Available online at www.sciencedirect.

com

Leukemia Research 33 (2009) 321–325

Receptor mutation is not a common mechanism of naturally

occurring glucocorticoid resistance in leukaemia cell lines
Alex H. Beesley, Renae E. Weller, Saranga Senanayake,
Mathew Welch, Ursula R. Kees ∗
Division of Children’s Leukaemia and Cancer Research, Telethon Institute for Child Health Research,
University of Western Australia Centre for Child Health Research, Perth, Australia
Received 23 May 2008; received in revised form 23 May 2008; accepted 5 August 2008
Available online 11 September 2008

Abstract
Glucocorticoids (GCs) are among the most important drugs for the treatment of acute lymphoblastic leukaemia (ALL). Cell lines cultured
in high GC concentrations typically contain mutated glucocorticoid receptor (GR), something that is rarely found in primary ALL specimens.
We studied naturally occurring mechanisms of GC resistance and examined sensitivity to GC in 15 T-ALL cell lines grown without prior
exposure to drugs. Resistance could not be attributed to mutations in GR or variations in levels of its expression. We conclude that this panel
of cell lines provides a suitable in vitro model since it reflects GC resistance in primary ALL.
© 2008 Elsevier Ltd. All rights reserved.

Keywords: Acute lymphoblastic leukaemia; Glucocorticoid receptor; Drug resistance; Relapse; Mutation

1. Introduction expression of GR subunits and the ability of the cell to induce

In children with acute lymphoblastic leukaemia (ALL)
cellular drug sensitivity is a major component of clinical
outcome. Around 10 different drugs are currently used in
paediatric ALL-treatment protocols but among the most
important are the glucocorticoids (GCs). Early GC response
is one of the most informative prognostic factors for infant,
childhood and adult ALL, with patients that respond well
showing significantly better outcome [1,2]. Moreover, GC
resistance is a well-documented feature of relapse [3,4].
Among the paediatric ALL subtypes, infants and those with
T-lineage ALL (T-ALL) are particularly resistant to GCs
[5].
Despite the clinical importance of this class of drug, the
exact mechanisms involved in GC cytotoxicity and the devel-
opment of resistance remain uncertain [6–8]. The level of
∗ Corresponding author at: Division of Children’s Leukaemia and Cancer
Research, Telethon Institute for Child Health Research, University of West-
ern Australia Centre for Child Health Research, PO Box 855, West Perth,
WA 6872, Australia. Tel.: +61 8 9489777; fax: +61 8 94897700.
E-mail address: ursula@ichr.uwa.edu.au (U.R. Kees).
them following GC stimulation (auto-induction) may con-
tribute to GC sensitivity but the evidence for this is conflicting
[8–11]. Mutations in the GC receptor (GR) are commonly
found in cell lines that have been selected for GC resistance
by extended exposure to high drug concentrations, but are
rarely found in primary ALL specimens and are not thought to
contribute significantly to GC resistance in patients [12,13].
Because of this discrepancy it is important to develop and
characterize in vitro models of leukaemia that more closely
reflect the naturally occurring mechanisms of GC resistance
that arise in vivo.
Over the past 20 years our laboratory has developed an
authenticated panel of paediatric ALL cell lines that have
been grown in the absence of drug selection [14,15] and
were established from both diagnosis and relapse patient
specimens [14]. We have previously demonstrated that these
cultures retain critical features of the primary disease, and that
their drug-resistance profile parallels the spectrum of resis-
tance that has been observed in primary patient specimens,
particularly in regards to dexamethasone (DEX) [14,15].
Here we have examined the relationship between GR status
and GC sensitivity in T-ALL cell lines from within this panel

