-
ase expression in rat prefrontal cortex and hippocampus. Behav
Brain Res 343:8–15. https://doi.org/10.1016/j.bbr.2018.01.022
104. LaPlant Q, Vialou V, Covington HE 3rd, Dumitriu D, Feng J,
Warren BL, Maze I, Dietz DM et al (2010) Dnmt3a regulates
emotional behavior and spine plasticity in the nucleus accumbens.
Nat Neurosci 13(9):1137–1143. https://doi.org/10.1038/nn.2619
105. Xing B, Liu P, Xu WJ, Xu FY, Dang YH (2014) Effect of
microinjecting of 5-aza-2-deoxycytidine into ventrolateral orbital
cortex on depressive-like behavior in rats. Neurosci Lett 574:11–
14. https://doi.org/10.1016/j.neulet.2014.04.050
106. Martinowich K, Hattori D, Wu H, Fouse S, He F, Hu Y, Fan G,
Sun YE (2003) DNA methylation-related chromatin remodeling
in activity-dependent BDNF gene regulation. Science 302(5646):
890–893. https://doi.org/10.1126/science.1090842
107. Fuchikami M, Morinobu S, Segawa M, Okamoto Y, Yamawaki S,
Ozaki N, Inoue T, Kusumi I et al (2011) DNA methylation profiles
of the brain-derived neurotrophic factor (BDNF) gene as a potent
diagnostic biomarker in major depression. PLoS One 6(8):e23881.
https://doi.org/10.1371/journal.pone.0023881
108. Tsankova NM, Berton O, Renthal W, Kumar A, Neve RL, Nestler
EJ (2006) Sustained hippocampal chromatin regulation in a mouse
model of depression and antidepressant action. Nat Neurosci 9(4):
519–525. https://doi.org/10.1038/nn1659
109. Kang HJ, Kim JM, Lee JY, Kim SY, Bae KY, Kim SW, Shin IS,
Kim HR et al (2013) BDNF promoter methylation and suicidal
behavior in depressive patients. J Affect Disord 151(2):679–685.
https://doi.org/10.1016/j.jad.2013.08.001
110. Chan RF, Turecki G, Shabalin AA, Guintivano J, Zhao M, Xie
LY, van Grootheest G, Kaminsky ZA et al (2020) Cell type-
specific methylome-wide association studies implicate
neurotrophin and innate immune signaling in major depressive
disorder. Biol Psychiatry 87(5):431–442. https://doi.org/10.1016/
j.biopsych.2019.10.014
111. Chang LC, Jamain S, Lin CW, Rujescu D, Tseng GC, Sibille E
(2014) A conserved BDNF, glutamate- and GABA-enriched gene
module related to human depression identified by coexpression
meta-analysis and DNA variant genome-wide association studies.
PLoS One 9(3):e90980. https://doi.org/10.1371/journal.pone.
0090980
112. Keller S, Sarchiapone M, Zarrilli F, Tomaiuolo R, Carli V,
Angrisano T, Videtic A, Amato F et al (2011) TrkB gene expres-
sion and DNA methylation state in Wernicke area does not asso-
ciate with suicidal behavior. J Affect Disord 135(1–3):400–404.
https://doi.org/10.1016/j.jad.2011.07.003
113. Wang P, Zhang C, Lv Q, Bao C, Sun H, Ma G, Fang Y, Yi Z et al
(2018) Association of DNA methylation in BDNF with
escitalopram treatment response in depressed Chinese Han pa-
tients. Eur J Clin Pharmacol 74(8):1011–1020. https://doi.org/10.
