Research Course Lab Report Zeynep Durmus

Understanding the Role of Microbiota in

Colorectal Cancer
Colorectal cancer (CRC) is defined as a malignant
tumor of intestinal epithelial cells that are characterized
by uncontrolled cell proliferation, invasiveness, and
metastasis. It is the third most common cancer
worldwide and shows increasing morbidity and
mortality among young people1-3. In the classical
genetic model, CRC develops due to the accumulation
of various critical mutations. In this model, the
adenomatous polyp is the main precursor of CRC4.
Serrated carcinomas account for about 10% of all CRC
cases5. They use an alternative pathway where serrated
tumors replace traditional adenoma and become
precursor lesions of colorectal cancer6. Molecularly, the
classical pathway is mainly governed by Adenomatous
Polyposis Coli (APC), a tumor suppressor gene,
whereas serrated pathway is driven by oncogenic
activation of KrasG12D and/or BrafV637E and/or
Pik3caH1047R 7. Although CRC is a genetic disease,
several studies suggest an association of different
microbial taxa with the initiation and progression of the
tumor8. Recent studies have shown that specific
pathogens and/or microbial communities activate
inflammatory pathways and aberrant epithelial cell
proliferation, enhance oncogenic immune responses,
induce DNA damage, and alter genomic stability,
suggesting that it plays an important role in
tumorigenesis. Furthermore, dysbiosis of the resident
gut microbiota have been shown to significantly alter
cancer risk and progression by causing abnormalities in
immune responses, among others 9-10. Moreover,
reduction of some commensal microbe-derived
metabolites such as short-chain fatty acids (SCFAs) and
tryptophan metabolites play an important role in
tumorigenesis and progression11. SCFAs have fewer
than six carbons in the aliphatic tail, exist in linear and
branched structures. Acetate (C2), propionate (C3), and
butyrate (C4) are the most abundant in the intestine.
They are a metabolic by-product of microbial
fermentation of partially and nondigestible complex
polysaccharides. The colon has the largest SCFA
content in the human gastrointestinal system, with a
molar ratio of around 60:20:20 for acetate: propionate:
butyrate (69 mmol/L, 25 mmol/L, 26 mmol/L)12-13.
SCFAs in the proximal colon are either used by
enterocytes or transported across the intestinal
epithelium into the bloodstream. SCFAs activate
cellular signaling pathways through GPCRs:
GPR41(FFAR3), GPR43 (FFAR2), GPR109A
(HCAR2) and also through OLFR78 (mouse). These
receptors are expressed in multiple tissues and cell
types in humans and animals. All three main SCFAs can
activate both GPR41 and GPR43, while GPR109A is
activated only by butyrate and niacin, and OLFR78 is
activated only by acetate and propionate14. Butyrate is
essential for colon health and gut microbial balance
since it has anti-inflammatory and anti-tumor
characteristics, and it can supply energy for intestinal
epithelial cells. Moreover, numerous studies have
demonstrated that butyrate can prevent the onset and
progression of CRC through a variety of mechanisms
such as by hyperactivating Wnt signaling pathway15-16.
Tryptophan (TRP) serves a number of physiological
purposes, many of which are connected to the control
of the immune system, brain function, gastrointestinal
nerve system, and intestinal flora. TRP is synthesized
into indole-3-acetic acid, indophenol-3-sulfate, indole-
3-propionic acid, indole-3- carboxaldehyde (ICA), and
other derivatives as part of the metabolism of the
intestinal bacteria. Many TRP metabolites have been
shown to be able to bind to and activate the aryl
hydrocarbon receptor (AhR)17-18. Human colon cancer
cell lines demonstrated that AhR activation in vitro
promotes cell proliferation, migration, and invasion via
transactivation of the EGFR/ERK signaling pathway.
Recent findings indicate AhR may be a potential CRC
treatment target by indicating that AhR and its ligands
play significant roles in the development of intestinal
tumors19.
2
Organoids are self-organized, genomically stable,
three-dimensional tissue cultures that are used to mimic
its corresponding in vivo organ in research. Organoids