0145-2126/$ – see front matter © 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.leukres.2008.08.007
322 A.H. Beesley et al. / Leukemia Research 33 (2009) 321–325
to assess the strength of the model system for investigating
naturally occurring mechanisms of resistance.
2. Design and methods
2.1. Cell lines
The cell line panel has been previously described [14–17] and
comprised nine T-ALL lines derived in our own laboratory (PER
cell lines), plus six additional T-ALL cell lines obtained from other
sources. The culture conditions have been previously described [14].
2.2. In vitro drug resistance
The sensitivity of the T-ALL cell lines to methylprednisolone
(MPRED) and dexamethasone (DEX) has been previously pub-
lished [14] with drugs incubated over 4 days. As an arbitrary
measurement of drug resistance the IC50 (drug concentration that
inhibits cell growth by 50%) was determined, and a dose range
from 30 pg/ml to 250 ␮g/ml was tested. Apoptotic responses of
cell lines to gamma irradiation (1 Gy) or DEX incubation (1 ␮M)
were measured by flow cytometry 24 h after stimulation using
Annexin-V-FLUOS and propidium iodide staining (Roche Diag-
nostics Australia Pty Ltd.). Cells were counted as viable (double
negative staining), apoptotic (Annexin V positive), or necrotic (dou-
ble positive), and data averaged from two to four experiments.
2.3. Real-time quantitative RT-PCR
Real-time quantitative RT-PCR (qRT-PCR) was performed
on total RNA from cell lines in accordance with stan-
dard Applied Biosystems protocols (Foster City, CA) and in
accordance with our published methods [18]. The forward
primers (5 -TGTTTTGCTCCTGATCTGA) and probe (5 FAM)-
ACTCTACCCTGCATGTAC-(MGB)) for amplification of the
GR were common to both alpha and beta GR isoforms and
were adapted from published methods [19]. Reverse primers
for GR␣ (5 -TCGGGGAATTCAATACTCA) and GR␤ (5 -
TGAGCGCCAAGATTGT) targeted Exons 9␣ and 9␤, respectively
[19]. All experiments were run in duplicates on an ABI 7700
sequence detector and data normalized to expression of beta-actin
(ACTB). For GR autoinduction experiments, cell lines were incu-
bated in the presence or absence of 0.1 ␮M DEX for 24 h before
RNA extraction [20].
2.4. GR sequence analysis
Denaturing HPLC (DHPLC) was used to assess T-ALL cell
lines for possible mutations in the coding region of GR␣ (Exons
2–9), using published methods [12] with the following modifi-
cations. Exons 2–9␣ were amplified from genomic DNA using
PlatinumTaq (Invitrogen) and touchdown PCR with primers as
published [12] except for Exon 4 reverse which was redesigned (5 -
AGTAACATTATGCTAGTCAAG). Heteroduplex formation was
induced after amplification using a final denaturation and step-
wise cooling program (−0.5 ◦ C steps). DHPLC was performed
in the Molecular Genetics Laboratory, Princess Margaret Hospital
using a Helix dHPLC (Varian) with melting temperatures cal-
culated using the Stanford Genome Technology Center DHPLC
Melt Program (http://insertion.stanford.edu/meltdoc.html). Sam-
ples were run using Varian Buffer B (100 mM triethylammonium
acetate, 0.1 mM EDTA, 25% (v/v) acetonitrile, 0.45 ml/min) with
the following gradients (%) and temperatures (Tm ): Exon 2A (46%,
60 ◦ C), Exon 2B (52%, 60 ◦ C), Exon 2C (52%, 58 ◦ C), Exon 3 (46%,
59 ◦ C), Exon 4 (46%, 56 ◦ C), Exon 5 (52%, 58 ◦ C), Exon 6 (46%,
58 ◦ C), Exon 7 (46%, 56 ◦ C), Exon 8 (46%, 53 ◦ C), Exon 9␣ (46%,
50 ◦ C). Hae III digested pUC18, and DYS271 dHPLC Standard
were included with each run as controls. Analysis was performed
using Star Reviewer Version 2.0 (Varian). Wild-type GR was ampli-
fied from the genomic DNA of a healthy donor, sequenced in full,
and run in parallel with cell line sequences. To control for false
negatives generated by homozygous mutation or loss of heterozy-
gosity, sequences showing apparently normal DHPLC profiles were
spiked with equal amounts of amplified wild-type GR DNA and re-
analyzed. Regions showing variation were directly sequenced from
amplified products and compared to the consensus sequence for
GR␣ (RefSeq NM000176.2). Novel mutations in coding regions not
previously described were confirmed by independent DNA extrac-
tions, amplification and sequencing. To confirm the relative allele
location of the L753F and A484V mutations in the CEM cell line,
GR cDNA spanning this region was amplified by RT-PCR using the
forward primer for Exon 4 and the reverse primer for Exon 9, and
the products cloned into TOPO-TA (Invitrogen). Multiple indepen-
dent clones were sequenced to determine the coincident presence or
absence of each mutation.
3. Results
3.1. GC resistance profile of T-ALL cell lines and
relationship with GR expression
The sensitivity of T-ALL cell lines to the GCs DEX and
MPRED is shown in Fig. 1A, full details of IC50 values have
been previously described [14]. Resistance varied by four
to five orders of magnitude between cell lines and corre-
lated closely for the two GCs (Pearson’s correlation 0.862,
p < 0.0001). The basal expression of the alpha subunit of
the GR across the cell line panel as measured by qRT-PCR
is shown as a bar chart in Fig. 1A, there was no correla-
tion between resting levels of GR␣ and resistance to either
DEX (correlation −0.363, p = 0.18) or MPRED (correla-
tion −0.323, p = 0.24). Similarly, there was no correlation
between expression of GR␤ and resistance to DEX (corre-
lation −0.05) or MPRED (correlation −0.07). These data
indicate that GC sensitivity in the T-ALL panel is not primar-
ily determined by baseline expression of the GR. There are
conflicting reports of the role of GR autoinduction on GC sig-
nalling in ALL [8–11]. In our cell lines, we found induction of
GR␤, but not GR␣, mRNA expression following incubation
in DEX (0.1 ␮M for 24 h, Fig. 1B).
3.2. GR sequencing
All cell lines were assessed for mutations in the coding
region for GR␣ by DHPLC and sequencing. Four lines were
found to carry the silent N766N polymorphism [21], whilst
 A.H. Beesley et al. / Leukemia Research 33 (2009) 321–325 323

