Environmental Pollution 323 (2023) 121324

Contents lists available at ScienceDirect

Environmental Pollution
journal homepage: www.elsevier.com/locate/envpol

Association between occupational noise exposure duration and heart rate

variability among Chinese adults: The role of plasma miRNAs☆
Wenzhen Li a, b, Haozhe Zhang c, d, Yang Xiao c, d, Yueqing Tao a, Weihong Chen c, d,
Dongming Wang c, d, *
a
Department of Social Medicine and Health Management, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, Wuhan,
Hubei 430030, PR China
b
Jockey Club School of Public Health and Primary Care, The Chinese University of Hong Kong, Hong Kong, China
c
Department of Occupational & Environmental Health, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei
430030, China
d
Key Laboratory of Environment and Health, Ministry of Education & Ministry of Environmental Protection, and State Key Laboratory of Environmental Health
(Incubating), School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, China

A R T I C L E I N F O A B S T R A C T

Keywords: We aimed to explore the association between occupational noise exposure duration and heart rate variability
Occupational health (HRV) and the underlying mechanism. A total of 449 subjects in a manufacturing company in Wuhan, China
Cardiac autonomic nervous system were included in our study and six candidate miRNAs (miR-200a-3p, miR-200b-3p, miR-200c-3p, miR-1-3p, miR-
Epidemiology
92a-3p and miR-21–5p) were tested among 200 individuals. Information combining the work histories and the
Mechanism
occupational noise monitoring records were used to calculate the exposure of occupational noise, HRV indices
were measured by using 3-channel digital Holter monitors, including the standard deviation of all normal R-R
intervals (SDNN), the root mean of the square of successive differences between adjacent normal NN intervals (r-
MSSD), SDNN index, low-frequency power (LF), high-frequency power (HF) and TP (total power). We found a
significant linear negative dose-response relationship between occupational noise exposure duration and HRV
indices (P for overall <0.05, P for nonlinear >0.05), including SDNN, r-MSSD, SDNN index, LF and HF. In the
continuous models, the β (95% CIs) for each 1-year occupational noise exposure were − 0.002 (− 0.004, − 0.001)
for SDNN, − 0.002 (− 0.004, − 0.001) for r-MSSD, − 0.002 (− 0.004, − 0.001) for SDNN index, and − 0.006
(− 0.012, − 0.001) for HF. Meanwhile, we also found that occupational noise exposure duration was significantly
associated with lower expression of five miRNAs, when adjusting for other covariates. The β (95% CIs) were
− 0.039 (− 0.067, − 0.011) for miRNA-200c-3p, − 0.053 (− 0.083, − 0.022) for miRNA-200a-3p, − 0.044 (− 0.070,
− 0.019) for miRNA-200b-3p, − 0.032 (− 0.048, − 0.017) for miRNA-92a-3p, and − 0.063 (− 0.089, − 0.038) for
miRNA-21–5p in the continuous models. In addition, we found a positive association between miRNA-1-3p and
LF (β = 0.039, 95% CI = 0.002, 0.080). Our study suggests that occupational noise exposure duration is asso­
ciated with cardiac autonomic dysfunction, and the role of miRNAs in noise induced HRV reduction needs to be
confirmed in future studies.

1. Introduction occupational noise (Teixeira et al., 2021a; Teixeira et al., 2021b). As we

all know, long-term exposure to occupational noise exposure could
Noise is regarded as a major occupational hazard for workers. induce several side effects including hypertension, hearing loss, and
Research has revealed that a large number of workers are exposed to cardiovascular outcomes (Basner et al., 2014; Li et al., 2021; Wang et al.,

Abbreviations: HRV, heart rate variability; SDNN, standard deviation of all normal R-R intervals; r-MSSD, root mean of the square of successive differences
between adjacent normal NN intervals; LF, low-frequency; HF, high-frequency power; TP, total power.
☆
This paper has been recommended for acceptance by Wen Chen.
* Corresponding author.Department of Occupational & Environmental Health, School of Public Health, Tongji Medical College, Huazhong University of Science
and Technology, No. 13 Hangkong Road, Wuhan, 430030, China
E-mail address: wangdm@hust.edu.cn (D. Wang).

