Biosci. Biotechnol. Biochem.

, 74 (7), 1447–1451, 2010

Yamabushitake Mushroom (Hericium erinaceus) Improved Lipid Metabolism

in Mice Fed a High-Fat Diet
Kazuyuki HIWATASHI,1;2 Yasuyuki KOSAKA,3 Nao SUZUKI,2 Keishi HATA,2 Toshiyuki MUKAIYAMA,3
Kenji SAKAMOTO,3 Hitoshi SHIRAKAWA,1;y and Michio KOMAI1
1
Laboratory of Nutrition, Graduate School of Agricultural Science, Tohoku University, Sendai 981-8555, Japan
2
Akita Research Institute for Food and Brewing (ARIF), 4-26 Sanuki, Araya-machi, Akita 010-1623, Japan
3
Sakamoto Bio Co., Ltd., 25 Kourokuzawa, Yuuwa-memeki, Akita 010-1233, Japan

Received February 23, 2010; Accepted April 15, 2010; Online Publication, July 7, 2010
[doi:10.1271/bbb.100130]

The effects of dietary Yamabushitake mushroom

(Hericium erinaceus) on lipid metabolism were exam-
ined. C57BL/6J mice were fed a high-fat diet
containing hot-water extract (HW-E) and an ethanol
extract (EtOH-E) of Yamabushitake mushroom.
Administra- tion of HW-E or EtOH-E with a high-fat
diet for 28 d resulted in a significant decrease in body
weight gain, fat weight, and serum and hepatic
triacylglycerol levels. Our in vitro experiments indicated
that EtOH-E acts as an agonist of peroxisome
proliferator-activated receptor α (PPARα).
Quantitative analyses of hepatic mRNA levels revealed
that EtOH-E administration resulted in up-regulation
of mRNA for a number of PPARα- regulating genes in
spite of the fact that the gene expression of PPARα did
not change. These results suggest that EtOH-E
improves lipid metabolism in mice fed a high-fat diet,
and that these effects were mediated by modulation of
lipid metabolic gene expression, at least in part via
activation of PPARα.
Key words: Yamabushitake mushroom; Hericium
erinaceus; lipid metabolism;
peroxisome proliferator-activated
receptor α (PPARα)
In developed countries, obesity is an important
health problem. Half or more of the adult
population is now identified as overweight (body
mass indexc or BMI > 25 kg/m2– c30 kg/m2) or
obese (BMI 30 kg/m ) in no less than 11
2 Preparation of Yamabushitake mushroom extract. We used
member countries of the Organization for
Economic Cooperation and Development
(OECD).1) Obesity is one of the significant risk
factors for metabolic syndrome, which include
hypertension and hyperlipidemia, potentially
leading to type-2 diabetes, cardiovascular
disease, and nonalcoholic fatty liver disease.2,3)
Recently, it was reported that several food
compo- nents have an anti-hyperlipidemia e ffect
in vivo. For example, isohumulones, 4) bitter acids
derived from hops, and sesamin, a sesame
lignan,5) improve lipid metabo- lism in rodents.
We have screened the anti-obesitic activities of
wild plants and mushrooms, and isolated
lupeol,6) a lupane-type triterpene from Chinese
dande- lion root, and ethanol extract from edible
shoots of giant butterbur (Petasites japonicus)7)
as active compounds.
Yamabushitake mushroom (Hericium
erinaceus) is a popular edible mushroom in east
Asia. It is utilized as a traditional Chinese
medicinal mushroom. Kawagishi et al. reported
that hericenones8) and erinacines,9) components of
the fruiting body of Yamabushitake mushroom,
can promote nerve growth factor synthesis in
cultured astrocytes. Oral administration of dried
Yamabushitake mushroom powder is effective in
im- proving mild cognitive impairment in
humans,10) but little is known about the anti-
obesity efficacy of Yamabushitake mushroom.
Here we investigated the lipid metabolism-
improving effects of dietary-administered
extracts of Yamabushitake mushroom in mice
fed a high-fat diet, examined the extracts for the
ligand activity of the nuclear receptor, and
analyzed the expression levels of the genes
involved in lipid metabolism in the mice to
elucidate the detailed mechanism.
Materials and Methods
two types of Yamabushitake mushroom extract as test
substances, a hot- water extract (HW-E) and an ethanol
extract (EtOH-E). Fruiting bodies of Yamabushitake,
cultured by us, were oven-dried and ground in a jet mill.
First, 200 g of dry powder of Yamabushitake (moisture 9.5%,
protein 9.6%, lipid 2.6%, ash 5.1%, carbohydrate 25.7%,
dietary fiber 47.5%) was suspended in hot water (2.0 liters).
After 2 h, treatment at 85 ○C, the suspension was filtered and
then lyophilized; the final product (48 g) was the HW-E.
Secondly, 400 g of dry powder of Yamabushitake was
agitated in 8.0 liters of ethanol for 16 h at room temperature
and then filtered. The filtrate was evaporated. The final
product (60 g) was the EtOH-E.
Animal experiment. C57BL/6JJcl mice (6 weeks old, male)
were purchased from CLEA Japan (Tokyo). They were
housed in poly- carbonate cages in a room maintained at 23 T
2 ○C under a 12-h light- dark cycle (8:00–20:00). They had
free access to fresh diet and drinking water during the
experimental period. They were fed High Fat Diet 32 (HFD,
CLEA Japan) for 7 d, and were divided into three