are derived from stem cells – either pluripotent or adult
stem cells – from various organs. Tumor organoids
were developed from a variety of sources- clinical
samples from patients, xenograft models from patients
(PDX, cultured in mice), as well as from murine tumor
tissue 20. Organoids provide better and more accurate
insights than 2D models for many reasons: compared
to conventional two-dimensional (2D) cell cultures,
organoids resemble primary tissues in both
composition and structure. Moreover, they can be
greatly expanded, cryopreserved as biobanks, and
easily manipulated 21. In conclusion, organoids hold
Expression of SCFA and TRP receptors in low and
high grade intestinal tumors. To see how SCFA and
TRP receptors are expressed in high and low grade,
intestinal tumors expression patterns were profiled
using existing RNA-seq data. Because SCFAs are
produced in the cecum and colon, it has been suggested
that they will exclusively suppress carcinogenesis
there24. Therefore, we expect to see significant
expression patterns mostly in the colon. In duodenum,
ileum, and colon a significant increase of HCAR2
expression in the Apcfl/wt colorectal adenoma and
adenocarcinoma tissues have been observed (Figure
1.A.a-c). Interestingly, there is compelling evidence
that HCAR2 serves as a tumor suppressor in the colon
and the reduced expression of HCAR2 linked to colon
cancer23. This inconsistency could be a result of an
experimental error, but it is also interesting that the
increase can be observed in all three locations.
Therefore, the experiment needs to be repeated and the
results need to be re-evaluated for HCAR2. A
significantly reduced expression of FFAR2 (free fatty
acid receptor 2) in Apcfl/wt colorectal adenoma tissues
has been observed (Figure 1.A.d). This observation
coincides with the studies showing a protective role of
FFAR2 in colon carcinogenesis23-24. A number of
stimuli, such as butyrate or FFAR2 agonists have been
great promise for the study of tissue development,
disease modeling, drug screening, personalized
medicine, and cell therapy 22. Previous work of the lab
showed that while in specific-pathogen- free (SPF)
mice, engrafted adenoma and carcinoma organoids
grow, in germ-free (GF) mice only engrafted
carcinoma organoids grow. To further explore this
finding, microbiota metabolites and their effect on
tumor formation and progression should be
investigated. Here we used healthy, adenoma and
carcinoma organoids derived from intestinal
epithelium-specific oncogenic KrasG12D mouse model
to study the effects of designated SCFAs and TRP
derivative (Butyrate, acetate and ICA) on the cell
growth and viability of these organoids.
linked to both an increase in FFAR2 expression and
anti-proliferative effects in which this might be helpful
in cancer therapy24. The reduced expression of FFAR3
in BrafV637E adenomas and adenocarcinomas in
duodenum can be observed (Figure 1.A.e). And, there
have been conflicting results concerning FFAR3
expression in human cancer and its involvement in
carcinogenesis23. However, according to our data, the
expression pattern of FFAR3 is similar to FFAR2 and
suggests anti-proliferative effects. A significantly
reduced expression of OlRF78 in Apcfl/wt colorectal
adenoma tissues has been observed (Figure 1.A.f). And
yet, colon tumors have been shown to have higher
levels of OLFR7825. The epithelial expression of AhR
in duodenum, ileum and colon significantly increased
in adenomas and adenocarcinomas (Figure 1.B.a-c).
According to several studies, AhR is overexpressed in
colon tumor tissue26 which is in line with our
observations. Moreover, AhR expression is
significantly increased in Pik3caH1047R mutated
adenomas and adenocarcinomas. The loss of AhR was
also linked to decreased expression and/or activity of
PI3K/AKT pathway components which might be of
relevance in our cohort26.
3
Figure 1∣ Mouse SCFA (A) and TRP (B) receptor expressions in tissues derived from healthy wildtype mice or
transgenic mice with different pathological states. (A) HCAR2 expression in duodenum, ileum and colon (a-c).
(d) FFAR2 expression in the colon. (e) FFAR3 expression in duodenum. (f) OLFR78 expression in the colon. (B)
AhR expression in the duodenum, ileum and colon (a-c).

