MOLECULAR PHYLOGENETICS AND EVOLUTION
Vol. 10, No. 2, October, pp. 202–209, 1998
ARTICLE NO. FY980516
Molecular Phylogeny of Dipetrocarpaceae in Southeast Asia Based
on Nucleotide Sequences of matK, trnL Intron, and trnL-trnF
Intergenic Spacer Region in Chloroplast DNA
Tadashi Kajita,* Koichi Kamiya,* Kaho Nakamura,* Hidenori Tachida,*
Ratnam Wickneswari,† Yoshihiko Tsumura,‡ Hiroshi Yoshimaru,‡ and Tsuneyuki Yamazaki*
*Department of Biology, Faculty of Science, Kyushu University, Fukuoka, Japan; †Forest Research Institute of Malaysia,
Kuala Lumpur, Malaysia; and ‡Bio-Resources Technology Division, Forestry and Forest Product Research Institute, Ibaraki, Japan
Received September 4, 1997; revised December 16, 1997
To obtain a refined molecular phylogeny of diptero-
carp species in Southeast Asia, nucleotide sequences of
matK, the intron of trnL, and intergenic spacer region
between trnL and trnF in chloroplast DNA were deter-
mined in 16 species throughout 10 genera. In the
resultant trees Southeast Asian dipterocarp species
were divided into two clusters. One cluster consisted
of Anisoptera, Vatica, Cotylelobium, and Upuna, all
with the base chromosome number of x 5 11. The
second cluster consisted of Hopea, Shorea, Neobalano-
carpus, Dryobalanops, Parashorea, and Dipterocar-
pus, mostly with the base chromosome number of x 5 7.
Dipterocarpus was the only genus that had the base
chromosome number x 5 11 in the latter cluster. This
result suggests that the chromosome number changed
from x 5 11 to x 5 7 after Dipterocarpus branched in
the latter cluster. Other evolutionary changes of mor-
phological characters are also discussed. r 1998 Academic
Press
INTRODUCTION
The family Dipterocarpaceae consists of three sub-
families distributed widely in tropics in the world.
According to the recent classification of this family
(Ashton, 1982; Londoño et al., 1995), approximately
470 species in 13 genera are recognized in the Asian
subfamily Dipterocarpoideae, 39 species in two African
genera and a monotypic South American genus in the
subfamily Monotoideae, and one species of one genus in
the South American subfamily Pakaraimoideae. The
disjunctive pattern of distribution of the three subfami-
lies is considered to be the result of the geographical
change in the Tertiary (Ashton, 1982). Although the
African and South American subfamilies include both
savanna and closed forest trees, the Asian subfamily is
mostly of closed forest where they dominate the emer-
gent canopy of most lowland rain forests. Many of these
202
1055-7903/98 $25.00
Copyright r 1998 by Academic Press
All rights of reproduction in any form reserved.
species are also major timbers in the hardwood mar-
kets in Asia (Ashton, 1982, 1988).
The phylogenetic relationships of Dipterocarpaceae
have been discussed using distribution, fossil, and
morphological data (Ashton, 1982). He inferred that
the origin of Dipterocarpaceae was in Gondwana conti-
nent, and that ancestors of the three subfamilies were
produced when the continent was split. He also dis-
cussed that the origin of Dipterocarpoideae was in
Africa, and it spread its distribution to the Malesian
area (the Malay Peninsula and Malay Archipelago,
including New Guinea and the Philippines) producing
relict genera, Stemonoporus, Vateria, and Vateriopsis,
that distribute in Ceylon and Seychelles.
The generic relationships in the most successful
subfamily Dipterocarpoideae were discussed in Ashton
(1982) based on morphology, wood-anatomy, palinology,
and fossil record. The cytological data for the family are
still limited but provide important information to the
understanding of the generic relationships in this
subfamily (see review in Ashton, 1982). Two tribes are
recognized according to these characters. One is tribe
Dipterocarpeae which has valvate fruit calyx lobe,
scattered resin canals, and the base chromosome num-
ber x 5 11; members of this tribe are Vateria, Vateriop-
sis, Stemonoporus, Vatica, Cotylelobium, Upuna, Anisop-
tera, and Dipterocarpus. The other is tribe Shoreae
which has imbricate fruit calyx lobe, resin canals in
tangential bands, and base chromosome number x 5 7;
members of this tribe are Dryobalanops, Parashorea,
Hopea, Neobalanocarpus, and Shorea. The genus Upuna
which is endemic in Borneo was thought to be the most
primitive genus in Malesian genera (Ashton, 1982).
The genus is most closely allied to Anisoptera, but
superficially resembles the genus Monotes of Monotoi-
deae, and shares a putative aril with Stemonoporus
and Vateriopsis.
The first to study the molecular phylogeny of Diptero-
carpaceae was Tsumura et al. (1996), using RFLP
 PHYLOGENY OF DIPETROCARPACEAE IN SOUTHEAST ASIA 203

