Food Micribiology

BioMed Research International
Food Microbiology
Lead Guest Editor: Marta Laranjo
Guest Editors: María de Guía Córdoba, Teresa Lemsaddek, and Maria E. Potes
Food Microbiology
Food Microbiology
Lead Guest Editor: Marta Laranjo

Guest Editors: María de Guía Córdoba, Teresa Lemsaddek,
and Maria E. Potes
Copyright © 2019 Hindawi. All rights reserved.
This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative
Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original
work is properly cited.
Contents
Food Microbiology
Marta Laranjo , María de Guía Córdoba, Teresa Semedo-Lemsaddek, and Maria Eduarda Potes
Editorial (2 pages), Article ID 8039138, Volume 2019 (2019)
Inhibitory Effect of Lactobacillus plantarum FL75 and Leuconostoc mesenteroides FL14 against
Foodborne Pathogens in Artificially Contaminated Fermented Tomato Juices
Aïssé Bah, Helena Albano , Joana Bastos Barbosa , Imene Fhoula , Yosra Gharbi, Afef Najjari,
Abdellatif Boudabous, Paula Teixeira , and Hadda-Imene Ouzari
Research Article (11 pages), Article ID 6937837, Volume 2019 (2019)
Survival and Behavior of Encapsulated Probiotics (Lactobacillus plantarum) in Calcium-Alginate-Soy

Protein Isolate-Based Hydrogel Beads in Different Processing Conditions (pH and Temperature) and in
Pasteurized Mango Juice
Ong-Ard Praepanitchai, Athapol Noomhorm, and Anil Kumar Anal
Salmonella Infantis in Broiler Flocks in Slovenia: The Prevalence of Multidrug Resistant Strains with
High Genetic Homogeneity and Low Biofilm-Forming Ability
Mateja Pate , Jasna Mičunovič, Majda Golob , Lene Karine Vestby , and Matjaž Ocepek
Pet Food Factory Isolates of Salmonella Serotypes Do Not Demonstrate Enhanced Biofilm Formation
Compared to Serotype-Matched Clinical and Veterinary Isolates
Amreen Bashir , Ansar Azeem, Yvonne Stedman, and Anthony C. Hilton
Technological Properties of Bifidobacterial Strains Shared by Mother and Child

Angela Peirotén , Pilar Gaya, Juan Luis Arqués , Margarita Medina , and Eva Rodríguez
Improving Ethyl Acetate Production in Baijiu Manufacture by Wickerhamomyces anomalus and

Saccharomyces cerevisiae Mixed Culture Fermentations
Guangsen Fan, Chao Teng, Dai Xu, Zhilei Fu, Pengxiao Liu, Qiuhua Wu, Ran Yang, and Xiuting Li
Long-Term Storage of Vegetable Juices Treated by High Hydrostatic Pressure: Assurance of the
Microbial Safety
Justyna Nasiłowska , Barbara Sokołowska, and Monika Fonberg-Broczek
Comparative Studies of Pectinase Production by Bacillus subtilis strain Btk 27 in Submerged and
Solid-State Fermentations
Oliyad Jeilu Oumer and Dawit Abate
Microbial Assessment of Tomatoes (Lycopersicon esculentum) Sold at Some Central Markets in Ghana
Forson Akua Obeng , Pokuaa Belinda Gyasi, Michael Olu-Taiwo, and F. Patrick Ayeh-kumi
Survival of Coliform Bacteria in Virgin Olive Oil

Biagi Angelo Zullo, Lucia Maiuro, and Gino Ciafardini
Extra-Intestinal Fluoroquinolone-Resistant Escherichia coli Strains Isolated from Meat

Giorgia Caruso, Anna Giammanco, Cinzia Cardamone, Giuseppa Oliveri, Chiara Mascarella,
Giuseppina Capra, and Teresa Fasciana
Prevalence and Antimicrobial Susceptibility Profile of Salmonella Serovars Isolated from Slaughtered
Cattle in Addis Ababa, Ethiopia
Lidya Ketema, Zerihun Ketema, Bitsu Kiflu, Haile Alemayehu, Yitagele Terefe, Mohammed Ibrahim,
and Tadesse Eguale
Genetic Heterogeneity of Alicyclobacillus Strains Revealed by RFLP Analysis of vdc Region and rpoB
Gene
Agnieszka Dekowska , Jolanta Niezgoda, and Barbara Sokołowska
Characteristics of Escherichia coli Isolated from Bovine Mastitis Exposed to Subminimum Inhibitory
Concentrations of Cefalotin or Ceftazidime
Gang Liu, Laidi Ding, Bo Han , Sofie Piepers, S. Ali Naqvi , Herman W. Barkema, Tariq Ali ,
Sarne De Vliegher , Siyu Xu, and Jian Gao
Reviewing Interventions against Enterobacteriaceae in Broiler Processing: Using Old Techniques for
Meeting the New Challenges of ESBL E. coli?
Michaela Projahn , Ewa Pacholewicz, Evelyne Becker, Guido Correia-Carreira, Niels Bandick,
and Annemarie Kaesbohrer
Review Article (14 pages), Article ID 7309346, Volume 2018 (2019)
Chemical Composition and Enzymatic Screening of Micromeria fruticosa serpyllifolia Volatile Oils
Collected from Three Different Regions of West Bank, Palestine
Nihaya Salameh, Naser Shraim , and Nidal Jaradat
Duration of Heat Stress Effect on Invasiveness of L. monocytogenes Strains

Ewa Wałecka-Zacharska , Renata Gmyrek, Krzysztof Skowron , Katarzyna Kosek-Paszkowska ,
and Jacek Bania
Food-Origin Lactic Acid Bacteria May Exhibit Probiotic Properties: Review
Dorota Zielińska and Danuta Kolożyn-Krajewska
Multiplex Real-Time Polymerase Chain Reaction for Simultaneous Quantification of Salmonella spp.,
Escherichia coli, and Staphylococcus aureus in Different Food Matrices: Advantages and Disadvantages
Amanda Teixeira Sampaio Lopes, George Rêgo Albuquerque, and Bianca Mendes Maciel
Probiotics and Their Potential Preventive and Therapeutic Role for Cancer, High Serum Cholesterol,
and Allergic and HIV Diseases
Yusuf Nazir , Syed Ammar Hussain , Aidil Abdul Hamid , and Yuanda Song
Molecular Basis of Macrolide Resistance in Campylobacter Strains Isolated from Poultry in South Korea
Bai Wei and Min Kang
Prevalence, Genetic Heterogeneity, and Antibiotic Resistance Profile of Listeria spp. and Listeria
monocytogenes at Farm Level: A Highlight of ERIC- and BOX-PCR to Reveal Genetic Diversity
Lesley Maurice Bilung , Lai Sin Chai, Ahmad Syatir Tahar, Chong Kian Ted , and Kasing Apun
Hindawi
Volume 2019, Article ID 8039138, 2 pages
https://doi.org/10.1155/2019/8039138
Editorial
Food Microbiology
Marta Laranjo ,1 Mar-a de Gu-a Córdoba,2

Teresa Semedo-Lemsaddek,3 and Maria Eduarda Potes1,4
1
Instituto de Ciências Agrárias e Ambientais Mediterrânicas (ICAAM), Universidade de Évora, Pólo da Mitra, Ap. 94,
7006-554 Évora, Portugal
2
Universitary Institute for Research in Agroalimentary Resources (INURA), Escuela de Ingenierı́as Agrarias,
University of Extremadura, Avda. Adolfo Suárez s/n, 06007 Badajoz, Spain
3
CIISA – Centre for Interdisciplinary Research in Animal Health, Faculty of Veterinary Medicine, University of Lisbon,
Pólo Universitário da Ajuda, 1300-477 Lisbon, Portugal
4
Departamento de Medicina Veterinária, Escola de Ciências e Tecnologia, Universidade de Évora, Pólo da Mitra,
Ap. 94, 7006-554 Évora, Portugal
Correspondence should be addressed to Marta Laranjo; mlaranjo@uevora.pt
Received 25 March 2019; Accepted 25 March 2019; Published 4 April 2019
Copyright © 2019 Marta Laranjo et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Food microbiology comprehends the study of microorgan- their careful use in the treatment of clinical E. coli mastitis.
isms that colonise, modify, and process, or contaminate and G. Caruso and coworkers characterised the extraintestinal
spoil food. It is one of the most diverse research areas within fluoroquinolone-resistant E. coli populations isolated from
microbiology. It comprises a wide variety of microorganisms poultry, beef, and pork meat, revealing a potential zoonotic
including spoilage, probiotic, fermentative, and pathogenic risk, because meat is a source of resistant bacterial strains.
bacteria, moulds, yeasts, viruses, prions, and parasites. It deals M. Pate and colleagues evaluated the prevalence of multidrug
with foods and beverages of diverse composition, combining resistant strains of Salmonella Infantis in broiler flocks in
a broad spectrum of environmental factors, which may Slovenia and reported that Salmonella Infantis persistence
influence microbial survival and growth. on broiler farms seems to be more related to its widespread
Food microbiology includes microorganisms that have occurrence in the broiler production chain and to ineffective
beneficial or deleterious effects on food quality and safety and disinfection protocols than to its ability to form biofilm.
may therefore be of concern to public health. L. Ketema et al. studied the prevalence and antimicrobial
Among the 39 submitted manuscripts, 22 have been susceptibility profile of Salmonella serovars isolated from
selected to be part of this special issue on food microbiology slaughtered cattle in Addis Ababa, Ethiopia, and detected
in a broad sense. multidrug resistant strains that pose a major public health
This special issue includes studies dealing with antibiore- concern, implying the need for a strict biosecurity and
sistance in bacteria isolated from food products. M. Kang and regulation of antimicrobial use.
B. Wei studied the molecular basis of macrolide resistance in M. Projahn et al. reviewed interventions against Enter-
Campylobacter strains isolated from poultry in South Korea, obacteriaceae in broiler processing and concluded that none
highlighting the importance of elucidating the mechanisms of the procedures was able to totally eradicate Enterobac-
underlying resistance development during chicken growth to teriaceae from the broiler carcasses, highlighting the need
prevent and control macrolide resistance in Campylobacter. to develop intervention measures to prevent contamina-
G. Liu et al. characterised Escherichia coli isolates from tion with extended-spectrum beta-lactamase Enterobacte-
bovine mastitis exposed to cephalothin or ceftazidime and riaceae, thus avoiding the exposure of humans and the
concluded that the exposure to cephalosporins at sub-MIC further release of antibiotic resistance into the environ-
levels induced resistant E. coli and therefore recommend ment.
2 BioMed Research International
Several studies have addressed the genetic diversity lactic acid bacteria. A. Peirotén et al. evaluated the techno-
occurring in food pathogens. M. Bilung et al. studied the logical properties of bifidobacterial strains shared by mother
prevalence, genetic diversity (ERIC- and BOX-PCR), and and child and considered two strains of Bifidobacterium
antibiotic resistance profile of Listeria spp. and Listeria breve and Bifidobacterium bifidum to be good candidates
monocytogenes at the farm level and concluded that hygienic as adjunct cultures in cheeses as potential probiotics. O.-
measures are needed to reduce the spread of Listeria along A Praepanitchai and coworkers studied the survival and
the food chain. A. Dekowska and coworkers characterised behaviour of encapsulated Lactobacillus plantarum probiotics
the genetic diversity of Alicyclobacillus strains and concluded under different processing conditions in pasteurized mango
that RFLP analysis of the 16S rRNA and rpoB genes, as well juice and found out that most bacteria did not survive at tem-
as vdc region, can be used for identification and intraspecies peratures above 50∘ C nor pH values below 3. Additionally,
differentiation of Alicyclobacillus. A. Bashir et al. studied the the survival of probiotic cells was higher with hybrid hydrogel
ability of pet food factory, clinical and veterinary Salmonella beads containing alginate and soy protein.
isolates to form biofilms and reported that, although biofilm N. Salameh and colleagues studied the in vitro antilipase
formation is an important mechanism of environmental and anti-alpha-amylase effect of the volatile oils or volatile
persistence in the food manufacturing environments, there organic compounds (VOCs) of Micromeria fruticosa ssp.
is no evidence of an enhanced biofilm-producing phenotype Serpyllifolia, a plant that is consumed as an infusion in
in factory persistent strains. A. T. S. Lopes and colleagues Palestine, and reported that their phytochemicals provide
evaluated the advantages and disadvantages of using a mul- different potential biological activities. In effect, moulds
tiplex real-time PCR to quantify Salmonella spp., E. coli, produce alpha-amylases to utilise starch, and thus these
and Staphylococcus aureus in different food matrices. E. volatile oils could be used as antifungals in starchy foods, for
Walecka-Zacharska and collaborators studied the effect of they leave no taste or odour.
heat stress on the invasiveness ability of L. monocytogenes and Submitting authors come from 15 different countries, six
reported that exposure to heat stress significantly decreased European (Poland, Slovenia, Germany, Italy, UK, and Spain),
the invasiveness of L. monocytogenes strains. and nine non-European (China, Ethiopia, Malaysia, South
Food safety is affected by food processing technologies, Korea, Brazil, Palestine, Ghana, Tunisia, and Thailand).
the use of preservatives, food packaging systems, and food We are pleased to introduce this special issue, which
transportation, among other factors that modulate the food includes 22 papers on very diverse topics within food micro-
microbiome. B. A. Zullo et al. demonstrated that olive oil biology and we wish that the readers find this issue of
polar phenols can prevent the survival of coliform bacteria relevance and importance for their research.
in virgin olive oil. F. A. Obeng and coworkers evaluated the
microbiological quality of tomatoes sold at central markets in
Conflicts of Interest
Ghana and detected a high contamination levels in both spoilt
and fresh tomatoes, which might have been caused by poor The authors declare that they have no conflicts of interest.
sanitation, improper handling, or transportation from the
farms to the markets. J. Nasilowska and colleagues used high
isostatic pressure technology to assure the microbial safety of Acknowledgments
long-term stored vegetable juices. A. Bah et al. evaluated the We thank the authors of the manuscripts for their contribu-
inhibitory effect of Lactobacillus plantarum and Leuconostoc tions, as well as all the anonymous reviewers for their valuable
mesenteroides strains against foodborne pathogens in arti- participation in the evaluation process.
ficially contaminated fermented tomato juices. The tested
strains are potential starters for developing nutritious and Marta Laranjo
safe fermented tomato juice products, because they showed Marı́a de Guı́a Córdoba
high survival rates, while the numbers of pathogenic bacteria, Teresa Semedo-Lemsaddek
yeasts, and moulds decreased drastically throughout storage. Maria Eduarda Potes
Regarding the microbiology of food fermentations, O.
J. Oumer and D. Abate performed comparative studies of
pectinase production by Bacillus subtilis in submerged and
solid-state fermentations using agroresidues and reported
that the maximum pectinase production was attained using
wheat bran. G. Fan et al. improved the production of ethyl
acetate in Baijiu using mixed culture fermentations with
Wickerhamomyces anomalus and Saccharomyces cerevisiae.
Probiotics have been a hot issue in the health industry for
some years and several papers were submitted on this topic.
Y. Nazir and colleagues reviewed the potential preventive
and therapeutic role of probiotics for cancer, high serum
cholesterol, and allergic and HIV diseases as well as providing
their possible mechanisms of actions. D. Zielinska and D.
Kolozyn-Krajewska revised the probiotic properties of food
Hindawi
https://doi.org/10.1155/2019/6937837
Research Article
Inhibitory Effect of Lactobacillus plantarum FL75 and
Leuconostoc mesenteroides FL14 against Foodborne Pathogens
in Artificially Contaminated Fermented Tomato Juices
A\ssé Bah,1 Helena Albano ,2 Joana Bastos Barbosa ,2 Imene Fhoula ,1 Yosra Gharbi,1
Afef Najjari,1 Abdellatif Boudabous,1 Paula Teixeira ,2 and Hadda-Imene Ouzari 1
1
Laboratoire de Microorganismes et Biomolécules Actives (LR03ES03), Faculté des Sciences de Tunis,
Université Tunis El Manar, Campus Universitaire, 2092, Tunis, Tunisia
2
Universidade Católica Portuguesa, CBQF-Centro de Biotecnologia e Quı́mica Fina-Laboratório Associado,
Escola Superior de Biotecnologia, Rua Arquiteto Lobão Vital 172, 4200-374 Porto, Portugal
Correspondence should be addressed to Hadda-Imene Ouzari; ouzari.imene@gmail.com
Received 3 August 2018; Accepted 10 January 2019; Published 26 February 2019
Guest Editor: Marta Laranjo
Copyright © 2019 Aı̈ssé Bah et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Tomatoes and tomato based-foods contain beneficial microorganisms and various organic acids that have important nutritional
values for human. The objective of this study was to access the physiochemical properties of fermented tomatoes juices and to
evaluate the competitiveness of lactic acid bacteria (LAB) against Listeria monocytogenes, Listeria innocua, and Salmonella spp.,
in artificially contaminated tomato juice. Microbial counting (LAB, fungi Salmonella spp., and Listeria spp.) was performed after
fermentation and weekly during storage. Different organic acids (Lactic, succinic, and acetic) and ethanol were also monitored
using HPLC method. Color parameters were also determined. The results showed an increase of lactic and acetic acid content,
during fermentation and storage of juices inoculated with Lactobacillus plantarum and Leuconostoc mesenteroides at 25∘ C. Besides,
citric acid and ethanol revealed higher content at the end of storage compared to that registered at 4∘ C. The pH from tomatoes
juices decreased from an initial value of 4.5 to below 3.2. Alongside, foodborne pathogen population was significantly suppressed
in tomatoes juices when the samples were coinoculated with LAB strains. Moreover, the inhibition of Salmonella species was faster
compared to that of Listeria. After four weeks of storage at 4∘ C, Lb. plantarum and Lc. mesenteroides showed high survival rate,
while pathogenic bacteria, yeasts, and molds cell numbers decreased drastically in all the contaminated vials. This work highlights
the efficiency of Lb. plantarum and Lc. mesenteroides as potential starters for developing nutritious and safe fermented tomato juice
products.
1. Introduction (e.g., L. monocytogenes, E. coli, and Salmonella spp.) can be