4
Effect of bacterial metabolites on cell viability. To cells have such diverse genetic and epigenetic
study the effect of 2 selected SCFAs and one backgrounds, their responses to HDAC inhibitor
tryptophan derivate (butyrate, ICA and acetate) on treatment varies as well. Therefore, this might be the
organoid cell lines, Resazurin and Cell Titer Glo (CTG) reason why we see an effect in the MT577 Duo
assay were performed. In these assays, butyrate organoid line as well. Moreover, acetate has been
treatment caused significantly less viable cells (Figure demonstrated to decrease cell viability and
2.a, b). It is known that butyrate has anti-inflammatory proliferation of colon cancer cells in vitro27. However,
and anti-tumorigenic characteristics, and it can prevent in both of the assays, acetate had no effect on cell
the onset and progression of CRC14. Therefore, we viability of colon cancer cells. This might be the result
would expect to see an effect on TM1783_T2-1 of experimental error such as the required
(adenoma) and MT577_T1-2 (adenocarcinoma) concentration of acetate may not be provided.
organoid lines. But we also see an effect in the MT577
Duo organoid line, which was derived from a healthy
Duodenum. In this case, the question remains; whether
butyrate can selectively kill tumor cells. Butyrate
regulates gene expression by inhibiting HDACs and
specifically prevents cell replication in transformed
cells (compared to healthy cells)28. And, HDAC
inhibitors have the ability to affect both normal and
malignant cells. However, because healthy and tumor

Figure 2∣Resazurin (a) and CTG (b) assays on MT577 Duo (healthy tissue), TM1783_T2-1 (adenoma) and
MT577_T1-2 (adenocarcinoma) organoid lines. Data are presented as mean ± SEM of four replicates. Viability
of cells exposed to the control was set at 100% and an asterisk indicated a significant difference from the control:
ns < 0.1234; ** p < 0.0021.
5
Butyrate inhibits proliferation in colon cells. To see
the effect of butyrate, ICA and acetate on organoid
lines morphologically, images of treated organoids
were captured under the microscope and the size of the
organoids (in diameters) was measured. As expected,
butyrate has the strongest negative effect on
proliferation compared to ICA and acetate (Figure 3.a-
c). We also see a slight positive effect of ICA and
acetate in TM1783_T2-1 (adenoma) and MT577_T1-2
(adenocarcinoma) organoid lines. However, as
mentioned before, acetate had been demonstrated to
decrease cell viability of colon cancer cells in vitro and
this positive effect on proliferation in adenocarcinoma
organoid lines is unexpected (Figure 3.c).

Figure 3 ∣ Size measurement of (a) MT577 Duo (healthy tissue), (b) TM1783_T2-1 (adenoma) and (c)
MT577_T1-2 (adenocarcinoma) organoid cell lines. All images were captured at 4X magnification. Each data
point represents mean ± SEM, for each condition 3 replicate images were captured, and 15 organoids were counted
per replicate.

Histological analysis after bacterial metabolite
treatment: To further assess the effect of bacterial
metabolites on organoids, Ki67, pERK and HE
stainings were performed (Figure 4.a-c). In the MT577
T1-2 organoid line, there was no organoid in the section
which could be due to damage caused by the needle or
loss during the embedding procedure (Figure 4.c).
MT577 Duo organoids treated with butyrate displayed
the highest number of Ki67 positive cells, which
indicates that these cells have the highest proliferation
(Figure 4.d). This finding can be expected since it’s a
healthy tissue and butyrate prevents the proliferation of
tumor cells. In TM1783 T2-1 organoids, acetate has the
highest proliferation percentage. And for MT577 T1-2
organoids, ICA and control have similar proliferation
percentage whereas butyrate and acetate have lower
compared to ICA and control. This pattern coincides
with our expectations since they are known to exert an
anti-proliferative effect on colon cancer cell.
6
7
Figure 4∣Representative microscopic images of Ki67, pERK and HEs stainings of (a) MT577 Duo (healthy
tissue) organoids (b) TM1783 T2-1 (adenoma) organoids (c) MT577 T1-2 (adenocarcinoma) organoids. Scale
bar indicates 40 µm. Ki-67: specific marker for cell proliferation. (d) Percentage of Ki67 positive cells in the
different organoid lines. (e) Total number of cells of Ki67 staining in the different organoid lines. Positive cells
indicated with black and negative cells are indicated the color of the respective treatments (gray, orange, blue,
purple).