analysis based on PCR amplified fragments of chloro-
plast DNA genes to compare 30 species in 10 genera.
They presented two phylogenetic trees based on the
maximum parsimony method and neighbor-joining
method, respectively, using the genus Upuna as an
outgroup. They showed that (1) the phylogenetic trees
clearly separate species with two different base chromo-
some numbers; (2) Parashorea lucida is a sister to most
Shorea species; (3) Neobalanocarpus heimii and Hopea
form a clade which is the sister to two Shorea species;
(4) and Cotylelobium and Vatica are closely related
species. But there were two potential problems in the
analysis. First, since correspondence of restriction frag-
ments between species belonging to different families
was very difficult to determine in the PCR-RFLP
analysis, an apparent outgroup from other families was
not reliable in their analyses. Thus, they selected
Upuna from Dipterocarpaceae as an outgroup, justifica-
tion of which was not well documented. They could not
discuss the generic relationships of Upuna to other
genera, because they determined the position of Upuna
a priori. Second, they did not give confidence levels of
their trees (e.g., bootstrap or decay analysis), even
though evaluation of these is one of the advantages to
construct phylogenetic trees using molecular markers.
Here, to obtain a more refined phylogeny among
genera of Dipterocarpaceae in Southeast Asia, phyloge-
netic analysis based on the nucleotide sequences of
matK, the intergenic spacer (IGS) region of trnL-trnF,
and the intron of trnL of chloroplast DNA was per-
formed. These genes were known to evolve faster in the
chloroplast genome (Neuhaus and Link, 1987; Gielly
and Taberlet, 1994), and often used to study relation-
ships among genera (Johnson and Soltis, 1994; Plun-
kett et al., 1997), among species (Gielly and Taberlet,
1994), and also within species (Fujii et al., 1995; Fujii et
al., 1997). We selected an outgroup from Tiliaceae
based on the phylogenetic analysis of Angiosperms by
rbcL sequences (Chase et al., 1993). Since samples from
three genera of Dipterocarpoideae, namely, Stemonopo-
rus, Vateria, and Vateriopsis, as well as those from
members of other subfamilies were not available, we
could not include them in this study.
MATERIALS AND METHODS
DNA Extraction
Fourteen samples of DNA materials were the same
as those used in the previous PCR-RFLP study of
Tsumura et al. (1996). Three additional samples were
obtained from other sources (Table 1). Extraction of
DNA was performed in the same way as was described
in Tsumura et al. (1996).
Automated Sequencing
DNA fragments of the matK, trnL-trnF IGS region,
and trnL intron were amplified by PCR using TaqI
polymerase (Pharmasia, Toyobo, Takara) using univer-
sal primers for matK (‘‘AF’’ and ‘‘8R’’ of Ooi et al., 1995),

TABLE 1

Species Studied in this Study

Voucher a Accession No. b Source

mat K trnL/F trnL intron

Anisoptera laevis Dyer Yoshimaru s.n. AB006370, AB006387, AB006404 FRIM, Kepong, Malaysia
Anisoptera oblonga Dyer Kawahara-95067* AB006371, AB006388, AB006405 FRIM, Kepong, Malaysia
Cotylelobium lanceolatum Craib c LGF 52/95* AB006372, AB006389, AB006406 FRIM, Kepong, Malaysia
Vatica odorata (Griff.) Sym. LGF 75/95* AB006373, AB006390, AB006407 FRIM, Kepong, Malaysia
Upuna borneensis Sym. LGF 76/95* AB006374, AB006391, AB006408 FRIM, Kepong, Malaysia
Dipterocarpus kerrii King LGF 71/95* AB006375, AB006392, AB006409 FRIM, Kepong, Malaysia
Dipterocarpus baudii Korth LGF 53/95* AB006376, AB006393, AB006410 FRIM, Kepong, Malaysia
Dryobalanops aromatica Gaertn LGF 51/95* AB006377, AB006394, AB006411 FRIM, Kepong, Malaysia
Dryobalanops oblongifolia Dyer Yoshimaru s.n. AB006378, AB006395, AB006412 FRIM, Kepong, Malaysia
Shorea macroptera Dyer LGF 59/95* AB006379, AB006396, AB006413 FRIM, Kepong, Malaysia
Shorea ovalis (Korth.) Bi. Kawahara-95025* AB006380, AB006397, AB006414 FRIM, Kepong, Malaysia
Shorea bracteolata Dyer. LGF 77/95* AB006381, AB006398, AB006415 FRIM, Kepong, Malaysia
Parashorea lucida (Miq.) Kurz LGF 67/95* AB006382, AB006399, AB006416 FRIM, Kepong, Malaysia
Neobalanocarpus heimii (King) Ashton LGF 57/95* AB006383, AB006400, AB006417 FRIM, Kepong, Malaysia
Hopea nervosa King LGF 74/95* AB006384, AB006401, AB006418 FRIM, Kepong, Malaysia
Hopea odorata Roxb. LGF 61/95* AB006385, AB006402, AB006419 FRIM, Kepong, Malaysia
Tilia kiusiana Makino et Shirasawa Kamiya s.n. AB006386, AB006403, AB006420 Kyushu University, Japan