Fig. 1. Relationship between GR expression and GC sensitivity in T-ALL cell lines. (A) Normalized GR alpha mRNA expression as measured by qRT-PCR
(bars) and IC50 values for MPRED (open circles) and DEX (closed squares). (B) Induction of GR mRNA expression in response to incubation with 0.1 ␮M
DEX for 24 h (black bars) or vehicle control (grey bars) as measured by qRT-PCR (mean of three independent experiments ± S.E.M.).

intronic base changes, mostly known SNPs, were identified
in several others (Table 1). However, out of 15 cell lines,
only four had sequence variations resulting in amino acid
changes. PER-604 carries the N363S mutation that has been
shown to have either no effect on GC resistance [13,21], or to
lead to an increased sensitivity to these agents [22–24]. The
A73V mutation found in MOLT-4 has not previously been
described, thus its effect of GR functionality is unknown.
However, it lies in a region of the gene (Exon 2) that is
not involved with DNA or ligand-binding and is not nor-
mally implicated in functional mutations. This cell line is
pseudotetraploid with only one copy of the A73V mutation
appearing to be present (Table 1). Only two cell lines carried
mutations that have been previously associated with strong

Table 1
Glucocorticoid receptor gene polymorphisms and mutations in T-ALL cell lines
Cell line Exon/intron Coding variation Nucleotide change Copy number Description [refs.]
ALL-SIL (Intron 4) – 1961 bp–16 G>T 50% Ref SNP rs6188 [2,3,8,10]
CEM 4 A484V 1943 bp C>T 50% Novel mutation (similar to GC resistant mutation A484D [2])
9␣ L753F 2741 bp A>T 50% GR unable to bind ligand [1,3–6,10,11]
9␣ – 2958 bp A>G 50% Novel 3 UTR sequence variation
JURKAT 4 R477H 1922 bp G>A 50% Reduced GR transactivation/transrepression [1,3,4,7,10]
(Intron 4) – 1961 bp–16 G>T 50% Ref SNP rs6188 [2,3,8,10]
9␣ N766N 2790 bp T>C 50% Synonymous Ref SNP rs6196 [2–4,8,10]
MOLT4 2 A73V 710 bp C>T 25% Novel mutation
(Intron 4) – 1961 bp–16 G>T 50% Ref SNP rs6188 [2,3,8,10]
PER-255 (Intron 4) – 1961 bp–16 G>T 50% Ref SNP rs6188 [2,3,8,10]
PER-278 (Intron 4) – 1961 bp–16 G>T 100% Ref SNP rs6188 [2,3,8,10]
9␣ N766N 2790 bp T>C 100% Synonymous Ref SNP rs6196 [2–4,8,10]
PER-377 2 N363S 1580 bp A>G 50% Increased GC sensitivity—Ref SNP rs6195 [2,4,8–10]
PER-427 9␣ N766N 2790 bp T>C 50% Synonymous Ref SNP rs6196 [2–4,8,10]
PER-487 9␣ N766N 2790 bp T>C 50% Synonymous Ref SNP rs6196 [2–4,8,10]
PER-490 9␣ N766N 2790 bp T>C 100% Synonymous Ref SNP rs6196 [2–4,8,10]
PER-537 (Intron 4) – 1961 bp–16 G>T 50% Ref SNP rs6188 [2,3,8,10]
9␣ N766N 2790 bp T>C 50% Synonymous Ref SNP rs6196 [2–4,8,10]
PER-550 (Intron 4) – 1961 bp–16 G>T 50% Ref SNP rs6188 [2,3,8,10]
PER-604 2 N363S 1580 bp A>G 50% Increased GC sensitivity—Ref SNP rs6195 [2,4,8–10]
PER-606 (Intron 4) – 1961 bp–16 G>T 50% Ref SNP rs6188 [2,3,8,10]
Nucleotide numbering based on RefSeq NM 000176 (for intronic regions the distance from the nearest Exon junction is indicated); copy number of variant
alleles estimated from DHPLC peak height ratio in comparison to wild-type sequence. References: (1) [20], (2) [12], (3) [13], (4) [24], (5) [28], (6) [27], (7)
[26], (8) [21], (9) [23], (10) [22], (11) [29].
324 A.H. Beesley et al. / Leukemia Research 33 (2009) 321–325
Fig. 2. Apoptotic responses in T-ALL cell lines. Sensitivity of four cell lines
to DEX (DX, 1 ␮M) or gamma-irradiation (IR, 1 Gy) compared to untreated
controls. Data indicate percentage of cells viable (black), apoptotic (grey),
or necrotic (white) 24 h after stimulation (mean of two to four independent
experiments ± S.E.M.).