y
To whom correspondence should be addressed. Tel: +81-22-717-8812; Fax: +81-22-717-8813; E-mail:
shirakah@biochem.tohoku.ac.jp
Abbreviations: ALT, alanine transaminase; AST, aspartate transaminase; BMI, body mass index; C, control diet; EtOH, ethanol
extract diet; EtOH-E, ethanol extract; HDL-C, high-density lipoprotein cholesterol; HFD, High-Fat Diet 32; HW, hot-water extract
diet; HW-E, hot-water extract; LDL-C, low-density lipoprotein cholesterol; NEFA, nonesterified fatty acid; OECD, Organization for
Economic Cooperation and Development; PCR, polymerase chain reaction; PL, phospholipids; PPARα, peroxisome proliferator-
activated receptor α; RCAS, Receptor Coactivator Ligand Assay System; SEM, standard error of the mean; TC, total cholesterol;
TG, triacylglycerol
1448 K. HIWATASHI et al.
Table 1. Compositions and Food Intake of Experimental Diets
EnBioTec Laboratories (Tokyo) using a PPARα/Receptor
Based on the HFD
Coactivator Ligand Assay System (RCAS) following the
Ingredients (g/100 g) C HW EtOH protocol. RCAS can detect agonistic activity without
antagonistic activity. In brief, a mixture of recombinant human
Casein 24.50 24.01 24.01 PPARα and samples was added to the wells of a plate coated
Egg white 5.00 4.90 4.90 with biotinylated coactivator peptide, and this was allowed to
L-Cystine 0.43 0.42 0.42 react at room temperature for 1 h. After washing of the wells
Beef tallow 15.88 15.56 15.56 with wash solution, anti-PPARα-horseradish peroxidase
Safflower oil 20.00 19.60 19.60 solution was added to each well. The absorbance at 450 nm was
Cellulose 5.50 5.39 5.39 measured with a microplate reader after incubation with the
Maltodextrin 8.25 8.09 8.09 chromogen. Wy14643 (Cayman Chemical, Ann Arbor, MI), a
selective PPARα agonist, was used as positive control.
Lactose 6.93 6.79 6.79
Sucrose 6.75 6.62 6.62
RNA preparation and quantitative real-time polymerase
Vitamin mix (AIN-93) 1.40 1.37 1.37 chain reaction (PCR). Total RNA was isolated from the liver
Mineral mix (AIN-93G) 5.00 4.90 4.90 with a silica- membrane spin column kit, an RNeasy Maxi
Choline bitartrate 0.36 0.35 0.35 Kit (Qiagen, Hilden, Germany) following the instruction
tert-Butylhydoroquinone 0.002 0.002 0.002 manual. The wavelength ratios at 260 and 280 nm and
Hot water extract of 2.00 capillary electrophoresis using an Agilent 2100 Bioanalyzer
Yamabushitake (Agilent Technologies, Santa Clara, CA) were measured to
EtOH extract of Yamabushitake 2.00 facilitate quantitative and qualitative analysis of isolated
RNA. Template cDNA synthesis was performed with 5 mg of
Actual composition (g/100 total RNA using a PrimeScript RT reagent Kit (Takara Bio,
g) Shiga, Japan) following the manufacturer’s instructions.
Moisture 6.1 5.0 7.6 Aliquots of cDNA were used as a template for subsequent
Protein 25.4 26.3 26.6 quantitative real-time-PCR using Chromo4 (Bio-Rad ~
Lipid 32.7 31.2 29.3 Laboratories, Hercules, CA). cDNA samples in 25 ml of 1
Ash 3.6 3.9 3.7 SYBR Premix Ex Taq (Takara Bio) containing 0.2 mM of
Carbohydrate 32.2 33.6 32.8 each primer were incubated in the thermal cycler for initial
Dietary fiber 5.5 5.8 5.5 denaturation at 95 ○C for 10 s, followed by 40 PCR cycles.
Each cycle consisted of 95 ○C for 5 s and 60 ○C for 30 s. The
Food intake (g/d) 2.56 2.37 2.52 oligonucleotide primers used in the experiment are indicated
in Table 2. To confirm amplification of specific transcripts,
HFD, High Fat Diet 32; C, control diet; HW, hot water extract diet;
melting curve profiles (cooling the sample to 60 ○C and to 95
EtOH, ethanol extract diet ○
C with continuous measurement of fluorescence) were
produced at the end of each PCR. The relative expression
groups of six mice each: control diet (C), hot-water extract levels of gene expression were normalized by the amount of
diet (HW), and ethanol extract diet (EtOH), and the six mice þ-actin (Actb) mRNA.
in a given group were housed in identical polycarbonate