Note. Asterisks indicate the same materials as were used in Tsumura et al. (1996).
a Voucher specimens collected in Malaysia are stored in Frim Herbarium (Forest Research Institute of Malaysia, Kuala Lumpur, Malaysia).
Voucher of Tilia kiusiana is stored in the herbarium of Tohoku University (TUS).
b Accession numbers of DNA Data Bank of Japan (DDBJ) for nucleotide sequences are shown in order of matK, trnL-trnF intergenic spacer

region, and trnL intron, respectively.

c Referred as Cotylelobium malayanum in Tsumura et al. (1996).
204
trnL-trnF spacer region, and trnL intron (‘‘e,’’ ‘‘f,’’ ‘‘c,’’
and ‘‘d’’ of Taberlet et al., 1991). Amplified products
were purified by GeneCleanIII (Bio 101, La Jolla, CA)
following the manufacturer’s specifications. DNA se-
quencing was performed using an Applied BioSystems
377 automated sequencer with ABI PRISM Dye Termi-
nator Cycle Sequencing Ready Reaction Kit following
the supplier’s instructions. Sequencing primers for the
trnL-trnF spacer region and trnL intron were the same
ones as those used as PCR primers. Although the 58
PCR primer for matK could be used as a sequence
primer, the 38 PCR primer did not produce good results
in some samples. Internal sequencing primers were
designed to complement matK sequences of N. heimii
and Cotylelobium lanceolatum. To obtain matK se-
quences of these two species, PCR-amplified products
were purified as described above and ligated to pGEM-T
vector (Promega) following the manufacturer’s specifi-
cations, and the resultant plasmid was amplified and
purified in XL1-Blue (Stratagene) following standard
protocols (Sambrook et al., 1989). Nucleotide sequences
of plasmid inserts were determined using both the T7
and reverse primers. The obtained sequences were
manually aligned and four internal primers (392R:
GATGGATGGGATGAGGTATTAGT; 602F: CCATTTTC-
CTTTTTCTCCGT; 892R:ATCCTTCCTTGATTGAGACCA;
and 1125R: TCCAGATCGGCTTACTAATG) were designed
from conserved regions. A pair of 8R and 1125R was
used to amplify the matK fragments of other species.
Phylogenetic Analyses
Alignments of obtained sequences were performed by
Clustal W (Thompson et al., Higgins, and Gibson,
1994). The trnL-trnF IGS region and trnL intron con-
tained numerous insertion/deletions (indels) between
dipterocarp species and the outgroup taxon. Align-
ments were visually corrected. Phylogenetic analyses
were performed by the maximum parsimony method
and neighbor-joining (NJ) method (Saitou and Nei,
1987). In the parsimony method, we performed branch-
and-bound search using PAUP v. 3.1.1 (Swofford, 1993).
In the NJ method, we used Clustal W (Thompson et al.,
1994).
Genetic distances were calculated using Kimura’s
two-parameter method (Kimura, 1980) for all pairs of
sequences. Nucleotide diversities were calculated in
each region of chloroplast DNA. In the matK, nucleo-
tide substitutions at synonymous and nonsynonymous
sites are computed separately using the method of Nei
and Gojobori (1986). Estimates of the average numbers
of substitutions within and between groups with their
variances were obtained using the method of Nei and
Jin (1989). For these analyses, computer software
ODEN (Ina, 1994) and SEnj (kindly provided by Dr. Y.
Ina, Biomolecular Engineering Research Institute,
Suita, 565, Japan; yina@beri.co.jp) were used.
The nucleotide sequence data reported in this paper
KAJITA ET AL.
will appear in the DNA Data Bank of Japan (DDBJ),
EMBL, and GenBank with the accession numbers
given in Table 1.
RESULTS
Characteristics of matK, trnL-trnF IGS Region, and
trnL Intron
matK is about 1.5 kb in length and located in the
2.5-kb intron of the trnK gene (Neuhaus and Link,
1987). The matK fragments of Neobalanocarpus and
Cotylelobium first determined in our study were 1265
bp and correspond to the 55 to 1316 region of the matK
gene (1530 bp) of Nicotiana tabacum (in the complete
chloroplast genome; Shinozaki et al., 1986) when aligned
together. There were three indels between the Neobala-
nocarpus and Nicotiana matK fragments, and the
identity was 79.1%. For other dipterocarp species,
915-bp fragments of matK were obtained using one of
the universal primers designed by Ooi et al. (1995) and
a primer (1125R) designed in this study. There were no
indels among sequences of Dipterocarpaceae, but a
6-base indel was found between dipterocarp species
and Tilia kiusiana. This 915-bp fragment corresponds
to the 136 to 1062 region of the N. tabacum matK gene.
Because some of the species of Dipterocarpaceae had a
long adenine (or thymine in the complementary strand)
repeat which troubled direct sequencing sometimes, at
position 1273 relative to the N. tabacum matK, we
could not use the 8R primer of Ooi et al. (1995) properly
in our study.
The average nucleotide compositions of the matK
fragments were 0.30 (A), 0.38 (T), 0.15 (G), and 0.18 (C).
Of the variable sites, 30.4% were at the first, 24.5%
were at the second, and 55.1% were at the third codon
positions. The transition/transversion ratio was 1.55.
This value was slightly higher than those reported in
Hilu and Liang (1997) which compared 11 complete
matK sequences obtained from Genbank. They re-
ported that the ratios between genera in the same
family were 1.25 (Poaceae), 0.61 (Solanaceae), and 1.15
(Saxifragaceae) (Table 2 in Hilu and Liang, 1997).
Those ratios varied from 0.39 between the two pine
species to 1.35 between Pinus contorta and Sullavantia
sullivantii (Saxifragaceae). The average nucleotide sub-
stitutions within the family was 0.0278 (60.0031) in
the total sequence, 0.0202 (60.0028) in nonsynony-
mous sites, and 0.0545 (60.0102) in synonymous sites.
As shown below, Dipterocarpaceae species studied here
are divided into two major clades each consisting of 5
and 10 species, respectively. The estimated number of
net nucleotide substitutions (see p. 276 of Nei, 1987)
between the two clades and the average number of
substitutions within each clade are shown in Table 2.
The ratio of nonsynonymous to synonymous substitu-
tions is also tabulated. The ratio of nonsynonymous to
synonymous substitutions between the two clades is
 PHYLOGENY OF DIPETROCARPACEAE IN SOUTHEAST ASIA 205