https://doi.org/10.1016/j.envpol.2023.121324
Received 27 August 2022; Received in revised form 31 January 2023; Accepted 18 February 2023
Available online 20 February 2023
0269-7491/© 2023 Elsevier Ltd. All rights reserved.
W. Li et al.
2021). However, the association between occupational noise exposure
and early cardiovascular injury in populations have not been well
established. For instance, just some studies explored the association of
occupational noise with fasting blood glucose, obesity, triglycerides and
metabolic syndrome; but the results were inconsistent (Kheirandish
et al., 2022; Kim et al., 2022; Kim et al., 2021).
Heart rate variability (HRV) represents changes of heart rate with
time, and is used as a practical tool to evaluate cardiac autonomic ner­
vous system (Mejía-Mejía et al., 2021; Shaffer and Ginsberg, 2017).
Many studies have shown that HRV reduction is associated with car­
diovascular diseases, and the reduction is thought to be an indicator of
early onset of cardiovascular damage (Sajadieh et al., 2004; Tegegne
et al., 2020). Thus, assessment of the relationship between occupational
noise and HRV could help us understand the early damage of occupa­
tional noise on cardiovascular system. As to the association between
noise and HRV, most studies focus on environmental noise (El Aarbaoui
and Chaix, 2020; Kraus et al., 2013). On the other hand, the above
described mechanism is not clear.
Studies have showed that oxidative stress played an important role in
cardiovascular diseases caused by noise exposure, it could induce
reactive oxygen species (ROS) (Münzel et al., 2017), and oxidative stress
was associated with expression of miRNAs (Kura et al., 2020; Magenta
et al., 2017) and HRV (Kheirandish et al., 2022; Kim et al., 2021).
However, it is still unknown whether miRNAs fulfill the role in HRV
associated with occupational noise through ROS. MiRNAs are short
(21–22 nucleotides) noncoding RNAs, which could inhibit translation
and modulate mRNA stability (Santos-Ferreira et al., 2020). MiRNAs
regulation is an important epigenetic mechanism and has been reported
to connect environmental exposures and health outcomes (Deng et al.,
2019). Studies have indicated that miRNAs were associated with several
diseases (Huang et al., 2016; Mehta, 2015). As to HRV, some limited
studies have assessed the association between miRNAs and HRV (Huang
et al., 2016; Santos-Ferreira et al., 2020), and miRNAs have also been
reported to be associated with early cardiovascular damage (Magenta
et al., 2017; Zhou et al., 2018). On the other hand, research indicated
that occupational noise is related to the expression of miRNAs, for
example, exposed to occupational noise was found to be associated with
lower expression of miRNAs (Ding et al., 2016). Thus, we selected 6
candidate miRNAs (miR-200a-3p, miR-200b-3p, miR-200c-3p,
miR-1-3p, miR-92a-3p and miR-21–5p) which were not only associated
with cardiac autonomic nervous system/heart rate but also affected by
reactive oxygen species or oxidative stress to explore the potential
mechanism (Kura et al., 2020; Magenta et al., 2017). MiR-200a-3p,
miR-200b-3p and miR-200c-3p are miRNA 200 family, and all the six
candidate miRNAs were reported to be associated with early cardio­
vascular injury, including arrhythmias, vascular dysfunction, insulin
resistance, etc (Kura et al., 2020; Magenta et al., 2017).
In this present study, we aimed to evaluate the relationship between
occupational noise exposure duration and HRV among 449 Chinese
workers. Besides, the relationship between occupational noise and 6
candidate miRNAs, and the mediation effect of miRNAs in the rela­
tionship between occupational noise and HRV were also evaluated
among a subset population (N = 200) to explore the potential
mechanism.
2. Methods
2.1. Subjects
All subjects were recruited from the baseline of an occupational noise
cohort established in Nov 2019 in Wuhan, Hubei, China. Participants in
the cohort were employees from an auto parts manufacturing enterprise,
and they were followed up for every two years. The company mainly
refers to stamping, polish, etc, and most of the process was automated;
however, the workers are still need to collect the auto parts near the
machinery, control the equipment or check the running status of the
2
Environmental Pollution 323 (2023) 121324
device regularly. The International Standard Classification of Occupa­
tions (ISCO) code for the participants are manufacturing managers
(1321), metal processing plant operators (8121), and mechanical ma­
chinery assemblers (8211). And the International Standard Industrial
Classification (ISIC) code for the participants are manufacture of basic
iron and steel (2410). All the participants worked more than one year in
the company (N = 476) were recruited except for those who do not want
to participate (N = 8). In this study, we included 449 subjects to evaluate
the relationship between occupational noise and HRV, after excluding
those with missing data (N = 19). And miRNAs were tested among 200
individuals who are males, nonsmokers, free of hypertension and free of
diabetes, as those factors may affect the expression of miRNAs (Chen
et al., 2019).
This study was approved by the Ethics and Human Subject Com­
mittee of Tongji Medical College, Huazhong University of Science and
Technology ([2019] IEC (S342)). Written informed consent was ob­
tained from all the participants.
2.2. Evaluation for occupational noise
Information combining the work histories and the occupational noise
monitoring records were used to calculate the exposure of occupational
noise. Work histories of workers were collected with a face-to-face
investigation, including company, job titles and work duration of
employment. Occupational noise in the workplace was tested by quali­
fied agencies in accordance with China’s national industrial hygiene
standards each year (GBZ/T 189.8 Measurement of Physical Agents in
Workplace Part 8: Noise). For instance, the company was first identified
into five departments and then divided into different locations according
to the manufacturing processes. Then the noise was measured for a 15-
min time-weighted average equivalent sound level by a sound analyzer
(3M SoundPro, US) if the job for the worker is fixed in the workplace, or
else it was measured for one working shift by an individual noise
dosimeter (3M QUEST Noisepro, US). As some noise monitoring records
were still missing for some workers, we could not calculate the accurate
cumulative occupational noise exposure with job-exposure matrix for
each worker. Thus, we use the monitoring records to define whether
they were occupational noise exposure (≥80 dB or not) for those have
records, and use the estimate level from similar jobs, or consulted with
local industrial hygienists for those with missing records. Occupational
noise exposure was defined as individuals with an 8-h equivalent A-
sound level (LAeq, 8h) ≥ 80 dB(A) for more than one year (Stokholm et al.,
2013). Subjects exposed to occupational noise were categorized into
three groups according to the tertiles of the duration of occupational
noise exposure: 1-<7 years, 7-<14 years, and ≥14 years.
2.3. HRV evaluation
HRV measurement are described previously (Wang et al., 2020). In
brief, after the rest of 5 min, each subject was mounted using a 3-channel
digital Holter equipment, which ran at a rate of 1024 samples per sec for
10 min. In this study, a single 5 min segment was selected between the
middle of ECG recordings (180–480 s) for 10 min of statistical analyses
(1996). Individuals not in the range of 40–100 beats per minute should
be excluded (Magari et al., 2002). Finally, the analysis included a total of
six measures of HRV. Low-frequency power (LF, 0.04–0.15 Hz),
high-frequency power (HF, 0.15–0.40 Hz), and total power (TP,
0.01–0.40 Hz) are the frequency domain indices. The standard deviation
of all normal R-R intervals (SDNN) and the root mean of the square of
successive differences between adjacent normal NN intervals (r-MSSD)
are the time domain indices. In addition, the time domain indices of the