Expression levels of cell cycle genes in metabolite
treated organoids. To see the expression levels of
certain genes which have a role in cell cycle, DNA
replication, DNA repair in treated organoid lines,
qPCR was performed (Figure 5). mCCNA1 (Cyclin
A1) and mCCNA2 (Cyclin A2) belong to the family of
highly conserved cyclins which are bound to crucial
cell cycle regulators. mCCNB1 is essential for effective
control of the cell cycle's G2/M transition phase. As
expected, in the MT577 Duo organoids, butyrate has
8
the highest expression levels in both mCCNA1,
mCCNA2, and mCCNB1, whereas their expression
levels have the lowest in MT577 T1-2 organoids.
According to this data butyrate exerts its anti-
proliferative effects on colon cancer cells and not on
healthy cells. mPcna is a cofactor of DNA polymerase
delta and helps to enhance the processivity of leading
strand synthesis during DNA replication. We would
expect to see low expression levels of mPcna in
butyrate treated MT577 T1-2 adenocarcinoma
organoids, however, mPcna showed one of the highest
expression levels in this organoid line. In the other two
organoid lines, expression level is expected with the
respective treatments. P16, also known as CDKN2A
(Cyclin Dependent Kinase Inhibitor 2A), codes for
many tumor suppressor proteins. P19, also known as
CDKN2D (Cyclin Dependent Kinase Inhibitor 2D),
acts as a cell growth regulator that controls cell cycle
G1 progression, and it prevents the activation of the
CDK kinases. As expected, the butyrate-treated
MT577 T1-2 adenocarcinoma organoids have the
highest expression level of p16, without any difference
in p19 expression levels. However, this highest
expression in butyrate might be the result of using only
one replicate. In the butyrate-treated TM1783 T2-1
adenoma organoids, p19 has the highest expression
levels which can be also expected. In the MT577 Duo
organoids, p16 and p19 expressions couldn’t be
measured although the experiment was repeated three
times.