TABLE 2

Average Number of Substitutions and Variances in Three Different Parts

of Chloroplast Gene within Dipterocarpaceae

Nucleotide substitution c

Shared sites a,b Between families d Between two clades e Within cladeA (10) Within cladeB (5)

matK 915 0.1277 (6 0.0119) 0.0161 (6 0.0037) 0.0248 (6 0.0032) 0.0107 (6 0.0024)
Nonsynonymous (Ka) 708 0.0959 (6 0.0116) 0.0067 (6 0.0026) 0.0207 (6 0.0032) 0.0098 (6 0.0025)
Synonymous (Ks) 203 0.2386 (6 0.0363) 0.0497 (6 0.0148) 0.0393 (6 0.0085) 0.0138 (6 0.0059)
Ka/Ks 0.4021 0.1347 0.5256 0.7067
trnL-trnF 355 0.2234 (6 0.0279) 0.0133 (6 0.0050) 0.0289 (6 0.0049) 0.0183 (6 0.0048)
trnL intron 438 0.1487 (6 0.0192) 0.0094 (6 0.0041) 0.0193 (6 0.0037) 0.0190 (6 0.0043)
a Numbers of sites shared within Dipterocarpaceae are shown. Numbers of sites shared between families are different from these values.
b The minimum numbers of synonymous and nonsynonymous sites were used to calculate variances.
c Nucleotide substitutions were calculated by Kimura’s two-parameter method (Kimura, 1980). Values of synonymous sites and

nonsynonymous sites were calculated by the method of Nei and Gojobori (1986).
d Average numbers of nucleotide substitutions [d
XY of Nei (1987), p. 276] between Dipterocarpaceae and Tiliaceae.
e Numbers of net nucleotide substitutions [d of Nei (1987), p. 276] between the two major clusters of Dipterocarpaceae.
A