average of SDNN for all 5-min segments of the entire recording (SDNN
index) was also chosen. The indices were selected based on previous
publications (Feng et al., 2015; Wang et al., 2020). LF power represents
both the sympathetic and parasympathetic tone, and HF power repre­
sents the parasympathetic tone. SDNN and SDNN index are regarded to
W. Li et al.
represent all the cyclic components of variability and thus reflects the
general HRV levels, and r-MSSD describes the short-term variability
(Fleisher, 1996). The decreases of LF, HF, TP, SDNN, r-MSSD and SDNN
index represent declined sympathetic/parasympathetic nerve excit­
ability and cardiac autonomic nervous function.
2.4. Assessment of plasma miRNAs
In our study, six candidate miRNAs (miR-200a-3p, miR-200b-3p,
miR-200c-3p, miR-1-3p, miR-92a-3p and miR-21–5p) were tested with
plasma. RNA was isolated according to the trizol-based protocol (TRI-
zol™Reagent, Invitrogen, USA), and synthetic Caenorhabditis elegans
miR-39 (cel-miR-39) (RNA oligonucleotides synthesized by Qiagen)
were added as an external reference. Qiagene miScript II RT Kit and
miScript SYBR Green PCR Kit were used to reverse transcribe RNA and
RT-PCR reactions. The plasma sample was tested in two parallel holes
and the standard deviation (SD) for cycle threshold (Ct) values among
parallel holes should be <5%; otherwise, the data will be abandoned or
be calculated by amplification plots and melt curve plots or remeasured
until meet the requirements; the expression of miRNAs was standardized
by cel-miR-39 and calculated by the 2− ΔCt, in which ΔCt equal to the
mean Ct value of miRNA minus the mean Ct value of cel-miR-39 (Deng
et al., 2014). Primers used were as follows: miR-200c-3p forward primer
(5′ -CCTAATACTGCCGGGTAATGATGGA-3′ ), miR-200a-3p forward
primer (5′ - CGCCTAACACTGTCTGGTAACGATGT-3′ ), miR-200b-3p
forward primer (5′ - CCGCGTAATACTGCCTGGTAATGATGA-3′ ),
miR-1-3p forward primer (5′ - CCGCGCGTGGAATGTAAAGAAGTAT
G-3′ ), miR-92a-3p forward primer (5′ - TATTGCACTTG-TCCCGGC
CTG-3′ ), miR-21–5p forward primer (5′ - CGCCGTAGCTTATCAGACTG
ATGTTGA-3′ ) and cel-miR-39 forward primer (5′ - CCTCACCGGGTGTA
AATCAGCTTG-3′ ).
2.5. Covariates
Baseline features (age, gender) and lifestyle data (smoking status,
drinking status, physical activity, etc) were collected by face-to-face
interviews in Nov 2019. Current smokers are identified as people
smoked more than one cigarette per day during the last half year. Cur­
rent drinkers have been identified as subjects drank more than once a
week during the last half year. Body mass index (BMI) was calculated as
weight in kilograms divided by the square of the height in meters, which
were measured with physicians. Dust exposure was defined as self-
reported exposure to dust for at least one year, or the level of dust
detected by qualified institutions was above zero in the workplace in the
past year. And the same definition applied to chemical poisons exposure.
Use of hearing protective devices was defined as self-reported use of
hearing protective devices for at least one year.
2.6. Statistical analysis
HRV measures (TP, HF, LF, SDNN, r-MSSD and SDNN index) and
miRNAs were log transformed, as they were not normally distributed.
Categorical variables are revealed as number (percentage), and contin­
uous variables are indicated as the mean ± standard deviation (SD) or
median [interquartile range (IQR)]. Generalized linear regressions were
conducted to get the β and 95% confidence intervals (CIs) for the rela­
tionship of occupational noise and miRNAs with HRV. In the meantime,
the dose-response association between occupational noise and HRV was
carried out using restricted cubic splines with 4 knots, and no occupa­
tional noise exposure is the reference group. The minimal confounding
factors were selected using directed acyclic graphs (DAGs), which are
visual representations of causal assumptions (Suttorp et al., 2015; Textor
et al., 2016) (Figure S1). Covariates in the full models included age,
gender, dust exposure, chemical poisons exposure, and hearing protec­
tion usage. Meanwhile, we also conducted the stratified analysis and
modification effect. Mediation analysis was conducted to identify the
3
Environmental Pollution 323 (2023) 121324
mediating role of miRNAs in the associations of occupational noise with
HRV by using the R mediation package (Tingley et al., 2014). Analyses
were conducted by SAS version 9.4 and R 4.0.5, and a 2-sided P < 0 0.05
was considered statistically significant.
3. Results
Table 1 shows the basic characteristics of the included subjects by the
quartiles of duration of occupational noise exposure in our study.
Among all the subjects, a total of 285 individuals (63.5%) were exposed
to occupational noise, with 91 (20.3%), 94 (20.9%), and 100 (22.3%) for
the 1-<7, 7-<14 and ≥ 14 years of occupational noise exposure,
respectively. Meanwhile, we also found significant differences in HRV
measures (LF, TP, SDNN and SDNN index) and miRNAs (miR-200a-3p,
miR-92a-3p and miR-21–5p) between different occupational noise
duration groups. LF, TP, SDNN and SDNN index were all decreased with
the increase of duration of occupational noise exposure (P < 0.05).
Besides, compared with no occupational noise exposure, the level of
miR-200a-3p, miR-92a-3p and miR-21–5p decreased for the longest
duration of occupational noise exposure (P < 0.05). The characteristics
of 200 subjects with miRNAs and the number of miRNAs subjects in
different occupational noise exposure duration groups are revealed in
Table S1 and Table S2, respectively.
3.1. Relationship between occupational noise duration and HRV
The association of occupational noise and HRV is shown in Table S3,
compared with no occupational noise exposure, occupational noise
exposure was not significantly associated with all HRV indices (P >
0.05).
Table 2 presents the relationship between occupational noise expo­
sure duration and HRV. Both continuous and categorical analyses sug­
gested negative associations between occupational noise exposure
duration and HRV indices, including SDNN, SDNN index, and HF.
Compared with no occupational noise exposure, individuals with the
longest duration of occupational noise exposure (≥14 years) were
associated with a reduction in HRV, the β (95% CIs) were − 0.043
(− 0.085, − 0.001) for SDNN, − 0.045 (− 0.088, − 0.003) for SDNN index,
and − 0.120 (− 0.258, − 0.019) for HF when adjusting for age and
gender; and the β (95% CIs) were − 0.044 (− 0.087, − 0.001) for SDNN,
− 0.049 (− 0.091, − 0.007) for SDNN index, and − 0.134 (− 0.271,
− 0.003) for HF with full adjustment. The dose-response relationship
between occupational noise exposure duration and HRV is also shown in
Fig. 1. We found a significant linear negative dose-response relationship
between occupational noise exposure duration and HRV indices (P for
overall <0.05, P for nonlinear >0.05), including SDNN, r-MSSD, SDNN
index, LF and HF. In addition, the stratified analysis and modification
effect could also be found in Table S4, and the negative results could also
be found in some subgroups. For instance, occupational noise duration
was associated with SDNN, r-MSSD and SDNN index among males;
SDNN, r-MSSD, SDNN index, LF, HF and TP among individuals aged
below 45 and nondrinkers; SDNN, LF and HF among BMI over 24; LF
among nonsmokers; SDNN, r-MSSD, SDNN index, HF and TP among no
dust exposure workers; SDNN index and HF among no chemical expo­
sure workers. And the modification effect could be found for gender,
age, drink and dust exposure (all P < 0.05).
3.2. The role of miRNAs in the association between occupational noise
duration and HRV
Table S5 shows the association between occupational noise exposure
and miRNAs. Compared with no occupational noise exposure, occupa­
tional noise exposure was associated with lower expression of miRNA-
21–5p (β = − 0.956, 95% CI = − 1.663, − 0.250), respectively.
The relationship between occupational noise exposure duration and
six candidate miRNAs is shown in Table 3. Occupational noise exposure
W. Li et al. Environmental Pollution 323 (2023) 121324