Figure 5∣Quantitative PCR results. The changes in expression of mCCNA1, mCCNA2, mCCNB1, mPcna, p16
and p19 in MT577 Duo (healthy tissue), TM1783_T2-1 (adenoma), and MT577_T1-2 (adenocarcinoma)
organoids were normalized to Cyclophilin A. The gene expression levels were calculated using the 2-ΔΔCt method,
and the results are presented as relative fold changes. For each condition 2 replicate were used, in total 6 replicates
9
were used for repeated 3 three experiment. Data are expressed as the mean ± SEM. Samples with only one
replicate indicated with *.
Methods
Organoid culture. Cryopreserved organoid lines of
MT577 Duo (healthy tissue), TM1783_T2-1
(adenoma), MT577_T1-2 (adenocarcinoma) were
thawed and cultured in organoid culture medium
containing 50% L-WRN medium plus ROCK inhibitor
(Y-27632). Each medium was changed every 2 or 3
days. Organoids were passaged with TrypLE and 50 µL
of Matrigel was used to plate out the organoids after 4-
6 days and were split at a ratio of 1:3 to 1:5 according
to the standard culturing procedures.
Metabolite treatment. Stock solutions of butyrate
(26.4 mg in 1.2 mL media; Stock 1:100→ 200 mM in
media), ICA (8.7 mg in 1.2 mL EtOH; Stock 1:1000→
50 mM in media) and Acetate (59.06 mg in 1.2 mL
media; Stock 1:100→ 600 mM in media) were
prepared according to calculations. Organoid cell lines
treated with these metabolites, and they were plated out
according to the experimental setup (RNA isolation,
organoid fixation and embedding, size measurement,
resazurin and CTG assays) and were grown for 4 days.
After 4 days, treatments were stopped, and experiments
were done.
Organoid fixation and embedding. Organoids were
grown according to standard procedures. A round
coverslip (12 mm diameter) was inserted in each well
before plating the organoids. Organoids were plated on
top of the coverslip as a Matrigel dome. 2 full wells of
organoids were used for this procedure. Medium was
discarded and 500 µL of formalin was added to each
well and incubated for 45 min at RT. Organoids were
removed from the plate and transferred to an
embedding Bionet cassette (Cat. No. 17995,
Engelbrecht Medizin- & Labortechnik).
Histology. A ROI (at 20x magnification) from
organoid slide images for each staining was extracted
using QuPath and scale bar was added using Fiji.
Resazurin Assay. Medium was removed from each
well of the organoids. 300 µL of working Resazurin
solution (10 µg/mL) was added to each well and also to
an empty well to use as a blank. Organoids were
incubated at 37°C in a humidified atmosphere with 5%
of CO2 for 90 minutes. 80 µL was taken from each well
in duplicate, including blank, to a black 96 multi-well
plate. The plate was read at 570 nm excitation and 600
nm emission with the gain at 1800g.
Cell Titer Glo Assay. Organoids were seeded
according to the experimental protocol. Supernatant
was partly removed, and the remaining well content
was used for a 1:1 dilution of the CTG reagent under
light protected conditions (Promega, Cat# G7573). The
Matrigel dome was disrupted by pipetting up and
down. The plate was covered with tin foil and
incubated for 40 min at RT on a shaker at 100 rpm. Any
bubbles were removed carefully. The plate was
measured in ClarioStar machine using the Cell Titer
Glo program.
Organoid imaging. Organoids were observed under
the microscope (Leica Microsystems) after the
metabolite treatments and pictures were taken for each
cell line and condition at 4x using LASX software.
Quantitative real-time PCR analysis. Total RNA
from the organoid pellets was extracted using Qiagen
RNeasy Mini Kit according to the manufacturer’s
protocol. RNA concentration was quantified by
Nanodrop and stored at −80°C. cDNA was synthesized.
Quantitative real-time RT-PCR was performed using
Power SYBR™ Green PCR Master Mix (Applied
Biosystems). The mRNA expression levels of each
gene were calculated relative to Cyclophilin A
10
expression levels. The qPCR primer sequences,
templates for cDNA synthesis and qPCR,
concentrations of the RNA’s were shown in
Supplementary section.
Statistics. Two-tailed Student’s t-tests were used for
comparisons between two groups. One-way ANOVA
Discussion
Changes in the gut microbiota are linked to CRC.
However, there is currently very little information
available about whether and how changes to the gut
microbiota are directly linked to the development of