smaller than those within clade and between families,
suggesting stronger constraints on nonsynonymous
substitutions in the period corresponding to the diversi-
fication of the two clades. Between Dipterocarpaceae
and T. kiusiana, the average nucleotide substitutions
was 0.1277 (60.0119), and the transition/transversion
ratio was 1.55 in the total sequence, 0.2386 (60.0363)
in synonymous sites, and 0.0959 (60.0116) in nonsyn-
onymous sites (Table 2).
For the trnL-trnF IGS region and trnL intron, we
used the universal primers designed by Taberlet et al.
(1991). The nucleotide sequences obtained from Diptero-
carpaceae were easy to align, but some difficulties were
encountered when we compared Dipterocarpaceae and
Tiliaceae because nucleotide divergence was high
(0.1280). The lengths of the trnL-trnF IGS region and
trnL intron determined in this study varied from 379 to
401 bp and 458 to 509 bp, respectively. The base
composition was 0.30 (A), 0.37 (T), 0.12 (G), and 0.21 (C)
in the spacer region, and 0.40 (A), 0.27 (T), 0.17 (G), and
0.15 (C) in the intron. The spacer region included 14 bp
of the flanking coding region of trnF. Numbers of sites
shared by all sequences were 355 bp in the spacer
region and 438 bp in the intron. The average nucleotide
substitutions within family were 0.030 (60.005) in the
spacer region, and 0.024 (60.004) in the intron. There
was a 37-bp inversion in the trnL intron of Cotylelo-
bium. The nucleotide sequence of the region correspond-
ing to this inversion was conserved in all dipterocarp
species. In the calculation of nucleotide distance, we
corrected the sequence of the inversion to allow proper
alignment with other species.
Molecular Phylogeny Constructed from Combined
Data Set
Phylogenetic analyses were done using sequence
data of each region, but the confidence levels to support
the branches were not high compared to the tree from
the combined data. We show only the phylogenetic
trees obtained from the combined data set in this paper.
The maximum parsimony analysis resulted in two
equally parsimonious trees with tree length 408 (Con-
sistency Index 5 0.895). The majority rule consensus
tree of 1000 bootstrap replications is shown in Fig. 1. In
the consensus tree, we could recognize two groups of
genera: one consisted of Anisoptera, Cotylelobium,
Vatica, and Upuna, and the other consisted of Diptero-
carpus, Dryobalanops, Shorea, Parashorea, Neobalano-
carpus, and Hopea. The bootstrap probabilities for the
two groups were 98 and 82%, respectively. The topology
of the NJ tree was consistent with the parsimony tree.
The bootstrap probabilities were 99% for the Anisop-
tera to Vatica cluster, and 97% for the Dipterocarpus to
Hopea cluster.
DISCUSSION
Generic Relationships of Dipterocarpaceae
We could obtain phylogenetic trees based on nucleo-
tide sequences of the matK, trnL-trnF IGS region, and
trnL intron by the maximum parsimony method and
NJ method. The topologies of these trees were almost
identical, except for the resolution within Anisoptera-
Upuna-Cotylelobium-Vatica clade. This clade was sup-
ported by high values of bootstrap probability (98% in
Fig. 1 and 99% in Fig. 2). The monophyly of Cotylelo-
bium and Vatica was also supported relatively well
(bootstrap probability 82% in Fig. 1, and 77% in Fig. 2),
but the relationships among four genera were not well
resolved. This result might suggest that these genera
diverged in a rather short time. The close relationships
between Cotylelobium and Vatica was also reported in
Tsumura et al. (1996), but the clear segregation of these
206 KAJITA ET AL.

FIG. 1. Majority rule bootstrap consensus tree for Southeast Asian genera of Dipterocarpaceae constructed by the maximum parsimony
method based on nucleotide sequences of the matK, trnL-trnF IGS region, and trnL intron. Numbers on each branch are numbers of steps
separating each node in the tree. Numbers below branches are bootstrap values of 1000 bootstrap replicates. This tree is rooted with Tilia
kiusiana. Tree length is 418. Consistency index is 0.892 (0.749 excluding uninformative characters). Retention index is 0.839 (0.748 excluding
uninformative characters).