cages. The composition of the HFD- based experimental Statistical analysis. Values are presented as means and
diets is shown in Table 1. HW and EtOH were supplemented standard errors (SEM). To evaluate di fferences among the
with 2% of HW-E and EtOH-E as the test substances. groups studied, one- way ANOVA was followed by
Determinations of the actual diet composition were Dunnett’s post hoc test (Fig. 1 and Table 3) and Student’s t-
performed by the Akita Foundation For Health Care (Akita, test (Fig. 3). GraphPad Prism 5.0-J (MDF, Tokyo) was used
Japan). All test diets were administered for 28 consecutive d. to analyze all data. Probability values of p < 0:05 were
Food intake was recorded every day, and body weight was considered significant.
measured once every 2 or 3 d. At the end of the experimental
period, the mice were sacrificed under light diethyl ether
anesthesia after 16 h of fasting. Blood was collected from the
Results
abdominal aorta, and the serum obtained was stored at —20
○
C until analysis. Livers, mesenteric and epididymal adipose Food intake, body weight, and body fat
tissues were excised, weighed, and frozen at —80 ○C until Daily food intake per cage did not differ
analysis. The exper- imental plan of the study was approved among the groups in this experiment (Table 1).
by the Ethics Committee for Animal Experimentation of the
Akita Research Institute for Food and Brewing. The entire
The EtOH mice were significantly lighter than
experiment closely followed the guidelines issued by the the C mice by day 24 of treatment. These trends
Committee, which strictly follows government legislation continued throughout the treat- ment period (Fig.
in Japan. 1). By the end of the 28-d treatment period, the
body weights of the HW and EtOH groups were
Serum and liver parameters. Serum levels of glucose, total significantly lower than the C group. On average,
cholesterol (TC), triacylglycerol (TG), high-density lipoprotein BW gain was 30.0% lower in the HW mice and
cho- lesterol (HDL-C), aspartate transaminase (AST), and
alanine trans- aminase (ALT) were measured with an automatic
42.4% lower in the EtOH mice than in the C
analyzer (Fuji DRI- CHEM 3500V; Fujifilm, Tokyo). The mice. The results of tissue harvesting indicated
concentration of low-density lipoprotein cholesterol (LDL-C) that mesenteric adipose tissue in the HW and
was calculated by Friedewald’s formula.11) The serum EtOH groups was significantly smaller than in
nonesterified fatty acid (NEFA) level was determined by the C group (32.4% and 38.5% decreases,
enzymatic colorimetric methods (Wako Pure Chemical respectively). In contrast, the weights of
Industries, Osaka, Japan). Levels of serum leptin and epididymal adipose tissue did not change among
adiponectin were determined by sandwich enzyme-linked
immunoassay (Morinaga Institute of Biological Science, the groups.
Kanagawa, Japan, and Otsuka Pharmaceutical, Tokyo,
respectively). The procedure for sample pretreatment and Serum parameters
measurement was carried out according to the instruction Table 3 shows the serum parameters recorded
manuals. Liver lipids were determined following Folch et in the present experiment. The HW and EtOH
al.12) Liver TC, TG, and phospholipid (PL) concentrations were
determined using enzymatic colorimetric kits (Sekisui
groups showed significantly lower serum TG
Chemical, Tokyo), following extraction of liver samples with levels than the C group (8.0% and 27.1%
chloroform- methanol (2:1, v/v). decreases, respectively). HW and EtOH did not
influence TC, HDL-C, or NEFA, but the average
Peroxisome proliferator-activated receptor (PPAR) α agonist LDL-Cs in the HW and EtOH groups were lower
assay. PPARα competitive binding assays were performed by than in the C group, although the differences
were not significant. At the end of the
experiment, the serum glucose level in the
HW group was significantly lower
 Hericium erinaceus Improved Lipid Metabolism 1449
Table 2. Sequences of Primers for PCR Amplification