CRCs. In this study, we saw that FFAR2 expression
was reduced in adenoma tissues which confirms
its protective role in colon carcinogenesis (Figure 1.d).
Also, the epithelial expression of AhR is increased in
adenoma and adenocarcinoma tissues (Figure 1.B.a-c)
which is in line with the several studies26. However, in
HCAR2, FFAR3 and OlRF78 expressions, there had
been some inconsistencies with the published data.
Therefore, these receptors and their expression in low
and high grade tumors should be investigated more
deeply, and results should be re-evaluated. Besides
repeating the experiment, protein analysis might also
reveal more insights about this argument. To study the
effects of bacterial metabolites on organoid lines cell
viability assays after treatment were performed. We
found that butyrate diminishes the cell viability of
tumor cells but also healthy cells (Figure 2a-b). This
situation might be the result of its action as a histone
deacetylase (HDAC) inhibitor. Moreover, by
measuring the size of the treated organoids, we also
confirm that the butyrate treated adenocarcinoma
organoids have the smallest size (Figure 3). However,
we also observe this in healthy and adenoma tissues.
The effect on butyrate to normal and tumor cells should
be further investigated. We couldn’t make a conclusion
about the effect of ICA on organoid cell lines since
there was no significant effect other than in Figure 3.b.
and due to limiting amount of published data. Acetate
also diminishes the proliferation of the tumor cells but
with Tukey’s multiple comparisons test were used for
comparisons of more than 2 groups. All analyses were
using Graph Pad Prism 8 (Figs. 1-6 a-f). All data are
presented as mean ± SEM (standard error). Statistical
tests were two-tailed and P < 0.05 was considered
significant.
there was no observable effect on cell viability (Figure
2.a-b). To confirm this hypothesis, organoids were
embedded after treatment and stained to assess the
proliferation marker Ki67. We saw that in
adenocarcinoma organoids, the percentage of Ki67
positive cells were lowest in butyrate and acetate
treated organoids. There was an inconsistency in the
MT577 Duo line as previously mentioned which can be
derived from experimental error and quantification
might need to be repeated. Lastly, we saw that in
adenoma and adenocarcinoma organoids, the two
cyclin dependent kinase inhibitor genes were
upregulated. However, there are some inconsistencies
in the expression levels with the other genes in
organoid lines such as mPcna. Highest expression of
mPcna in butyrate treated MT577 T1-2
adenocarcinoma organoids might be the result of
experimental error. Moreover, the statistical test for
qPCR couldn’t be performed. Therefore, our
conclusions for this part of the experiment are not
accountable. We repeated the qPCR experiment three
times. In the first run, Ct values of the reference gene
and also the other genes were too high, indicating bad
quality of the cDNA. Due to a pipetting error, one of
the genes couldn’t be performed. Therefore, newly the
experiment was repeated with newly synthesized
cDNA. The fold expression of the genes of three runs
was compared, but the values showed a high variance
which is why all 6 replicates were visualized.
Moreover, some genes couldn’t be assessed in some
organoid cell lines, therefore there is no data available.
For troubleshooting, one of the main reasons that we
encounter so many problems for this experiment is that
the RNA quality was not good. The measured
11
concentration of RNA was good, but RNA quality was
not assessed, and some sample’s RNA concentrations
were too low to allow repetition. To fully comprehend
the processes behind the gut bacterial connection to
CRC development, more research is required.
Nevertheless, while additional mechanisms may be at
play here, our data raise the possibility that butyrate can
inhibit cell viability and the proliferation of colon
cancer cells. These results increase our knowledge of
whether and how changes in the gut microbiota
contribute to the development of CRC and provide new
possibilities for its therapy.
References
1. Sung, H. et al. Global Cancer Statistics 2020:
GLOBOCAN Estimates of Incidence and Mortality
Worldwide for 36 Cancers in 185 Countries. CA: A
Cancer Journal for Clinicians 71, 209–249 (2021).
2. Akimoto, N. et al. Rising incidence of early-onset