part of these populations and may cause food poisoning
Tomatoes are one of the major vegetables widely used when eaten as raw product [3]. However, the matrices of
throughout the world, either in fresh or in processed fresh tomato contain autochthonous beneficial microbes
form, including canned, sun-dried tomatoes, juices, ketchup, (e.g., Lb. plantarum, Lc. mesenteroides) which may com-
mashed tomatoes, sauces, and soups [1]. Tomatoes juices pete with pathogens and ensure extended shelf life [4, 5]
are well recognized by their important nutritional values Lactobacillus plantarum as well as other LAB were widely
for human (low cholesterol, fiber and proteins, vitamins used in biopreservation of different food matrices [6]. Sugar
as well as 𝛽-carotene, potassium and lycopene, and high content in juice is favorable for microbe proliferation and
content of antioxidants) [2]. Fresh tomatoes, as well as common foodborne pathogens, which may affect the quality
grapes, lettuce, peaches, peppers, spinach, sprouts, are nat- of juice [7]. Fermentation by using LAB as starter carries
urally colonized by large microbial populations. Pathogens out acidification, [8], which leads to the decrease of pH
and production of lactic acid [9]. Besides, it improves the inoculated with the mix of Listeria and Salmonella species,
nutritional, rheological, and sensory properties of fruits [10]. separately. The procedure was detailed in Table 1. Twelve
Organic acid (lactic and acetic acid) produced may have an samples were prepared and stored at 4∘ C and 25∘ C for 30 days
antimicrobial effect, which will therefore depend upon its as described by [4].
pK value (dissociation constant) and the pH of the external The inoculated juices and control samples were analyzed
medium [11]. The low pH of most fruits and vegetables for growth and viability of strains after fermentation and at 7,
reduces spoilage microbiota, besides, it favors the growth 14, 21, and 28 days of storage. Also, physicochemical analyses
of LAB and fungi [12]. Microorganisms used as probiotics and color determination were performed.
during fermentation of fruits and vegetables are recognized
for their nutritional profile and for their health benefit [13]. 2.2. Microbiological Analyses. Viable cells were determined
However, heat treatment process (70∘ C, 10 min) destroys after each week during fermentation of tomatoes juices. One
bacteria and inactivates enzymes [14]. Lactic acid bacteria ml of tomato juice was homogenized in 9 ml of Ringer solu-
affected the organic acid production during fermentation, tion (Lab M). Juice preparation was serially diluted in Ringer
from the metabolism of sugars [15]. Most strains of Lacto- solution and counts were done on different agar media: plate
bacillus plantarum have activity against fungal and spoilage count agar (PCA) [21] was used for total counts of aerobic
microorganisms, in order to prevent adhesion, establishment, mesophilic (30∘ C for 48 h); Rose Bengal Chloramphenicol
and invasion of enteropathogens such as Salmonella and (RBC) was used for fungal and yeast (25∘ C for 5 days),
Listeria [16]. The Food and Agriculture Organization (FAO) Modified Semisolid Rappaport–Vassiliadis agar (MRSV) was
of the United Nations and the World Health Organization used for Salmonella spp. and Oxford agar for Listeria spp.
(WHO) reposed that if the Listeria count does not exceed 100 (37∘ C for 48 h) according to Stratakos et al. [22] and De Man-
CFU/g at the time of consumption, the food is acceptable [17]. Rogosa-Sharpe agar (MRS) for lactic acid bacteria (30∘ C for
The preservation of vegetables juices by probiotic strains is an 48 h–72 h).
important technique for the elaboration of bioproducts and
traditional food [18]. 2.3. Physicochemical Analyses
The objectives of this work were (i) to evaluate metabo-
lites produced during fermentation and of storage of toma- 2.3.1. Determination of pH, Carbohydrates, Organic Acids,
toes juices, (ii) perform the microbiological analysis and Ascorbic Acid, Succinic Acid, and Ethanol. The level of pH
viability of LAB used as starter, and (iii) test the antagonistic was determined during each week of fermentation by using a
activity of LAB against foodborne pathogens in artificially Crison Micro pH 2002 pH-meter (Crison, Barcelona, Spain),
contaminated vials. equipped with an In Lab 427 puncture electrode (Mettler
Toledo, Columbus, OH, USA).
2. Materials and Methods After centrifugation of tomatoes juices (8877× g, 10 min,
4∘ C; Rotina 35R, Hettich, Germany), 2 ml of the obtained
2.1. Sampling and Preparation and Fermentation of Tomato supernatants was filtered through a 0.20 𝜇m disposable
Juice. Fresh tomatoes (Lycopersicon esculentum) were pur- syringe filter. The filtrate was analyzed by high-performance
chased from local markets (Portugal) and were taken to the liquid chromatography (HPLC) equipped with a UV detector
laboratory for experimental analysis. operated at 210 nm, using a Shim-pack SCR-101H column
Tomato fruit was washed with tap water and the seeds as (7.9 mm × 30 cm). The concentrations of different com-
well as skin were removed. Then, the fruits were homogenized pounds such as fructose and glucose, nonvolatile acids (citric,
by conventional blender (Stomacher Mix CC Click Clean), lactic, and ascorbic acids), acetic acid, and ethanol were
for 8 min at room temperature. One hundred milliliters of determined. The analysis was performed at 30∘ C by using
tomato juices was distributed in 200 ml flask and 1 g of 100 mM perchloric acid as the eluent at a flow rate of
sucrose was added. The tomato juice was heated in the oven 0.6 ml/min with a sample volume of 0.02 ml. Lactic and
for 5 min at 70∘ C [4]. The starter strains (Lb. plantarum citric acids were identified by a comparison of the retention
FL75 and Lc. mesenteroides FL14) used were isolated from time of an authentic standard corresponding to each acid.
spontaneous fermentation of tomatoes fruits (of Laboratory The concentration was determined using a calibration curve
Microorganisms and Active Biomolecules “LMBA,” Tunisia). obtained by different standard concentrations of each sample
The protocol for processing and storage of tomatoes juices is in the same conditions used for sample analysis. The assay was
described in Table 1. Lactobacillus plantarum FL75 and Lc. performed in duplicate according to Ferrari et al. and Barbosa
mesenteroides FL14 were mixed and inoculated as starter (4% et al. [23, 24].
v/v) in tomatoes juices leading to an initial cell number of 1011
and 109 CFU/ml, respectively. 2.3.2. Color Measurements. The color measurements were
Also, juice samples were inoculated with pathogens performed to each sample each week during fermentation of
including a mix of S. Typhimurium ATCC 14028, S. Enteridi- tomatoes juices. The measurements were performed in the
tis ATCC 13076, S. Braenderup H9812 [19] or a mix of CIE (Commission Internationale de L’Eclairage) Lab color
L. innocua 2030C (culture collection of Escola Superior de scale, using a Konica Minolta CR-300 Chroma Meter (Konica
Biotecnologia ESB) and L. monocytogenes L7946 [20] at a Minolta, Tokyo, Japan) colorimeter. The analysis consists in
final concentration of 106 CFU/ml. Control samples were only an evaluation of the color parameters L∗, a∗, and b∗. L∗ value
BioMed Research International 3
Table 1: Different treatment of tomatoes juices.
Samples Code
1. Non inoculated juice Control
2. Juices inoculated with Lb. plantarum Lb. plantarum
3. Juices inoculated with Lc. Mesenteroides Lc. mesenteroides
4. Juices inoculated with Lb. plantarum and Lc. mesenteroides Lb. plantarum+ Lc. mesenteroides
5. Juices inoculated with Mix of Salmonella species and Lb. plantarum Salmonella+ Lb. plantarum
6. Juices inoculated with Salmonella species and Lc. mesenteroides Salmonella + Lc. mesenteroides
7. Juices inoculated with Salmonella species, Lb. plantarum and Lc. Mesenteroides Salmonella+ Lb. plantarum+ Lc. mesenteroides
8. Juices inoculated with Mix of Salmonella species Salmonella
9. Juices inoculated with Mix of Listeria species Listeria
10. Juices inoculated with Listeria species and Lb. plantarum Listeria+ Lb. plantarum
11. Juices inoculated with Listeria species and Le. mesenteroides Listeria+ Lc. mesenteroides
12. Juices inoculated with Listeria species, Lb. plantarum and Lc. mesenteroides Listeria+ Lb. plantarum+ Lc. mesenteroides
measures the lightness of the sample, ranging from 0 (black) with Lb. plantarum FL75 and Lc. Mesenteroides FL14, the cell
to 100 (white), a∗ varies between red (+a∗) and green (-a∗), density of spoilage yeasts and molds was markedly lower than
and b∗ varies between yellow (+b∗) and blue (-b∗) color that found frequently in samples subjected to spontaneous
space. Three color measurements were performed for each fermentation (control), indicating the antifungal action of
sample. The chroma value was calculated, which indicates the LAB used as starter. These findings are similar to other
color intensity and saturation (Chroma= (a∗2 + b∗2) e1/2) studies conducted either for fermented foods [30] or for
and the hue angle, which measures the highlights, midtones, food preservation [31, 32]. Antilisterial activity by LAB (Lb.
and shadows (Hue angle=tan-1(b∗/a∗) [25]. plantarum and Lc. mesenteroides) coinoculated in tomatoes
juices was detected by diminishing the growth rate of Listeria
3. Results and Discussion at the end of fermentation and its total inhibition after one
week of storage conditions (Figure 2). This behavior was also
3.1. Microbiological Analysis. Cell counts of LAB ranged observed when Lb. plantarum was inoculated alone, with the
between 108 and 1011 CFU/ml during the fermentation (Fig- difference that total inhibition of Listeria was obtained after
ure 1). Moreover, LAB counts of tomatoes juices inoculated two weeks of storage at 4∘ C. However, when tomatoes juices
with strains of Lc. mesenteroides and Lb. plantarum remain were inoculated with Lc. mesenteroides, total inhibition was
high during the first weeks until 21 days of storage. The result observed only for storage conditions of 25∘ C, after two weeks.
was similar to that obtained by Mousavi et al. [26]. Cell Such difference in viability upon storage temperature may be
viability obtained at the beginning of fermentation in the due to the reduced growth rate and secondary metabolites
tomatoes juice inoculated with LAB was higher compared to release at 4∘ C. Besides, total inhibition of Listeria was not
the control sample. observed for the control samples. It was only reduced to 2.1
Fast growth of lactic acid bacteria in tomatoes juices CFU/ml at 25∘ C. The obtained results highlight the impor-
showed to be advantageous, because there was production tance of use and selection of starters and the effectiveness of
of organic acid, resulting in rapid fermentation periods. Lb. plantarum compared to Lc. mesenteroides in inhibiting
As indicated by Pereira et al. [27], tomato juice inoculated Listeria population. As it was previously reported by Alves
with Lb. plantarum and Lc. mesenteroides has showed high et al. and Albano et al. [33, 34], antilisterial activity was due
production of organic acids compared to the control samples to the effect of LAB, which showed high viability rate after
in both conditions. Lactic acid and low pH in juices influence fermentation and during storage (Figure 2).
the viability of LAB at the end of storage in fermented Similarly, monitoring of Salmonella viability in contam-
tomato juice samples at 4 and 25∘ C. This result confirms the inated tomato juice revealed that when LAB count was
metabolism effect of the Lb. plantarum and Lc. mesenteroides increased, the cell counts of Salmonella were reduced after
used as starter for tomatoes juices acidification. Higher pH storage at 4 and 25∘ C for 28 days. In control samples,
values in the control samples could be due to the occur- Salmonella counts were also decreased progressively during
rence of autochthonous lactobacilli with low acidifying effect storage at 4∘ C and slightly differ from which observed in
power. In addition, high pH value of the control samples samples kept at 25∘ C (Figure 3), suggesting the involvement
could be due to the superficial development of molds which of various antimicrobial compounds (acetic and lactic acid,
lead to the loss of acidification and deaminase activities as hydrogen peroxide (H2 O2 ), and bacteriocin). This result was
also reported by Merchesini et al. or Sunesen and Stahnke in accordance with those obtained by Li et al. [35], showing an
[28, 29]. The number of yeasts and molds was increased antagonistic effect by LAB against Salmonella. These findings
gradually from day 14 of fermentation for both inoculated confirm the observations obtained by Fazeli et al.; Brillet et
and control tomato juices. However, in the juices inoculated al.; and Budde et al. [36–38], which suggested that application
12 12
10 10
LAB Counts log (Cfu/ml) at 25∘ C

LAB Counts log (Cfu/ml) at +4∘ C
8 8
6 6
4 4
2 2
0 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Time (days) Time (days)
Control Control
Lb. plantarum Lb. plantarum
Lc.mesenteroides Lc.mesenteroides
Lb. plantarum+ Lc.mesenteroides Lb. plantarum+ Lc.mesenteroides
(a) (b)
Figure 1: The growth of LAB in tomatoes juices after 24 h of fermentation and during storage at 4∘ C (a) and 25∘ C (b).
1
Listeria Counts log(N/N0) at 4 ∘ C
0
Listeria Counts log(N/N0) at 25∘ C
0 0 5 10 15 20 25 30
−1 0 5 10 15 20 25 30 −1
−2 −2
−3 −3
−4 −4
−5
−5
−6
−6
−7
−8 −7
Time (days) −8
Time (days)
Listeria
Listeria
Lb.plantarum +Listeria
Lb.plantarum +Listeria
Lc. mesenteroides +Listeria Lc. mesenteroides +Listeria
Lb.plantarum+ Lc. mesenteroides +Listeria Lb.plantarum+ Lc. mesenteroides +Listeria
(a) (b)
Figure 2: Logarithmic reduction of Listeria species by LAB in tomatoes juices after 24 h of fermentation and during storage at 4∘ C (a) and
25∘ C (b). The control used corresponds to Listeria(black square with solid line), Lb.plantarum+ Listeria(gray circle with dashed line), Lc.
mesenteroides+ Listeria(empty triangle with dashed line), and Lb.plantarum+ Lc. mesenteroides +Listeria(asterisk with dashed line). The gray
lines mean that the isolate was reduced to values below the detection limit of the enumeration technique.
of selected LAB as starter cultures allowed fast growth rate in and 3.4 after 28 days, while the control sample revealed
the fermented products at different temperatures. LAB counts a slightly higher pH compared to the inoculated samples.
increased rapidly at the beginning of fermentation, allowing The pH of tomatoes juices inoculated with Lb. plantarum
the pH decrease, due to the metabolic activity of LAB which FL75 varied from 4.2 to 3.38 after 14 days of storage at 4∘ C,
inhibit pathogens. with a slight increase until 3.55 after 21 days. This finding
is in agreement with similar studies reported by Georgieva
3.2. Physicochemical Analyses. The results showed that the et al. [39]. High pH values in the control samples and all
evolution of pH in tomatoes juices was similar in both storage samples inoculated after 14 days of storage could be due to
conditions at 4∘ C and 25∘ C (Figure 4). The pH was decreased the occurrence of molds. Moreover, the coinoculated samples
progressively from initial value 4.2 to about 3.6, after 7 days with Lb. plantarum FL75 and Lc. mesenteroides FL14 showed
Salmonella Counts log(N/N0) at 25 C

0
Salmonella Counts log(N/N0) at 4 ∘ C
∘
1 0 5 10 15 20 25 30
−1
0
−1 0 5 10 15 20 25 30 −2
−2 −3
−3
−4 −4
−5 −5
−6
−7 −6
−8 −7
Salmonella Salmonella
Lb.plantarum +Listeria Lb.plantarum +Salmonella
Lc. mesenteroides +Listeria Lc. mesenteroides +Salmonella
Lb.plantarum+ Lc. mesenteroides +Salmonella Lb.plantarum+ Lc. mesenteroides +Salmonella
(a) (b)
Figure 3: Logarithmic reduction of Salmonella species by LAB in tomatoes juices after 24 h of fermentation and during storage at 4∘ C (a)
and 25∘ C (b). The control used corresponds to Salmonella(black diamond with solid line), Lb.plantarum+ Salmonella(empty square with
dashed line), Lc. mesenteroides+ Salmonella(empty triangle with dashed line), and Lb. plantarum+ Lc. mesenteroides + Salmonella(asterisk
with dashed line). The gray lines mean that the isolate was reduced to values below the detection limit of the enumeration technique.
5,0 5,0
4,8 4,8
4,6 4,6
4,4 4,4
4,2 4,2
PH at+4∘ C
PH at 25∘ C
4,0 4,0
3,8 3,8
3,6 3,6
3,4 3,4
3,2 3,2
3,0 3,0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Control Control
Lb. plantarum Lb.plantarum
Lc. mesenteroides Lc. Mesenteroides
Lb. plantarum+ Lc. mesenteroides Lb. plantarum+ Lc. Mesenteroides
(a) (b)
Figure 4: pH variation monitoring in tomatoes juices after 24 h of fermentation and during storage at 4∘ C (a) and 25∘ C (b).
a lower pH in all the analyzed samples. Accumulation of The degradation of ascorbic, succinic, and citric acid
organic acids confirmed the strong acidifying activity of LAB was greater rapidly during storage at 25∘ C compared to 4∘ C
used as starter, which is in concordance with those obtained (Figures 5 and 6). This is due to the use of citric, succinic, and
by Di Cagno et al. [10]. ascorbic acid by LAB as energy source during storage.
The concentrations of citric acid, L-ascorbic acid, and However, the concentrations of ethanol were increased
succinic acid were decreased in all tomatoes juices subjected with a maximum at day 14 in both storage temperatures
to spontaneous fermentation and starter-fermented toma- followed by a slight decrease (Figure 7). The concentrations
toes juice (Figures 5 and 6). The L-ascorbic acid content of ethanol were increased in tomatoes juices inoculated
diminished from 176 mg/l to 46.43 mg/l. Besides succinic acid with Lb. plantarum FL75 and Lc. mesenteroides FL14 at the
content ranged to 2.7g/l and to 1.12 g/l in tomatoes juices end during storage of 25∘ C, which suggests that the inoc-
inoculated with Lc. mesenteroides FL14 during storage at 4∘ C, ulated LAB were totally responsible for ethanol production
which is in concordance with Hernández et al. [40]. [41, 42]. Heating of tomatoes juices before starter cultures
5
5
4
4
Citric acid (g/l) at 25∘ C

Citric acid (g/l) at +4∘ C
3
3
2 2
1 1
0 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Control Control
Lc.mesenteroides Lc. mesenteroides
Lb. plantarum+ Lc.mesenteroides Lb. plantarum+ Lc. mesenteroides
(a) (b)
Figure 5: Citric acid quantification in tomatoes juices after 24 h of fermentation and during storage at 4∘ C (a) and 25∘ C (b).
3, 0
3, 0
2, 5
2, 5
Succinic acid (g/l) at 25∘ C
Succinic acid (g/l) at +4∘ C
2, 0
2, 0
1, 5
1, 5
1, 0 1, 0
0, 5 0, 5
0, 0 0, 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Control Control
Lc. mesenteroides Lc. mesenteroides
Lb. plantarum+ Lc. mesenteroides Lb. plantarum+ Lc.mesenteroides
(a) (b)
Figure 6: Evolution of Succinic acid amount after 24 h of fermentation and during storage at 4∘ C (a) and 25∘ C (b).
inoculation decreases the load of foodborne pathogenic (very good carbon and energy source) and even on the
bacteria and promotes the growth and proliferation of lactic fermentation time, which explained the reduction of car-
acid bacteria during fermentation and storage, leading to bohydrates (glucose and fructose) in tomatoes juices stored
the production of healthy and nutritional tomatoes juices, at 4∘ C and 25∘ C. This result is in agreement with those
which verify the properties probiotic beverages [43]. The of Reddy et al. [44], obtained for mango juice fermenta-
growth of LAB depends on the substrate such as glucose tion.
12 12
10 10
Ethanol (g/l) at +4∘ C
Ethanol (g/l) at 25∘ C

8 8
6 6
4 4
2 2
0 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Control Control
Lb. plantarum+ Lc. mesenteroides Lb. plantarum+ Lc. mesenteroides
(a) (b)
Figure 7: Production of bioethanol in tomatoes juices after 24 h of fermentation and during storage at 4∘ C (a) and 25∘ C (b).
6
6
5
5
Acetic acid (g/l) at +4∘ C
4 4
Acetic acid (g/l) at 25∘ C
3 3
2 2
1 1
0
0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Control Control
Lb. plantarum+ Lc. mesenteroides Lb. plantarum+ Lc. mesenteroides
(a) (b)
Figure 8: Acetic acid content in tomatoes juices after 24 h of fermentation and during storage at 4∘ C (a) and 25∘ C (b).
Besides, organics acids were determined to evaluate their final product due to the activity of lipases. However, higher
content variation upon LAB starter use in the tomatoes juices content was noticed for samples inoculated with Lb. plan-
and control sample during fermentation and storage. Organic tarum compared to those inoculated with Lc. mesenteroides
acid such as lactic and acetic acids has shown high amount in (Figure 9). Higher amount of acids was also registered for
tomatoes juices inoculated with LAB starter compared to the juice samples inoculated with LAB and stored at 25∘ C than
control sample (Figure 8), which can affect the flavor of the juices stored at 4∘ C. These results are in agreement with
25
25
20
20
Lactic acid (g/l) at 25∘ C

Lactic acid (g/l) at +4∘ C
15
15
10
10
5
5
0
0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Control Control
Lb. plantarum + Lc. mesenteroides Lb. plantarum + Lc. mesenteroides
(a) (b)
Figure 9: Concentration of lactic acid in tomatoes juices after 24 h of fermentation and during storage at 4∘ C (a) and 25∘ C (b).
60
60 50
Color of tomatoes juices at 25∘ C
50 40
Color of tomatoes juices at +4∘ C
40
30
30
20
20
10
10
0
0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Control
Control
Lb. plantarum + Lc. mesenteroides Lb. plantarum + Lc. mesenteroides
(a) (b)
Figure 10: Color component of tomatoes juices.