Table 1
Characteristics of the study population by occupational noise exposure duration.
Characteristics All participants Years of exposure to noise P value

0 1-<7 7-<14 ≥14

Number of participants 449 164 91 94 100

Age, years, mean ± SD 36.82 ± 9.14 35.73 ± 9.97 31.55 ± 8.08 35.96 ± 5.75 44.23 ± 6.32 <0.001
BMI, kg/m2, mean ± SD 23.87 ± 3.75 23.65 ± 4.36 23.53 ± 3.37 24.55 ± 3.45 23.89 ± 3.21 0.222
Male, n (%) 354 (78.84) 116 (70.73) 80 (87.91) 75 (79.79) 83 (83.00) 0.007
Current smoker, n (%) 141 (31.40) 39 (23.78) 32 (35.16) 32 (34.04) 38 (38.00) 0.001
Current drinker, n (%) 146 (32.52) 65 (39.63) 19 (20.88) 30 (31.91) 32 (32.00) 0.032
Dust exposure, n (%) 150 (33.41) 72 (43.90) 24 (26.37) 28 (29.79) 26 (26.00) 0.004
Chemical poisons exposure, n (%) 70 (15.59) 31 (18.90) 14 (15.38) 9 (9.57) 16 (16.00) 0.265
Hearing protection usage, n (%) 308 (68.60) 74 (45.12) 69 (75.82) 80 (85.11) 85 (85.00) <0.001
SDNN, ms, mean ± SD 42.60 ± 28.17 41.78 ± 15.62 45.88 ± 17.81 47.11 ± 51.78 36.74 ± 17.84 0.043
r-MSSD, ms, mean ± SD 29.38 ± 33.23 27.93 ± 11.37 31.04 ± 14.70 33.87 ± 67.11 26.05 ± 17.93 0.355
SDNN index, ms, mean ± SD 34.58 ± 13.90 34.67 ± 13.11 39.12 ± 15.93 35.27 ± 12.91 29.64 ± 12.62 <0.001
LF, ms2, mean ± SD 402.76 ± 528.51 383.75 ± 545.95 553.07 ± 613.09 413.30 ± 535.57 287.25 ± 356.55 0.006
HF, ms2, mean ± SD 286.11 ± 440.04 271.43 ± 405.40 374.49 ± 476.23 289.21 ± 346.52 226.82 ± 524.96 0.128
TP, ms2, mean ± SD 1019.51 ± 1136.35 1000.68 ± 1126.25 1333.83 ± 1347.39 1013.68 ± 1003.35 769.86 ± 1002.22 0.005
MicroRNAs, median, IQR
miR-200c-3p ( × 10− 2) a 6.67 (3.26, 13.52) 12.25 (4.93, 16.88) 7.44 (3.57, 12.74) 9.18 (3.77, 14.73) 5.54 (3.02, 9.43) 0.332
miR-200a-3p ( × 10− 2) b 1.00 (0.43, 2.72) 1.18 (0.61, 2.89) 1.61 (0.86, 2.71) 1.24 (0.54, 3.93) 0.55 (0.31, 1.60) 0.005
miR-200b-3p ( × 10− 2) c 5.57 (2.67, 9.13) 6.37 (4.71, 11.02) 7.20 (3.47, 11.38) 6.25 (3.38, 9.79) 4.21 (2.07, 7.13) 0.900
miR-1-3p ( × 10− 2) d 6.86 (2.72, 18.35) 6.22 (3.45, 15.61) 9.54 (3.73, 23.60) 9.78 (2.92, 19.51) 4.88 (2.44, 14.41) 0.078
miR-92a-3p e 12.85 (9.42, 17.47) 15.39 (12.81, 17.42) 16.64 (11.83, 28.20) 12.97 (10.08, 17.50) 11.26 (6.94, 14.88) <0.001
miR-21–5p f 9.15 (4.97, 19.58) 18.27 (12.33, 27.78) 19.17 (8.35, 32.50) 9.52 (6.11, 20.30) 8.23 (4.19, 11.78) <0.001

Abbreviations: SD, standard deviation; IQR, interquartile range; BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; SDNN, standard
deviation of normal-to-normal R-R intervals; r-MSSD, root mean square of successive differences; SDNN index, mean of the standard deviation of the 5-min average R-R
intervals 5 min; LF, low frequency; HF, high frequency; TP, total power.
Notes: P value reflects the difference between the four groups (not exposed to noise, exposed to noise for 1–7 years, exposed to noise for 7–14 years, exposed to noise for
more than 14 years); a: N = 199 for miR-200c-3p data; b: N = 185 for miR-200a-3p data; c: N = 198 for miR-200b-3p data; d: N = 196 for miR-1-3p data; e: N = 200 for
miR-92a-3p; f: N = 186 for miR-21–5p data.

Table 2
Associations between occupational noise duration and HRV.
All participants Years of exposure to noise P for trend

0 1-<7 7-<14 ≥14

β (95%CI) reference β (95%CI) β (95%CI) β (95%CI)

SDNN
Model 1 ¡0.003 (-0.005, -0.001) Ref 0.038 (− 0.007, 0.084) 0.018 (− 0.028, 0.063) ¡0.065 (-0.110, -0.021) 0.015
Model 2 ¡0.002 (-0.004, -0.001) Ref 0.032 (− 0.013, 0.078) 0.007 (− 0.038, 0.052) ¡0.043 (-0.085, -0.001) 0.111
Model 3 ¡0.002 (-0.004, -0.001) Ref 0.031 (− 0.014, 0.076) 0.016 (− 0.028, 0.060) ¡0.044 (-0.087, -0.001) 0.103
r-MSSD
Model 1 ¡0.003 (-0.005, -0.001) Ref 0.034 (− 0.016, 0.084) − 0.008 (− 0.058, 0.041) ¡0.052 (-0.100, -0.004) 0.033
Model 2 ¡0.002 (-0.004, -0.001) Ref 0.039 (− 0.011, 0.089) − 0.010 (− 0.059, 0.039) − 0.031 (− 0.079, 0.018) 0.154
Model 3 ¡0.002 (-0.004, -0.001) Ref 0.036 (− 0.014, 0.087) − 0.003 (− 0.052, 0.046) − 0.033 (− 0.082, 0.015) 0.157
SDNN index
Model 1 ¡0.003 (-0.005, -0.002) Ref 0.048 (0.004, 0.093) 0.008 (− 0.036, 0.053) ¡0.071 (-0.115, -0.028) 0.003
Model 2 ¡0.002 (-0.004, -0.001) Ref 0.040 (− 0.004, 0.084) − 0.004 (− 0.047, 0.039) ¡0.045 (-0.088, -0.003) 0.038
Model 3 ¡0.002 (-0.004, -0.001) Ref 0.039 (− 0.005, 0.083) 0.005 (− 0.037, 0.048) ¡0.049 (-0.091, -0.007) 0.034
LF
Model 1 ¡0.009 (-0.014, -0.003) Ref 0.208 (0.074, 0.342) 0.041 (− 0.092, 0.173) − 0.130 (− 0.260, 0.001) 0.060
Model 2 − 0.004 (− 0.010, 0.001) Ref 0.159 (0.026, 0.292) − 0.011 (− 0.142, 0.120) − 0.065 (− 0.194, 0.065) 0.227
Model 3 − 0.004 (− 0.010, 0.001) Ref 0.161 (0.029, 0.293) 0.015 (− 0.114, 0.145) − 0.073 (− 0.200, 0.055) 0.222
HF
Model 1 ¡0.010 (-0.015, -0.004) Ref 0.165 (0.023, 0.308) 0.034 (− 0.108, 0.175) ¡0.187 (-0.325, -0.049) 0.016
Model 2 ¡0.006 (-0.012, -0.001) Ref 0.166 (0.024, 0.309) 0.017 (− 0.123, 0.157) ¡0.120 (-0.258, -0.019) 0.098
Model 3 ¡0.006 (-0.012, -0.001) Ref 0.154 (0.012, 0.297) 0.035 (− 0.104, 0.175) ¡0.134 (-0.271, -0.003) 0.078
TP
Model 1 ¡0.007 (-0.011, -0.002) Ref 0.133 (0.021, 0.245) 0.019 (− 0.092, 0.130) ¡0.127 (-0.235, -0.018) 0.031
Model 2 − 0.003 (− 0.008, 0.001) Ref 0.114 (0.003, 0.225) − 0.010 (− 0.120, 0.099) − 0.065 (− 0.173, 0.043) 0.178
Model 3 − 0.003 (− 0.008, 0.001) Ref 0.111 (0.001, 0.221) 0.009 (− 0.099, 0.117) − 0.075 (− 0.182, 0.031) 0.155