Gene Function Forward primer Reverse primer

Ppara Transcription factor AAGTGCCTGTCTGTCGGGATG CCAGAGATTTGAGGTCTGCAGTTTC
Apoa1 Lipoprotein AATGTGTATGTGGATGCGGTCAA AGCCGTTCCTGCAGCTGACTA
Lpl Fatty acid transport GCCCAGCAACATTATCCAGT GGTCAGACTTCCTGCTACGC
Slc27a1 Fatty acid transport GCAGCATTGCCAACATGGAC GTGTCCTCATTGACCTTGACCAGA
Slc27a4 Fatty acid transport TGCCCAGTCACCCAGACAAG CATGCGGAATCCATAGTACACCAG
Acsl1 Fatty acid transport TGACCTCTCCATGCAGTCAG GAGCCTATGCACTCAGCCAGT
Acox1 Fatty acid oxidation CAGCGTTACGAGGTGGCTGTTA TGCCCAAGTGAAGGTCCAAAG
Acadm Fatty acid oxidation TGATGTGGCGGCCATTAAGA GGGTTAGAACGTGCCAACAAGAA
Acadl Fatty acid oxidation CTACCTCATGCAAGAGCTTCCACA CTTCAAACATGAACTCACAGGCAGA
Srebf1 Transcription factor GGAGACATCGCAAACAAGCTGA CAGACTGCAGGCCAGATCCA
Fasn Fatty acid synthesis GCAGCAAGTGTCCACCAACAA CTCATCGGAGCGCAGGATAGA
Acaca Fatty acid synthesis GAGTGACTGCCGAAACATCTCTG GCCTCTTCCTGACAAACGAGT
Actb Housekeeping CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA
Ppara, Peroxisome Proliferator-Activated Receptor α; Apoa1, apo A-I; Lpl, lipoprotein lipase; Slc27a1, fatty acid transport protein 1; Slc27a4, fatty
acid transport protein 4; Acsl1, acyl-CoA synthetase long-chain family member 1; Acox1, palmitoyl acyl-CoA oxidase 1; Acadm, acyl-CoA
dehydrogenase, medium chain; Acadl, acyl-CoA dehydrogenase, long-chain; Srebf1, sterol regulatory element binding factor 1; Fasn, fatty acid
synthase; Acaca, acetyl-CoA carboxylase α; Actb, þ-actin

Table 3. Effects of Experimental Diets on Tissue Weight and the Biochemical Parameters in Mice Fed a High-Fat Diet

C HW EtOH
Mean SEM Mean SEM Mean SEM
Tissue
weight
Liver (mg) 1485 87 1170x 62 1183x 89
(mg/100 g BW) 4180 182 3582 109 3793 189
Mesenteric adipose (mg) 1056 76 714x 73 649x 79
tissue
(mg/100 g BW) 2968 165 2173x 158 2067x 202
Epididymal adipose (mg) 846 39 721 33 698 37
tissue
(mg/100 g BW) 2387 89 2215 83 2243 72
Serum
Triglyceride (mg/dl) 122.5 7.7 112.7x 3.2 89.3xx 7.6
Total cholesterol (mg/dl) 176.2 5.5 156.3 6.6 162.2 8.3
HDL cholesterol (mg/dl) 107.0 1.6 104.8 2.0 107.7 1.6
LDL cholesterol (mg/dl) 44.7 4.0 29.2 4.5 36.8 6.2
NEFA (mEq/L) 1.4 0.1 1.5 0.1 1.2 0.1
Glucose (mg/dl) 269.5 8.1 210.7x 8.1 225.2 14.8
AST (U/L) 141.8 10.5 129.7 12.2 167.0 22.4
ALT (U/L) 50.2 5.2 36.8 1.9 36.4 5.1
Adiponectin (mg/ml) 20.9 1.0 22.9 1.8 23.5 2.7
Leptin (ng/ml) 74.8 4.4 60.7 13.0 43.0 10.0
Liver
Triglyceride (mg/g liver) 160.2 12.2 112.5x 11.8 98.1xx 15.4
Total cholesterol (mg/g liver) 3.6 0.2 3.9 0.3 3.4 0.2
Phospholipid (mg/g liver) 14.3 0.4 15.3 0.3 16.3xx 0.2