resistance to GC-CEM (L753F) and JURKAT (R477H). Our
CEM cell line carried an additional, previously undescribed
mutation (A484V), which was confirmed by cDNA cloning
and sequencing to reside on the same allele as the L753F
mutation.
3.3. Functional relevance of novel mutations
To investigate the contribution of the identified GR muta-
tions in CEM and JURKAT cells to GC resistance we
compared the apoptotic responses of these cell lines to DEX
and gamma irradiation (Fig. 2). Whilst both cell lines showed
a minimal response to DEX after 24 h as expected, they
were equally resistant to the effects of irradiation. In con-
trast PER-117, which is also relatively resistant to both
DEX and MPRED (see Fig. 1A), showed sensitivity to
the effects of irradiation, whilst PER-255, a GC-sensitive
cell line demonstrated strong apoptotic responses to both
stimuli (Fig. 2). This data clearly indicates that defects
at the level of the GR are not the primary factors con-
tributing to GC resistance in the CEM and JURKAT cell
lines.
4. Discussion
Since mutations in the GR are rarely observed in patients
[12,13], and since our cell line panel has been maintained
in the absence of any selection pressure for GC resistance,
the resistance profile observed in the cell line panel was not
anticipated to be attributable to mutations in the receptor.
Accordingly, mutations known to be linked with GC resis-
tance were found in only 2 out of 15 cell lines, and none
in ALL cell lines derived from our own laboratory. This
contrasts with the contention that GC resistance in vitro
almost always arises from mutations in the GR [8,9,25].
The heterozygous R477H mutation carried by JURKAT
cells is known to impair the ability of the GR to transacti-
vate and transrepress gene expression but does not act in a
dominant-negative manner and thus is insufficient to explain
GC resistance in this line [26]. Similarly, the L753F func-
tional mutation previously described in the CEM cell line
(and in the patient from whom this cell line was originally
derived [27]) is known to be present in both GC-sensitive
and resistant sub-clones [28,29]. Additional GR mutations
or other defects in downstream GR-signalling pathways
are thus required for GC resistant phenotypes in these cell
lines.
The parental CCRF-CEM cell line is known to represent
a mixed population of sensitive and resistant clones [30] and
we have previously reported that our CEM represents a highly
resistant sub-clone that has grown out during culture [14,16].
One possibility to explain this resistance would be the novel
A484V mutation since this targets an amino acid known to
be important for GC sensitivity [20] (Table 1). However, this
is unlikely since we have determined that the A484V muta-
tion resides on the same allele as L753F (see Section 2),
thus leaving the other allele unaffected. In addition, the pres-
ence of these mutations cannot explain the insensitivity of
CEM cells to irradiation, indicating the existence of other
factors that primarily contribute to GC resistance in this cell
line.
In summary, in contrast to the contention that that GC
resistance in vitro almost always arises from mutations in the
GR, resistance in our T-ALL panel could not be attributed to
mutations in the GR or variations in its level of expression.
We conclude that in the absence of selection pressure applied
in vitro by drug, GR mutation is not a common cause of GC
resistance in ALL cell lines. We are currently measuring the
gene expression profile in these cell lines in order to identify
resistance mechanisms to GCs.