Kohajdova et al. and Perez et al. [21, 45], which reported the NCBI (https://www.ncbi.nlm.nih.gov/genbank/), Lactobacil-
production of organic acids by Lb. plantarum in vegetables lus plantarum FL75 MH037134; Leuconostoc mesenteroides
juices. FL14 MH037132.
Fruit acidity and sweetness are among the major factors
determining the quality of tomatoes juices, by decreasing the Conflicts of Interest
pH during fermentation and storage, which correlated with
the high quantity of organic acids [46]. The authors declare that there are no conflicts of interest
As indicated by Essid et al. [30], the acidifying activities regarding the publication of this paper.
of Lb. plantarum in vivo were demonstrated by inhibition
of spoilage microorganism of Listeria and Salmonella in the
inoculated tomatoes juices compared to the control samples.
Acknowledgments
The antimicrobial activity is translated by the undissociated The authors thank for the financial support the Tunisian
form of the acid which can cross the microbial membrane and Ministry of Higher Education and Scientific research in
inhibit pathogenic bacteria such as Salmonella, Listeria, and the ambit of the laboratory Project LR03ES03. This work
the spoilage molds. According to the Henderson-Hasselbalch was scientifically supported by National Funds from the
equation [47] the antimicrobial activity is effective when Fundação para a Ciência e a Tecnologia (FCT) through
the amounts of acetic acid and lactic acid have reached 0- Project UID/Multi/50016/2013 and through Project “Bio-
22 mg/g and 1-68 mg/g, respectively. Strong accumulation of logical tools for adding and defending value in key agro-
lactic and acetic acids in tomatoes juices suggests antimi- food chains (bio – n2 – value),” n∘ NORTE-01-0145-FEDER-
crobial activity against Salmonella, Listeria, and spoilage 000030, funded by Fundo Europeu de Desenvolvimento
molds, in vivo. Moreover, in accordance with Jankuloski Regional (FEDER), under Programa Operacional Regional
et al. [48], pathogenic bacteria and the spoilage molds do Norte-Norte2020.”
were decreased after 14 days of storage at 4∘ C and 25∘ C,
due of the effect of acetic and lactic acids in all tomatoes
juices. Supplementary Materials
Red color of tomatoes juices is related to the concentra- The result of Biolog phenotypic microarray analysis data used
tion of its pigments (carotenoids and lycopen) and is one to support the findings of this study are included within the
of the organoleptic properties often evaluated. Ours results supplementary information file. (Supplementary Materials)
indicated intense color development in tomato juices inoc-
ulated by LAB compared to the control samples (Figure 10).
Moreover, juices samples inoculated only with Lb. plantarum References
or the mixed of Lb. plantarum and Lc. mesenteroides showed
[1] H. D. Sesso, J. E. Buring, E. P. Norkus, and J. M. Gaziano,
higher color intensity than those inoculated only by Lc. “Plasma lycopene, other carotenoids, and retinol and the risk of
mesenteroides, particularly after ten days of storage. These cardiovascular disease in women,” American Journal of Clinical
results are in agreement with those of Gould et al. [49], Nutrition, vol. 79, no. 1, pp. 47–53, 2004.
reporting the variation of color during storage of tomato [2] J. Shi and M. Le Maguer, “Lycopene in tomatoes: chemical
juice. and physical properties affected by food processing,” Critical
Reviews in Food Science and Nutrition, vol. 40, no. 1, pp. 1–42,
2000.
4. Conclusion [3] J. W. Leff and N. Fierer, “Bacterial communities associated with
the surfaces of fresh fruits and vegetables,” PLoS ONE, vol. 8, no.
The results of this study highlight the effectiveness of LAB 3, Article ID e59310, pp. 1–9, 2013.
starter in inhibiting foodborne pathogens of Listeria spp.
[4] R. Di Cagno, R. F. Surico, A. Paradiso et al., “Effect of
and Salmonella spp. species during fermentation and storage autochthonous lactic acid bacteria starters on health-promoting
of fermented tomatoes juices. Lb. plantarum associated or and sensory properties of tomato juices,” International Journal
not with Lc. mesenteroides have shown high viability in the of Food Microbiology, vol. 128, no. 3, pp. 473–483, 2009.
tomato matrix and has exhibited high level of organic acids, [5] K. Pingulkar, A. Kamat, and D. Bongirwar, “Microbiological
ethanol, and color development. The selected LAB starter has quality of fresh leafy vegetables, salad components and ready-
proven efficiency in the development and biopreservation of to-eat salads: An evidence of inhibition of Listeria monocyto-
dietetical and safe functional food with important shelf life at genes in tomatoes,” International Journal of Food Sciences and
both room and refrigerated temperatures. Nutrition, vol. 52, no. 1, pp. 15–23, 2001.
[6] R. Di Cagno, G. Minervini, E. Sgarbi et al., “Comparison of
phenotypic (Biolog System) and genotypic (random amplified
Data Availability polymorphic DNA-polymerase chain reaction, RAPD-PCR,
and amplified fragment length polymorphism, AFLP) methods
The data used to support the findings of this study are for typing Lactobacillus plantarum isolates from raw vegetables
available from the corresponding author upon request. The and fruits,” International Journal of Food Microbiology, vol. 143,
nucleotide sequences data used to support the findings of no. 3, pp. 246–253, 2010.
this study are publicly available in the GenBank repos- [7] S. Pao, W. W. Widmer, and P. D. Petracek, “Effects of cutting on
itory at National Center for Biotechnology Information Juice leakage, microbiological stability and bitter substances of
peeled citrus,” Lebensmittel-Wissenschaft und –Technologie, vol. juice using a novel continuous microwave system,” Food Chem-
30, no. 7, pp. 670–675, 1997. istry, vol. 190, pp. 1–24, 2016.
[8] N. J. Gardner, T. Savard, P. Obermeier, G. Caldwell, and C. P. [23] I. D. S. Ferrari, J. V. de Souza, C. L. Ramos, M. M. da Costa,
Champagne, “Selection and characterization of mixed starter R. F. Schwan, and F. S. Dias, “Selection of autochthonous lactic
cultures for lactic acid fermentation of carrot, cabbage, beet acid bacteria from goat dairies and their addition to evaluate
and onion vegetable mixtures,” International Journal of Food the inhibition of Salmonella typhi in artisanal cheese,” Food
Microbiology, vol. 64, no. 3, pp. 261–275, 2001. Microbiology, vol. 60, pp. 1–35, 2016.
[9] P. Teixeira, H. Castro, and R. Kirby, “Spray drying as a method [24] J. Barbosa, S. Borges, and P. Teixeira, “Effect of different
for preparing concentrated cultures of Lactobacillus bulgari- conditions of growth and storage on the cell counts of two lactic
cus,” Journal of Applied Bacteriology, vol. 70, no. 4, pp. 456–462, acid bacteria after spray drying in orange juice,” Beverages, vol.
1995. 8, pp. 2–12, 2016.
[10] R. Di Cagno, G. Cardinali, G. Minervini et al., “Taxonomic [25] J. Barbosa, S. Borges, M. Amorim et al., “Comparison of spray
structure of the yeasts and lactic acid bacteria microbiota of drying, freeze drying and convective hot air drying for the
pineapple (Ananas comosus L. Merr.) and use of autochthonous production of a probiotic orange powder,” Journal of Functional
starters for minimally processing,” Food Microbiology, vol. 27, Foods, vol. 17, pp. 340–351, 2015.
no. 3, pp. 381–389, 2010. [26] Z. E. Mousavi, S. M. Mousavi, S. H. Razavi, Z. Emam-Djomeh,
[11] M. R. Adams and C. J. Hall, “Growth inhibition of food- and H. Kiani, “Fermentation of pomegranate juice by probiotic
borne pathogens by lactic and acetic acids and their mixtures,” lactic acid bacteria,” World Journal of Microbiology and Biotech-
International Journal of Food Science & Technology, vol. 23, pp. nology, vol. 27, no. 1, pp. 123–128, 2011.
287–292, 1988. [27] A. L. F. Pereira, T. C. Maciel, and S. Rodrigues, “Probiotic
[12] C. S. Andrés, L. Giannuzzi, and N. E. Zaritzky, “The effect of beverage from cashew apple juice fermented with Lactobacillus
temperature on microbial growth in apple cubes packed in film casei,” Food Research International, vol. 44, no. 5, pp. 1276–1283,
and preserved by use of orange juice,” International Journal of 2011.
Food Science & Technology, vol. 39, pp. 927–933, 2004. [28] B. Marchesini, A. Bruttin, N. Romailler, R. S. Moreton, C. Stuc-
[13] J. Koh, Y. Kim, and J. Oh, “Chemical characterization of tomato chi, and T. Sozzi, “Microbiological events during commercial
juice fermented with bifidobacteria,” Journal of Food Science, meat fermentations,” Journal of Applied Bacteriology, vol. 73, no.
vol. 75, no. 5, pp. C428–C432, 2010. 3, pp. 203–209, 1992.
[14] H. Vega-Mercado, O. Martin-Belloso, B. L. Qin et al., “Non- [29] L. O. Sunesen and L. H. Stahnke, “Mould starter cultures for dry
thermal food preservation: Pulsed electric fields,” Trends in sausages—selection, application and effects,” Meat Science, vol.
Food Science & Technology, vol. 8, pp. 151–157, 1997. 65, no. 3, pp. 935–948, 2003.
[15] R. F. McFeeters, “Fermentation microorganisms and flavor [30] I. Essid and M. Hassouna, “Effect of inoculation of selected
changes in fermented foods,” Journal of Food Science, vol. 69, Staphylococcus xylosus and Lactobacillus plantarum strains on
no. 1, pp. FMS35–FMS37, 2004. biochemical, microbiological and textural characteristics of a
[16] A. L. Servin, “Antagonistic activities of lactobacilli and bifi- Tunisian dry fermented sausage,” Food Control, vol. 32, no. 2,
dobacteria against microbial pathogens,” FEMS Microbiology pp. 707–714, 2013.
Reviews, vol. 28, no. 4, pp. 405–440, 2004. [31] S. Crowley, J. Mahony, and D. Van Sinderen, “Comparative
[17] E. A. Szabo, L. Simons, M. J. Coventry, and M. B. Cole, analysis of two antifungal Lactobacillus plantarum isolates
“Assessment of control measures to achieve a food safety and their application as bioprotectants in refrigerated foods,”
objective of less than 100 CFU of Listeria monocytogenes per Journal of Applied Microbiology, vol. 113, no. 6, pp. 1417–1427,
gram at the point of consumption for fresh precut iceberg 2012.
lettuce,” Journal of Food Protection, vol. 66, no. 2, pp. 256–264, [32] W. Lan, Y. Chen, H. Wu, and F. Yanagida, “Bio-protective
2003. potential of lactic acid bacteria isolated from fermented wax
[18] J. Karovicova and Z. Kohajdova, “Lactic acid fermented veg- gourd,” Folia Microbiologica, vol. 57, no. 2, pp. 99–105, 2012.
etable juices,” Horticultural Science - Prague, vol. 30, pp. 152–158, [33] V. F. Alves, R. C. R. Martinez, M. A. S. Lavrador, and E. C. P. De
2003. Martinis, “Antilisterial activity of lactic acid bacteria inoculated
[19] J. McLauchlin, M. Hampton, S. Shah, E. Threlfall, A. Wieneke, on cooked ham,” Meat Science, vol. 74, no. 4, pp. 623–627, 2006.
and G. Curtis, “Subtyping of Listeria monocytogenes on the [34] H. Albano, M. Oliveira, R. Aroso, N. Cubero, T. Hogg, and
basis of plasmid profiles and arsenic and cadmium susceptibil- P. Teixeira, “Antilisterial activity of lactic acid bacteria isolated
ity,” Journal of Applied Microbiology, vol. 83, no. 3, pp. 381–388, from “Alheiras” (traditional Portuguese fermented sausages):
1997. In situ assays,” Meat Science, vol. 76, no. 4, pp. 796–800, 2007.
[20] S. B. Hunter, P. Vauterin, M. A. Lambert-Fair et al., “Establish- [35] D. Li, K. Ni, H. Pang, Y. Wang, Y. Cai, and Q. Jin, “Identification
ment of a universal size standard strain for use with the pulsenet and antimicrobial activity detection of lactic acid bacteria
standardized pulsed-field gel electrophoresis protocols: Con- isolated from corn stover silage,” Asian-Australasian Journal of
verting the national databases to the new size standard,” Journal Animal Sciences, vol. 28, no. 5, pp. 620–631, 2015.
of Clinical Microbiology, vol. 43, no. 3, pp. 1045–1050, 2005. [36] M. R. Fazeli, N. Amirmozafari, R. G. nejad, and H. Jamal-
[21] M. Perez and F. Saguir, “Transfer and subsequent growth and ifar, “Antagonistic Action of Watermelon Juice Probioticated
metabolism of Lactobacillus plantarum in orange juice medium Using Different Strains of Lactobacilli against Salmonella
during storage at 4 and 30∘C,” Letters in Applied Microbiology, typhimurium,” Iranian Journal of Public Health, vol. 36, pp. 70–
vol. 54, no. 5, pp. 398–403, 2012. 73, 2007.
[22] A. C. Stratakos, G. Delgado-Pando, M. Linton, M. F. Patterson, [37] A. Brillet, M.-F. Pilet, H. Prevost, M. Cardinal, and F. Leroi,
and A. Koidis, “Industrial scale microwave processing of tomato “Effect of inoculation of Carnobacterium divergens V41, a
biopreservative strain against Listeria monocytogenes risk, on

the microbiological, chemical and sensory quality of cold-
smoked salmon,” International Journal of Food Microbiology,
vol. 104, no. 3, pp. 309–324, 2005.
[38] B. B. Budde, T. Hornbæk, T. Jacobsen, V. Barkholt, and A.
G. Koch, “Leuconostoc carnosum 4010 has the potential for
use as a protective culture for vacuum-packed meats: Cul-
ture isolation, bacteriocin identification, and meat application
experiments,” International Journal of Food Microbiology, vol.
83, no. 2, pp. 171–184, 2003.
[39] R. Georgieva, P. Koleva, D. Nikolova, D. Yankov, and S. Danova,
“Growth parameters of probiotic strain lactobacillus plan-
tarum, isolated from traditional white cheese,” Biotechnology &
Biotechnological Equipment, vol. 23, pp. 861–865, 2009.
[40] Y. Hernández, M. G. Lobo, and M. González, “Factors affecting
sample extraction in the liquid chromatographic determination
of organic acids in papaya and pineapple,” Food Chemistry, vol.
114, no. 2, pp. 734–741, 2009.
[41] H. Rüssmann, H. Shams, F. Poblete, Y. Fu, J. E. Galán, and R. O.
Donis, “Delivery of epitopes by the Salmonella type III secretion
system for vaccine development,” Science, vol. 281, no. 5376, pp.
565–568, 1998.
[42] B. T. Lucena, B. M. dos Santos, J. L. Moreira et al., “Diversity of
lactic acid bacteria of the bioethanol process,” BMC Microbiol-
ogy, vol. 298, pp. 1–10, 2010.
[43] K. Y. Yoon, E. E. Woodams, and Y. Hang, “Probiotication of
tomato juice by lactic acid bacteria,” Journal of Microbiology, vol.
42, pp. 315–318, 2004.
[44] L. V. Reddy, J. Min, and Y. Wee, “Production of probiotic mango
juice by fermentation of lactic acid bacteria,” Microbiology and
Biotechnology Letters, vol. 43, no. 2, pp. 120–125, 2015.
[45] Z. Kohajdova and J. Karovicova, “Sensory and chemical evalu-
ation of lactic acid-fermented cabbage-onion juices,” Chemical
Papers, vol. 59, pp. 55–61, 2005.
[46] A. Casaburi, M.-C. Aristoy, S. Cavella et al., “Biochemical and
sensory characteristics of traditional fermented sausages of
Vallo di Diano (Southern Italy) as affected by the use of starter
cultures,” Meat Science, vol. 76, no. 2, pp. 295–307, 2007.
[47] L. A. Shelef, “Antimicrobial effects of lactates: a review,” Journal
of Food Protection, vol. 57, no. 5, pp. 445–450, 1994.
[48] D. Jankuloski, P. Sekulovski, L. Angelovski et al., ““Effect of
acetic, citric and lactic acid on Salmonella enteridis and Listeria
monocytogenes,” Journal of Hygienic Engineering and Design, pp.
93–96, 2012.
[49] W. A. Gould, “Quality evaluation of processed tomato juice,”
Journal of Agricultural and Food Chemistry, vol. 26, no. 5, pp.
1006–1011, 1978.
Hindawi
https://doi.org/10.1155/2019/9768152
Research Article
Survival and Behavior of Encapsulated Probiotics
(Lactobacillus plantarum) in Calcium-Alginate-Soy
Protein Isolate-Based Hydrogel Beads in Different Processing
Conditions (pH and Temperature) and in Pasteurized
Mango Juice
Ong-Ard Praepanitchai, Athapol Noomhorm, and Anil Kumar Anal

Department of Food Agriculture and Bioresources, Asian Institute of Technology, Pathum Thani, 12120, Thailand
Correspondence should be addressed to Anil Kumar Anal; anilkumar@ait.ac.th
Received 11 July 2018; Revised 15 January 2019; Accepted 29 January 2019; Published 13 February 2019
Guest Editor: Maria E. Potes
Copyright © 2019 Ong-Ard Praepanitchai et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.
Hybrid alginate-soy protein isolate-based hydrogel beads were prepared and evaluated to enhance the survival of the encapsulated
probiotics (Lactobacillus plantarum) during heat processing to incorporate in mango juice. The solutions of sodium alginate-soy
protein isolate (SA-SPI) with probiotic cells were dropped into the gelation bath containing calcium chloride (3% w/v) solution to
develop various types of hydrogel beads. The level of survival of probiotics in encapsulated beads under acidic conditions (pH 2,
3, and 6.5) and bile salt (0.5 and 1.0% w/v) was evaluated. The survival of the encapsulated probiotics to thermal processing was
evaluated by treating the beads in saline solution (0.9% w/v) at 30, 50, 63, and 72∘ C. The encapsulated probiotic bacteria were found
alive even after treatment at 72∘ C for 90 s. Most of the free cells did not survive at the temperature higher than 50∘ C and very low pH
(pH 2 and 3). The survival of probiotic cells was found higher with the hybrid hydrogel beads containing alginate and soy protein
isolate (1:8 w/w). Furthermore, mango juice fortified with encapsulated L. plantarum in hydrogel beads was subjected to thermal
pasteurization at 72∘ C for 90 s.
1. Introduction exhibiting antimutagenic activities, and preventing carcino-

genesis [4, 5]. The genera Lactobacillus and Bifidobacterium
The functional beverage business has recently launched the are the most important probiotic microorganisms commonly
new ready-to-drink with enhanced bioactive compounds. associated with gastrointestinal tract [2]. The probiotics to be
The functionality of food and beverage is enhanced via bio- used in food and beverage products should optimally fulfill
logical conversions such as by exploiting the activity of probi- all of the following criteria: (1) cells remaining viable during
otics such as lactic acid bacteria (LAB) with a long history of industrial processes; (2) survival during preparation and
safe use in the food industry. Probiotics have commonly been storage of the carrier foods; (3) survival in the gastrointestinal
added to a wide range of food and beverage products such environment of the host; and (4) having ability to provide
as yoghurt, sour milk, fermented vegetables, and fruit juices health benefits through fermentation process in lower
[1–3]. Probiotics have numerous health benefits to the human intestine of the host [6]. However, most of the probiotics
such as improving intestinal microbial balance, inhibiting incorporated in food and beverage are sensitive to processing
pathogenic growth by producing antimicrobial substances, and environmental factors including low pH and heat
simulating and modulating the innate immune systems, [7].
Encapsulation of probiotics improves the stabilizing via- Research (TISTR), Thailand. Mahachanok mango puree was
bility during processing and gastrointestinal transit (GIT). purchased from SWIFT Co. Ltd. (Nakornpathaom, Thai-
Alginate is one of the most frequently used biopolymers for land). Culture media and all other analytical grade chemicals
encapsulating the cells and bioactive compounds because of were of purchased from Merck (Darmstadt, Germany).
its simplicity, nontoxicity, biodegradability, biocompatibility,
low cost, and especially its pH-sensitive profile [1, 8]. The 2.2. Preparation of L. plantarum Probiotics Culture. The L.
survival of encapsulated Bifidobacterium bifidum RO71 in plantarum TISTR 050 was cultured in MRS medium at
polysaccharide-protein gel beads decreased by about 2 log 37∘ C. The cells in early stationary phase were harvested
CFU mL−1 after treatment with simulated gastric fluid (pH by centrifugation at 5000 rpm (Centrikon T-324, Kontron
2.5) for 2 h. Most of the free cells did not survive at the same Instrument, Germany) for 10 min at 4∘ C. The cell pellets were
condition. Microencapsulated Lactobacillus casei NCDC 298 further washed twice with 10 mL of saline solution (0.9% w/v)
in alginate beads showed a higher survival rate than that of the followed by centrifugation at 5000 rpm (Centrikon T-324,
free probiotics at low pH (1.5) and high bile salt concentration Kontron Instrument, Germany) for 10 min at 4∘ C.
and under heat treatment (55, 60, and 65∘ C) [9]. The combi-
nation of denatured whey protein isolate (WPI) and sodium
2.3. Preparation of Hydrogel Bead with L. plantarum. Various
alginate provided better protection under simulated gastric
types of hydrogel beads were prepared and named after
conditions as well as under pasteurization temperatures
their multivalent components: alginate, soy protein isolate.
[10]. Viable cell numbers of nonencapsulated L. acidophilus
Alginate-soy protein isolate-based hydrogel beads were pro-
readily decreased in harsh environment conditions, such as
duced by the gelation method as described by Bhopatkar et al.
gastric (low pH in stomach) and thermal conditions (higher
[13] with slight modifications. The stock solutions of 4% (w/v)
temperatures during pasteurization), when compared with
sodium alginate and 20% (w/v) of soy protein isolate proteins
hydrogel beads comprising WPI and alginate [7]. Similarly,
in distilled water were prepared. Various ratios of homoge-
the encapsulated probiotic bacteria with alginate and fish
nous aqueous solutions of alginate and soy protein isolate (as
gelatin protein were found viable during exposure at higher
shown in Table 1) were used as wall materials to encapsulate
temperature (50∘ C for an hour) [11]. Lactobacillus reuteri
probiotic cells. The mixtures were then mixed with the
encapsulated in chitosan-alginate beads was found to have
suspension comprising L. plantarum TISTR 050 probiotics
better tolerance toward stress conditions encountered in food
processing as well as to preserve its functional properties (1011 CFU mL−1 ). The encapsulated beads were produced by
[12]. extrusion technique using encapsulator as shown in Figure 1.
The modified encapsulator was designed and fabricated at the
None of the studies has yet been reported about alginate-
Bioprocess Technology Laboratory at the Asian Institute of
soy protein isolate (SPI) based hydrogel beads incorporating Technology (AIT), Thailand. The different mixture solutions
probiotic cells. Soy protein isolate (SPI) possesses nonpolar comprising alginate, soy protein isolates, and probiotic cells
and polar functionalities with both acidic- and basic-charged (Table 1) were dropped into the gelation bath containing cal-
amino acids that are suitable for encapsulating various active cium chloride solution (3% w/v) using a hypodermic needle
substances. This study aims to determine the synergetic (21 gauge) at a constant flow rate of 3.6 mL min−1 using a
effects from the combination of alginate and SPI as encapsula- peristaltic pump (Millipore, USA). After 30 min of incubation
tion matrices, using the widely employed extrusion gelation for gelation, the hydrogel beads were washed twice with saline
technique, on the survival of L. plantarum probiotics under solution (0.9% w/v) and further stored at 4∘ C for further use.
acidic conditions, and improve the survival of probiotic
bacteria in fruit juices during pasteurization.
2.4. Particle Size Determination of Hydrogel Beads. The par-
ticle size of the 100 hydrogel beads was measured with a
2. Experimental Study micrometer (Mittotuyo micrometer, NSK Co. Ltd., Japan).
2.1. Materials. Alginic acid (sodium salt) extracted from The average values are presented.
brown algae (molecular weight 200 kD) with a glucuronic
acid (60%) and mannuronic acid (40%) were obtained 2.5. Encapsulation Efficiency. The encapsulation efficiency of
from Rama Production Co. Ltd. (Bangkok, Thailand). Soy the probiotic cells in alginate-soy protein isolate hydrogel
protein isolate (SPI) was obtained from Shandong Sinoglory beads was determined by digestion method as described by
Health Food Co., Ltd. (Qingdao, China). The viscosity of the Anal and Stevens [1] with slight modification. The probiotic
solutions with different ratios of biopolymers (alginate and cells loaded hydrogel beads (1 g) were transferred in 9 mL of
soy protein isolate) was measured by Brookfield viscometer phosphate buffer saline solution (0.1 M PBS; pH 7.4) at 4C for
(The DV-II+ PRO) with a spindle LV-3 at 25∘ C. The test was 24 h suspension was then centrifuged at 6000 rpm (Centrikon
performed three times for each sample. T-324, Kontron Instrument, Germany) for 30 min. The cell
Pure culture of L. plantarum (TISTR 050) was acquired pellets were plate-counted and the encapsulation efficiency of
from Thailand Institute of Scientific and Technological probiotic cells (CFU) was determined as follows:
Cells count (CFU/mL) af ter disintegration of the hydrogel beads