four genera from the remaining genera was not re-
ported because of Upuna being selected as the out-
group.
The other well-defined cluster consisted of Dipterocar-
pus, Dryobalanops, Shorea, Parashorea, Neobalanocar-
pus, and Hopea (the bootstrap probability was 82% in
Fig. 1 and 97% in Fig. 2). This clade was also recognized
by Tsumura et al. (1996). Within this clade, most
branches were supported very well (95–100%) except
for the branch supporting the monophyly of tribe
Shoreae (Dryobalanops, Shorea, Parashorea, Neobala-
nocarpus, and Hopea), of which the bootstrap probabil-
ity was not so high (62% in Fig. 1. and 63% in Fig. 2).
Tsumura et al. (1996) could not get good resolution in
two generic relationships: one was among Parashorea
and some species of Shorea, and the other among
Hopea, Neobalanocarpus, and the white meranti group
of Shorea (Shorea bracteolata in the present study). In
our present study, we could get good resolution for
these relationships. Parashorea was the sister to the
clade consisting of two Shorea species, and Hopea and
Neobalanocarpus formed a monophyletic group which
was the sister to S. bracteolata (Fig. 1 and 2). The
polyphyly of the genus Shorea suggested by Tsumura et
al. (1996) was also clearly shown in our results. The
species relationships of Shorea species and allied gen-
era will be discussed elsewhere.
Chromosome Number and Some Other Character
Evolutions
Tsumura et al. (1996) pointed out that the phyloge-
netic group consisting of Hopea, Neobalanocarpus,
Shorea, Parashorea, and Dryobalanops was character-
ized by the base chromosome number x 5 7. They
thought there were two groups in Dipterocarpaceae,
one with x 5 7 and the other with x 5 11, and the
character state x 5 7 was a derived state. However, if
the character state x 5 11 was the ancestral state, there
was no criterion to recognize the latter as a monophy-
letic group. The present data showed that there were
clearly two monophyletic groups (Figs. 1 and 2). One
group consisted of Anisoptera, Vatica, Cotylelobium,
and Upuna; all the members of this clade had the base
chromosome number x 5 11, valvate fruit calyx lobe,
and scattered resin canals. The other group consisted of
Dipterocarpus, Dryobalanops, Shorea, Parashorea, Neo-
balanocarpus, and Hopea. Most members of this clade
had the base chromosome number x 5 7, imbricate fruit
 PHYLOGENY OF DIPETROCARPACEAE IN SOUTHEAST ASIA
FIG. 2. Neighbor-joining tree based on Kimura’s distance, using Clustal W (Thompson et al., 1994). Branch lengths are proportional to the
scale given in nucleotide substitutions per site. Numbers below branches are bootstrap values based on 1000 replications. This tree is rooted
with Tilia kiusiana.
calyx lobe, and resin canals in tangential bands, but
only Dipterocarpus, which is placed at the base of this
clade, had x 5 11, valvate fruit calyx lobe, and scattered
resin canals. These results showed clearly that the
change of chromosome number, calyx lobe, and resin
canals occurred after Dipterocarpus had branched in
the latter group. Although there are many morphologi-
cal features which characterize the x 5 7 clade, no clear
characters were reported to characterize the clade
formed by Dipterocarpus and genera with the base
chromosome number x 5 7. Further morphological
studies are needed.
The differences of the base chromosome numbers,
calyx lobe, and resin canals were main criteria to divide
the Asian dipterocarp species (i.e., Dipterocarpoideae)
into two tribes: Dipterocarpeae and Shoreae. Our data
showed that the classification recognizing the two
tribes was not consistent with the phylogenetic relation-
ships, because Dipterocarpus classified into Dipterocar-
peae was a genus monophyletic with Shoreae. Neverthe-
less, our data suggest that both Dipterocarpus and
Dryobalanops diverged early from each other and from
the other Shoreae, and could be regarded as taxa of
equal standing with both the remainder of Shoreae and
the Anisoptera, Upuna, Cotylelobium, Vatica group.
Although we could not determine the phylogenetic
position of three genera of Dipterocarpeae (Stemonopo-
207
rus, Vateria, and Vateriopsis), classification of Diptero-
carpaceae should be reconsidered.
Nucleotide Substitutions of the matK Gene, trnL-trnF
IGS Region, and trnL Intron
Tsumura et al. (1996) estimated the rate of nucleotide
substitution for the chloroplast loci analyzed in their
PCR-RFLP study. They concluded that suitable genes
for phylogenetic studies in Dipterocarpaceae were rpoC,
rbcL, petB, and trnK, of which estimated nucleotide
substitutions per site were 4.21, 4.05, 6.22, and 6.83%,
respectively. The nucleotide substitutions obtained in
our study (Table 2) were lower than those of Tsumura et
al. (1996), but values obtained in PCR-RFLP studies
may have higher levels of error in estimation. Tsumura
et al. (1996) suggested that the nucleotide divergence of
the trnK gene was high; thus we chose to test useful-
ness of matK for phylogenetic analysis in Dipterocar-