C, control diet; HW, hot-water extract diet; EtOH, ethanol extract diet; NEFA, nonesterified fatty acid; AST, aspartate transaminase; ALT, alanine
transaminase Mean values with standard errors for six mice per group.
Mean values were significantly different from those of C: x p < 0:05, xx p < 0:01.

than in the C group, but there was no significant
difference between the EtOH and the C group.
AST, ALT, adiponectin, and leptin did not change
signifi- cantly, but in the HW and EtOH groups,
serum adiponectin levels were higher and leptin
levels were lower than in the C group.
Hepatic lipid profile
The hepatic TG levels in HW and EtOH
groups were significantly lower than in the C
group (29.8% and 38.8% decreases,
respectively). The EtOH mice had significantly
higher liver PL. The Yamabushitake extracts did
not influence liver TC.
PPARα ligand assay
The PPARα agonist activities of HW-E and
EtOH-E were determined in RCAS. Figure 2
shows a summary of the results obtained in the
two assays. The dose
response of EtOH-E was fitted to a sigmoid model
like the dose response of Wy14643 as a positive
control. EtOH-E acted as an agonist of PPARα ¼ at
EC50 40:0 mg/ml. In contrast, HW-E did not show
agonistic activity toward the same receptor.
Hepatic mRNA expression levels
The mRNA expression levels of lipid
metabolic genes in the liver are shown in Fig. 3.
We found no change in the expression of
PPARα (ppara) between the C and the EtOH
group (Fig. 3A), but the EtOH group had
significantly increased mRNA levels of PPARα-
regulating genes, viz., fatty acid transport protein
1 (Slc27a1), fatty acid transport protein 4
(Slc27a4), acyl- CoA dehydrogenase, medium
chain (Acadm), and acyl- CoA dehydrogenase,
long-chain (Acadl), and tended to have a higher
level of apo A-I (Apoa1) and lipoprotein lipase
(Lpl). There was no change in the expression
of
1450 K. HIWATASHI et al.

40 A
1.5 C
C HW EtOH 1.5

Relative expression
Body weight (g)

35 *

Relative expression
* C
1.0 **
1.0 EtOH

**
**
30 0.5
0.5

25 0 0
0 10 20 30 Ppara Srebf1 Fasn Acaca
Experimental period (d)
B *
1.5
Fig. 1. Effects of Experimental Diets on Body Weight Gain in *
Mice
**

Relative expression
Fed a High-Fat Diet.
Symbols indicate control diet group (C, open circle), hot 1.0
water extract diet group (HW, closed square), and ethanol **
extract diet group (EtOH, closed triangle). Values are
means with standard errors, depicted by vertical bars (six
mice per group). Mean values were significantly different 0.5
from those of the control group: x p < 0:05; xx p <
0:01.

100 0
Wy14643 EtOH
HW Apoa1 Lpl Slc27a1 Slc27a4 Acsl1 Acox1 Acadm Acadl
Relative activity (%)