Encapsulation efficiency (%) = × 100 (1)
Initial loading of the cells (CFU/mL) in hydrogel beads
7 5 3 2
1
10 8
6
11
Figure 1: Schematic diagram and working encapsulator (designed and fabricated of low cost encapsulation machine): peristaltic pump (1);
air pump (2); pressure regulator (3); pressure gauge (4); air filter membrane (5); magnetic stirrer control (6); double stainless steel jacket (7);
needle (8); rubber tube (9); mixture solution (10); gelling beaker (11).
Table 1: Different ratio of biopolymers, their viscosity, and effects on hydrogel bead size and encapsulation efficiency.
Encapsulation
Formulations SA: SPI Viscosity Bead size (𝜇m) Efficiency
(% w/w) (cp)
(%)
A 1:0 164.67 ± 4.03a 3030 ± 30a 90.60 ± 0.90a
B 1:2 250.17 ± 7.56b 3090 ± 40b 92.00 ± 1.00ab
C 1:4 423.53 ± 10.08c 3160 ± 40c 92.70 ±1.00b
D 1:8 1040.53 ± 49.75d 3320 ± 40d 91.60 ± 1.00b
E 1:12 2580.67 ± 53.78e 3440 ± 60e 91.50 ± 1.30ab
SA: sodium alginate; SPI: soy protein isolate. Means followed by the same letter in each column do not differ by least significant difference (LSD) at p < 0.05.
Data are means ± standard deviation of three replications.
2.6. Surface Morphology of Hydrogel Beads. The shape and centrifuged (5000 rpm for 10 min at 4∘ C) and the hydrogel
surface morphology of hydrogel beads loaded with L. plan- beads were further allowed to disintegrate in 9 mL phosphate
tarum were observed under scanning electron microscopy buffer saline solution (0.1 M; pH 7.0) to release the cells
(SEM, Hitachi S-3400N, Japan). The hydrogel beads were from the beads. The survival of the free and encapsulated L.
mounted on copper stubs followed by sputter-coated in a plantarum probiotics was evaluated by standard plate count
metallizer (Agar Sputter Coater) with gold-palladium to (SPC) method.
reach a thickness of coating of 100 A∘ and then observed in
high vacuum mode in different magnifications. 2.8. Evaluation of Survival of Encapsulated Probiotics in
Different Bile Salt Solutions. Free cells and encapsulated L.
2.7. Evaluation of Survival of Encapsulated Probiotics in plantarum were evaluated for their survival in 0, 0.5, and
Acidic Solutions. The survival of the L. plantarum probiotics 1.0% (w/v) porcine bile salt solutions following the method of
encapsulated in the hydrogel beads under acidic conditions Hansen et al. [14] with slight modifications. Briefly, free cell
was performed at pH 2.0, 3.0, and 6.5. Free cells were used as and L. plantarum-encapsulated beads (1010 CFU mL−1 ) were
control. L. plantarum-encapsulated in various hydrogel beads added to different test tubes containing 9 mL of milk–yeast
(1010 CFU mL−1 ) were added to test tubes containing 9 mL extract medium at pH 6.9 (10% w/v nonfat skim milk, 0.5%
of NGYC medium (comprising nonfat skim milk (12% w/v), w/v yeast extract, 0.05% w/v cysteine) containing 0.5, 1.0%
glucose (2% w/v), yeast extract (1% w/v), and cysteine (0.05% (w/v) porcine bile salt. The samples were further incubated at
w/v) and adjusted to the desired pH with 5 M HCl or 1 M 37∘ C for 3 and 6 h. The viable cell counts were enumerated as
NaOH). After incubation at 37∘ C for 3 h, the samples were described in earlier section.
2.9. Evaluation of Survival of Encapsulated Probiotics under the two biopolymeric mixtures (sodium alginate and SPI)
Heat Treatment. The viability of L. plantarum-encapsulated is likely to occur via electrostatic complexion and the Ca2+
hydrogel beads dispersed in normal saline solution (0.9% ions neutralize electrostatic repulsion and form salt bridges
w/v) was exposed to heat treatment following the method between the biopolymeric networks [15, 16]. The structure of
descried by Fang et al. [7] with slight modifications. Free outer wall provides an efficient protective barrier to diffusion
cells and L. plantarum-encapsulated beads (1010 CFU mL−1 ) toward the core of the capsule. As illustrated in Figure 3,
were placed in test tubes containing 9 mL of normal saline the entrapped rod-shaped probiotic cells are clearly observed
solution (0.9% w/v). The test tubes were further incubated inside the membranes of the hydrogel beads.
in a water bath at various temperatures (30, 50, 63, and
72∘ C) for 2 min. Aliquots were collected at different intervals 3.2. Viability of Encapsulated L. plantarum under Acid
of time after incubation. The samples were cooled down Solutions. Figure 4 illustrates the viability of probiotic cells
to room temperature (∼25∘ C). The viability of the free encapsulated in SA and SA/SPI beads in acidic solutions. The
and encapsulated L. plantarum probiotics was obtained as viability of both the free and the encapsulated probiotics (in
described above for heat treatment using SPC. SA and SA/SPI beads) increased with decreased acidity from
pH 2 to 6.5. At pH 6.5; most of the free and encapsulated
2.10. Evaluation of Survival of Encapsulated Probiotics in probiotics were found viable and active after 3 h of incubation.
Mango Juice during Pasteurization. The mango juice (50% In contrast, at pH 2 and 3, the survival of the encapsulated
w/v) was prepared by dissolving the mango concentrate in probiotics was significantly (p > 0.05) higher than that of the
sterilized deionized water. Free cell and L. plantarum were free probiotics owing to their protection from direct contact
placed in test tubes containing 9 mL of preheated mango with the acidic medium as a result of encapsulation. The free
juice. The test tubes were incubated in a water bath at 72∘ C cells did not survive at pH 2 after 3 h of incubation. The viable
for 90 s followed by storing at 4∘ C. The samples were further cell count of encapsulated bead in the SA/SPI beads (bead A-E
taken every 7 days to analyze the probiotic cells in juice and formulations) at pH 2 was 5.04 ± 0.05, 5.88 ± 0.06, 5.97 ± 0.06,
pH. All experiments were conducted in triplicate. 6.23 ± 0.04, and 6.15 ± 0.05 log CFU mL−1 , respectively. More
importantly, the survival of the probiotics encapsulated in the
2.11. Analysis of Titratable Acidity. The pH of mango juice was SA/SPI beads was higher than that of the probiotics encapsu-
measured using pH meter (Hanna pH 211, USA). Titratable lated in SA beads only. Soybean protein isolate (SPI) seems
acidity (TA) was determined using titration method with to exert a synergetic effect on the survival of encapsulated
standardized alkali solution (0.1 N NaOH). TA expressed as probiotics. The results additionally indicated that, at pH 2 and
the percentage of citric acid per 100 g of juice. 3, increasing the content of SPI at a given SA content (i.e.,
SA:SPI ratios from 1:2 to 1:12% w/w) influenced the survival of
2.12. Statistical Analysis. All experiments were repeated at probiotic cells. The probiotic in bead D formulation achieved
least three times. Results are reported as mean ± standard the highest survival rate (p < 0.05) with 6.23 ± 0.04 and 7.62 ±
deviation using IBM SPSS statistics program (Ver. 21, USA). 0.10 log CFU mL−1 when submerged in NGYC medium pH 2
The statistical significance among various samples of free and 3 for 3 h, respectively. The variations in the probiotics sur-
cell and encapsulated beads was evaluated with one-way vival may be due to differing complexion between SPI and SA
ANOVA, with significant level (p < 0.05). when the relative content of SPI exceeds 8% w/v (at 1% SA).
3. Results and Discussion 3.3. Viability of Encapsulated L. plantarum under Different Bile
Salt Solutions. Survival of free and encapsulated probiotics in
3.1. Formation of Encapsulated Probiotics SA:SPI Hybrid SA and SA/SPI hydrogel beads in different bile salt concentra-
Hydrogel Beads. The polyanionic polymer solution sodium tions (0.5 and 1.0 %, w/v of porcine bile salt solutions; pH 6.9)
alginate in aqueous solution dropped into an aqueous solu- at 37∘ C was also evaluated. Viability of free and encapsulated
tion containing a suitable divalent counter cation like Ca2+ probiotics in SA hydrogel bead remained unchanged after 6 h
has the tendency to form hydrogel beads using ionotropic of incubation in milk–yeast extract medium without bile salt.
gelation method. The probiotic cells were encapsulated in In contrast, the viability of the encapsulated probiotics in the
calcium-alginate-SPI based hydrogel beads. Table 1 shows SA/SPI beads increased gradually from 3 to 6 h of incubation
the formulation of different ratio of SA and SPI (A-E with increasing SA/SPI ratios to 1:8. This is due to the
formulations), their viscosity, size of the hydrogel beads, growth of the probiotics encapsulated in the SA/SPI beads;
and encapsulation efficiency of probiotic cells. The size of a milk–yeast extract medium, used as nutrient, penetrated
the hydrogel beads was found increasing with the increased the interface between the electrostatically charged SA and SPI
viscosity of the hydrogel mixtures as shown in Table 1 complexion particles and the SA wavy matrix. Increasing the
and illustrated in Figure 2. The encapsulation efficiency of bile salt concentrations from 0.5 to 1.0 % (w/v), the survival of
probiotic cells was found 90-92% in all types of hydrogel the free cells and the probiotic cells encapsulated in SA beads
beads. Figure 3 illustrates the surface morphology of the only decreased with increasing incubation periods from 3 to
hydrogel beads encapsulating probiotic cells. The smooth 6 h. The viability of free cells and encapsulated probiotic in
and spherical hydrogel beads were formed dropping the SA beads after 6 h of incubation in 0.5% w/v bile salt was
alginate alone and the mixtures of alginate with various 8.17 ± 0.04 and 8.62 ± 0.08 log CFU mL−1 , respectively, and
concentrations of soy protein isolate (SPI). The gelation of 1.0% w/v bile salt of 6 h incubation was 8.05 ± 0.20 and
A B
C D
Figure 2: Scanning Electron Microscopy (SEM) images (magnification 50×) showing the increased trends of sodium alginate (SA)—soy protein
isolate (SPI) hydrogel beads containing Lactobacillus plantarum with the increasing SA: SPI ratios (a) bead A (1 : 0), (b) bead B (1 : 2), (c) bead
C (1 : 4), (d) bead D (1 : 8), and (e) bead E (1 : 12).
A B C
D E F
Figure 3: Scanning Electron Microscopy (SEM) images (magnification 50×) showing the surface morphology of sodium alginate (SA)—soy
protein isolate (SPI) hydrogel beads containing Lactobacillus plantarum. (A) Only sodium alginate hydrogel bead (magnification 50X); (B)
only sodium hydrogel bead (magnification 500X), (C) only sodium hydrogel bead (magnification 5000X), and (D) sodium alginate-soy
protein isolate hydrogel beads (ratio 1:8; magnification 50X); (E) sodium alginate-soy protein isolate hydrogel beads (ratio 1:8; magnification
500X); sodium alginate-soy protein isolate hydrogel beads (ratio 1:8; magnification 5000X).
8.51 ± 0.10 log CFU mL−1 , respectively. However, the survival 10

of the probiotic in the SA/SPI beads remained nearly the a a a a a a
9
same as that of the starting content (9 log CFU mL−1 ) after
6 h owing to protection from the electrostatically charged
Log CFU mL-1

8 c b
SA and SPI complexion in the hybrid beads. Hence, bile b b
salt concentrations of 0.5 and 1.0% w/v (high bile) had no 7 a
diminishing effects on the survival level of the probiotics b b
d c
encapsulated in the SA/SPI beads after 6 h of incubation. 6 a
a
5
3.4. Viability of L. plantarum-Encapsulated in SA/SPI Beads
a
under Heat Treatment. In order for probiotic cells to be 4
effective and remain viable in food and beverage prod- pH 2 pH 3 pH 6.5
ucts, they must withstand the recommended pasteurization
temperatures and/or other industrial processing parameters. free cell bead C
Survival of probiotic cells in SA/SPI beads was therefore bead A bead D
bead B bead E
evaluated under the heat treatment at 50, 63, and 72∘ C and
illustrated in Figure 5. All the free cells were killed at within Figure 4: Survival of free cell and encapsulated probiotics in
a min. In contrast, addition of SPI in beads significantly SA beads (bead A formulation) and SA/SPI beads (bead B to E
improved the survival of the probiotic cells in SA/SPI beads. formulations) under acidic conditions at 37∘ C for 3 h.
Increasing content of SPI at a given SA content (i.e., SA:SPI
ratios from 1:2 to 1:12% w/w) also enhanced the survival of mL−1 during 28 days of storage. The number of cell during
the probiotic cells; however, the probiotic in the SA/SPI beads storages is decreased with large amount when compared to
prepared at a SA/SPI ratio of 1:8% w/w achieved the highest another study [20], due to L. plantarum in encapsulated bead
survival rate (7.91 ± 0.09 log CFU mL−1 ) after heat treatment of our study passing the pasteurization process and this is
at 72∘ C for 1 min. There was no significant difference (p the main cause of making the cell injury and decreasing to
< 0.05) between the survival of probiotic in beads D and almost 2.8 log CFU mL−1 during storage. However, there was
E formulations. However, the survival of probiotic in SA not any microorganism on pasteurized mango juice with free
beads was not found after treat with heat at 72∘ C for 2 min. cell all the period of storage found. Therefore, encapsulated
Importantly, adequate active amount of probiotic (6-8 log probiotics in SA/SPI bead were able to maintain viability in
CFU mL−1 ) in the bead B to E formulations survived for 1 min acidic fruit juice up to 25 days after pasteurization in which
under heat treatment at 63 and 72∘ C. The results confirmed the probiotic remained at least 6 log CFU mL−1 .
the presence of probiotic bacteria at minimum levels of 6-7
log CFU mL−1 which is recommended in functional foods 3.7. pH and Acidity Changes during Mango Juice Storage. The
[17–19]. Fang et al. [7] reported that the cells encapsulated initial pH of all mango juice samples at day 0 (before the
with whey protein and alginate beads provided better thermal addition of L. plantarum TISTR 050) was 4.7. The pH of
protection on the viability of L. acidophilus more than free pasteurized mango juice with free cell remained constant
and alginate encapsulated cells. during storage (28 days) because all L. plantarum was
killed during pasteurization as illustrated in Figure 7. The
3.5. Viability of L. plantarum-Encapsulated SA/SPI Beads pasteurized mango juice with encapsulated L. plantarum
in Mango Juice after Pasteurization. The hydrogel beads bead remained constant at 4.7 during storage. In case of
(formulation D) were chosen to fortify with mango juice. acidity of both pasteurized mango juice with free cell and
Figure 6 illustrates the survival of free and encapsulated cells pasteurized mango juice with encapsulated L. plantarum
in mango juice after pasteurization process at 72∘ C for 90 s. TISTR 050, the hydrogel beads were constant during 35
The free cells were found killed in mango juice after exposure days of storage (1.25%). There was no significant difference
to pasteurization temperature (72∘ C, 90 s). In case of mango (𝜌 < 0.05) between the pH and the acidity at day 0 and
juice with the cells encapsulated in bead D formulation, only day 28 for two types of stored juice. Therefore, it was found
one Log CFU mL−1 (from 9.10 ± 0.04 log CFU mL−1 to 8.11 that encapsulation of probiotic was able to maintain the pH
± 0.13 log CFU mL−1 ) was found decreased. Therefore, it was and acidity of fruit juice during storage. As illustrated in
proven that the encapsulated probiotic bacteria with SA/SPI Figure 7, for the acidity of both pasteurized mango juice with
can protect probiotics from thermal pasteurization. L. plantarum TISTR 050 free cells and pasteurized mango
juice with encapsulated L. plantarum TISTR 050, the hydrogel
3.6. Viability of L. plantarum TISTR 050 in Mango Juice beads remained constant during 35 days of storage (1.25%).
during Storage. Figure 7 illustrates the changes in numbers There was no significant difference (p < 0.05) of acidity at day
of viable probiotic cells in in mango juice during storage 35 between two types of storage juices.
at 4∘ C over 28 days. A drop in the microbial population of
pasteurization mango juice with encapsulated L. plantarum 4. Conclusions
bead was observed during the storage. The survival of L.
plantarum TISTR 050 beads in mango juice was decreased Encapsulated beads of L. plantarum (TISTR 050) probiotics
from 8.56 ± 0.02 log CFU mL−1 to 5.83 ± 0.03 log CFU were successfully obtained by extrusion gelation technique of
10 d b ccc c
a b cdd
9 bbcc a
8 bb
a a bb c c
7 a
Log CFU mL-1

a
6
5
4 a c bd d
3
2
1
a a a a a
0
∘ ∘ ∘ ∘ ∘
50 ＃ 63 ＃ 72 ＃ 50 ＃ 63 ＃ 72∘ ＃
1 min 2 min
Temperature (∘ ＃)
Free cell bead C
bead A bead D
bead B bead E
Figure 5: Survival of free and encapsulated probiotics in SA beads (bead A formulation) and SA/SPI beads (bead B to E formulations) under
heat treatment at 50∘ C, 63∘ C, and 72∘ C for 1 min and 2 min.
10 10 5
9 Viable cell count (Log CFU mL-1) 9 4.9
8 8 4.8
7
Log CFU mL-1
7 4.7
6
5 6 4.6
pH
4 5 4.5
3 4 4.4
2 3 4.3
1
2 4.2
0
free cells bead D 1 4.1
0 4
before 0 7 14 21 28
after Time (Days)
Figure 6: Survival level of the probiotics free cells and encapsulated Figure 7: The survival of L. plantarum TISTR 050 and pH change
in SA/SPI beads (bead D formulation) before and after pasteuriza- in mango juice after pasteurization during storage at 4∘ C for 35 days;
tion process. survival of free cell (I), survival of encapsulated bead (), pH of free
cell (), and pH of encapsulated bead (×).
various ratios of pure SA and SA/SPI into CaCl2 solution.

The encapsulated beads with SA and SA/SPI can protect L. an alternative encapsulated material to create a barrier to the
plantarum from gastric condition; however, SA/SPI beads surrounding environment and it is suitable for the people who
provided better protection. The bile salt concentrations of 0.5 are allergic to dairy proteins.
and 1.0% (w/v) had no diminishing effects on the survival
level of the probiotics encapsulated in the SA/SPI beads after Data Availability
6 h of incubation. Furthermore, the probiotics encapsulated
in the SA/SPI beads survived longer relative to those encap- All relevant data is included within manuscript.
sulated in the SA beads and the nonencapsulated probiotics
subjected to heat treatment. The application of encapsulated Conflicts of Interest
bead of L. plantarum in mango juice under pasteurization
The authors declare that they have no conflicts of interest.
process showed successful resistance to thermal conditions
(72∘ C for 90 s). The similar result is reported in case of
encapsulated probiotics in alginate—whey protein isolate-
References
based hydrogel beads [7]. The pH of mango juice with [1] A. K. Anal and W. F. Stevens, “Chitosan-alginate multilayer
encapsulated bead remained constant at 4.70 during storage. beads for controlled release of ampicillin,” International Journal
Probiotics were found heat resistant during pasteurization of Pharmaceutics, vol. 290, no. 1-2, pp. 45–54, 2005.
process and thus found in higher concentration in mango [2] A. K. Anal and H. Singh, “Recent advances in microencap-
juice containing the probiotics loaded SA/SPI beads; SPI is sulation of probiotics for industrial applications and targeted
delivery,” Trends in Food Science & Technology, vol. 18, no. 5, pp. [19] Y. K. Lee and S. Salminen, “The coming of age of probiotics,”
240–251, 2007. Trends in Food Science & Technology, vol. 6, no. 7, pp. 241–245,
[3] T. Heidebach, P. Först, and U. Kulozik, “Microencapsulation of 1995.
probiotic cells for food applications,” Critical Reviews in Food [20] S. Nualkaekul and D. Charalampopoulos, “Survival of Lacto-
Science and Nutrition, vol. 52, no. 4, pp. 291–311, 2012. bacillus plantarum in model solutions and fruit juices,” Inter-
[4] S. Rokka and P. Rantamäki, “Protecting probiotic bacteria national Journal of Food Microbiology, vol. 146, no. 2, pp. 111–117,
by microencapsulation: Challenges for industrial applications,” 2011.
European Food Research and Technology, vol. 231, no. 1, pp. 1–12,
2010.
[5] D. Song, S. Ibrahim, and S. Hayek, “Recent application of pro-
biotics in food and agricultural science,” Probiotics, pp. 3–36,
2012.
[6] R. Fuller, “Probiotics in man and animals,” Journal of Applied
Bacteriology, vol. 66, no. 5, pp. 365–378, 1989.
[7] Y. Fang, B. Kennedy, T. Rivera, K.-S. Han, A. K. Anal, and
H. Singh, “Encapsulation system for protection of probiotics
during processing,” U.S. patent 20120263826, 2012.
[8] D. Guérin, J.-C. Vuillemard, and M. Subirade, “Protection of
bifidobacteria encapsulated in polysaccharide-protein gel beads
against gastric juice and bile,” Journal of Food Protection, vol. 66,
no. 11, pp. 2076–2084, 2003.
[9] S. Mandal, A. K. Puniya, and K. Singh, “Effect of alginate
concentrations on survival of microencapsulated Lactobacillus
casei NCDC-298,” International Dairy Journal, vol. 16, no. 10,
pp. 1190–1195, 2006.
[10] R. Rajam, P. Karthik, S. Parthasarathi, G. S. Joseph, and
C. Anandharamakrishnan, “Effect of whey protein - alginate
wall systems on survival of microencapsulated Lactobacillus
plantarum in simulated gastrointestinal conditions,” Journal of
Functional Foods, vol. 4, no. 4, pp. 891–898, 2012.
[11] K. K. Kumaree, A. Akbar, and A. K. Anal, “Bioencapsulation
and application of Lactobacillus plantarum isolated from catfish
gut as an antimicrobial agent and additive in fish feed pellets,”
Annals of Microbiology, vol. 65, no. 3, pp. 1439–1445, 2014.
[12] A. De Prisco, D. Maresca, D. Ongeng, and G. Mauriello, “Micro-
encapsulation by vibrating technology of the probiotic strain
Lactobacillus reuteri DSM 17938 to enhance its survival in foods
and in gastrointestinal environment,” LWT- Food Science and
Technology, vol. 61, no. 2, pp. 452–462, 2015.
[13] D. Bhopatkar, A. K. Anal, and W. F. Stevens, “Ionotropic algi-
nate beads for controlled intestinal protein delivery: Effect of
chitosan and barium counter-ions on entrapment and release,”
Journal of Microencapsulation, vol. 22, no. 1, pp. 91–100, 2005.
[14] L. T. Hansen, P. M. Allan-Wojtas, Y.-L. Jin, and A. T. Paulson,
“Survival of Ca-alginate microencapsulated Bifidobacterium
spp. in milk and simulated gastrointestinal conditions,” Food
Microbiology, vol. 19, no. 1, pp. 35–45, 2002.
[15] C. G. De Kruif and R. Tuinier, “Polysaccharide protein interac-
tions,” Food Hydrocolloids, vol. 15, no. 4-6, pp. 555–563, 2001.
[16] A. Maltais, G. E. Remondetto, and M. Subirade, “Mechanisms
involved in the formation and structure of soya protein cold-
set gels: A molecular and supramolecular investigation,” Food
Hydrocolloids, vol. 22, no. 4, pp. 550–559, 2008.
[17] F. C. A. Buriti, J. S. da Rocha, and S. M. I. Saad, “Cheese as pro-
biotic carrier: Technological aspects and benefits,” in Handbook
of Animal-Based Fermented Food and Beverage Technology, H.
Hui, Ed., pp. 749–784, CRC Press, Boca Raton, Fla, USA, 2nd
edition, 2012.
[18] V. S. Jayamanne and M. R. Adams, “Determination of survival,
identity and stress resistance of probiotic bifidobacteria in bio-
yoghurts,” Letters in Applied Microbiology, vol. 42, no. 3, pp. 189–
194, 2006.
Hindawi
https://doi.org/10.1155/2019/4981463
Research Article
Salmonella Infantis in Broiler Flocks in Slovenia: The
Prevalence of Multidrug Resistant Strains with High Genetic
Homogeneity and Low Biofilm-Forming Ability
Mateja Pate ,1 Jasna MiIunoviI,1 Majda Golob ,1