colorectal cancer — a call to action. Nature
Reviews Clinical Oncology (2020)
doi:10.1038/s41571-020-00445-1.
3. Wong, M. C. S. et al. Differences in Incidence and
Mortality Trends of Colorectal Cancer Worldwide
Based on Sex, Age, and Anatomic Location.
Clinical Gastroenterology and Hepatology 19,
955-966.e61 (2021).
4. Er, F. & B, V. A Genetic Model for Colorectal
Tumorigenesis. Cell
https://pubmed.ncbi.nlm.nih.gov/2188735/ (1990).
5. Pino, M. S. & Chung, D. C. The Chromosomal
Instability Pathway in Colon Cancer.
Gastroenterology 138, 2059–2072 (2010).
6. Mäkinen, M. J. Colorectal serrated
adenocarcinoma. Histopathology 50, 131–150
(2007).
7. Wong, S. H. & Yu, J. Gut microbiota in colorectal
cancer: mechanisms of action and clinical
applications. Nature Reviews Gastroenterology &
Hepatology (2019) doi:10.1038/s41575-019-0209-
8. Yachida, S. et al. Metagenomic and metabolomic
analyses reveal distinct stage-specific phenotypes
of the gut microbiota in colorectal cancer. Nature
Medicine 25, 968–976 (2019).
9. Fan, X., Jin, Y., Chen, G., Ma, X. & Zhang, L. Gut
Microbiota Dysbiosis Drives the Development of
Colorectal Cancer. Digestion 1–8 (2020)
doi:10.1159/000508328.
10. Zhang, W. et al. Gut Microbiota-Derived
Metabolites in Colorectal Cancer: The Bad and the
Challenges. Frontiers in Oncology 11, (2021).
11. Dalal, N. et al. Gut microbiota-derived metabolites
in CRC progression and causation. Journal of
Cancer Research and Clinical Oncology 147,
3141–3155 (2021).
12. van der Hee, B. & Wells, J. M. Microbial
Regulation of Host Physiology by Short-chain
Fatty Acids. Trends in Microbiology 29, 700–712
(2021).
13. Tan, J. et al. The Role of Short-Chain Fatty Acids
in Health and Disease. Advances in Immunology
121, 91–119 (2014).
14. Wu, X. et al. Effects of the intestinal microbial
metabolite butyrate on the development of
colorectal cancer. Journal of Cancer 9, 2510–2517
(2018).
15. Lazarova, D. L., Chiaro, C. & Bordonaro, M.
Butyrate induced changes in Wnt-signaling specific
gene expression in colorectal cancer cells. BMC
Research Notes 7, 226 (2014).
12
16. Bordonaro, M., Lazarova, D. L. & Sartorelli, A. C.
Butyrate and Wnt signaling: a possible solution to
the puzzle of dietary fiber and colon cancer risk?
Cell Cycle 7, 1178–1183 (2008).
17. Sun, M., Ma, N., He, T., Johnston, L. J. & Ma, X.
Tryptophan (Trp) modulates gut homeostasis via
aryl hydrocarbon receptor (AhR). Critical Reviews
in Food Science and Nutrition 60, 1760–1768
(2020).
18. Zhang, H. et al. Targeting regulation of tryptophan
metabolism for colorectal cancer therapy: a
systematic review. RSC Advances 9, 3072–3080
(2019).
19. Xie, G. & Raufman, J.-P. Role of the Aryl
Hydrocarbon Receptor in Colon Neoplasia.
Cancers 7, 1436–1446 (2015).
20. Brand-Saberi, B. Essential Current Concepts in
Stem Cell Biology. Google Books (Springer
Nature, 2020).
21. Fatehullah, A., Tan, S. H. & Barker, N. Organoids
as an in vitro model of human development and
disease. Nature Cell Biology 18, 246–254 (2016).
22. Scalise, M. et al. From Spheroids to Organoids: The
Next Generation of Model Systems of Human
Cardiac Regeneration in a Dish. International
Journal of Molecular Sciences 22, 13180 (2021).
23. Cosín-Roger, J., Ortiz-Masia, D., Barrachina, M.
D. & Calatayud, S. Metabolite Sensing GPCRs:
Promising Therapeutic Targets for Cancer
Treatment? Cells 9, 2345 (2020).
24. Sivaprakasam, S. et al. An essential role of Ffar2
(Gpr43) in dietary fibre-mediated promotion of
healthy composition of gut microbiota and
suppression of intestinal carcinogenesis.
Oncogenesis 5, e238–e238 (2016).
25. Priyadarshini, M., Kotlo, K. U., Dudeja, P. K. &
Layden, B. T. Role of Short Chain Fatty Acid
Receptors in Intestinal Physiology and
Pathophysiology. Comprehensive Physiology 8,
1091–1115 (2018).
26. Karasová, M. et al. Inhibition of Aryl Hydrocarbon
Receptor (AhR) Expression Disrupts Cell
Proliferation and Alters Energy Metabolism and
Fatty Acid Synthesis in Colon Cancer Cells.
Cancers 14, 4245 (2022).
27. Sahuri-Arisoylu, M. et al. Acetate Induces Growth
Arrest in Colon Cancer Cells Through Modulation
of Mitochondrial Function. Frontiers in Nutrition
8, (2021).
28. Li, Z. & Zhu, W.-G. Targeting Histone
Deacetylases for Cancer Therapy: From Molecular
Mechanisms to Clinical Implications. International
Journal of Biological Sciences 10, 757–770 (2014).
13
Supplementary