Abbreviations: Ref, reference; SDNN, standard deviation of normal-to-normal R-R intervals; r-MSSD, root mean square of successive differences; SDNN index, mean of
the standard deviation of the 5-min average R-R intervals 5 min; LF, low frequency; HF, high frequency; TP, total power.
Model 1 was not adjusted. Model 2 was adjusted for age, gender. Model 3 was adjusted for age, gender, dust exposure, chemical poisons exposure and hearing
protection usage. The levels of HRV status were log-transformed.

duration was significantly associated with lower expression of five − 0.019) for miRNA-200b-3p, − 0.032 (− 0.048, − 0.017) for miRNA-92a-
miRNAs, when adjusting for other covariates. In the continuous model, 3p, and − 0.063 (− 0.089, − 0.038) for miRNA-21–5p. In categorical
the β (95% CIs) were − 0.039 (− 0.067, − 0.011) for miRNA-200c-3p, analysis, it was revealed that just individuals with the longest duration
− 0.053 (− 0.083, − 0.022) for miRNA-200a-3p, − 0.044 (− 0.070, of occupational noise exposure (≥14 years) were associated with lower

4
W. Li et al.
Fig. 1. Dose-response relationship between occupational noise duration and heart rate variability. Adjusted for age, gender, dust exposure, chemical poisons
exposure and hearing protection usage.
expression of those miRNAs, the β (95% CIs) were − 0.835 (− 1.610,
− 0.061), − 0.836 (− 1.679, − 0.007), − 0.752 (− 1.455, − 0.050), − 0.648
(− 1.066, − 0.230), and − 1.420 (− 2.129, − 0.711) for the above-
mentioned five miRNAs after adjusting for age; and the β (95% CIs)
were − 0.838 (− 1.619, − 0.056), − 0.848 (− 1.686, − 0.010), − 0.731
(− 1.441, − 0.021), − 0.649 (− 1.072, − 0.226), and − 1.403 (− 2.115,
− 0.690) with full adjustment.
Table 4 shows the associations between six candidate miRNAs and
HRV indices. We found a positive association between miRNA-1-3p and
LF (β = 0.039, 95% CI = 0.002, 0.080), when controlling for other
covariates. But no significant association was observed for others (P >
0.05). In addition, the mediating effects of miRNA in the association
between occupational noise duration and HRV is presented in Table S6,
and no mediating effect was found for the six candidate miRNAs in the
association between occupational noise duration and HRV.
In order to confirm the stability and reliability of the result, we also
conducted the association of occupational noise duration, miRNAs with
HRV indices based on the standard 85 dB cutoff for noise exposure in a
sensitivity analysis (Table S7-S9). And the results were similar as those
with 80 dB (A).
4. Discussion
In the present study, we found that occupational noise exposure
duration was negatively associated with HRV indices in a dose-response
manner. Furthermore, we also found that long-term exposure to occu­
pational noise was associated with lower expression of five miRNAs,
including miRNA-200c-3p, miRNA-200a-3p, miRNA-200b-3p, miRNA-
92a-3p, and miRNA-21–5p. However, no other positive association was
found except for miRNA-1-3p and LF, although we selected the miRNAs
5
Environmental Pollution 323 (2023) 121324
related to cardiac autonomic nervous system/heart rate according to
published literatures.
The findings of our study have important significance because
occupational noise is a major hazard in the workplace globally. Previous
study mainly focuses on cardiovascular diseases (Gan et al., 2011;
Thacher et al., 2022), and some limited studies have assessed the asso­
ciation between noise exposure and HRV; however, the exposure was
environmental noise with sample size less than 100 (El Aarbaoui and
Chaix, 2020; El Aarbaoui et al., 2017; Kraus et al., 2013). Environmental
noise is different from occupational noise, occupational noise is exposed
to occupational populations in the workplace, but environmental noise
is exposed to general population. Furthermore, occupational noise level
is usually much higher than environmental noise (Rabiei et al., 2021). In
addition, they did not explore the underlying mechanism. The findings
of our study indicated that occupational noise duration was associated
with early cardiovascular injury, as HRV reduction is reported to be an
indicator of early-onset cardiovascular events (Xhyheri et al., 2012). The
study implied the urgent need to control noise exposure to prevent
workers from experiencing early cardiovascular injury. Meanwhile, the
results could still provide clues for physicians that occupational noise
may be an important risk factor for early cardiovascular injury.
With regard to the results of stratified analysis and modification ef­
fect, male workers may experience relatively higher noise level
compared with female workers, although exposed to occupational noise
environment, the phenomenon could also be found in our previous
studies (Li et al., 2021; Wang et al., 2021). The number of workers who
aged over 45 (n = 118) is limited, making it less powerful. And in­
dividuals with BMI over 24 are more likely to be associated with reduced
HRV (Mehta, 2015). In addition, the positive results could be found
among nonsmokers, nondrinkers, no dust and no chemical exposure
W. Li et al. Environmental Pollution 323 (2023) 121324

Table 3
Associations between occupational noise duration and microRNA.
Years of exposure to noise

miRNAs All participants 0 1-<7 7-<14 ≥14 P for trend

β (95%CI) Reference β (95%CI) β (95%CI) β (95%CI)

miRNA-200c-3p a
Model 1 ¡0.039 (-0.067, -0.011) Ref − 0.282 (− 1.123, 0.560) − 0.181 (− 0.972, 0.611) ¡0.835 (-1.610, -0.061) 0.018
Model 2 ¡0.039 (-0.067, -0.011) Ref − 0.287 (− 1.141, 0.567) − 0.185 (− 0.988, 0.617) ¡0.838 (-1.619, -0.056) 0.019
miRNA-200a-3p b
Model 1 ¡0.054 (-0.084, -0.023) Ref 0.386 (− 0.519, 1.291) 0.183 (− 0.667, 1.032) ¡0.836 (-1.679, -0.007) 0.002
Model 2 ¡0.053 (-0.083, -0.022) Ref 0.303 (− 0.617, 1.225) 0.110 (− 0.750, 0.970) ¡0.848 (-1.686, -0.010) 0.002
miRNA-200b-3p c
Model 1 ¡0.045 (-0.070, -0.020) Ref 0.003 (− 0.765, 0.771) − 0.057 (− 0.776, 0.662) ¡0.752 (-1.455, -0.050) 0.006
Model 2 ¡0.044 (-0.070, -0.019) Ref − 0.037 (− 0.746, 0.820) − 0.026 (− 0.759, 0.706) ¡0.731 (-1.441, -0.021) 0.007
miRNA-1-3p d
Model 1 − 0.035 (− 0.070, 0.001) Ref 0.501 (− 0.536, 1.537) 0.435 (− 0.539, 1.409) − 0.444 (− 1.401, 0.514) 0.078
Model 2 − 0.034 (− 0.070, 0.001) Ref 0.462 (− 0.596, 1.520) 0.399 (− 0.594, 1.392) − 0.456 (− 1.424, 0.511) 0.083
e
miRNA-92a-3p
Model 1 ¡0.032 (-0.048, 0.017) Ref 0.064 (− 0.391, 0.519) − 0.257 (− 0.684, 0.170) ¡0.648 (-1.066, -0.230) <0.001
Model 2 ¡0.032 (-0.048, -0.017) Ref 0.063 (− 0.402, 0.527) − 0.258 (− 0.693, 0.177) ¡0.649 (-1.072, -0.226) <0.001
miRNA-21–5p f
Model 1 ¡0.063 (-0.089, -0.038) Ref − 0.241 (− 1.028, 0.546) − 0.804 (− 1.532, − 0.075) ¡1.420 (-2.129, -0.711) <0.001
Model 2 ¡0.063 (-0.089, -0.038) Ref − 0.197 (− 0.991, 0.598) − 0.747 (− 1.524, − 0.030) ¡1.403 (-2.115, -0.690) <0.001

Abbreviations: Ref, reference.