Lene Karine Vestby ,2 and MatjaD Ocepek1
1
University of Ljubljana, Veterinary Faculty, 1000 Ljubljana, Slovenia
2
Norwegian Veterinary Institute, 0106 Oslo, Norway
Correspondence should be addressed to Mateja Pate; mateja.pate@vf.uni-lj.si
Received 3 August 2018; Revised 30 December 2018; Accepted 20 January 2019; Published 7 February 2019
Copyright © 2019 Mateja Pate et al. This is an open access article distributed under the Creative Commons Attribution License,
For almost a decade, the number of Salmonella enterica subspecies enterica serovar Infantis-positive broiler flocks has been
steadily increasing in Slovenia, doubling the number of positive holdings in only a few years. Since multidrug resistant S. Infantis
isolates are highly prevalent in the broiler meat industry and may represent a public health concern through the food chain, we
aimed to investigate the antimicrobial susceptibility, genetic diversity, and biofilm-forming ability of S. Infantis from Slovenian
broiler flocks. A total of 87 S. Infantis strains isolated from broiler faeces in the period between 2007 and 2013 were studied. The
samples originated from 41 farms which were subcontractors of three major food business operators and from two autonomously
operating holdings (farms). Isolates were phenotypically tested for their susceptibility to 14 antimicrobials from nine classes by
determining the minimum inhibitory concentration with the microdilution method. Only 8% of the isolates were susceptible to all
of the antimicrobial agents tested, while 88.5% of the isolates were multidrug resistant, with the most common resistance pattern
CipNxSSuT (65.5%) followed by CipNxSuT (17.2%). Pulsed-field gel electrophoresis (PFGE) divided the strains into five clusters (A-
E) comprising 16 distinct XbaI PFGE profiles. Sixty-five out of 87 isolates were grouped in clusters A and B, with the predominant
PFGE profiles A1 and B1 encompassing 33 and 28 isolates, respectively. A vast majority of the isolates (75/87) showed >90% PFGE
profile similarity. The biofilm-forming capacity of the tested isolates, determined with crystal violet assay in polystyrene microwell
plates, was generally weak. The average biofilm formation for persistent strains was higher than for presumably nonpersistent
strains; however, the difference was not significant. It seems that S. Infantis persistence on broiler farms is more related to its
widespread occurrence in the broiler production chain and ineffective disinfection protocols than to its ability to form biofilm.
1. Introduction still ranks first among the causative agents of food-borne

outbreaks in the EU. The two most commonly reported
The presence of Salmonella in poultry is considered to be a Salmonella serovars in humans in 2017 were S. Enteritidis and
risk factor for the contamination of meat and eggs. In order to S. Typhimurium [2].
prevent zoonotic transmission of Salmonella, national control A statistically significant decreasing trend of confirmed
programmes for Salmonella in poultry are set in the European human salmonellosis cases was observed between 2008 and
Union (EU) to reduce the prevalence of certain serovars 2017; however, during the last five years (2013-2017), the over-
[1]. Most of the EU Member States met their Salmonella all trend has not shown any statistically significant decrease
reduction targets for poultry, and Salmonella prevalence is or increase [2]. In contrast, Salmonella enterica subspecies
declining in these animal populations. At the same time, a enterica serovar Infantis (S. Infantis) became the emerging
significant declining trend of human salmonellosis cases was nontyphoidal Salmonella worldwide. In the EU, S. Infantis
observed between 2008 and 2012 [2]. However, Salmonella was the most commonly reported serovar from broiler flocks
and broiler meat. S. Infantis is an important public health inhibitory concentration (MIC) by microdilution method
concern due to its frequent isolation from humans; it ranks using commercially available microplates (EUMVS2, Sensi-
in fourth position among top-10 human serovars [2]. It is titre, Trek Diagnostic Systems, Thermo Fisher Scientific,
frequently multidrug resistant (MDR) and seems successfully USA). All isolates were phenotypically tested for their sus-
spread by certain clones among broilers and humans [3]. ceptibility to 14 antimicrobials from nine different antimi-
MDR S. Infantis isolates are highly prevalent in the broiler crobial groups: ampicillin, cefotaxime, ceftazidime, chlo-
meat industry in several EU Member States and contribute ramphenicol, ciprofloxacin, colistin, florfenicol, gentamicin,
significantly to the overall occurrence of MDR Salmonella kanamycin, nalidixic acid, streptomycin, sulfamethoxazole,
in Europe [3]. Resistant strains may spread from animals to tetracycline, and trimethoprim. Escherichia coli ATCC 25922
humans through the food chain, representing a public health was used as a test control strain. The results were interpreted
concern. As shown before, the same MDR S. Infantis clone according to the European Committee on Antibiotic Suscep-
was recovered from the broiler houses, abattoirs, retail meat, tibility Testing (EUCAST) epidemiological cut-offs [13] and
and humans [4]. Furthermore, a recent study demonstrated the recommendations of the European Union Reference Lab-
the spread of ESBL-producing MDR S. Infantis from animals oratory for Antimicrobial Resistance [14]. The interpretative
to humans in Italy [5]. criteria were in concordance with the Decision 2013/652/EU
Since 2010, a considerable increase of S. Infantis-positive of the European Commission [3]. Resistance to antimicro-
broiler flocks has been observed in Slovenia. The number bials for which no breakpoint is available was shown as
of positive flocks has increased by more than 100% in only distribution of MICs (Figure 1). Multidrug resistance was
two years. In addition, S. Infantis has been often repeatedly defined as resistance to three or more antimicrobial classes.
detected in certain holdings, despite applying sanitation
measures during the production break [6]. It is well known 2.3. Pulsed-Field Gel Electrophoresis (PFGE). PFGE was car-
that the elimination of Salmonella from poultry houses is ried out according to the standardised PulseNet protocol [15].
a difficult task and that cleansing and disinfection methods Restriction patterns were analysed with BioNumerics soft-
may often be ineffective in a field situation where protective ware (v. 6.6, Applied Maths, Belgium). The relation between
organic materials are abundant [7, 8]. Furthermore, it has two isolates was scored using the Dice coefficient of similarity.
been demonstrated that production of fimbriae and cellulose A cluster analysis was performed by the unweighted pair-
and the ability to form biofilm are important for the survival group method with arithmetic means (UPGMA). Position
of Salmonella on surfaces and persistence in the environment tolerance and optimisation were set at 1%. Bands of size less
[9, 10]. To date, only a few studies on biofilm-forming ability than 33.3 kb were excluded from the analysis. Isolates with
of S. Infantis from poultry have been published [8, 11, 12]. PFGE profiles of >95% similarity were considered to belong
Because of an alarming spread of S. Infantis in the broiler to the same cluster (marked by letters). Within a cluster,
chicken industry in recent years, the aim of this study was to profiles differing from each other in at least one band were
get some insight into the genetic diversity and antimicrobial considered as subtypes (marked by digits).
susceptibility of S. Infantis from broiler flocks. However,
as the data obtained indicated the persistence of specific
clones in certain farms, the biofilm-forming capacity of the 2.4. Classification of Persistent and Presumably Nonpersistent
isolates has also been tested, providing relevant data on a large Strains. If strains with the same PFGE profile had been
collection of S. Infantis isolates. isolated from the same poultry house over a time period
of at least one year, the strain that was last isolated was
classified as persistent. A strain was classified as presumably
2. Materials and Methods nonpersistent if no other strain with the same PFGE profile
2.1. Bacterial Strains and Culture Conditions. Eighty-seven had been isolated from the same poultry house, or if the
S. Infantis strains isolated from broiler faeces in the period strains with the same PFGE profile had been isolated in a
between 2007 and the first half of 2013 were included in certain poultry house over a period of less than a year.
this study (Table 1). The broiler chicken originated from
at least 41 holdings (farms); the origin is not known for 2.5. Biofilm-Forming Capacity Testing. All strains were stored
four isolates, hence the term ‘at least.’ The holdings (farms) at -80∘ C in brain heart infusion broth (BHI; Difco, BD,
were subcontractors of three major food business operators NJ, USA), supplemented with 15% glycerine (Merck KGaA,
(FBOs; SI-A, SI-B, and SI-C). In addition, chicken from two Darmstadt, Germany) and recovered on sheep blood agar
autonomously operating holdings (AOHs; SI-X) were inves- at 37±1∘ C overnight. The bacterial cultures were then trans-
tigated. In total, there were 17 subcontractors of FBO SI-A, at ferred into Luria Bertani broth (LB; Merck KGaA) and
least two subcontractors of FBO SI-B, and 22 subcontractors incubated statically overnight at 37±1∘ C. The assay was based
of FBO SI-C. Seventeen holdings were sampled more than on the method described by Vestby et al. [9]. In short,
once in the time range from 14 days to four years (Table 1). 20 𝜇l aliquots of overnight cultures were added to each
The number of isolates collected at respective holdings was well in a 96-well microtiter plate (Nunc Nunclon, Roskilde,
two to eight. Denmark) containing 180 𝜇l of LB without NaCl (LB wo /NaCl;
bacto-tryptone 10 g/l, yeast extract 5 g/l). Triplicates of each
2.2. Antimicrobial Susceptibility Testing. The antimicrobial strain were used. After inoculation, the plates were incubated
susceptibility was evaluated by determining the minimum statically for 48±1 hour at 20±1∘ C. After incubation, optical
Table 1: Overview of PFGE profiles, resistance patterns, and biofilm formation of Salmonella Infantis isolates from broiler farms collected between 2007 and 2013.
No Farm IDa Isolate ID Sampling time Location PFGE profile Resistance patternb ABFc
1 SI-A-01 S-163/11 Sept 2011 broiler house 1 C1 CipNxSSuT 0.221
2 S-149/12 Aug 2012 broiler house 6 C1 CipNxSSuT 1.04
3 S-11/13 Feb 2013 broiler house 5 C1 CipNxSSuT 1.105
4 S-209/13d Sept 2013 broiler house 4 C1 CipNxSSuT 0.842
5 SI-A-02 S-99/10 May 2010 broiler house 1 B3 CipNxSuT 0.0855
6 S-243/10 Sept 2010 broiler house 2 A1 CipNxSSuT 0.113
7 SI-A-03 S-205/11 Nov 2011 nae C1 CipNxSSuT 0.959
8 SI-A-04 S-257/12 Nov 2012 broiler house 1 A1 CipNxSSuT 0.7095
9 S-79/13 May 2013 broiler house 1 A1 CipNxSSuT 0.3895
10 SI-A-05 S-141/12 Aug 2012 na A2 ACipNxSSuT 0.129
11 SI-A-06 S-78/13 May 2013 na A1 CipNxSSuT 0.4665
12 SI-A-07 S-244/10 Nov 2010 na A1 CipNxSSuT 0.1055
13 SI-A-08 S-196/10a Oct 2010 broiler house 2 C1 CipNxSuT -0.0975
14 S-245/10 Nov 2010 broiler house 1 B1 sensitive -0.1975
15 S-83/12 May 2012 broiler house 1 C3 CipNxSSuT 0.908
16 SI-A-09 S-101/12 June 2012 na C1 CipNxSSuT 0.089
17 SI-A-10 S-72/11 June 2011 na A1 CipNxSSuT ndf
18 SI-A-11 S-160/13 July 2013 na A1 CipNxSSuT 0.3645
19 SI-A-12 S-74/13 May 2013 na A1 ACipNxSSuT 0.373
20 SI-A-13 S-140/10 July 2010 broiler house 1 A1 CipNxSSuT 0.1715
21 S-261/12 Dec 2012 broiler house 2 A3 CipNxSuT 0.7915
22 SI-A-14 S-251/12 Nov 2012 na C2 CipNxSuT 1.4095
23 SI-A-15 S-142/13 June 2013 na A1 CipNxSSuT 0.3
24 SI-A-16 S-210/13 Sept 2013 na E2 A 0.358
3
4
Table 1: Continued.
25 SI-A-17 S-220/12 Nov 2012 na A1 CipNxSSuT 0.724
26 SI-B-01 S-101/08 Apr 2013 na D1 A -0.033
27 SI-B-02 S-5/07 nrg nr D1 S 0.081
28 S-12/07 nr nr D1 sensitive 0.4945
29 SI-B-NN S-131/07 nr nr D2 sensitive 0.096
30 S-158/07 nr nr D1 sensitive -0.1015
31 S-271/07 nr nr D1 sensitive -0.005
32 S-222/08 Sept 2008 broiler house 1 D1 sensitive -0.023
33 SI-C-01 S-27/11 Mar 2011 broiler house 1 B1 CipNxSuT 0.0855
34 S-185/11 Oct 2011 broiler house 1 B1 CipNxSSuT 0.105
35 S-250/11 Dec 2011 broiler house 1 B1 CipNxSSuT 0.6415
36 S-18/12 Jan 2012 broiler house 1 B1 CipNxSSuT 0.1885
37 S-53/12 Mar 2012 broiler house 1 B1 CipNxSSuT 0.9875
38 S-160/12 Sept 2012 broiler house 1 B1 CipNxSSuT 1.7655
39 S-219/12d Nov 2012 broiler house 1 B1 CipNxSSuT 1.6335
40 SI-C-02 S-184/11 Oct 2011 na B1 CipNxSuT 0.4885
41 SI-C-03 S-129/10 June 2010 broiler house 1 B1 CipNxSSuT 0.0375
42 S-124/13 June 2013 broiler house 1 E1 sensitive 1.3005
43 SI-C-04 S-186/11 Oct 2011 na B1 CipNxSSuT 0.099
44 SI-C-05 S-187/13 Aug 2013 na A1 CipNxSSuT 0.578
45 SI-C-06 S-12/12 Jan 2012 na A1 CipNxSSuT 0.33
46 SI-C-07 S-188/11 Oct 2011 broiler house 1 B1 CipNxSSuT 0.02375
47 S-87/12 May 2012 broiler house 1 B1 CipNxSSuT 0.6115
48 S-274/12 Dec 2012 broiler house 1 B1 CipNxSSuT 0.2845
Table 1: Continued.
49 SI-C-08 S-207/11 Nov 2011 broiler house 2 B1 CipNxSSuT 1.857
50 S-180/12 Oct 2012 broiler house 1 A1 CipNxSSuT 0.389
51 SI-C-09 S-204/08 Aug 2008 broiler house 1 A1 CipNxSSuT -0.079
52 S-97/10 Apr 2010 broiler house 1 A1 CipNxSuT 0.1375
53 S-40/11 Apr 2011 broiler house 1 A1 CipNxSuT 0.377
54 S-175/12d Oct 2012 broiler house 1 A1 CipNxSSuT 0.997
55 SI-C-10 S-189/11 Oct 2011 na B1 CipNxSSuT 0.23
56 SI-C-11 S-47/11 May 2011 na A1 CipNxSSuT 0.116
57 SI-C-12 S-82/12 May 2012 broiler house 1 A1 CipNxSSuT 0.3465
58 S-21/13 Feb 2013 broiler house 1 A1 CipNxSSuT 0.9105
59 SI-C-13 S-41/12 Mar 2012 na A1 CipNxSSuT 0.223
60 SI-C-14 S-30/11 Apr 2011 broiler house 1 A1 CipNxSuT 0.2055
61 S-14/12 Jan 2012 broiler house 1 B1 CipNxSSuT 1.767
62 SI-C-15 S-3/08 Dec 2017 nr A1 CipNxSSuT -0.031
63 S-10/08 nr nr A1 CipNxSSuT -0.063
64 S-213/09 Aug 2009 nr A1 CipNxSSuT 0.0385
65 S-1/10 Dec 2009 nr G CipNxSuT nd
66 S-59/10 Mar 2010 broiler house 1 A1 CipNxSuT -0.0155
67 S-48/11 May 2011 broiler house 1 A1 CipNxSuT 0.4735
68 S-191/11 Nov 2011 broiler house 1 C4 CipNxSSuT 0.132
69 S-111/12 June 2012 broiler house 1 A1 CipNxSSuT 0.2665
70 SI-C-16 S-57/12 Apr 2012 na B1 CipNxSSuT 0.4405
5
6
Table 1: Continued.
a
No Farm ID Isolate ID Sampling time Location PFGE profile Resistance patternb ABFc
71 SI-C-17 S-26/11 Mar 2011 na A1 CipNxSSuT -0.229
72 SI-C-18 S-143/12 Aug 2012 na B1 CipNxSSuT 0.2135
73 SI-C-19 S-149/10 Aug 2010 na E2 CipNxSSuT 0.425
74 SI-C-20 S-20/13 Feb 2013 na A1 SSuT 1.081
75 SI-C-21 S-223/09 Aug 2009 nr B1 CipNxSuT 0.122
76 S-119/10 June 2010 broiler house 1 B1 CipNxSuT 0.06
77 S-7/11 Feb 2011 broiler house 1 B1 CipNxSSuT -0.158
78 S-166/11 Sept 2011 broiler house 1 B1 CipNxSSuT 0.2375
79 S-60/12 Apr 2012 broiler house 1 B1 CipNxSSuT 0.9065
80 S-144/12 Aug 2012 broiler house 1 B1 CipNxSSuT 0.4895
81 S-29/13 Mar 2013 broiler house 1 B1 CipNxSSuT 0.731
82 S-215/13d Sept 2013 broiler house 1 B1 CipNxSSuT 0.754
83 SI-C-22 S-251/11 Dec 2011 broiler house 1 B2 CipNxSuT nd
84 S-138/13 June 2013 broiler house 2 B1 CipNxSSuT 0.6405
85 SI-X-01 S-34/10 Feb 2010 broiler house 1 F CipNxSSuT 0.1815
86 S-176/10 Sept 2010 broiler house 2 A1 CipNxSSuT -0.0545
87 SI-X-02 S-73/12 Apr 2012 na A1 ACipNxSSuT 0.079
a
The origin of the isolates is indicated by farm ID, consisting of capital letters SI-A, SI-B, SI-C (standing for three major food business operators, FBOs), and SI-X (standing for autonomously operating holdings,
AOHs); while digits designate individual subcontractors of a certain FBO. b Resistance pattern code: S, streptomycin, Su, sulfamethoxazole, Cip, ciprofloxacin, Nx, nalidixic acid, A, ampicillin, and T, tetracycline.
c
Average biofilm formation measured as optical density at 595 nm (OD595 ). d Isolates classified as persistent. e Not applicable. f Test not performed. g Data not recorded.
Antimicrobial Resistance Distribution of MICs (mg/L)