paceae. In our result, the highest value of nucleotide
substitution was obtained from the synonymous sites of
matK and the lowest from nonsynonymous sites of the
same gene. If we compare the nucleotide substitutions
among genes used in this study, the average number of
nucleotide substitutions of the synonymous sites of
matK was significantly higher than those of the spacer
and the intron (P , 0.05, assuming approximate nor-
mality). The nucleotide divergence of the synonymous
208 KAJITA ET AL.
site of matK was also significantly higher than those of
the nonsynonymous site. There were no significant
differences between the spacer region and the intron,
and in other combinations. These results showed that
in Dipterocarpaceae the synonymous site of the matK
gene evolved 1.79 and 2.26 times faster than the spacer
region and intron, respectively. The slower evolution-
ary rate of the spacer region and intron might reflect
some kind of constraint on these regions.
As shown in Table 2, the ratio of the numbers of
nonsynonymous to synonymous substitutions between
the two major clades is smaller than those within
clades and between families. In order to examine the
statistical significance, we performed a test of indepen-
dence similar to that used by McDonald and Kreitman
(1991). The numbers of nonsynonymous and synony-
mous changes within clades were 57 and 29, respec-
tively. The numbers of nonsynonymous and synony-
mous substitutions between clades were 2 and 6,
respectively. The G value was 4.85, statistically signifi-
cant with a probability of P 5 0.03 with William’s
correction. This suggests that the matK gene was more
constrained in the period corresponding to the diversifi-
cation of the two clades. Various interpretations of this
result are possible, as discussed by McDonald and
Kreitman (1991). For example, population size might
be larger in this period, permitting a smaller number of
slightly deleterious substitutions (Ohta, 1992), or adap-
tive nonsynonymous substitutions might have occurred
in the other periods. Since no other sequence informa-
tion is available for the species studied here at present,
we cannot even determine whether or not synonymous
substitutions are constrained; such information is im-
portant for evaluating various hypotheses for the differ-
ence of the ratio and also for determining biological
significance of the noncoding regions where substitu-
tion rates were lower than that of the synonymous
substitution rate. Further studies using other regions
of genomes including nuclear DNA are necessary to
resolve these questions.
We may calculate the presumed date of diversifica-
tion of Dipterocarpaceae from our nucleotide sequence
data, using the rate of synonymous substitutions for
angiosperm cpDNA coding sequences, 1 3 1029–3 3
1029, reported in Wolfe et al. Sharp (1987), as was done
in the study of Rubiaceae (Manen and Natali, 1995).
The nucleotide divergence of synonymous sites of matK
between Dipterocarpaceae and Tiliaceae, and between
the two clades of Dipterocarpoideae are 0.2386
(60.0363) and 0.0763 (60.0167), respectively. Based on
these values, the date of diversification between Diptero-
carpaceae and Tiliaceae was estimated to be 119.3 to
39.8 million years ago (MYA). The diversification be-
tween the two clades of Dipterocarpoideae could be 38
to 12.7 MYA. These values are consistent with the
prediction of Ashton (1982) based on historical biogeog-
raphy including fossil evidence, who suggested that the
subfamily Dipterocarpoideae diversified in the Upper
Tertiary.
CONCLUSIONS
The species diversity of Dipterocarpaceae has been
one of the central interests among biologists who study
tropical forests. In this study, we presented phyloge-
netic trees to show the relationships among genera of
Dipterocarpaceae in Southeast Asia, where this family
has most diversified. In the phylogenetic tree based on
three regions of chloroplast DNA, most of the relation-
ships among genera were well resolved. In the most
diversified genus Shorea, paraphyly of the genus and
relationships with other allied genera were resolved.
However, only a small number of substitutions was
found between S. ovalis and S. macroptera. Molecular
markers that have higher resolution at the species level
will be necessary to study species relationships within
genus Shorea, a genus of about 193 species. In our
study, we concentrated on the Asian species excluding
the three genera of Indo-Sri Lanka region, two genera
of Africa, and two genera of South America. Relation-
ships of these other species to the Asian species are also
of interest and studies including these genera are
necessary.
ACKNOWLEDGMENTS
We thank Dr. E. Nitasaka for helpful advice on DNA experiments,
Dr. T. Kawahara for the DNA samples, and Dr. Y. Ina for providing
computer software (SEnj). We also thank Dr. P. Ashton and anony-
mous reviewers for reading the manuscript and giving valuable
comments. This research was partially supported by grants-in-aid