Generalized linear model was constructed for associations between occupational noise and miRNAs.
Model 1 was adjusted for age. Model 2 was adjusted for age, dust exposure, chemical poisons exposure and hearing protection usage.
The levels of miRNAs were log-transformed.
a
N = 199 for miR-200c-3p data.
b
N = 185 for miR-200a-3p data.
c
N = 198 for miR-200b-3p data.
d
N = 196 for miR-1-3p data.
e
N = 200 for miR-92a-3p.
f
N = 186 for miR-21–5p data.

Table 4
Associations between microRNA and HRV.
SDNN r-MSSD SDNN index LF HF TP

miRNA-200c- 0.015 (− 0.003, 0.034) 0.020 (− 0.001, 0.015 (− 0.003, 0.034) 0.033 (− 0.023, 0.088) 0.046 (− 0.016, 0.108) 0.029 (− 0.018, 0.076)
3p 0.040)
miRNA-200a- 0.014 (− 0.002, 0.030) 0.019 (− 0.002, 0.010 (− 0.007, 0.026) 0.009 (− 0.040, 0.057) 0.036 (− 0.018, 0.090) 0.016 (− 0.025, 0.057)
3p 0.039)
miRNA-200b- 0.009 (− 0.012, 0.030) 0.018 (− 0.005, 0.007 (− 0.014, 0.029) 0.023 (− 0.041, 0.086) 0.032 (− 0.039, 0.103) 0.019 (− 0.035, 0.073)
3p 0.041)
miRNA-1-3p 0.006 (− 0.008, 0.020) 0.004 (− 0.011, 0.006 (− 0.008, 0.020) 0.039 (0.002, 0.080) 0.009 (− 0.038, 0.056) 0.028 (− 0.007, 0.063)
0.019)
miRNA-92a-3p − 0.001 (− 0.031, 0.012 (− 0.022, − 0.001 (− 0.033, − 0.019 (− 0.112, − 0.016 (− 0.120, − 0.022 (− 0.101,
0.031) 0.045) 0.031) 0.075) 0.089) 0.057)
miRNA-21–5p 0.004 (− 0.014, 0.023) 0.009 (− 0.011, 0.007 (− 0.012, 0.026) 0.020 (− 0.036, 0.076) − 0.008 (− 0.054, 0.015 (− 0.032, 0.062)
0.029) 0.071)

Abbreviations: SDNN, standard deviation of normal-to-normal R-R intervals; r-MSSD, root mean square of successive differences; SDNN index, mean of the standard
deviation of the 5-min average R-R intervals 5 min; LF, low frequency; HF, high frequency; TP, total power.
Model was adjusted for age, dust exposure, chemical poisons exposure and hearing protection usage. The levels of HRV and miRNAs status were log-transformed.

workers, which could further confirm the association between occupa­
tional noise exposure duration and reduced HRV.
The mechanism underlying the association between occupational
noise exposure duration and reduced HRV is unknown. HRV represents
the activity of the autonomic nervous system, and it has been reported
that lower levels of parasympathetic tone and higher levels of sympa­
thetic input are associated with reduced HRV (Kraus et al., 2013). Pre­
vious studies have indicated that noise could increase the sympathetic
tone of the autonomic nervous system as a stressor (Schmidt et al.,
2013). In addition, we just found a positive association between
miRNA-1-3p and LF in our study. Several factors may contribute to this
phenomenon, for instance, difference characteristics in the study pop­
ulation, small simple size with miRNAs and HRV, etc, which need to be
confirmed in future studies. Nevertheless, we also found significant
negative relationship between occupational noise exposure and five
candidate miRNAs. Data on the association between occupational noise
exposure and miRNAs is scare, and they mainly focused on miRNAs
associated with noise-induced hearing loss (Ding et al., 2016). Previous
studies have indicated that noise exposure could result in early cardio­
vascular damage through oxidative stress and inflammation response
(Kröller-Schön et al., 2018; Münzel et al., 2017; Münzel et al., 2021),
and studies have also indicated that oxidative stress could result in the
change of miRNA level (Kura et al., 2020; Magenta et al., 2017), thus we
thought that occupational noise was associated with the change of
miRNAs level through oxidative stress process. In addition, our study
explored the role of miRNAs in reduced HRV associated with occupa­
tional noise, which has been less studied before.
The present study has some strengths. Firstly, we assessed the
mechanism for occupational noise duration and HRV, and found that
occupational noise duration was related with lower level of five candi­
date miRNAs, which could provide evidence for studies in future. Sec­
ondly, we also conducted a sensitivity analysis by using the standard 85