≤ >
% 0.008 0.015 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 64 128 256 512 1024 1024
Ampicillin 5.7 1 30 38 12 1 5
Cefotaxime 0 21 38 26 2
Ceftazidime 0 18 49 19 1
Chloramphenicol 0 17 41 26 3
Ciprofloxacin 87.4 6 5 3 26 39 8
Colistin 0 87
Florfenicol - 18 42 21 6
Gentamicin 0 31 52 4
Kanamycin - 85 1 1
Nalidixic acid 87.4 9 1 1 76
Streptomycin 72.4 1 9 14 39 19 4 1
Sulfamethoxazole 88.5 1 5 4 77
Tetracycline 88.5 8 2 2 1 24 50
Trimethoprim 0 86 1
Figure 1: Distribution of MICs and resistance (%) in Salmonella Infantis isolates (n=87) from broilers, 2007–2013.
densities (OD595 ) were measured before the plates were resistance to streptomycin was also notable (72.4%). Reduced
gently washed once with sterile distilled water (SDW). The susceptibility was found for ampicillin (5.7%). Acquired resis-
plates were dried at room temperature before the addition tance to third-generation cephalosporins, chloramphenicol,
of 220 𝜇l of 1% crystal violet (Sigma-Aldrich, St. Louis, MO, colistin, gentamicin, and trimethoprim was not detected. The
USA). After a 30-minute incubation at room temperature, results indicate that the selected isolates did not belong to the
the plates were washed three times with SDW. Then, 220 group of extended-spectrum 𝛽-lactamase producing (ESBL)
𝜇l ethanol:acetone (70:30, w:w) was added, followed by bacteria. Distribution of MICs is shown in Figure 1.
the incubation for 10 minutes at room temperature. OD595
were measured after the bound dye was dissolved using
3.2. PFGE. A remarkable genetic homogeneity was noticed
ethanol:acetone. For each strain, the result was calculated by
as a vast majority of isolates (75/87) showed >90% profile
subtracting the median OD595 of the three parallels of the
similarity. Five clusters (A to E) and 16 profiles (A1-3, B1-3,
control (test broth only) from the median OD595 of the three
C1-4, D1-2, E1-2, F, and G) were defined. Representative PFGE
parallels of the sample. Two independent experiments were
profiles are shown in Figure 2.
performed using freshly prepared reagents and media.
Cluster A comprised 35 isolates originating from 12
subcontractors of FBO SI-A, 11 subcontractors of FBO SI-C,
2.6. Statistics. Statistical analyses were performed using and both AOHs (Table 2). Almost all (94.3%) of the isolates
Excel (Microsoft, Redmond, WA, USA). in cluster A expressed PFGE profile A1, which was also the
most prevalent PFGE profile among the isolates analysed in
3. Results this study as it was found in 37.9% of isolates.
Cluster B consisted of 30 isolates obtained from the sam-
3.1. Antimicrobial Susceptibility Testing. The majority of iso- ples collected almost exclusively at the subcontractors of FBO
lates (80/87; 92%) were resistant to at least one or more SI-C. Only two isolates within this cluster originated from
antimicrobials, and only 7 out of 87 isolates (mostly from year subcontractors of FBO SI-A (Table 2). The most common
2007) were susceptible to all 14 antimicrobials tested. Mul- PFGE profile in this cluster was B1, identified in 93.3% of the
tidrug resistance was detected in 88.5% (77/87) of the isolates. isolates. In addition, this PFGE profile was the second most
By far the most common resistance pattern was CipNxSSuT, prevalent in the present study, shared by 32.2% of the isolates.
expressed by 65.5% (58/87) of the isolates. Resistance pattern Similar to cluster B, cluster C contained the isolates
CipNxSuT was the second most frequent, despite being related to the subcontractors of a single FBO, in this case SI-
exhibited by a considerably lesser number of isolates (15/87; A, with the exception of one isolate. The PFGE profile C1 was
17.2%). The highest proportion of resistance was observed in identified in 7 out of 10 isolates (Table 2).
tetracyclines (88.5% of isolates), sulfonamides (88.5%), and The isolates connected to FBO SI-B grouped together in
quinolones (nalidixic acid and ciprofloxacin, 87.4% each). The cluster D, mostly sharing the PFGE profile D1 (6/7 isolates).
Table 2: Occurrence of Salmonella Infantis PFGE profiles at broiler chicken holdings from 2007 to 2013.
PFGE profile No. of isolates (n=87) FBO/AOHa Years

A1 33 SI-A (nb =11), SI-C (n=12), SI-X01 (n=1), SI-X02 (n=1) 2008-2013
A2 1 SI-A 2012
A3 1 SI-A 2012
B1 28 SI-A (n=1), SI-C (n=12) 2009-2013
B2 1 SI-C 2011
B3 1 SI-A 2010
C1 7 SI-A 2010-2013
C2 1 SI-A 2012
C3 1 SI-A 2012
C4 1 SI-C 2011
D1 6 SI-B 2007-2008
D2 1 SI-B 2007
E1 1 SI-C 2013
E2 2 SI-A, SI-C 2013, 2010
F 1 SI-X-01 2010
G 1 SI-C 2010
a
Food business operator/autonomously operating holding. b Number of subcontracting farms.
PFGE XbaI PFGE XbaI

100
Isolate ID Resistance pattern PFGE profile No. of isolates/profile

70
80
90
141/12 ACipNxSSuT A2 1
78/13 CipNxSSuT A1 33
261/12 CipNxSuT A3 1
251/11 CipNxSuT B2 1
99/10 CipNxSuT B3 1
186/11 CipNxSSuT B1 28
163/11 CipNxSSuT C1 7
251/12 CipNxSuT C2 1
34/10 CipNxSSuT F 1
1/10 CipNxSuT G 1
131/07 - D2 1
222/08 - D1 6
124/13 - E1 1
149/10 CipNxSSuT E2 2
Figure 2: Sixteen representative PFGE profiles of Salmonella Infantis isolates selected from a total of 87 isolates included in the study.
The smallest cluster E comprised three isolates from three that different housing objects within the same holding were
farms related to FBO SI-A and SI-C (Table 2). Two unique sampled in six cases (SI-A-02, SI-A-08, SI-A-13, SI-C-08, SI-
PFGE profiles were identified, which occurred in 2010 on two C-22, and SI-X-01; see Table 1).
farms (Figure 2).
Analysis of the isolates from holdings with multiple S. 3.3. Biofilm Formation. Strains with OD595 values between 0
Infantis-positive samples revealed the following situation: in and 0.5 were considered as weak biofilm producers, strains
8 out of 17 cases (at holdings SI-A-01, SI-A-04, SI-B-02, SI- with OD595 between 0.5 and 2.5 as medium to high biofilm
C-01, SI-C-07, SI-C-09, SI-C-12, and SI-C-21; see Table 1), producers, and strains with OD595 above 2.5 as very high
isolates with the same PFGE profile were retrieved from all biofilm producers. Average biofilm formation measured as
samples collected within a respective holding, regardless of OD595 for all strains tested was 0.42±0.17 (standard devi-
the time span between samplings (range 6 months to 4 years). ation). There were large differences between the strains
Among these, a common profile (C1) has also been observed regarding the ability to form biofilm (Figure 3).
in different poultry houses of the same holding (SI-A-01) in The average biofilm formation for persistent strains was
the period of two years (Table 1). Isolates with distinct PFGE higher than for presumably nonpersistent strains, but the
profiles were detected in nine cases, but it should be noted difference was not significant as the standard deviation was
1.5
Biofilm formed (OD at 595nm)
0.5
0
S-5/07
S-10/08
S-34/10
S-99/10
S-27/11
S-47/11
S-18/12
S-57/12
S-82/12
S-11/13
S-29/13
S-79/13
S-158/07
S-222/08
S-140/10
S-245/10
S-166/11
S-186/11
S-191/11
S-250/11
S-143/12
S-160/12
S-219/12
S-257/12
S-142/13
S-209/13
S-196/10a
S-101/12
−0.5
Figure 3: Average biofilm formation of 84 Salmonella Infantis isolates from broilers, shown as optical density values measured at 595 nm
(OD595 ).
1.2 biofilm than profile A1 (p<0.05), and profile C1 produced

significantly more biofilm than profile D1 (p<0.05). Due to
1 the large standard deviation between the strains within one
group, there was no significant difference between profiles A1
and C1 (p= 0.06), A1 and D1 (p= 0.09), B1 and C1 (p= 0.91),
Biofilm formed (OD at 595nm)
0.8 and B1 and D1 (p= 0.06).

Among the 84 strains included in biofilm formation
0.6 testing, the two predominant resistance patterns were Cip-
NxSSuT (n= 52, average OD595 = 0.50±0.19) and CipNxSuT
(n=12, average OD595 = 0.33±0.15). There was no significant
0.4
difference in biofilm formation between the strains with
mentioned resistance patterns (Student’s t-test, p=0.29).
0.2
0 4. Discussion
The number of S. Infantis-positive broiler flocks in Slovenia
−0.2 has steadily increased in the past eight years from 0.7% of
Presumed non-persistent positive flocks in 2010 to 11.5% in 2017 (Maja Bajt, personal
Persistent communication). Detection of S. Infantis in minced meat,
Figure 4: Biofilm formation by persistent Salmonella Infantis meat preparations, and meat products is not compliant with
strains and presumably nonpersistent Salmonella Infantis strains. the EU regulation concerning the microbiological food safety.
The results are shown as average optical density measured at 595 nm In the national zoonosis monitoring program from 2013 to
(OD595 ) from two independent experiments. The results are shown 2015, S. Infantis was detected in 4.5% of the food samples
with standard deviation. of animal origin. The prevalence of Salmonella spp. was
found to be the highest in fresh broiler meat and broiler
meat preparations (28.4% and 26.7%, respectively), and the
predominant Salmonella serovar was S. Infantis (92% and
large and the difference in ability to form biofilm was small 100%, respectively) [16]. The increase of Salmonella-positive
(Student’s t-test, p=0.44) (Figure 4). broiler flocks, which was due to increase of S. Infantis-
Of the strains tested for biofilm formation (n=84), profiles positive flocks, raised the interest of veterinary authorities
A1 (n=32), B1 (n=28), C1 (n=7), and D1 (n=6) were the to conduct the study described herein, the first of its kind
most dominant. The average biofilm formation between regarding S. Infantis in Slovenia.
the profiles varied, but the standard deviation between the On the EU level, as reported from all Member States
strains within one profile was large (Figure 5). Student’s t-test in 2017, S. Infantis accounted for 46.5% and 50.6% of all
analysis showed that profile B1 produced significantly more Salmonella isolated from broiler flocks and broiler meat,
1.4
1.2
Average biofilm formation (OD at 595nm)

1
0.8
0.6
0.4
0.2
−0.2
−0.4
A1
B1
C1
D1
Figure 5: Biofilm formation by the different dominant PFGE profiles of Salmonella Infantis isolates, shown as optical density values at 595
nm (OD595 ). The results are given with the standard deviation of the strains within the PFGE profile.
respectively [2]. This indicates that this serovar has the over time. Moreover, historical isolates did not share any
capability to spread along the entire broiler production chain obvious resistance pattern, while most of the more recent
and can persist in the farm environment once it has become strains had a common combined resistance pattern. These
established. findings correlate with the present study. Specifically, S. Infan-
The results from the present study demonstrated a high tis isolated in 2007 from the broilers raised at subcontractors
level of resistance to ciprofloxacin (76/87; 87.4%), sulfon- of FBO SI-B were either susceptible to all antimicrobials
amides (77/87; 88.5%), tetracyclines (77/87; 88.5%), nalidixic tested or resistant to only one antimicrobial agent. Unfor-
acid (76/87; 87.4%), and streptomycin (63/87; 72.4%). These tunately, the number of isolates tested was limited, and for
findings are in concordance with the situation in Europe, as this reason it would be interesting to investigate in more
most EU Member States reported extremely high levels of detail the occurrence of antimicrobial resistance in S. Infantis
resistance to ciprofloxacin and nalidixic acid (overall 94.1% isolates in Slovenia. Already in the following year, isolates
and 94.1%, respectively). Overall resistance to sulfamethox- with the most common MDR pattern (CipNxSSuT) emerged
azole and tetracycline at the EU level was 78% and 75.6%, on the broiler farms and have been regularly detected in
respectively [3]. In addition, >80% of S. Infantis isolates from broiler flocks ever since, though occasionally complemented
broilers, tested for MDR at the EU level, were MDR and with the resistance to ampicillin. Interestingly, the isolates
displayed a wide range of different MDR patterns. However, susceptible to all antimicrobials tested formed a small PFGE
>97% MDR patterns included resistance to ciprofloxacin cluster D together with two isolates showing resistance to one
and/or nalidixic acid, as well as resistance to sulfamethoxa- antimicrobial each (Table 2). Otherwise, there was no cor-
zole and tetracycline. This was the most common resistance relation observed between the PFGE profiles and resistance
pattern in S. Infantis from broiler meat (72.7%) and broilers patterns. The most prevalent PFGE profile A1 was associated
(78.4%) [3]. The results presented herein correlate with the with all MDR patterns, and the second most common profile
data reported by EFSA as the vast majority of S. Infantis B1 with the two most common MDR patterns (CipNxSSuT
MDR patterns in Slovenia included resistance to the above- and CipNxSuT).
mentioned antimicrobials. A high genetic homogeneity has been observed within
It seems that MDR in S. Infantis emerged in the new the analysed S. Infantis isolates as 16 profiles were defined
millennium. Gal-Mor et al. [17] reported notable differences among 87 isolates, with a vast majority of them showing
between the strains isolated before and after 2007. Historical >90% profile similarity. These results are in correspondence
strains (before 2007) were either susceptible to all antimicro- with the findings from several other studies [18–20] including
bials tested or resistant to only one antimicrobial agent. On Nogrady et al. [21] who revealed close relatedness between
the contrary, none of the more recent isolates (2007-2009) the isolates (16 PFGE profiles in five clusters among 138
were susceptible to all antimicrobials tested and most of the isolates); moreover, 66% of the isolates tested belonged to
isolates were MDR, which suggested resistance acquisition the same genetic clone, which emerged in Hungary in both
humans and broilers. The genetic homogeneity of S. Infantis p=0.54) (unpublished data). For this reason, it is considered
is supposed to be a consequence of possible clonal expansion as likely that adding a 10% instead of a 23% overnight culture
and establishment of specific PFGE profiles [18, 19]. In a has very limited impact on the result.
study by Hauser et al. [22] most isolates were assigned to two S. Infantis from chicken carcasses was in general classified
clusters, comprising 40.2% and 34.5% of isolates, respectively. as a moderate biofilm producer but showed high variability
These results are in accordance with the findings of the in the biofilm-forming ability [10], which is similar to S.
present study in which two PFGE profiles encompassed Infantis isolates of pork origin [23]. The overall biofilm-
37.9% and 32.2% of all isolates. The predominance could forming ability of the isolates collected in the present study
be explained either by the prevalence of a certain clone was determined as weak/moderate (median OD595 0.28). The
in the environment or by a common source of infection. majority of isolates (73.8%) were weak biofilm producers, and
Namely, the most frequently identified PFGE profile A1 was none of the isolates exhibited a very high biofilm-forming
detected both at AOHs and at the subcontractors of FBOs ability. There were also substantial differences noted in the
SI-C and SI-A. The fact that the FBOs maintained their own ability of tested isolates to produce biofilm (OD595 range from
breeding flocks ruled out the possibility of a common origin -0.229 to 1.857). We also attempted to compare the biofilm-
of animals reared by different FBOs. Therefore, the reason forming ability of the persistent and presumably nonper-
for a widespread dissemination of the PFGE profile A1 could sistent strains. Even though average biofilm formation for
be its prevalence in the environment, along with its temporal persistent strains was higher than for presumed nonpersistent
and genetic stability. Conversely, the case of PFGE profile B1, strains, the difference was not significant as the standard
which was found almost exclusively (with one exception to deviation was large.
the rule) at the holdings of SI-C subcontractors, pointed out a Four holdings were presumed to have persistent S. Infan-
probable common source of infection (feed, water, and envi- tis strains as the same PFGE profile was repeatedly identified
ronment). In a previous study, conducted after the cleaning in strains obtained in different time periods (range 1 year 7
and disinfection of the broiler house before repopulation, we months to 4 years 1 month) in the same broiler house. The
demonstrated the presence of S. Infantis in more than 50% presumably persistent strains were of PFGE profiles A1, B1,
of environmental samples taken, including floor, ventilators, and C1, and of resistance patterns CipNxSSuT and CipNxSuT.
drinking troughs, boots, and a high pressure washer (unpub- There was a variation observed regarding the biofilm-forming
lished data). This indicates improper/ineffective sanitation ability of the isolates collected within individual holdings
procedures. with presumably persistent strains. It seems that the biofilm-
Biofilms increase microbial tolerance to chemical, physi- forming ability increased with time, as the isolates from
cal, and biological agents, and the ability to form biofilms has 2012 and 2013 showed higher OD595 values compared to the
been identified as an important but not the only contributing isolates before 2010. There was no obvious reason found for
factor for the persistence of bacteria in the environment this observation except the differences in storage and number
[10]. Being a good biofilm producer only gives an advan- of passages. However, Schoneville et al. [12] reported that 10
tage. Several hypotheses are related to the high persistence passages of selected isolates did not affect their phenotypic
of Salmonella in poultry houses, such as the absence of biofilm-forming capacity.
standardised cleaning and disinfection guidelines, inaccurate
use of disinfectants, incorrect hardness and temperature of
cleaning water, high contents of protective compounds in
5. Conclusions
poultry houses, and biofilm development, as reviewed by
Marin et al. [8]. However, Marin et al. [8] demonstrated The results of this study complement the current knowledge
that the disinfectants used in infected poultry houses are on S. Infantis in broiler flocks. The strains isolated after 2007
more important than the capacity of Salmonella to form were characterised by a high resistance to antimicrobials
biofilm. showing a widespread MDR pattern, genetic homogeneity,
Biofilm-forming ability of Salmonella may vary both and low average biofilm-forming ability. It seems that, as
between and within serovars. Certain serotypes, e.g., S. reported previously for S. Infantis from Hungary which was
Agona, showed significantly more biofilm formation in com- characterised as a poor biofilm producer despite being the
parison to other serotypes [10, 11]. The method for testing single most dominant serotype in the country [12], S. Infantis
biofilm-forming capacity in the present study was based on persistence on broiler farms could be more related to its
a previously described method with a modification of the widespread occurrence in broiler production and ineffective
percentage of overnight culture added to the biofilm growth disinfection protocols than to its ability to form biofilm.
medium. In the present assay, a 10% overnight culture (20 𝜇l Biosafety guidelines and disinfection practices on the farms
+ 180 𝜇l) was used, while in the study by Vestby et al. [10], as should therefore be reviewed, and radical measures to limit
much as 23% (30 𝜇l + 100 𝜇l) was used. This has been seen the spread of the microbe should be discussed.
to have very little influence on the final amount of biofilm
formed after two days of incubation. The average biofilm
produced by three E. coli strains and four Salmonella strains Data Availability
after two days when a 23% overnight culture was added was
1.57 (OD595 ). When adding as little as a 0.1% overnight culture The data used to support the findings of this study are
of the same strains, the OD595 was 1.78 (Student’s t-test, available from the corresponding author upon request.
Conflicts of Interest to Humans in Italy between 2011 and 2014,” PLoS ONE, vol. 10,
no. 12, 2015.
The authors declare that there are no conflicts of interest [6] M. Pate, M. Golob, J. Micunovic, J. Avberek, I. Zdovc, and M.
regarding the publication of this article. Ocepek, “Salmonella Infantis in broiler chicken flocks: what do
the results of genotyping and susceptibility testing tell us?” in
Slovenian Veterinary Research, G. Majdič, Ed., 16, pp. 197-198,
Authors’ Contributions Slovenian Veterinary Congress, Portorož, 5th edition, 2014.
Mateja Pate, Jasna Mičunovič, and Matjaž Ocepek designed [7] R. Davies and M. Breslin, “Observations on Salmonella contam-
the work. Jasna Mičunovič performed the cultivation and ination of commercial laying farms before and after cleaning
identification of the strains. Mateja Pate analysed and inter- and disinfection,” Veterinary Record, vol. 152, no. 10, pp. 283–
preted the PFGE data. Majda Golob performed antimicrobial 287, 2003.
susceptibility testing and interpreted the results, and Lene [8] C. Marin, A. Hernandiz, and M. Lainez, “Biofilm development
Karine Vestby carried out the biofilm-forming capacity tests, capacity of Salmonella strains isolated in poultry risk factors and
interpreted the results, and performed the statistics. Mateja their resistance against disinfectants,” Poultry Science, vol. 88,
no. 2, pp. 424–431, 2009.
Pate wrote the manuscript and Jasna Mičunovič, Majda
Golob, Lene Karine Vestby, and Matjaž Ocepek critically [9] C. Latasa, A. Roux, A. Toledo-Arana et al., “BapA, a large
reviewed the text and contributed to the final version with secreted protein required for biofilm formation and host col-
onization of Salmonella enterica serovar Enteritidis,” Molecular
comments, corrections, and suggestions.
[10] L. K. Vestby, T. Møretrø, S. Langsrud, E. Heir, and L. L. Nesse,
Acknowledgments “Biofilm forming abilities of Salmonella are correlated with
persistence in fish meal- and feed factories,” BMC Veterinary
Maja Bajt (The Administration of Republic of Slovenia for Research, vol. 5, article 20, 2009.
Food Safety, Veterinary and Plant Protection) is gratefully [11] M. Dı́ez-Garcı́a, R. Capita, and C. Alonso-Calleja, “Influence of
acknowledged for providing broiler flock data and for serotype on the growth kinetics and the ability to form biofilms
critically reading the manuscript. The authors also thank of Salmonella isolates from poultry,” Food Microbiology, vol. 31,
Alenka Magdalena Usenik (Veterinary Faculty Ljubljana) for no. 2, pp. 173–180, 2012.
her technical assistance. The work related to PFGE typing [12] E. Schonewille, L. L. Nesse, R. Hauck, D. Windhorst, H.
and antimicrobial susceptibility testing was funded by The M. Hafez, and L. K. Vestby, “Biofilm building capacity of
Administration of Republic of Slovenia for Food Safety, Salmonella enterica strains from the poultry farm environ-
Veterinary and Plant Protection. Biofilm-forming capacity ment,” FEMS Immunology & Medical Microbiology, vol. 65, no.
testing was supported by the Slovenian Research Agency 2, pp. 360–365, 2012.
[research core funding no. P4-0092]. [13] “European Committee on Antibiotic Susceptibility Testing,”
http://www.eucast.org.
[14] “European Union Reference Laboratory – Antimicrobial Resis-
References tance,” http://www.eurl-ar.eu.
[1] W. Messens, L. Vivas-Alegre, S. Bashir, G. Amore, P. Romero- [15] E. M. Ribot, M. A. Fair, R. Gautom et al., “Standardization of
Barrios, and M. Hugas, “Estimating the public health impact pulsed-field gel electrophoresis protocols for the subtyping of
of setting targets at the European level for the reduction of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet,”
zoonotic Salmonella in certain poultry populations,” Interna- Foodborne Pathogens and Disease, vol. 3, no. 1, pp. 59–67, 2006.
tional Journal of Environmental Research and Public Health, vol. [16] “Administration of Republic of Slovenia for Food Safety, Veteri-
10, no. 10, pp. 4836–4850, 2013. nary and Plant Protection,” in Proceedings of the Annual report
[2] European Food Safety Authority and European Centre for Dis- on zoonoses and zoonotic agents, pp. 13–19, 2015 (Slovenian).
ease Prevention and Control, “The European union summary [17] O. Gal-Mor, L. Valinsky, M. Weinberger et al., “Multidrug
report on trends and sources of zoonoses, zoonotic agents and resistant salmonella enterica serovar infantis, Israel,” Emerging
food-borne outbreaks in 2017,” EFSA Journal, vol. 16, no. 12, Infectious Diseases, vol. 16, no. 11, pp. 1754–1757, 2010.
Article ID 5500, p. 262, 2018.
[18] N. Nógrády, M. Király, R. Davies, and B. Nagy, “Multidrug
[3] European Food Safety Authority and European Centre for Dis- resistant clones of Salmonella Infantis of broiler origin in
ease Prevention and Control, “The European Union Summary Europe,” International Journal of Food Microbiology, vol. 157, no.
Report on antimicrobial resistance in zoonotic and indicator 1, pp. 108–112, 2012.
bacteria from humans, animals and food in 2016,” EFSA Journal, [19] M. Rahmani, S. M. Peighambari, C. A. Svendsen, L. M.
vol. 16, no. 2, p. 270, 2018. Cavaco, Y. Agersø, and R. S. Hendriksen, “Molecular clonality
[4] N. Nógrády, G. Kardos, A. Bistyák et al., “Prevalence and and antimicrobial resistance in Salmonella enterica serovars
characterization of Salmonella infantis isolates originating from Enteritidis and Infantis from broilers in three Northern regions
different points of the broiler chicken-human food chain in of Iran,” BMC Veterinary Research, vol. 9, no. 66, 2013.
Hungary,” International Journal of Food Microbiology, vol. 127, [20] M. Velhner, G. Kozoderović, E. Grego et al., “Clonal spread of
no. 1-2, pp. 162–167, 2008. salmonella enterica serovar infantis in Serbia: Acquisition of
[5] A. Franco, P. Leekitcharoenphon, F. Feltrin et al., “Emergence mutations in the topoisomerase genes gyrA and parC leads to
of a Clonal Lineage of Multidrug-Resistant ESBL-Producing increased resistance to fluoroquinolones,” Zoonoses and Public
Salmonella Infantis Transmitted from Broilers and Broiler Meat Health, vol. 61, no. 5, pp. 364–370, 2014.
[21] N. Nógrády, Á. Tóth, Á. Kostyák, J. Pászti, and B. Nagy,