from the Ministry of Education, Science, and Culture of Japan to H.T.
and T.Y.
REFERENCES
Ashton, P. S. (1982). ‘‘Flora Malesiana. Series I—Spermatophyta.
Flowering Plants,’’ Vol. 9, Part 2, ‘‘Dipterocarpaceae.’’ Martinun
Nijhoff Pub, The Netherlands.
Ashton, P. S. (1988). Dipterocarp biology as a window to the under-
standing of tropical forest structure. Ann. Rev. Ecol. Syst. 19:
347–70.
Chase, M. W., Soltis, D. E., Olmstead, R. G., et al. (1993). Phylogenet-
ics of seed plants: An analysis of nucleotide sequences from the
plastid gene rbcL. Ann. Mol. Bot. Gard. 80: 528–580.
Fujii, N., Ueda, K., Watano, Y., and Shimizu, T. (1995). Intraspecific
sequence variation in chloroplast DNA of Primula cuneifolia
Ledeb. (Primulaceae). J. Phytogeogr. Taxon. 43: 15–24.
Fujii, N., Ueda, K., Watano, Y., and Shimizu, T. (1997). Intraspecific
sequence variation of chloroplast DNA in Pedicularis chamissonis
Steven (Scrophulariaceae) and geographic structuring of the Japa-
nese ‘‘alpine’’ plants. J. Plant Res. 110: 195–207.
Gielly, L., and Taberlet, P. (1994). The use of chloroplast DNA to
resolve plant phylogenies: Noncoding versus rbcL sequences. Mol.
Biol. Evol. 11(5): 769–777.
Hilu, K. H., and Liang, H. (1997). The matK gene: Sequence variation
and application in plant systematics. Am. J. Bot. 84: 830–839.
 PHYLOGENY OF DIPETROCARPACEAE IN SOUTHEAST ASIA
Ina, Y. (1994). ODEN: A program package for molecular evolutionary
analysis and database search of DNA and amino acid sequences.
CABIOS 10: 11–12.
Johnson, L. A., and Soltis, D. E. (1994). matK DNA sequences and
phylogenetic reconstruction in Saxifragaceae s. str. Syst. Bot. 19:
143–156.
Kimura, M. (1980). A simple method for estimating evolutionary
rates of base substitutions through comparative studies of nucleo-
tide sequences. J. Mol. Evol. 16: 111–120.
Londoño, A. C., Alvarez, E., Forero, E., and Morton, C. M. (1995). A
new genus and species of Dipterocarpaceae from the Neotropics. I.
Introduction, Taxonomy, ecology, and distribution. Brittonia 47:
225–236.
Manen, J. F., and Natali, A. (1995). Comparison of the evolution of
Ribulose-1,5-biphosphate carboxylase (rbcL) and atpB-rbcL noncod-
ing spacer sequences in a recent plant group, the tribe Rubieae
(Rubiaceae). J. Mol. Evol. 41: 920–927.
McDonald, J. H., and Kreitman, M. (1991). Adaptive protein evolu-
tion at the Adh locus in Drosophila. Nature 351: 652–654.
Nei, M., and Gojobori, T. (1986). Simple methods for estimating the
numbers of synonymous and nonsynonymous nucleotide substitu-
tions. Mol. Biol. Evol. 3: 418–426.
Nei, M. (1987). ‘‘Molecular Evolutionary Genetics.’’ Columbia Univer-
sity Press, NY.
Nei, M., and Jin, L. (1989). Variances of the average number of
nucleotide substitutions within and between populations. Mol.
Biol. Evol. 6: 290–300.
Neuhaus, H., and Link, G. (1987). The chloroplast tRNALys (UUU)
gene from mustard. Curr. Genet. 11: 251–257.
Ohta, T. (1992). The nearly neutral theory of molecular evolution.
Ann. Rev. Syst. Ecol. 23: 263–286.
Ooi, K., Endo, Y., Yokoyama, J., and Murakami, N. (1995). Useful
primer designs to amplify DNA fragments of the plastid gene matK
from Angiosperm plants. J. Jpn. Bot. 70: 328–331.
209
Plunkett, G. M., Soltis, D. E., and Soltis, P. S. (1997). Clarification of
the relationships between Apiaceae and Araliaceae based on matK
and rbcL sequence data. Am. J. Bot. 84(4): 565–580.
Saitou, N., and Nei, M. (1987). The neighbor-joining method: A new
method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:
406–425.
Sambrook, J., Fritsch, E. F., and Maniatis, T. (Eds.) (1989). ‘‘Molecu-
lar Cloning: A Laboratory Manual,’’ 2nd edition. Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY.
Shinozaki, K., Ohme, M., Tanaka, M., et al. (1986). The complete
nucleotide sequence of tobacco chloroplast genome: Its gene organi-
zation and expression. EMBO J. 5: 2043–2049.
Swofford, D. L. (1993). ‘‘PAUP: Phylogenetic Analysis Using Parsi-
mony,’’ Version 3.1. Illinois Natural History Survey, Champaign,
IL.
Symington, C. F. (1943). ‘‘Malayan Forest Records No. 16. Foresters’
Manual of Dipterocarps.’’ University of Malaya Press, Kuala
Lumpur. [Reprinted with plates and historical introduction]
Taberlet, P., Gielly, L., Pautou, G., and Bouvet, J. (1991). Universal
primers for amplification of three non-coding regions of chloroplast
DNA. Plant Mol. Biol. 17: 1105–1109.
Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994).
CLUSTAL-W: Improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, position-specific
gap penalties and weight matrix choice. Nucleic Acids Res. 22:
4673–4680.
Tsumura, Y., Kawahara, T., Wickneswari, R., and Yoshimura, K.
(1996). Molecular phylogeny of Dipterocarpaceae in Southeast Asia
using RFLP of PCR-amplified chloroplast genes. Theor. Appl.
Genet. 93: 22–29.
Wolfe, K. H., Li, W. H., and Sharp, P. M. (1987). Rates of nucleotide
substitution vary greatly among plant mitochondrial, chloroplast,
and nuclear DNAs. Proc. Natl. Acad. Sci. USA 84: 9054–9058.