1007/s00228-018-2463-z
114. Aberg KA, Dean B, Shabalin AA, Chan RF, Han LKM, Zhao M,
van Grootheest G, Xie LY et al (2018) Methylome-wide associa-
tion findings for major depressive disorder overlap in blood and
brain and replicate in independent brain samples. Mol Psychiatry.
https://doi.org/10.1038/s41380-018-0247-6
115. Boersma GJ, Lee RS, Cordner ZA, Ewald ER, Purcell RH,
Moghadam AA, Tamashiro KL (2014) Prenatal stress decreases
Bdnf expression and increases methylation of Bdnf exon IV in
rats. Epigenetics 9(3):437–447. https://doi.org/10.4161/epi.27558
116. Chandrasekar R (2013) Alcohol and NMDA receptor: current re-
search and future direction. Front Mol Neurosci 6:14. https://doi.
org/10.3389/fnmol.2013.00014
Mol Neurobiol
117. Kaut O, Schmitt I, Hofmann A, Hoffmann P, Schlaepfer TE,
Wullner U, Hurlemann R (2015) Aberrant NMDA receptor
DNA methylation detected by epigenome-wide analysis of hippo-
campus and prefrontal cortex in major depression. Eur Arch
Psychiatry Clin Neurosci 265(4):331–341. https://doi.org/10.
1007/s00406-014-0572-y
118. Jobe EM, Zhao X (2017) DNA methylation and adult
neurogenesis. Brain Plast 3(1):5–26. https://doi.org/10.3233/
BPL-160034
119. Sweatt JD (2016) Dynamic DNA methylation controls glutamate
receptor trafficking and synaptic scaling. J Neurochem 137(3):
312–330. https://doi.org/10.1111/jnc.13564
120. Mahar I, Bambico FR, Mechawar N, Nobrega JN (2014) Stress,
serotonin, and hippocampal neurogenesis in relation to depression
and antidepressant effects. Neurosci Biobehav Rev 38:173–192.
https://doi.org/10.1016/j.neubiorev.2013.11.009
121. Fukumoto K, Iijima M, Funakoshi T, Chaki S (2018) Role of 5-
HT1A receptor stimulation in the medial prefrontal cortex in the
sust aine d ant ide pres sant effects of ket amine. Int J
Neuropsychopharmacol 21(4):371–381. https://doi.org/10.1093/
ijnp/pyx116
122. Zhou W, Wang N, Yang C, Li XM, Zhou ZQ, Yang JJ (2014)
Ketamine-induced antidepressant effects are associated with
AMPA receptors-mediated upregulation of mTOR and BDNF in
rat hippocampus and prefrontal cortex. Eur Psychiatry 29(7):419–
423. https://doi.org/10.1016/j.eurpsy.2013.10.005
123. Sales A, Biojone C, Joca S (2016) Site-specific delivery of epige-
netic modulating drugs into the rat brain. In: Karpova N (ed)
Epigenetic methods in neuroscience research, Neuromethods,
vol 105. Humana press, New York
124. Paxinos G, Watson C (2013) The rat brain in stereotaxic coordi-
nates, 7th edn. Academic Press, Cambridge
125. Abel EL, Bilitzke PJ (1990) A possible alarm substance in the
forced swimming test. Physiol Behav 48(2):233–239
126. Bonefeld BE, Elfving B, Wegener G (2008) Reference genes for
normalization: a study of rat brain tissue. Synapse 62(4):302–309.
https://doi.org/10.1002/syn.20496
127. Karpova NN, Umemori J (2016) Protocol for methylated DNA
immunoprecipitation (meDIP) analysis. In: Epigenetic methods in
neuroscience research, vol 105. Humana Press, New York, pp.
97–114
128. Roy B, Shelton RC, Dwivedi Y (2017) DNA methylation and
expression of stress related genes in PBMC of MDD patients with
and without serious suicidal ideation. J Psychiatr Res 89:115–124.
https://doi.org/10.1016/j.jpsychires.2017.02.005
129. Casarotto PC, de Bortoli VC, Correa FM, Resstel LB, Zangrossi H
Jr (2010) Panicolytic-like effect of BDNF in the rat dorsal
periaqueductal grey matter: the role of 5-HT and GABA. Int J
Neuropsychopharmacol 13(5):573–582. https://doi.org/10.1017/
S146114570999112X
130. Fernandez Macedo GV, Cladouchos ML, Sifonios L, Cassanelli
PM, Wikinski S (2013) Effects of fluoxetine on CRF and CRF1
expression in rats exposed to the learned helplessness paradigm.