“Emergence of multidrug-resistant clones of Salmonella Infan-
tis in broiler chickens and humans in Hungary,” Journal of
Antimicrobial Chemotherapy, vol. 60, no. 3, pp. 645–648, 2007.
[22] E. Hauser, E. Tietze, R. Helmuth et al., “Clonal dissemination
of Salmonella enterica serovar Infantis in Germany,” Foodborne
Pathogens and Disease, vol. 9, no. 4, pp. 352–360, 2012.
[23] G. A. A. Castelijn, J.-A. Parabirsing, M. H. Zwietering, R.
Moezelaar, and T. Abee, “Surface behaviour of S. Typhimurium,
S. Derby, S. Brandenburg and S. Infantis,” Veterinary Microbiol-
ogy, vol. 161, no. 3-4, pp. 305–314, 2013.
Hindawi
https://doi.org/10.1155/2019/8569459
Research Article
Pet Food Factory Isolates of Salmonella Serotypes Do
Not Demonstrate Enhanced Biofilm Formation Compared to
Serotype-Matched Clinical and Veterinary Isolates
Amreen Bashir ,1 Ansar Azeem,1 Yvonne Stedman,2 and Anthony C. Hilton 1
1
School of Life & Health Sciences, Aston University, Birmingham, B4 7ET, UK
2
Mars, Incorporated, McLean, VA, USA
Correspondence should be addressed to Amreen Bashir; bashira6@aston.ac.uk
Received 9 July 2018; Revised 26 November 2018; Accepted 18 December 2018; Published 29 January 2019
Guest Editor: Teresa Lemsaddek
Copyright © 2019 Amreen Bashir et al. This is an open access article distributed under the Creative Commons Attribution License,
Environmentally persistent Salmonella in the pet food factory environment has been described, with biofilm formation suggested
as a candidate mechanism contributing to their persistence. In this study the ability of a panel of Salmonella isolates from factory,
clinical, and veterinary sources was investigated for their ability to form biofilms at 24 and 48 hours. The effect of nutrient availability
and incubation time on biofilm formation was investigated using full strength and diluted 1/20 TSB media at 37∘ C, 25∘ C, 15∘ C, and
10∘ C. Results highlighted that all the Salmonella isolates were able to form biofilms in both nutrient conditions and this was highly
correlated with temperature. At 25∘ C, biofilm formation was enhanced in diluted 1/20 TSB and increased incubation time (48h)
(p= <0.001). However, this was not observed at 10∘ C, 15∘ C, or 37∘ C. None of the factory isolates demonstrated enhanced biofilm
formation in comparison to serotype-matched isolates from veterinary and clinical sources. Salmonella enterica Senftenberg 775W
was the strongest biofilm former at 15∘ C, 25∘ C, and 37∘ C in all the conditions tested (p=<0.05). Biofilm formation is an important
mechanism of environmental persistence in the food manufacturing environment; however, there is no evidence of an enhanced
biofilm-producing phenotype in factory persistent strains.
1. Introduction surfaces are in contact [7], and in the food industry this
is clearly problematic in relation to their control. Biofilms
An important factor enabling environmental survival of are difficult to control in areas of the factory environment
microorganisms, especially in nutrient depleted conditions, where effective cleaning is compromised [8]. In addition
is their ability to form biofilms [1, 2]. A biofilm is classified as to persistence, detached cells from the biofilm can lead
a population of microbial cells that is associated with a surface to disseminated contamination of the wider production
and enclosed in a matrix of primarily polysaccharide material environment and food products. Salmonella spp. have been
[3]. The cells in a biofilm produce proteinaceous substances reported to form biofilms on a range of surfaces found
which allow protection from environmental stresses. in the food manufacturing environment including plastic
Reports have highlighted the presence of problematic, waste water pipes [7, 9], glass [10], concrete floors [11],
persistent microorganisms such as Salmonella, L. monocyto- and stainless steel [7, 12, 13]. The development of biofilms
genes, and E. coli in the microflora of the food manufacturing on surfaces has been suggested to be one of the principal
environment and suggested that persistence of the pathogens mechanisms for the survival and persistence of Salmonella
may be contributed to by multiple mechanisms [4, 5]. in food manufacturing environments, and some strains have
The protective nature of the biofilm makes it a candi- been reported to survive on the surface of equipment for
date mechanism to explain the environmental persistence many years [7, 14].
observed in some food factory isolates of Salmonella [6]. Environmental persistence of Salmonella has been asso-
Biofilm formation can occur where microorganisms and ciated with their ability to form biofilms [7, 12]; however, it
Table 1: Challenge panel of isolates. Panel of isolates selected for different environments were serotype matched. Veterinary
a majority of the investigations detailing the origin of the isolate. strains from canine isolates were obtained from the Veteri-
Serotype-matched clinical and veterinary isolates were sourced for nary Laboratory Agency, Surrey, UK (VLA), and included
the pet food factory isolates of S. Senftenberg and S. Schwarzen- S. Senftenberg (VLA) and S. Schwarzengrund (VLA). S.
grund to balance serotypes. Schwarzengrund, USA, caused an outbreak associated with
Strain Source pet food in 2009 and the S. Schwarzengrund (FSL S5-458) is
the American clinical isolate which was isolated from patients
S. Senftenberg 775W ATCC 43845
during the outbreak. The heat resistant strain S. Senftenberg
S. Senftenberg Pet food factory UK
775W is well-documented and unlike other strains it is a
S. Senftenberg VLA nonhydrogen sulphide producer. Globally, S. Senftenberg
S. Schwarzengrund FSL S5-458 American clinical 775W (ATCC 43845) is not a major cause of salmonellosis
S. Schwarzengrund Pet food factory USA but outbreaks are commonly associated with contaminated
S. Schwarzengrund VLA poultry and plant derivative food. S. Typhimurium SL1344
S. Typhimurium SL1344 NCTC 13347 was included in the panel as it has been typed and literature
S. Livingstone Pet food factory UK shows that the serotypes Typhimurium and Enteritidis are
S. Kedougou Pet food factory UK the leading cause of Salmonella disease. All were stored on
S. Montevideo Pet food factory UK Microbank beads (Fisher Scientific, UK) and maintained at
L. monocytogenes NCTC 11994 -80∘ C until required.
2.2. Pet Food Factory Environmental Monitoring

is currently unknown if pet food factory isolates demonstrate
an enhanced capability compared to Salmonella adapted to 2.2.1. Measurement of Relative Humidity and Ambient Air
other environments. The aim of this study therefore was to Temperature. The relative humidity (RH) and ambient tem-
establish the biofilm forming capacity of a panel of Salmonella perature of a factory producing heat extruded product subject
isolates at different temperatures and duration of incubation to ambient cooling were monitored every 10 minutes for
in both nutrient-rich and nutrient-deprived media. Having two months (May–July) using a Hygropalm-HP21 data logger
a better understanding of the role of biofilms as a potential (Rotronic, West Sussex, UK). The manufacturing cycle was
mechanism of persistence of food factory isolates will provide four-day production followed by three-day shutdown. These
valuable data necessary to control their persistence in food environmental data were used to inform the incubation
manufacturing environments. temperature of the biofilm production study.
2. Material and Methods 2.2.2. Biofilm Assay. The Salmonella biofilms were grown
in sterile polystyrene 96-well flat microtitre plates (Fisher
2.1. Bacterial Strains. A panel of ten Salmonella was created Scientific, UK), using a method as described by Stepanovic
comprising isolates known to be persistent in the pet food et al. [13]. Full strength Tryptone Soya Broth (TSB; Oxoid,
factory environment, veterinary, and well-characterised ref- Basingstoke, UK) and 1/20 TSB were prepared according to
erence strains (Table 1). Listeria monocytogenes (NCTC11994) manufacturer’s instructions and sterilised by autoclaving at
was included as a strong biofilm-forming positive control. 121∘ C for 15 minutes. Prepared media were stored at 4∘ C
The factory isolates originated from environmental swabs until required. A 230𝜇l volume of neat TSB and 1/20 TSB
collected at two pet food manufacturing sites producing were added to the wells in the microtitre plate. To prepare
dry complete pet food and wet food in tins and pouches. the standardised inoculum, a Microbank bead carrying each
Environmental swabs were collected daily at 20-40 sample strain was recovered from frozen storage and added to a
points based on factory size, number of systems, and sub- Universal tube containing 20ml of fresh TSB culture media.
processes. Persistent strains were defined as those isolated This was incubated with shaking for 18–24hrs at 37∘ C.
repeatedly from designated sample points within the factory Following incubation, a stock inoculum was prepared by
on more than eight independent occasions. All swab locations taking 5 ml of the TSB media and adding to 5 ml of fresh
were mapped and documented as part of the factory master TSB media in a sterile universal tube. The stock inoculum
sanitation program. was mixed by vortexing for 60 seconds. A 1ml volume of
Swabbing was conducted using sterile, cellulose sponge the stock inoculum was transferred into a disposable cuvette
swabs premoistened with 10ml sodium thiosulphate buffer (Sigma-Aldrich, UK) and the optical density (OD) at 600nm
and containing neutralizers of Tween 80 and Lecithin (TSC was noted. The stock inoculum was diluted as required by
Ltd., Lancashire, UK). Environmental swabs were collected the addition of fresh TSB media to generate a standardised
daily at 20-40 sample points based on factory size, num- inoculum concentration of 106 cfu/ml as established by
ber of systems, and subprocesses. All swab locations were previous OD calibration studies (data not shown). A 20𝜇l
mapped and documented as part of the factory master volume of standardised inoculum was added to the 230𝜇l
sanitation program. Pet food factory isolates included S. volume of neat TSB and 1/20 TSB in the microtitre plate and
Senftenberg, S. Livingstone, S. Kedougou, S. Montevideo, and incubated statically at 37∘ C, 25∘ C, 15∘ C, and 10∘ C for 24hrs or
S. Schwarzengrund (USA). As far as possible isolates from the 48hrs as required. For the 48hr plates the culture media were
Table 2: Environmental sampling of temperature and relative humid- The mean 24h and 48h biofilm density measurements for
ity in the preparation and packaging zones of the factory. Temperature each strain at the various temperature and media concen-
and relative humidity profiles of the preparation and packaging trations investigated are shown in Figures 1(a)–1(d). All the
room over a 60-day period. Monitoring was undertaken at 10- strains in the panel could form biofilm with S. Senftenberg
minute intervals. 775W being the strongest biofilm producer at 37∘ C, 25∘ C,
Preparation room Packaging room and 15∘ C. At all temperatures investigated; no association was
Temp ∘ C %RH Temp ∘ C %RH observed (p=>0.05) between the environmental source of the
AVERAGE 21.5 54.5 18.6 56.2 isolate and the biofilm density. As a general trend, stronger
STD DEVIATION 2.5 7.5 2.6 9.5
biofilms were produced as the temperature of incubation
increased from 10∘ C to 37∘ C.
MAXIMUM 29.2 79.3 26.2 72.8
At 25∘ C across the panel of isolates there was a signifi-
MINIMUM 15.6 30.5 14.7 34.6 cantly more established biofilm at 48h compared to 24h and at
MODE 21.2 54.9 16.6 63.1 1/20 TSB compared to neat TSB media (P=<0.01). This effect
of time and nutrient depletion on biofilm production was not
observed at the other temperatures investigated. A chi square
test revealed that at 10∘ C and 37∘ C there were no statistically
changed for fresh TSB or 1/20 TSB as appropriate, at 24hrs; significance differences between the ability of isolates to form
the spent culture media was removed with a pipette and 250𝜇l biofilms in neat or 1/20 TSB media and increased incubation
fresh media added and the plates returned to incubation for a time (p=>0.05). Analysis at 15∘ C revealed that all isolates
further 24 hours before being assayed for biofilm production. except S. Senftenberg factory produced statistically stronger
The biofilm assay was undertaken on 24hr and 48hr biofilms with 48h incubation (p=<0.01). Furthermore all of
incubated plates. The spent culture media were removed the isolates produced statistically stronger biofilms in diluted
with a pipette and each well was washed twice by gentle media compared to full strength at 24 hours (P=<0.01) with
irrigation with 300𝜇l of sterile distilled water (SDW). A the exception of S. Senftenberg factory and S. Typhimurium
250𝜇l volume of 100% methanol (Fisher Scientific, UK) was SL1344.
added to each well to fix the bacteria and incubated for 15 Comparison of the serotype-matched clinical, factory,
minutes before the methanol was removed with a pipette. and veterinary isolates of S. Schwarzengrund and S. Senften-
The plates were then air dried by incubation at ambient berg revealed that S. Senftenberg 775W was the strongest
temperature to evaporate the remaining methanol. A 250𝜇l biofilm producer across 15∘ C, 25∘ C, and 37∘ C (p=<0.05).
volume of crystal violet (CV) dye (Sigma-Aldrich, UK) was Both of the factory isolates did not demonstrate an enhanced
added to each well and biofilm biomass determined by crystal capacity to produce biofilms in comparison to serotype-
violet assay according to Stepanovic et al., 2014). The optical matched isolates in the neat and 1/20TSB media conditions.
density at 570nm of the liberated CV was measured using No other effect of serotype or strain origin was observed
a BIOTEK Elx808 Absorbance micro plate reader (Biotek, across the six isolates tested (p=0.067).
UK) and the OD data exported for statistical analysis using
ANOVA in STATISTICA version 10 (USA). Each experiment
was repeated four times. 4. Discussion
Salmonella is able to persist in the food manufacturing envi-
2.3. Statistical Analysis. An ANOVA was conducted to inves-
ronment for years [15]. Biofilms are particularly problematic
tigate the differences across the four temperatures. Fur-
as they represent a persistent focus of Salmonella which is
ther data mining included extracting the serotype-matched
difficult to control and can be a source of disseminated, post-
data for the clinical, factory, and veterinary isolates of S.
process contamination. Previous studies have highlighted
Schwarzengrund and S. Senftenberg and conducting an
the role of Salmonella contamination of factory surfaces
ANOVA to explore if any environment driven effects were
and the production environment [16–18]. However, there is
present.
limited knowledge on the underlying mechanisms by which
environmentally adapted factory isolates of Salmonella may
3. Results demonstrate enhanced survival in comparison to those from
other environments. This study investigated a panel of ten
A summary description of the relative humidity and ambient defined isolates of Salmonella originating from the pet food
temperature of the pet food factory environment monitored factory, veterinary, and clinical environment by comparing
over a 60-day period is presented in Table 2. The average their ability to form biofilms attached to surfaces. The effect
recorded temperature was 21.5∘ C with 54.5% RH. The max- of temperature, incubation time, and media concentration on
imum temperature reached was 29.2∘ C with 79.3% RH and biofilm formation was investigated.
the minimum temperature was 15.6∘ C with 30.5% RH. The Joseph et al. [11] investigated the ability of poultry isolates
average temperature recorded in the packaging room was of Salmonella to form biofilms on stainless steel, plastic,
18.6∘ C with 56.2% RH. The maximum in this zone reached and cement and found that the highest density of biofilm
26.2∘ C with 72.8% RH and the minimum temperature fell to formed on plastic, followed by cement and finally stainless
14.7∘ C with 34.6% RH during factory shutdown. steel. Other studies also indicated that Salmonella and L.
10 degrees 15 degrees
0.6 1.8
1.6
absorbance @570nm
0.5
absorbance e570nm
1.4
0.4 1.2
1
0.3
0.8
0.2 0.6
0.4
0.1
0.2
0 0
Listeria monocytogenes
S. Typhimurium SL1344
S.Senftenberg 775w
S.Schwarzengrund clinical
S. Kedougou factory
S.Montevideo factory
S.Schwarzengrund factory
S.Senftenberg factory
S.Schwarzengrund vet
S.Senftenberg vet
S.Livingstone factory
S.Senftenberg 775w
S. Kedougou factory
S.Senftenberg vet
Strains Strains
24h neat TSB 48h neat TSB 24h neat TSB 48h neat TSB
24h 1/20 TSB 48h 1/20 TSB 24h 1/20 TSB 48h 1/20 TSB
(a) (b)
37 degrees
25 degrees 3.5
4.5
4 Absorbance @570nm 3
absorbance @570nm
3.5 2.5
3
2
2.5
2 1.5
1.5 1
1
0.5
0.5
0 0
S.Senftenberg vet
S.Senftenberg 775w
S. Kedougou factory
S.Senftenberg vet
S.Senftenberg 775w
S. Kedougou factory
Strains Strains
24h neat TSB 48h neat TSB
24h neat TSB 48h neat TSB 24h 1/20 TSB 48h 1/20 TSB
24h 1/20 TSB 48h 1/20 TSB
(c) (d)
Figure 1: Biofilms. Mean 24h and 48h biofilm density measurements for each strain at 37 C, 25 C, 15 C, and 10∘ C in neat TSB and 1/20 TSB ∘ ∘ ∘
media. Error bars represent standard deviation of the mean.
monocytogenes adhere in higher numbers to hydrophobic 29∘ C, with the highest temperature in the packaging zone
materials such as plastic [3, 19]. Considering adhesion is the being 26∘ C. Other studies, modelling and predicting the
primary step in biofilm formation, it could explain why all biofilm capabilities of Salmonella and investigations into the
the isolates investigated in this study are able to form good survival of Salmonella, have also been conducted at similar
biofilm on plastic surfaces [13]. temperatures to represent conditions present in dry food
The incubation temperatures used in the currently manufacturing plants [17, 20, 21].
described study were selected to model those typical of All of the Salmonella isolates investigated could form
a large UK-based pet food manufacturing environment, biofilms, independent of the environment from which they
and, with exception of the S. Schwarzengrund, the same were isolated, and the strength of biofilm formation was not
environmental conditions from which the factory strains directly linked to serotype (Figures 1(a)–1(d)). One notable
used in this study were isolated. These realistic environmental exception to this was S. Senftenberg 775W which, with the
conditions represented temperature fluctuations during peri- exception of 10∘ C (Figure 1(a)), under all other conditions
ods of production and shut-down. During the factory shut- investigated produced significantly stronger biofilms com-
down period temperatures fell to 15∘ C and during production pared to the other Salmonella isolates (p=<0.05). S. Senften-
the heat processing through cooling and packaging zones berg 775W is a known heat resistant strain and on this basis is
of the factory showed temperatures ranging from 15∘ C to frequently used as a challenge organism in the food industry
[22, 23]. The underlying mechanism of the enhanced heat Bacteria in food processing environments are likely to be
resistance demonstrated by S. Senftenberg 775W is poorly exposed to differing levels of available nutrients depending on
understood; however, on the basis of observation made here, their location in the factory plant [8]. In laboratory studies it
it is likely at least some of its resistance properties may be has been observed that the concentration of the culture media
attributed to its ability to form stronger biofilms compared is an important variable in influencing biofilm formation
to other more sensitive salmonellae. for both Salmonella and L. monocytogenes [13]. Furthermore
Setting S. Senftenberg 775W aside as a clear outlier, time is also an important parameter in biofilm development;
none of the remaining Salmonella isolates, from any source, the longer the bacterial cells take to form biofilms, normally
demonstrated an enhanced ability to generate biofilm under the more comprehensive and dense the biofilm. Stepanovic
any of the conditions investigated. Whilst the survival et al. [13] investigated biofilm formation in four media types
and persistence of Salmonella in the food factory envi- at 35∘ C over 24 hours; brain heart infusion (BHI), trypticase
ronment have been the subject of previous investigation, soy broth (TSB), meat broth (MB), and 1/20 diluted trypticase
their survival in comparison to serotype-matched clinical soya broth. They reported that Salmonella formed better
and veterinary isolates has not been reported previously biofilms in low nutrient diluted TSB media, used to mimic
[14, 17, 24]. factory conditions, in comparison to full strength TSB. In
In the current study, resident pet food factory strains did a similar study by Paz-Mendez et al. [24] in which they
not produce significantly stronger biofilms in comparison investigated the effect of food residues on biofilm formation
to clinical and veterinary isolates of the same serotype. it was found that 1/20 diluted TSB media enhanced the
Although all the isolates could form biofilm, and formation development of biofilm in all Salmonella isolates investigated
of biofilm is likely to be advantageous in both the clinical and In the current study, biofilm formation in 1/20 TSB
veterinary environment, it does suggest that factory isolates media was compared to that in full strength TSB media at
are no more capable of forming biofilm than their serotype- four temperatures and the effect of increased incubation to
matched counterparts. Vestby et al. [21] compared biofilm 48 hours following a media change was also investigated.
production of “persistent” and “nonpersistent” strains of S. With the exception of 25∘ C, where across the panel of
Agona and S. Montevideo, reporting that the “persistent” isolates there was a significantly more established biofilm at
strains were stronger biofilm producers than the “nonpersis- 1/20 TSB compared to full strength (P=<0.05), at the other
tent” strains; however, the matched isolates studied were also temperatures although similar trend was revealed whereby
from the same factory environment, suggesting that biofilm 1/20 TSB media promoted biofilm development; this did not
formation was more linked to serotype than the environment achieve significance (p=>0.05). The general observation of
from which it was isolated. enhanced biofilm development in 1/20 TSB media over a
Interestingly, biofilm formation was the highest at 25∘ C, range of incubation temperatures is consistent with that of
followed by 37∘ C and decreased, respectively, at 15∘ C and the Paz-Mendez et al. [24]; however, low nutrient availability
lowest level of biofilm formation was seen at 10∘ C. However, may not be a significantly independent factor in promoting
the ability to produce biofilms is not exclusively linked to biofilm development but influenced by temperature and
growth as formation of biofilm at 37∘ C was not as strong serotype.
as at 25∘ C, and it would be anticipated that the growth
rate of Salmonella would be higher at 37∘ C than at 25∘ C.
At lower temperatures the strains were unable to form as 5. Conclusion
strong biofilms, presumably as cells struggled to grow; if
cells were unable to grow they could not attach to a surface Biofilm formation is an accepted mechanism facilitating the
and grow in sufficient number to produce a substantial persistence of Salmonella in the environment and enhanced
extracellular matrix. Similarly, a study by Tammakritsada and resistance to disinfection. This study highlighted that all the
Todhanakasem [25] investigated the ability of Salmonella to isolates in the challenge panel were able to form biofilms in
form biofilms on polystyrene tubes and also showed the same both nutrient-rich and nutrient-limited environments with
pattern with the density of biofilm formation decreasing with higher levels of biofilm production occurring at 25∘ C and
temperature from 25∘ C to 15∘ C and finally to 10∘ C. In the 37∘ C. At 37∘ C, 15∘ C, and 10∘ C an extended duration of
current study, only at 25∘ C was an enhanced biofilm observed incubation had no general effect on the ability of strains
after 48 hours in comparison to that formed at 24 hours, to form more established biofilms; however, at 25∘ C biofilm
which supports the observations of others [13]. Vestby et al. formation was significantly enhanced at 48 hours. Under
[14] reported that Salmonella biofilm formation was favoured all conditions investigated, although all were able to form
at 20∘ C and could be linked to its persistence in fish meal biofilm, none of the factory isolates showed an enhanced
and feed production environments. The observation that capability to form biofilms in comparison to serotype-
Salmonella produced enhanced biofilm at 25∘ C compared to matched isolates from veterinary and clinical sources. Biofilm
the other temperatures investigated in this study identifies a formation continues to represent an important mechanism
risk factor for environmental persistence. As Salmonella is of environmental persistence of Salmonella in the food
able to form biofilms on surfaces and survive for months at manufacturing environment; however, there appears to be
25∘ C, which is close to factory ambient temperatures, this no evidence of an enhanced biofilm-producing phenotype
poses an enhanced risk of cross-contamination within the in factory persistent strains compared to serotype-matched
manufacturing environment. isolates from nonmanufacturing environments.
Data Availability on Gallstones and on Glass,” Infection and Immunity, vol. 71, no.
12, pp. 7154–7158, 2003.
The data used to support the findings of this study are [11] B. Joseph, S. K. Otta, I. Karunasagar, and I. Karunasagar,
available from the corresponding author upon request. “Biofilm formation by Salmonella spp. On food contact surfaces
and their sensitivity to sanitizers,” International Journal of Food
[12] O. Habimana, T. Møretrø, S. Langsrud, L. K. Vestby, L. L. Nesse,
The authors declare that there are no conflicts of interest and E. Heir, “Micro ecosystems from feed industry surfaces: A
regarding the publication of this paper. survival and biofilm study of Salmonella versus host resident
flora strains,” BMC Veterinary Research, vol. 6, article no. 48,
2010.
Acknowledgments [13] S. Stepanovic, I. Cirkovic, L. Ranin, and M. Svabic-vlahovic,
“Biofilm formation by Salmonella spp. and Listeria monocyto-
The authors would like to thank Mars, Incorporated for genes on plastic surface,” Letters in Applied Microbiology, vol. 38,
funding the Ph.D. project entitled “Exploring the Biological no. 5, pp. 428–432, 2004.
Basis for Salmonella Persistence in Food Manufacturing [14] L. Vestby, T. Moretro, S. Ballance, S. Langsrud, and L. Nesse,
Environments” and their support throughout the delivery of “Survival potential of wild type cellulose deficient Salmonella
the work Bashir [26]. from the feed industry,” BMC Veterinary Research, vol. 5, p. 43,
2009.
References [15] L. L. Nesse, K. Nordby, E. Heir et al., “Molecular analyses of
Salmonella enterica isolates from fish feed factories and fish feed
[1] R. Seixas, J. Machado, F. Bernardo, C. Vilela, and M. Oliveira, ingredients,” Applied and Environmental Microbiology, vol. 69,
“Biofilm formation by Salmonella enterica serovar 1, 4, [5], no. 2, pp. 1075–1081, 2003.
12:i:- Portuguese isolates: a phenotypic, genotypic, and socio- [16] P. Dawson, I. Han, M. Cox, C. Black, and L. Simmons,
geographic analysis,” Current Microbiology, vol. 68, pp. 670–677, “Residence time and food contact time effects on transfer of
2014. Salmonella Typhimurium from tile, wood and carpet: Testing
[2] S. Srey, I. K. Jahid, and S.-D. Ha, “Biofilm formation in food the five-second rule,” Journal of Applied Microbiology, vol. 102,
industries: A food safety concern,” Food Control, vol. 31, pp. 572– no. 4, pp. 945–953, 2007.
585, 2013. [17] E. Margasa, A. Alstrom-Moorea, C. Dodd, and J. Holaha,
[3] R. M. Donlan and J. W. Costerton, “Biofilms: Survival mecha- Salmonella Survival in Low Aw Environment, 2013.
nisms of clinically relevant microorganisms,” Clinical Microbi- [18] K. Oliveira, T. Oliveira, P. Teixeira, J. Azeredo, and R. Oliveira,
ology Reviews, vol. 15, no. 2, pp. 167–193, 2002. “Adhesion of Salmonella Enteritidis to stainless steel surfaces,”
[4] J. T. Holah, J. H. Taylor, D. J. Dawson, and K. E. Hall, “Biocide Brazilian Journal of Microbiology, vol. 38, no. 2, pp. 318–323,
use in the food industry and the disinfectant resistance of 2007.
persistent strains of Listeria monocytogenes and Escherichia [19] E. Sinde and J. Carballo, “Attachment of Salmonella spp. and
coli,” Journal of Applied Microbiology, vol. 92, pp. 111S–120S, Listeria monocytogenes to stainless steel, rubber and polyte-
2002. trafluorethylene: the influence of free energy and the effect of
[5] L. L. Waldner, K. D. MacKenzie, W. Köster, and A. P. White, commercial sanitizers,” Food Microbiology, vol. 17, no. 4, pp.
“From exit to entry: Long-term survival and transmission of 439–447, 2000.
salmonella,” Pathogens, vol. 1, no. 2, pp. 128–155, 2012. [20] E. Giaouris, G. J. Nychas, N. Chorianopoulos, and P. Skandamis,
[6] S. Finn, O. Condell, P. McClure, A. Amézquita, and S. Fanning, Attachment and Biofilm Formation by Salmonella in Food Pro-
“Mechanisms of survival, responses, and sources of Salmonella cessing Environments, INTECH Open Access Publisher, Greece,
in low-moisture environments,” Frontiers in Microbiology, vol. 2012.
4, article 331, 2013. [21] L. K. Vestby, T. Møretrø, S. Langsrud, E. Heir, and L. L. Nesse,
[7] M. Kostaki, N. Chorianopoulos, E. Braxou, G.-J. Nychas, “Biofilm forming abilities of Salmonella are correlated with
and E. Giaouris, “Differential biofilm formation and chemical persistence in fish meal- and feed factories,” BMC Veterinary
disinfection resistance of sessile cells of Listeria monocytogenes Research, vol. 5, article 20, 2009.
strains under monospecies and dual-species (with Salmonella [22] J. M. Goepfert and R. A. Biggie, “Heat resistance of Salmonella
enterica) conditions,” Applied and Environmental Microbiology, typhimurium and Salmonella senftenberg 775W in milk choco-
vol. 78, no. 8, pp. 2586–2595, 2012. late,” Journal of Applied Microbiology, vol. 16, no. 12, pp. 1939-
[8] D. Djordjevic, M. Wiedmann, and L. A. McLandsborough, 1940, 1968.
“Microtiter plate assay for assessment of Listeria monocytogenes [23] H. Ng, H. G. Bayne, and J. A. Garibaldi, “Heat resistance of
biofilm formation,” Applied and Environmental Microbiology, Salmonella: the uniqueness of Salmonella senftenberg 775W.,”
vol. 68, no. 6, pp. 2950–2958, 2002. Journal of Applied Microbiology, vol. 17, no. 1, pp. 78–82, 1969.
[9] E. Hurrell, E. Kucerova, M. Loughlin, J. Caubilla-Barron, and [24] A. M. Paz-Méndez, A. Lamas, B. Vázquez, J. M. Miranda,
S. J. Forsythe, “Biofilm formation on enteral feeding tubes by A. Cepeda, and C. M. Franco, “Effect of Food Residues in
Cronobacter sakazakii, Salmonella serovars and other Enter- Biofilm Formation on Stainless Steel and Polystyrene Surfaces
obacteriaceae,” International Journal of Food Microbiology, vol. by Salmonella enterica Strains Isolated from Poultry Houses,”
136, no. 2, pp. 227–231, 2009. Foods, vol. 6, no. 12, p. 106, 2017.
[10] A. M. Prouty and J. S. Gunn, “Comparative Analysis of [25] M. Tammakritsada and T. Todhanakasem, “Isolation of
Salmonella enterica Serovar Typhimurium Biofilm Formation Salmonella from Natural Sources Representing High Potential
for Biofilm Formations,” Journal of AU Technology, vol. 15, pp.