Supplementary Table 1. Primers for quantitative real-time PCR.

mouse CcnA1 Forward GCTGTCTCTTTACCCGGAGCA

mouse CcnA1 Reverse ACGTTCACTGGCTTGTCTTCTA
mouse CcnA2 Forward CACTGACACCTCTTGACTATCC
mouse CcnA2 Reverse CGTTCACTGGCTTGTCTTCT
mouse CcnB1 Forward TTGTGTGCCCAAGAAGATGCT
mouse CcnB1 Reverse GTACATCTCCTCATATTTGCTTGCA
mouse Pcna Forward GCAAGTGGAGAGCTTGGCA
mouse Pcna Reverse AGGCTCATTCATCTCTATGGTTAC
mouse p16 Forward CCCAACGCCCCGAACT
mouse p16 Reverse GTGAACGTTGCCCATCATCA
mouse p19 Forward TCGCAGGTTCTTGGTCACTGT
mouse p19 Reverse GAACTTCACCAAGAAAACCCTCTCT
mouse Cyclophilin A Forward ATGGTCAACCCCACCGTGT
mouse Cyclophilin A Reverse TTCTTGCTGTCTTTGGAACTTTGTC

Supplementary Table 2. cDNA synthesis template.

Manufacturer Ref# Final Concentration 1x Reaction

Applied #4374967 10x RT buffer
Biosystems 1x 10 µl
Peqlab #97062-848 MgCl2 (25mM) 5.5 mM 22 µl
Sigma #D7295 dNTP mix (2.5mM
each)* 500 µM each 20 µl
Roche #11034731001 Random hexamers
(50µM) 2.5 µM 5 µl
Applied #100021540 RNAse Inhibitor
Biosystems (20U/µl) 0.4U/µl 2 µl
Applied #4311235 Multiscribe RT
Biosystems (50U/µl) 1.25U/µl 2,5 µl
dH2O 0 µl
RNA Dilutions (1µg) 38,5 µl
TOTAL 100 µl
Master Mix 61,5µl per well

14
Supplementary Table 3. RT-PCR program overview.

RT-PCR (Thermocycler Biometra)

105°C lid
25°C 10 min
48°C 1h
95°C 5 min
12°C PAUSE

Supplementary Table 4. qRT-PCR synthesis reaction template.

Applied Biosystems, Thermo Fisher, Power SYBR Green,

#4367659
Master mix for 1 reaction
SYBR 12,5 µl
f-primer 0,25 µl
r-primer 0,25 µl
A.dest 7 µl
5µl of cDNA
Master Mix 20µl per well

Supplementary Table 5. qRT-PCR program overview.

qRT-PCR program
1 cycle 10 min 95°C

40 cycles 15 sec 95°C

1 min 60°C

1cycle 15 sec 95°C

1 min 60°C
15 sec 95°C

15
Supplementary Table 6. NanoDrop measurements of the RNA samples.

# Name Conc. Units A260/A280 A260/A230

1 Blank 0,0000 ng/ul 0,000 0,000
2 TM1783_B 33,640 ng/ul 1,801 0,556
4 TM1783_ICA 547,52 ng/ul 2,119 2,158
5 TM783_ACT 464,72 ng/ul 2,129 1,011
6 TM1783_CTR 115,36 ng/ul 2,114 0,278
7 MT577 Duo_B 204,40 ng/ul 2,108 1,469
8 MT577 Duo_ICA 251,08 ng/ul 2,116 1,276
9 MT577 Duo_ACT 173,04 ng/ul 2,124 0,347
10 MT577 Duo_CTR 293,80 ng/ul 2,109 0,630
11 MT577 T1-2_B 35,440 ng/ul 2,085 0,793
12 MT577 T1-2_ICA 399,16 ng/ul 2,112 2,122
13 MT577 T1-2_ACT 372,56 ng/ul 2,111 2,057
14 MT577 T1-2_CTR 408,88 ng/ul 2,111 2,151

16