Psychopharmacology 225(3):647–659. https://doi.org/10.1007/
s00213-012-2859-x
131. Yan HC, Cao X, Das M, Zhu XH, Gao TM (2010) Behavioral
animal models of depression. Neurosci Bull 26(4):327–337.
https://doi.org/10.1007/s12264-010-0323-7
132. Urb M, Anier K, Matsalu T, Aonurm-Helm A, Tasa G, Koppel I,
Zharkovsky A, Timmusk T et al (2019) Glucocorticoid receptor
stimulation resulting from early life stress affects expression of
DNA methyltransferases in rat prefrontal cortex. J Mol Neurosci
68(1):99–110. https://doi.org/10.1007/s12031-019-01286-z
133. Morris MJ, Adachi M, Na ES, Monteggia LM (2014) Selective
role for DNMT3a in learning and memory. Neurobiol Learn Mem
115:30–37. https://doi.org/10.1016/j.nlm.2014.06.005
134. Feng J, Zhou Y, Campbell SL, Le T, Li E, Sweatt JD, Silva AJ,
Fan G (2010) Dnmt1 and Dnmt3a maintain DNA methylation and
regulate synaptic function in adult forebrain neurons. Nat
Neurosci 13(4):423–430. https://doi.org/10.1038/nn.2514
135. Levenson JM, Roth TL, Lubin FD, Miller CA, Huang IC, Desai P,
Malone LM, Sweatt JD (2006) Evidence that DNA (cytosine-5)
methyltransferase regulates synaptic plasticity in the hippocam-
pus. J Biol Chem 281(23):15763–15773. https://doi.org/10.1074/
jbc.M511767200
136. Poulter MO, Du L, Weaver IC, Palkovits M, Faludi G, Merali Z,
Szyf M, Anisman H (2008) GABAA receptor promoter hyperme-
thylation in suicide brain: Implications for the involvement of
epigenetic processes. Biol Psychiatry 64(8):645–652. https://doi.
org/10.1016/j.biopsych.2008.05.028
137. Hsieh MT, Lin CC, Lee CT, Huang TL (2019) Abnormal brain-
derived neurotrophic factor exon IX promoter methylation, pro-
tein, and mRNA levels in patients with major depressive disorder.
J Clin Med 8(5). https://doi.org/10.3390/jcm8050568
138. Efstathopoulos P, Andersson F, Melas PA, Yang LL, Villaescusa
JC, Ruegg J, Ekstrom TJ, Forsell Y et al (2018) NR3C1 hyperme-
thylation in depressed and bullied adolescents. Transl Psychiatry
8(1):121. https://doi.org/10.1038/s41398-018-0169-8
139. Haghighi F, Xin Y, Chanrion B, O’Donnell AH, Ge Y, Dwork AJ,
Arango V, Mann JJ (2014) Increased DNA methylation in the
suicide brain. Dialogues Clin Neurosci 16(3):430–438
140. Morris MJ, Na ES, Autry AE, Monteggia LM (2016) Impact of
DNMT1 and DNMT3a forebrain knockout on depressive- and
anxiety like behavior in mice. Neurobiol Learn Mem 135:139–
145. https://doi.org/10.1016/j.nlm.2016.08.012
141. Elliott E, Manashirov S, Zwang R, Gil S, Tsoory M, Shemesh Y,
Chen A (2016) Dnmt3a in the medial prefrontal cortex regulates
anxiety-like behavior in adult mice. J Neurosci 36(3):730–740.