80
Fig. 3. Effects of Experimental Diets on mRNA Expression of
60 PPARα (A), Its Regulating Genes (B), and Other Lipid
Metabolic Genes (C) in the Liver.
mRNA levels were analyzed by quantitative RT-PCR, with
40 the amount of mRNA normalized with þ-actin mRNA as
endogenous control. Columns indicate the control diet group
20 (C, open column), and the ethanol extract diet group (EtOH,
closed column). Values are means, and standard errors are
depicted by vertical bars (six mice per group). Mean values
0 were significantly different from those of the control
group: x p < 0:05; xx p < 0:01. Ppara, peroxisome
proliferator-activated receptor α (PPARα); Apoa1, apo A-I;
Lpl, lipoprotein lipase; Slc27a1, fatty acid transport protein
10-9 10-8 10-7 10-6 10-5 10-4 10-3 1; Slc27a4,
Wy14643 concentration (M) cardiovascular disease, and nonalcoholic fatty
Extract concentration (g/ml) liver disease.3) In this study, we used mice fed a
high-fat diet as an animal model of
Fig. 2. Dose-Response Curve of Yamabushitake Extracts for
PPARα Agonist.
PPARα agonist activity was measured by the
PPARα/Coactivator Ligand Assay System. Wy14643, a
selective PPARα agonist, was used as positive control.
Relative activity is shown, with the maximum activity of
Wy14643 as 100%. Symbols indicate Wy14643 (open
circle), EtOH extract (EtOH, closed triangle), and hot water
extract (HW, closed square). Values are the means of
duplicate analysis.

acyl-CoA synthetase long-chain family member

1 (Acsl1), and the EtOH group showed
significant down- regulation in mRNA levels of
palmitoyl acyl-CoA oxidase 1 (Acox1) (Fig. 3B).
Other lipid metabolic genes, sterol regulatory
element binding factor 1 (Srebf1) and acetyl-
CoA carboxylase α (Acaca), were significantly
upregulated, and the fatty acid synthase (Fasn)
gene tended to be upregulated in the EtOH
group.

Discussion
Hyperlipidemia is a significant risk factor for
the development of atherosclerosis,
 fatty acid transport protein 4; Acsl1, acyl-CoA synthetase
long-chain
family member 1; Acox1, palmitoyl acyl-CoA oxidase 1;
Acadm, acyl-CoA dehydrogenase, medium chain; Acadl,
acyl-CoA dehy- drogenase, long-chain; Srebf1, sterol
regulatory element binding factor 1; Fasn, fatty acid
synthase; Acaca, acetyl-CoA carboxylase α