6
W. Li et al.
dB cutoff for noise exposure, and the results were similar as 80 dB for
noise exposure, which could confirm the stability of the results. Limi­
tations should also be noted. First, it is a cross-sectional study, which
could not provide a causal inference; meanwhile, healthy worker se­
lection may exist in the present study, which need to be cautious when
the results were generalized to other populations. Second, we just
selected six candidate miRNAs according to published literature; how­
ever, it could also provide clues for the mechanism. Third, the lack of
data on noise sensitivity is also a limitation, thus it should be caution
about its potential impact on the results. Fourth, occupational noise
exposure was just assessed with noise exposure duration, not the cu­
mulative occupational noise exposure, which need to be confirmed in
future studies. Finally, the results should be confirmed in larger sample
size population, especially for the null association between miRNAs and
HRV.
5. Conclusions
Our study indicates a linear negative dose-response relationship
between occupational noise exposure duration and HRV indices.
Meanwhile, occupational noise exposure duration is associated with
lower expression of miRNAs. However, the role of miRNAs in the asso­
ciation between occupational noise exposure duration and HRV indices
needs to be confirmed in future studies.
Funding
The study was supported by National Natural Science Foundation of
China (81903291), National Key R&D Program of China
(2022YFC2503203), Health Commission of Hubei Province scientific
research project (WJ 2023M002), Hubei Province Key Laboratory of
Occupational Hazard Identification and Control, Wuhan University of
Science and Technology (OHIC 2021Y03), and Fundamental Research
Funds for School of Public Health, Tongji Medical College, Huazhong
University of Science and Technology (2022gwzz02). The funder did not
play any role in study design; in the collection, analysis, and interpre­
tation of data; in the writing of the report; nor in the preparation, re­
view, or approval of the manuscript.
Author contributions
WZL wrote the manuscript and performed statistical analysis. WZL
and DMW conceived and designed the study, and interpreted data. HZZ,
YX, YQT and WHC critically revised the manuscript and approved the
final version. WZL and DMW are the guarantors of this work and, as
such, had full access to all the data in the study and take responsibility
for the integrity of the data and the accuracy of the data analysis.
Author contributions statement
Wenzhen Li, Dongming Wang: Conceptualization, Methodology,
Formal analysis, Writing – review & editing; Wenzhen Li, Haozhe Zhang,
Yang Xiao, Yueqing Tao, Weihong Chen: Investigation, Review & Edit­
ing; Dongming Wang: Conceptualization, Methodology, Funding
acquisition, Writing-Review & Editing, Supervision, Project adminis­
tration. All authors have read and approved the final version of the
manuscript.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
7
Environmental Pollution 323 (2023) 121324
Data availability
Data will be made available on request.
Acknowledgements
All the participants, staffs of Wuhan Prevention and Treatment
Center for Occupational Diseases, and all the study team members
should be greatly acknowledged.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.envpol.2023.121324.
References
Basner, M., Babisch, W., Davis, A., Brink, M., Clark, C., Janssen, S., Stansfeld, S., 2014.
Auditory and non-auditory effects of noise on health. Lancet 383, 1325–1332.
Chen, W., Fu, W., Deng, Q., Li, Y., Wang, K., Bai, Y., Wu, X., Li, G., Wang, G., Huang, J.,
He, M., Zhang, X., Wu, T., Wei, S., Guo, H., 2019. Multiple metals exposure and
chromosome damage: exploring the mediation effects of microRNAs and their
potentials in lung carcinogenesis. Environ. Int. 122, 291–300.
Deng, Q., Huang, S., Zhang, X., Zhang, W., Feng, J., Wang, T., Hu, D., Guan, L., Li, J.,
Dai, X., Deng, H., Zhang, X., Wu, T., 2014. Plasma microRNA expression and
micronuclei frequency in workers exposed to polycyclic aromatic hydrocarbons.
Environ. Health Perspect. 122, 719–725.
Deng, Q., Dai, X., Feng, W., Huang, S., Yuan, Y., Xiao, Y., Zhang, Z., Deng, N., Deng, H.,
Zhang, X., Kuang, D., Li, X., Zhang, W., Zhang, X., Guo, H., Wu, T., 2019. Co-
exposure to metals and polycyclic aromatic hydrocarbons, microRNA expression,
and early health damage in coke oven workers. Environ. Int. 122, 369–380.
Ding, L., Liu, J., Shen, H.X., Pan, L.P., Liu, Q.D., Zhang, H.D., Han, L., Shuai, L.G.,
Ding, E.M., Zhao, Q.N., Wang, B.S., Zhu, B.L., 2016. Analysis of plasma microRNA
expression profiles in male textile workers with noise-induced hearing loss. Hear.
Res. 333, 275–282.
El Aarbaoui, T., Chaix, B., 2020. The short-term association between exposure to noise
and heart rate variability in daily locations and mobility contexts. J. Expo. Sci.
Environ. Epidemiol. 30, 383–393.
El Aarbaoui, T., Méline, J., Brondeel, R., Chaix, B., 2017. Short-term association between
personal exposure to noise and heart rate variability: the RECORD MultiSensor
Study. Environ. Pollut. 231, 703–711.
Feng, W., He, X., Chen, M., Deng, S., Qiu, G., Li, X., Liu, C., Li, J., Deng, Q., Huang, S.,
Wang, T., Dai, X., Yang, B., Yuan, J., He, M., Zhang, X., Chen, W., Kan, H., Wu, T.,
2015. Urinary metals and heart rate variability: a cross-sectional study of urban
adults in Wuhan, China. Environ. Health Perspect. 123, 217–222.
Fleisher, L.A., 1996. Heart rate variability as an assessment of cardiovascular status.
J. Cardiothorac. Vasc. Anesth. 10, 659–671.
Gan, W.Q., Davies, H.W., Demers, P.A., 2011. Exposure to occupational noise and
cardiovascular disease in the United States: the national health and nutrition
examination survey 1999-2004. Occup. Environ. Med. 68, 183–190.
Huang, S., Deng, Q., Feng, J., Zhang, X., Dai, X., Li, L., Yang, B., Wu, T., Cheng, J., 2016.
Polycyclic aromatic hydrocarbons-associated MicroRNAs and heart rate variability
in coke oven workers. J. Occup. Environ. Med. 58, e24–e31.
Kheirandish, A., Mehrparvar, A., Abou-Bakre, A., Zare Sakhvidi, M.J., 2022. Association
between long-term occupational noise exposure and obesity. Environ. Sci. Pollut.
Res. Int. 29, 20176–20185.
Kim, S., Yun, B., Lee, S., Kim, C., Sim, J., Cho, A., Oh, Y., Lee, J., Yoon, J., 2021.
Occupational noise exposure and incidence of high fasting blood glucose: a 3-year,
multicenter, retrospective study. Int. J. Environ. Res. Publ. Health 18, 9388.
Kim, G., Kim, H., Yun, B., Sim, J., Kim, C., Oh, Y., Yoon, J., Lee, J., 2022. Association of
occupational noise exposure and incidence of metabolic syndrome in a retrospective
cohort study. Int. J. Environ. Res. Publ. Health 19, 2209.
Kraus, U., Schneider, A., Breitner, S., Hampel, R., Rückerl, R., Pitz, M., Geruschkat, U.,
Belcredi, P., Radon, K., Peters, A., 2013. Individual daytime noise exposure during