https://doi.org/10.1523/JNEUROSCI.0971-15.2016
142. Momparler RL (2005) Pharmacology of 5-Aza-2′-deoxycytidine
(decitabine). Semin Hematol 42(3 Suppl 2):S9–S16
143. Fandy TE (2009) Development of DNA methyltransferase inhib-
itors for the treatment of neoplastic diseases. Curr Med Chem
16(17):2075–2085. https://doi.org/10.2174/
092986709788612738
144. Brueckner B, Garcia Boy R, Siedlecki P, Musch T, Kliem HC,
Zielenkiewicz P, Suhai S, Wiessler M et al (2005) Epigenetic
reactivation of tumor suppressor genes by a novel small-
molecule inhibitor of human DNA methyltransferases. Cancer
Res 65(14):6305–6311. https://doi.org/10.1158/0008-5472.
CAN-04-2957
145. Schirrmacher E, Beck C, Brueckner B, Schmitges F, Siedlecki P,
Bartenstein P, Lyko F, Schirrmacher R (2006) Synthesis and
in vitro evaluation of biotinylated RG108: a high affinity com-
pound for studying binding interactions with human DNA meth-
yltransferases. Bioconjug Chem 17(2):261–266. https://doi.org/
10.1021/bc050300b
146. Yang C, Shirayama Y, Zhang JC, Ren Q, Yao W, Ma M, Dong C,
Hashimoto K (2015) R-ketamine: a rapid-onset and sustained an-
tidepressant without psychotomimetic side effects. Transl
Psychiatry 5:e632. https://doi.org/10.1038/tp.2015.136
147. Schneeberger Y, Stenzig J, Hubner F, Schaefer A, Reichenspurner
H, Eschenhagen T (2016) Pharmacokinetics of the experimental
non-nucleosidic DNA methyl transferase inhibitor N-phthalyl-L-
tryptophan (RG 108) in rats. Basic Clin Pharmacol Toxicol
118(5):327–332. https://doi.org/10.1111/bcpt.12514
148. Marcucci G, Silverman L, Eller M, Lintz L, Beach CL (2005)
Bioavailability of azacitidine subcutaneous versus intravenous in
patients with the myelodysplastic syndromes. J Clin Pharmacol
45(5):597–602. https://doi.org/10.1177/0091270004271947
149. Champagne FA, Francis DD, Mar A, Meaney MJ (2003)
Variations in maternal care in the rat as a mediating influence

for the effects of environment on development. Physiol Behav
79(3):359–371
150. Li N, Liu RJ, Dwyer JM, Banasr M, Lee B, Son H, Li XY,
Aghajanian G et al (2011) Glutamate N-methyl-D-aspartate recep-
tor antagonists rapidly reverse behavioral and synaptic deficits
caused by chronic stress exposure. Biol Psychiatry 69(8):754–
761. https://doi.org/10.1016/j.biopsych.2010.12.015
151. Ardalan M, Rafati AH, Nyengaard JR, Wegener G (2017) Rapid
antidepressant effect of ketamine correlates with astroglial plastic-
ity in the hippocampus. Br J Pharmacol 174(6):483–492. https://
doi.org/10.1111/bph.13714
152. Ardalan M, Wegener G, Rafati AH, Nyengaard JR (2017) S-
ketamine rapidly reverses synaptic and vascular deficits of hippo-
campus in genetic animal model of depression. Int J
Neuropsychopharmacol 20(3):247–256. https://doi.org/10.1093/
ijnp/pyw098
153. Ardalan M, Elfving B, Rafati AH, Mansouri M, Zarate CA Jr,
Mathe AA, Wegener G (2020) Rapid effects of S-ketamine on
the morphology of hippocampal astrocytes and BDNF serum
levels in a sex-dependent manner. Eur Neuropsychopharmacol
32:94–103. https://doi.org/10.1016/j.euroneuro.2020.01.001
154. Lepack AE, Fuchikami M, Dwyer JM, Banasr M, Duman RS
(2014) BDNF release is required for the behavioral actions of
ketamine. Int J Neuropsychopharmacol 18(1). https://doi.org/10.