obesity and hyperlipidemia,13) and evaluated the

anti- obesitic effects of two Yamabushitake
mushroom extracts, HW-E and EtOH-E, on the
lipid metabolism of the mice. As for the results,
HW-E and EtOH-E decreased body weight
gain, mesenteric adipose tissue weight, and
serum and hepatic TG levels in the mice as
compared to C. No meaningful differences in
the food intakes of the three groups were
detected. These results suggest that the two
extracts from Yamabushitake mushroom
selectively reduced body weight gain and
mesenteric adipose tissue weights without
affecting food intake.
PPARα, a nuclear receptor-type
transcriptional factor, is widely expressed in
the liver, muscle, kidney, and intestine, and
regulates expression of the genes involved in
lipid metabolism. Activators of PPARα, such
as fibrates and isohumulones, lower body
weight gain, retroperitoneal adipose tissue
weight, plasma TG level, and hepatic TG
content.4,14–16) We investigated to determine
whether activation of PPARα is involved in the
anti-obesity effects of Yamabushitake
mushroom
 Hericium erinaceus Improved Lipid Metabolism
extracts in mice fed a high-fat diet. An in vitro
RCAS assay demonstrated that EtOH-E contains
PPARα ligand. Quantitative real-time PCR
analysis indicated that EtOH-E supplementation
did not change the hepatic gene expression of
PPARα and upregulated the gene expression of
Slc27a1, Slc27a4, Acadm, and Acadl regulated
by PPARα.17,18) The proteins encoded by Lpl,
Slc27a, and Acad mRNA are involved in
hydrolysis of the TG moiety of chylomicron and
VLDL particles, translocation of fatty acids
across the plasma membrane, and the initial step
of mitochondrial þ-oxidation of straight-chain
fatty acids, respectively.19) Therefore,
upregulation of these genes by EtOH might
result in normalizing serum and hepatic TG
levels by stimulation of þ-oxidation potentials in
the liver. Some studies have indicated that the
Acsl1 and Acox1 genes are also regulated by
PPARα. In the present study, EtOH-E did not
markedly affect the expression of these genes.
The reason remains unclear, but not only PPARα
but also other regulators might play important
roles in gene expression. Moreover, quantitative
RT-PCR analysis of mRNA from the liver
indicated that the expression of Srebf1, Fasn, and
Acaca, which is involved in the transcription of
the adipogenetic gene, the synthesis of saturated
fatty acids, and the carboxylation of acetyl- CoA
respectively,19,20) were significantly increased, or
tended to increase. These data suggest that
alternative components of EtOH-E, other than
the PPARα agonist, also modulate lipid
metabolism in mice fed a high-fat diet.
HW-E also reduced serum TG levels in the
mice, but the extracts did not exhibit PPARα
agonist activities in vitro. Furthermore, HW
supplementation significantly downregulated
hepatic gene expression of PPARα, Slc27a4, and
Acadm on quantitative real-time PCR analysis
(data not shown). This data suggests that the
mechanism of the improvement of lipid
metabolism in the HW-fed mice differed from
that in the EtOH-fed mice. Water-soluble dietary
fiber in HW-E might have been involved in the
inhibitory effects on serum TG levels.
In conclusion, we found that EtOH-E
prevented diet- induced obesity and
hyperlipidemia, and that these effects might be
mediated by the modulation of lipid metabolic
gene expression, at least in part, via activation of
PPARα.
1451
Acknowledgment
This study was supported in part by a Grant for
the City Area Program from the Ministry of
Education, Culture, Sports, Science, and
Technology (MEXT) of Japan.
References
1) OECD, ‘‘OECD Factbook 2009: Economic, Environmental
and Social Statistics,’’ OECD Publishing, Paris, pp. 250–
251 (2009).
2) Kopelman PG, Nature, 404, 635–643 (2000).
3) Funahashi T and Matsuzawa Y, Ann. Med., 39, 482–494
(2007).
4) Miura Y, Hosono M, Oyamada C, Odai H, Oikawa S, and
Kondo K, Br. J. Nutr., 93, 559–567 (2005).
5) Ashakumary L, Rouyer I, Takahashi Y, Ide T, Fukuda N,
Aoyama T, Hashimoto T, Mizugaki M, and Sugano M,
Metabolism, 48, 1303–1313 (1999).
6) Sasaki H, Kawarazaki S, Sugawara K, and Hata K, J. Clin.
Biochem. Nutr., 43/Suppl. 1, 422–424 (2008).
7) Watanabe T, Hata K, Hiwatashi K, Hori K, Suzuki N, and
Itoh H, Biosci. Biotechnol. Biochem., 74, 499–503 (2010).
8) Kawagishi H, Ando M, and Mizuno T, Tetrahedron Lett.,
31,
373–376 (1990).
9) Kawagishi H, Shimada A, Shirai R, Okamoto K, Ojima F,
Sakamoto H, Ishiguro Y, and Furukawa S, Tetrahedron
Lett., 35, 1569–1572 (1994).
10) Mori K, Inatomi S, Ouchi K, Azumi Y, and Tuchida T,
Phytother. Res., 23, 367–372 (2009).
11) Friedewald WT, Levy RI, and Fredrickson DS, Clin.
Chem., 18, 499–502 (1972).
12) Folch J, Lees M, and Sloane Stanley GH, J. Biol. Chem.,
226, 497–509 (1957).
13) Ikemoto S, Takahashi M, Tsunoda N, Maruyama K, Itakura
H, and Ezaki O, Metabolism, 45, 1539–1546 (1996).
14) Evans RM, Barish GD, and Wang YX, Nat. Med., 10, 355–
361
(2004).
15) Yajima H, Ikeshima E, Shiraki M, Kanaya T, Fujiwara D,
Odai H, Tsuboyama-Kasaoka N, Ezaki O, Oikawa S, and
Kondo K, J. Biol. Chem., 279, 33456–33462 (2004).
16) Yajima H, Noguchi T, Ikeshima E, Shiraki M, Kanaya T,
Tsuboyama-Kasaoka N, Ezaki O, Oikawa S, and Kondo
K, Int. J. Obes. (Lond.), 29, 991–997 (2005).
17) Frohnert BI, Hui TY, and Bernlohr DA, J. Biol. Chem., 274,
3970–3977 (1999).
18) Gulick T, Cresci S, Caira T, Moore DD, and Kelly DP,
Proc. Natl. Acad. Sci. USA, 91, 11012–11016 (1994).
19) Schoonjans K, Staels B, and Auwerx J, J. Lipid Res., 37,
907–
925 (1996).
20) Brown MS and Goldstein JL, Cell, 89, 331–340 (1997).