routine activities and heart rate variability in adults: a repeated measures study.
Environ. Health Perspect. 121, 607–612.
Kröller-Schön, S., Daiber, A., Steven, S., Oelze, M., Frenis, K., Kalinovic, S., Heimann, A.,
Schmidt, F.P., Pinto, A., Kvandova, M., Vujacic-Mirski, K., Filippou, K., Dudek, M.,
Bosmann, M., Klein, M., Bopp, T., Hahad, O., Wild, P.S., Frauenknecht, K.,
Methner, A., Schmidt, E.R., Rapp, S., Mollnau, H., Münzel, T., 2018. Crucial role for
Nox2 and sleep deprivation in aircraft noise-induced vascular and cerebral oxidative
stress, inflammation, and gene regulation. Eur. Heart J. 39, 3528–3539.
Kura, B., Szeiffova Bacova, B., Kalocayova, B., Sykora, M., Slezak, J., 2020. Oxidative
stress-responsive MicroRNAs in heart injury. Int. J. Mol. Sci. 21, 358.
Li, W., Yi, G., Chen, Z., Wu, J., Lu, Z., Liang, J., Mao, G., Yao, Y., Wang, D., 2021.
Association of occupational noise exposure, bilateral hearing loss with hypertension
among Chinese workers. J. Hypertens. 39, 643–650.
Magari, S.R., Schwartz, J., Williams, P.L., Hauser, R., Smith, T.J., Christiani, D.C., 2002.
The association of particulate air metal concentrations with heart rate variability.
Environ. Health Perspect. 110, 875–880.
W. Li et al.
Magenta, A., Ciarapica, R., Capogrossi, M.C., 2017. The emerging role of miR-200 family
in cardiovascular diseases. Circ. Res. 120, 1399–1402.
Mehta, R.K., 2015. Impacts of obesity and stress on neuromuscular fatigue development
and associated heart rate variability. Int. J. Obes. 39, 208–213.
Mejía-Mejía, E., May, J.M., Elgendi, M., Kyriacou, P.A., 2021. Differential effects of the
blood pressure state on pulse rate variability and heart rate variability in critically ill
patients. NPJ Digit Med 4, 82.
Münzel, T., Daiber, A., Steven, S., Tran, L.P., Ullmann, E., Kossmann, S., Schmidt, F.P.,
Oelze, M., Xia, N., Li, H., Pinto, A., Wild, P., Pies, K., Schmidt, E.R., Rapp, S., Kröller-
Schön, S., 2017. Effects of noise on vascular function, oxidative stress, and
inflammation: mechanistic insight from studies in mice. Eur. Heart J. 38,
2838–2849.
Münzel, T., Sørensen, M., Daiber, A., 2021. Transportation noise pollution and
cardiovascular disease. Nat. Rev. Cardiol. 18, 619–636.
Rabiei, H., Ramezanifar, S., Hassanipour, S., Gharari, N., 2021. Investigating the effects
of occupational and environmental noise on cardiovascular diseases: a systematic
review and meta-analysis. Environ. Sci. Pollut. Res. Int. 28, 62012–62029.
Sajadieh, A., Nielsen, O.W., Rasmussen, V., Hein, H.O., Abedini, S., Hansen, J.F., 2004.
Increased heart rate and reduced heart-rate variability are associated with
subclinical inflammation in middle-aged and elderly subjects with no apparent heart
disease. Eur. Heart J. 25, 363–370.
Santos-Ferreira, C.A., Abreu, M.T., Marques, C.I., Gonçalves, L.M., Baptista, R., Girão, H.
M., 2020. Micro-RNA analysis in pulmonary arterial hypertension: current
knowledge and challenges. JACC Basic Transl Sci 5, 1149–1162.
Schmidt, F.P., Basner, M., Kröger, G., Weck, S., Schnorbus, B., Muttray, A., Sariyar, M.,
Binder, H., Gori, T., Warnholtz, A., Münzel, T., 2013. Effect of nighttime aircraft
noise exposure on endothelial function and stress hormone release in healthy adults.
Eur. Heart J. 34, 3508–3514a.
Shaffer, F., Ginsberg, J.P., 2017. An overview of heart rate variability metrics and norms.
Front. Public Health 5, 258.
Stokholm, Z.A., Bonde, J.P., Christensen, K.L., Hansen, A.M., Kolstad, H.A., 2013.
Occupational noise exposure and the risk of hypertension. Epidemiology 24,
135–142.
Suttorp, M.M., Siegerink, B., Jager, K.J., Zoccali, C., Dekker, F.W., 2015. Graphical
presentation of confounding in directed acyclic graphs. Nephrol. Dial. Transplant.
30, 1418–1423.
Tegegne, B.S., Man, T., van Roon, A.M., Asefa, N.G., Riese, H., Nolte, I., Snieder, H.,
2020. Heritability and the genetic correlation of heart rate variability and blood
pressure in >29 000 families: the lifelines cohort study. Hypertension 76,
1256–1262.
Environmental Pollution 323 (2023) 121324
Teixeira, L.R., Pega, F., de Abreu, W., de Almeida, M.S., de Andrade, C.A.F., Azevedo, T.
M., Dzhambov, A.M., Hu, W., Macedo, M.R.V., Martínez-Silveira, M.S., Sun, X.,
Zhang, M., Zhang, S., Correa da Silva, D.T., 2021a. The prevalence of occupational
exposure to noise: a systematic review and meta-analysis from the WHO/ILO Joint
Estimates of the Work-related Burden of Disease and Injury. Environ. Int. 154,
106380.
Teixeira, L.R., Pega, F., Dzhambov, A.M., Bortkiewicz, A., da Silva, D.T.C., de
Andrade, C.A.F., Gadzicka, E., Hadkhale, K., Iavicoli, S., Martínez-Silveira, M.S.,
Pawlaczyk-Łuszczyńska, M., Rondinone, B.M., Siedlecka, J., Valenti, A.,
Gagliardi, D., 2021b. The effect of occupational exposure to noise on ischaemic heart
disease, stroke and hypertension: a systematic review and meta-analysis from the
WHO/ILO Joint Estimates of the Work-Related Burden of Disease and Injury.
Environ. Int. 154, 106387.
Textor, J., van der Zander, B., Gilthorpe, M.S., Liskiewicz, M., Ellison, G.T., 2016. Robust
causal inference using directed acyclic graphs: the R package ’dagitty. Int. J.
Epidemiol. 45, 1887–1894.
Thacher, J.D., Roswall, N., Lissåker, C., Aasvang, G.M., Albin, M., Andersson, E.M.,
Engström, G., Eriksson, C., Hvidtfeldt, U.A., Ketzel, M., Khan, J., Lanki, T.,
Ljungman, P.L.S., Mattisson, K., Molnar, P., Raaschou-Nielsen, O., Oudin, A.,
Overvad, K., Petersen, S.B., Pershagen, G., Poulsen, A.H., Pyko, A., Rizzuto, D.,
Rosengren, A., Schioler, L., Sjöström, M., Stockfelt, L., Tiittanen, P., Sallsten, G.,
Ögren, M., Selander, J., Sorensen, M., 2022. Occupational noise exposure and risk of
incident stroke: a pooled study of five Scandinavian cohorts. Occup. Environ. Med.
79, 594–601.
Tingley, D., Yamamoto, T., Hirose, K., Keele, L., Imai, K., 2014. Mediation: R package for
causal mediation analysis. J. Stat. Software 59, 1–38.
Wang, B., Cheng, M., Yang, S., Qiu, W., Li, W., Zhou, Y., Wang, X., Yang, M., He, H.,
Zhu, C., Cen, X., Chen, A., Xiao, L., Zhou, M., Ma, J., Mu, G., Wang, D., Guo, Y.,
Zhang, X., Chen, W., 2020. Exposure to acrylamide and reduced heart rate
variability: the mediating role of transforming growth factor-β. J. Hazard Mater.
395, 122677.
Wang, D., Xiao, Y., Feng, X., Wang, B., Li, W., He, M., Zhang, X., Yuan, J., Yi, G., Chen, Z.,
Dai, X., Wu, J., Chen, W., 2021. Association of occupational noise exposure, bilateral
hearing loss with atherosclerotic cardiovascular disease risk in Chinese adults. Int. J.
Hyg Environ. Health 235, 113776.
Xhyheri, B., Manfrini, O., Mazzolini, M., Pizzi, C., Bugiardini, R., 2012. Heart rate
variability today. Prog. Cardiovasc. Dis. 55, 321–331.
Zhou, S.S., Jin, J.P., Wang, J.Q., Zhang, Z.G., Freedman, J.H., Zheng, Y., Cai, L., 2018.
miRNAS in cardiovascular diseases: potential biomarkers, therapeutic targets and
challenges. Acta Pharmacol. Sin. 39, 1073–1084.