Conflict of interest
None.
Acknowledgements
The authors would like to thank Dr. David Baker (Princess
Margaret Hospital) and the patients from whom cell lines
were derived. DHPLC analysis was conducted in collabo-
ration with Dr. Ted Edkins and Dr. Michael Abdo from the
Molecular Genetics Laboratory, Princess Margaret Hospital.
This research was funded by the NHMRC and the Children’s
Leukaemia and Cancer Research Foundation, Western Aus-
tralia.
References
[1] Dordelmann M, Reiter A, Borkhardt A, Ludwig WD, Gotz N,
Viehmann S, et al. Prednisone response is the strongest predictor
of treatment outcome in infant acute lymphoblastic leukemia. Blood
1999;94(4):1209–17.
[2] Annino L, Vegna ML, Camera A, Specchia G, Visani G, Fioritoni G,
et al. Treatment of adult acute lymphoblastic leukemia (ALL): long-
term follow-up of the GIMEMA ALL 0288 randomized study. Blood
2002;99(3):863–71.
 A.H. Beesley et al. / Leukemia Research 33 (2009) 321–325
[3] Kaspers GJ, Wijnands JJ, Hartmann R, Huismans L, Loonen AH, Stack-
elberg A, et al. Immunophenotypic cell lineage and in vitro cellular drug
resistance in childhood relapsed acute lymphoblastic leukaemia. Eur J
Cancer 2005;41(9):1300–3.
[4] Klumper E, Pieters R, Veerman AJ, Huismans DR, Loonen
AH, Hahlen K, et al. In vitro cellular drug resistance in chil-
dren with relapsed/refractory acute lymphoblastic leukemia. Blood
1995;86(10):3861–8.
[5] Pieters R, den Boer ML, Durian M, Janka G, Schmiegelow K,
Kaspers GJ, et al. Relation between age, immunophenotype and
in vitro drug resistance in 395 children with acute lymphoblas-
tic leukaemia—implications for treatment of infants. Leukemia
1998;12(9):1344–8.
[6] Schmidt S, Rainer J, Riml S, Ploner C, Jesacher S, Achmuller C, et al.
Identification of glucocorticoid-response genes in children with acute
lymphoblastic leukemia. Blood 2006;107(5):2061–9.
[7] Tissing WJ, Den Boer ML, Meijerink JP, Menezes RX, Swage-
makers S, van der Spek PJ, et al. Genome-wide identification of
prednisolone-responsive genes in acute lymphoblastic leukemia cells.
Blood 2007;109(9):3929–35.
[8] Bachmann PS, Gorman R, Papa RA, Bardell JE, Ford J, Kees UR,
et al. Divergent mechanisms of glucocorticoid resistance in experi-
mental models of pediatric acute lymphoblastic leukemia. Cancer Res
2007;67(9):4482–90.
[9] Bachmann PS, Gorman R, Mackenzie KL, Lutze-Mann L, Lock
RB. Dexamethasone resistance in B-cell precursor childhood
acute lymphoblastic leukemia occurs downstream of ligand-
induced nuclear translocation of the glucocorticoid receptor. Blood
2005;105(6):2519–26.
[10] Tissing WJ, Meijerink JP, Brinkhof B, Broekhuis MJ, Menezes RX, den
Boer ML, et al. Glucocorticoid-induced glucocorticoid receptor expres-
sion and promoter-usage is not linked to glucocorticoid resistance in
childhood ALL. Blood 2006.
[11] Schmidt S, Rainer J, Ploner C, Presul E, Riml S, Kofler R.
Glucocorticoid-induced apoptosis and glucocorticoid resistance:
molecular mechanisms and clinical relevance. Cell Death Differ
2004;11(Suppl. 1):S45–55.
[12] Irving JA, Minto L, Bailey S, Hall AG. Loss of heterozygosity and
somatic mutations of the glucocorticoid receptor gene are rarely
found at relapse in pediatric acute lymphoblastic leukemia but may
occur in a subpopulation early in the disease course. Cancer Res
2005;65(21):9712–8.
[13] Tissing WJ, Meijerink JP, den Boer ML, Brinkhof B, van Rossum EF,
van Wering ER, et al. Genetic variations in the glucocorticoid receptor
gene are not related to glucocorticoid resistance in childhood acute
lymphoblastic leukemia. Clin Cancer Res 2005;11(16):6050–6.