1093/ijnp/pyu033
155. Lener MS, Kadriu B, Zarate CA Jr (2017) Ketamine and beyond:
investigations into the potential of glutamatergic agents to treat
depression. Drugs 77(4):381–401. https://doi.org/10.1007/
s40265-017-0702-8
156. Hashimoto K (2011) The role of glutamate on the action of anti-
depressants. Prog Neuro-Psychopharmacol Biol Psychiatry 35(7):
1558–1568. https://doi.org/10.1016/j.pnpbp.2010.06.013
157. Castren E (2005) Is mood chemistry? Nat Rev Neurosci 6(3):241–
246. https://doi.org/10.1038/nrn1629
158. Courtney MJ, Akerman KE, Coffey ET (1997) Neurotrophins
protect cultured cerebellar granule neurons against the early phase
of cell death by a two-component mechanism. J Neurosci 17(11):
4201–4211
159. Karege F, Vaudan G, Schwald M, Perroud N, La Harpe R (2005)
Neurotrophin levels in postmortem brains of suicide victims and
the effects of antemortem diagnosis and psychotropic drugs. Brain
Res Mol Brain Res 136(1–2):29–37. https://doi.org/10.1016/j.
molbrainres.2004.12.020
Mol Neurobiol
160. Roth TL, Lubin FD, Funk AJ, Sweatt JD (2009) Lasting epige-
netic influence of early-life adversity on the BDNF gene. Biol
Psychiatry 65(9):760–769. https://doi.org/10.1016/j.biopsych.
2008.11.028
161. Zhang JC, Yao W, Dong C, Yang C, Ren Q, Ma M, Han M,
Hashimoto K (2015) Comparison of ketamine, 7,8-
dihydroxyflavone, and ANA-12 antidepressant effects in the so-
cial defeat stress model of depression. Psychopharmacology
232(23):4325–4335. https://doi.org/10.1007/s00213-015-4062-3
162. Shirayama Y, Hashimoto K (2018) Lack of antidepressant effects
of (2R,6R)-hydroxynorketamine in a rat learned helplessness
model: comparison with (R)-ketamine. Int J
Neuropsychopharmacol 21(1):84–88. https://doi.org/10.1093/
ijnp/pyx108
163. Maussion G, Yang J, Suderman M, Diallo A, Nagy C, Arnovitz
M, Mechawar N, Turecki G (2014) Functional DNA methylation
in a transcript specific 3′UTR region of TrkB associates with sui-
cide. Epigenetics 9(8):1061–1070. https://doi.org/10.4161/epi.
29068
164. Mifsud KR, Saunderson EA, Spiers H, Carter SD, Trollope AF,
Mill J, Reul JM (2017) Rapid down-regulation of glucocorticoid
receptor gene expression in the dentate gyrus after acute stress
in vivo: role of DNA methylation and microRNA activity.
Neuroendocrinology 104(2):157–169. https://doi.org/10.1159/
000445875
165. Martin-Hernandez D, Tendilla-Beltran H, Madrigal JLM, Garcia-
Bueno B, Leza JC, Caso JR (2019) Chronic mild stress alters
kynurenine pathways changing the glutamate neurotransmission
in frontal cortex of rats. Mol Neurobiol 56(1):490–501. https://doi.
org/10.1007/s12035-018-1096-7
166. van Eijk KR, de Jong S, Boks MP, Langeveld T, Colas F, Veldink
JH, de Kovel CG, Janson E et al (2012) Genetic analysis of DNA
methylation and gene expression levels in whole blood of healthy
human subjects. BMC Genomics 13:636. https://doi.org/10.1186/
1471-2164-13-636
167. Lea AJ, Vockley CM, Johnston RA, Del Carpio CA, Barreiro LB,
Reddy TE, Tung J (2018) Genome-wide quantification of the
effects of DNA methylation on human gene regulation. eLife 7.
https://doi.org/10.7554/eLife.37513
Publisher’s Note Springer Nature remains neutral with regard to jurisdic-
tional claims in published maps and institutional affiliations.