[14] Beesley AH, Palmer ML, Ford J, Weller RE, Cummings AJ, Freitas JR,
et al. Authenticity and drug resistance in a panel of acute lymphoblastic
cell lines. Br J Cancer 2006;95(11):1537–44.
[15] Kees UR, Ford J, Watson M, Murch A, Ringner M, Walker RL, et al.
Gene expression profiles in a panel of childhood leukemia cell lines
mirror critical features of the disease. Mol Cancer Ther 2003;2(7):
671–7.
325
[16] Beesley AH, Palmer ML, Ford J, Weller RE, Cummings AJ, Fre-
itas JR, et al. In vitro cytotoxicity of nelarabine, clofarabine and
flavopiridol in paediatric acute lymphoblastic leukaemia. Br J Haematol
2007;137(2):109–16.
[17] Kees UR, Ford J, Price PJ, Meyer BF, Herrmann RP. PER-117: a new
human ALL cell line with an immature thymic phenotype. Leuk Res
1987;11(5):489–98.
[18] Dallas PB, Gottardo NG, Firth MJ, Beesley AH, Hoffmann K, Terry
PA, et al. Gene expression levels assessed by oligonucleotide microar-
ray analysis and quantitative real-time RT-PCR—how well do they
correlate? BMC Genomics 2005;6(1):59.
[19] Hagendorf A, Koper JW, de Jong FH, Brinkmann AO, Lamberts SW,
Feelders RA. Expression of the human glucocorticoid receptor splice
variants alpha, beta, and P in peripheral blood mononuclear leukocytes
in healthy controls and in patients with hyper- and hypocortisolism. J
Clin Endocrinol Metab 2005;90(11):6237–43.
[20] Schmidt S, Irving JA, Minto L, Matheson E, Nicholson L, Ploner A, et
al. Glucocorticoid resistance in two key models of acute lymphoblastic
leukemia occurs at the level of the glucocorticoid receptor. FASEB J
2006;20(14):2600–2.
[21] Koper JW, Stolk RP, de Lange P, Huizenga NA, Molijn GJ, Pols HA,
et al. Lack of association between five polymorphisms in the human
glucocorticoid receptor gene and glucocorticoid resistance. Hum Genet
1997;99(5):663–8.
[22] Tissing WJ, Meijerink JP, den Boer ML, Pieters R. Molecular determi-
nants of glucocorticoid sensitivity and resistance in acute lymphoblastic
leukemia. Leukemia 2003;17(1):17–25.
[23] Lin RC, Wang WY, Morris BJ. High penetrance, overweight,
and glucocorticoid receptor variant: case–control study. BMJ
1999;319(7221):1337–8.
[24] Bray PJ, Cotton RG. Variations of the human glucocorticoid receptor
gene (NR3C1): pathological and in vitro mutations and polymorphisms.
Hum Mutat 2003;21(6):557–68.
[25] Haarman EG, Kaspers GJ, Veerman AJ. Glucocorticoid resistance in
childhood leukaemia: mechanisms and modulation. Br J Haematol
2003;120(6):919–29.
[26] Riml S, Schmidt S, Ausserlechner MJ, Geley S, Kofler R. Glu-
cocorticoid receptor heterozygosity combined with lack of receptor
auto-induction causes glucocorticoid resistance in Jurkat acute lym-
phoblastic leukemia cells. Cell Death Differ 2004;11(Suppl. 1):S65–72.
[27] Hillmann AG, Ramdas J, Multanen K, Norman MR, Harmon JM. Glu-
cocorticoid receptor gene mutations in leukemic cells acquired in vitro
and in vivo. Cancer Res 2000;60(7):2056–62.
[28] Powers JH, Hillmann AG, Tang DC, Harmon JM. Cloning and expres-
sion of mutant glucocorticoid receptors from glucocorticoid-sensitive
and -resistant human leukemic cells. Cancer Res 1993;53(17):4059–65.
[29] Ashraf J, Thompson EB. Identification of the activation-labile gene: a
single point mutation in the human glucocorticoid receptor presents as
two distinct receptor phenotypes. Mol Endocrinol 1993;7(5):631–42.
[30] Medh RD, Webb MS, Miller AL, Johnson BH, Fofanov Y, Li T,
et al. Gene expression profile of human lymphoid CEM cells sen-
sitive and resistant to glucocorticoid-evoked apoptosis. Genomics
2003;81(6):543–55.