225–232, 2012.
[26] A. Bashir, Exploring the biological basis for Salmonella persis-
tence in food manufacturing environments [Ph.D. thesis], Aston
University, Birmingham, UK, 2016.
Hindawi
https://doi.org/10.1155/2019/9814623
Research Article
Technological Properties of Bifidobacterial Strains Shared by
Mother and Child
Angela Peirotén , Pilar Gaya, Juan Luis Arqués ,

Margarita Medina , and Eva Rodr-guez
Departamento de Tecnologı́a de Alimentos, INIA, Ctra. de La Coruña Km 7, 28040 Madrid, Spain
Correspondence should be addressed to Juan Luis Arqués; arques@inia.es
Received 3 August 2018; Revised 20 December 2018; Accepted 27 December 2018; Published 17 January 2019
Copyright © 2019 Angela Peirotén et al. This is an open access article distributed under the Creative Commons Attribution License,
Technological processes in the dairy industry and the further passage through the gastrointestinal tract could impair viability and
functionality of probiotic bifidobacteria. In the present work, the growth in milk of nine bifidobacterial strains shared by mother
and child, their survival to freeze-drying and cold storage, and their behavior in a model cheese were investigated. All the strains
exhibited high stability to the technological conditions studied when compared with two commercial strains. Bifidobacterium breve
INIA P734 and Bifidobacterium bifidum INIA P671 as adjunct cultures maintained high stability during manufacture and ripening
of cheese. Both strains showed, at the end of ripening period, resistance to simulated gastrointestinal conditions. Moreover, their
presence did not affect negatively the quality of cheese. B. breve INIA P734 and B. bifidum INIA P671 could be considered as potential
candidates for their use in cheese as adjunct cultures.
1. Introduction of 106 cfu/g have been recommended to compensate their

possible reduction after the passage through the gut [7], with
Bifidobacteria shared by mother and infant constitute an dossing from 107 to 1012 cfu [8].
interesting source of potential probiotic strains [1]. Among Viability and functionality of a potential probiotic strain
functional foods, dairy products are considered optimum throughout the food manufacturing processes and gastroin-
vehicles for probiotics. Probiotic strains must firstly meet testinal stress barriers must be monitored to guarantee that its
various technological requirements as maintenance of viabil- health-promoting properties are maintained [9]. In the dairy
ity during food processing and storage, feasibility of appli- industry, only a few strains belonging mainly to Bifidobac-
cation in products, and resistance to the physicochemical terium animalis, such as B. animalis BB12, are used as adjunct
processing of foods [2]. Proteolytic activity on milk caseins, cultures. Some bifidobacteria have been successfully included
compatibility with starter cultures, tolerance to low pH of in cheeses, since cheese pH and fat and their buffering effect
fermented foods, packaging to maintain anaerobiosis for may favor the protection of this microorganism over the
bifidobacteria, or cold stress should also be considered. self-life [10]. Furthermore, the cheese matrix may protect
Moreover, final probiotic dairy products must have good probiotic bacteria against low pH and bile salts when going
sensory properties [3], while retaining their functionality through the gastrointestinal tract after consumption [11, 12].
[4, 5]. Thus, many studies have been conducted with commercial
Bifidobacteria are anaerobe bacteria of intestinal origin strains in different cheese varieties [13–17].
that usually grow poorly in milk. Their viability in fermented In the present work, technological properties of nine
dairy foods is a challenge to dairy processors due to the mother-infant shared Bifidobacterium spp. strains [18] were
low oxidation reduction potential required for their growth, investigated. Model cheeses with two selected bifidobacterial
as well as their sensitivity to low pH [6]. Probiotic bifi- strains as adjunct cultures were elaborated to evaluate their
dobacterial strains should be viable at high numbers in the impact in cheese quality and their survival at the end of the
product at the time of consumption and minimum levels ripening period to a digestive in vitro assay.
2. Materials and Methods 2.3.2. Microbial Determinations. Microbiological determi-

nations were carried out at days 1, 7, 15, and 28. Cheese
2.1. Bacterial Strains and Culture Conditions. Nine bifidobac- samples (5 g) were homogenized with 45 ml of a sterile 2%
terial strains previously settled to be shared by mother-infant (w/v) sodium citrate solution at 45∘ C and decimal dilutions
pairs [18] were selected. The commercial probiotic strains B. were prepared in a sterile 0.1% (w/v) peptone solution. Bifi-
animalis BB12 (Chr. Hansen A/S, Hørsholm, Denmark) and dobacterial counts were determined on duplicate plates of
Bifidobacterium longum BB536 (isolated from a Morinaga RCM agar supplemented with 50 mg/l mupirocin (Oxoid,
product) were used for comparative purposes. Strains were Basingstoke, UK) (RCA-MUP) and incubated at 37∘ C for
routinely cultured in RCM broth (Becton, Dickinson and 48 h under anaerobic conditions. Lactococci counts from
Company, Franklin Lakes, NJ), incubated at 37∘ C for 48 h the commercial starter were determined in milk and cheese
in anaerobic atmosphere (AnaeroGen, Oxoid, Basingstoke, samples on M17 agar (Biolife) supplemented with glucose at
UK), and maintained at -80∘ C in RCM with 15% (v/v) 0.5 g/ml (GM17) and incubated at 40∘ C and 30∘ C for 24 h,
glycerol. Isolates were subcultured twice on RCM agar before and total counts on PCA agar (Biolife) for 24 h at 30∘ C.
their use in subsequent experiments.
2.3.3. Chemical Determinations. Cheese pH was measured
2.2. Technological Properties of Shared Bifidobacterial Strains. in duplicate by means of a Crison pH meter (model GPL
Survival as frozen cultures was measured after 21 days of 22, Crison Instruments, Barcelona, Spain) using a Crison
storage at -80∘ C. The strains were grown in RCM for 48 h penetration electrode (model 52-3.2).
at 37∘ in anaerobic conditions and glycerol was added as a Cheeses overall proteolysis was determined on duplicate
cryopreservant to a final concentration of 5% (w/v). Viable samples by the o-phthaldialdehyde (OPA) test as described by
cell population was determined by plate counting on RCM Church et al. [20].
agar before and after the storage at -80∘ C. Sugars and organic acids were extracted from duplicate
In order to test their viability as lyophilized cultures, samples of cheese and determined by high-performance
cells were in the first place resuspended in skimmed milk liquid chromatography (HPLC) [21]. Extracts (50 𝜇l) were
(10%) (Central Lechera Asturiana, Siero, Spain) as protective injected in duplicate and eluted with 3 mM sulfuric acid
medium and frozen at -80∘ C for 24 h. Subsequently, cultures at 65∘ C and a flow rate of 0.7 ml/min on a 300 x 7.8 mm
were lyophilized in a Cryodos model lyophilizer (Telstar S.A., Aminex HPX-87H ion exchange column protected by a
Terrasa, Spain) operating at 1 Pa pressure and -45∘ C for cation H+ Micro-Guard cartridge (Bio-Rad Laboratories,
24 h. Lyophilized cultures were stored at 5∘ C for 21 days. Richmond, CA, USA) in a Beckman System Gold-Liquid
Freeze-dried cells were reconstituted using peptone water Chromatograph (Beckman Instruments S.A., Madrid, Spain),
and viability was determined by plate counting on RCM equipped with two detectors connected in series, a diode
agar. array detector with a detection wavelength of 210 nm for
The ability to grow in milk was tested in reconstituted citric, pyruvic, lactic, acetic, propionic, and butyric acids
skimmed milk (10% w/v) inoculated with bifidobacterial and at 280 nm for orotic and uric acids, and a differential
cultures and incubated in anaerobic conditions at 37∘ C for 24 refractometer detector module (Knauer, Berlin, Germany)
h. Counts were assessed by plate counting on RCM agar at 0 for sugars (lactose, glucose, and galactose). Organic acids and
and 24 h. sugars were quantified by the external standard method. The
Viability in milk under refrigerated storage was tested results were expressed as micrograms per gram of cheese.
in reconstituted skimmed milk inoculated with bifidobacte- Volatile compounds in 28 d cheeses were extracted by
rial cultures and stored at 5∘ C. Viable cell population was automated solid-phase microextraction (SPME) and ana-
determined at 0, 14, and 28 days by plate counting on RCM lyzed by gas chromatography-mass spectrometry (GC-MS)
agar. (HP 6890-MSD HP 5973, Agilent Technologies, Santa Clara,
CA). Duplicate 10 g cheese samples were homogenized in an
2.3. Behavior of Bifidobacteria in Model Cheeses analytical grinder (IKA, Labortechnik, Staufen, Germany),
with 20 g of anhydrous Na2 SO4 and 50 𝜇l of an aqueous solu-
2.3.1. Cheese Manufacture. Semihard model cheeses inocu- tion of 1 mg/ml cyclohexanone (Merck KGaA, Darmstadt,
lated with B. breve INIA P734 and B. bifidum INIA P671 Germany) as internal standard (IS). Two grams of this mix-
were manufactured from pasteurized cow’s milk in duplicate ture was weighed in a 20 ml headspace glass vial sealed with a
experiments. Three vats of 2 L of milk each were processed polytetrafluorethylene (PTFE) faced silicone septum (Agilent
each day: vat 1 (control) without bifidobacterial strains, vat Technologies). The equilibration (37∘ C/20 min), extraction
2 with B. breve INIA P734, and vat 3 with B. bifidum INIA (37∘ C/30 min), and injection and desorption (260∘ C/10 min
P671. Bifidobacteria were resuspended in pasteurized cow's in splitless mode) phases were carried out using a CTC
milk (approximately 7-8 log cfu/ml milk) and added to the CombiPAL autosampler (Agilent Technologies). The volatile
correspondent vat at 1%, after the addition of the commercial compounds were extracted using a 2 cm x 50/30 𝜇m
starter MA 016. Cheeses were made according to Gómez- StableFlex Divinylbenzene/Carboxen/Polydimethylsiloxane
Torres et al. [19]. One cheese, of approximately 200 g in (DVB/CAR/PDMS) coated fiber (Supelco, Bellefonte, PA).
weight, was obtained from each vat. Cheeses were pressed Chromatographic separation was carried out in a Zebron
overnight at 20∘ C, vacuum-packaged in Cryovac plastic bags, 100% polyethylene glycol capillary column (60 m long; 0.25
and ripened at 12∘ C for 28 d. mm internal diameter; 0.50 𝜇m film thickness; ZB-WAXplus,
Table 1: Changes (log cfu/ml) in bifidobacterial counts after freezing or freeze-drying and subsequent storage.
Strain -80∘ C (21 d) Freeze-drying (21 d)

B. breve INIA P712 -0.99 ± 0.58ab -1.76 ± 0.18a
B. longum subsp. longum INIA P678 -0.67 ± 0.17de -1.10 ± 0.09bc
B. breve INIA P734 -0.95 ± 0.07abc -0.10 ± 0.03e
B. longum subsp. infantis INIA P737 -0.63 ± 0.31de -0.85 ± 0.26cd
B. bifidum INIA P671 -0.58 ± 0.05de -0.95 ± 0.07bcd
B. pseudocatenulatum INIA P753 -1.12 ± 0.18a -0.65 ± 0.26d
B. adolescentis INIA P784 -0.10 ± 0.05f -1.20 ± 0.14b
B. bifidum INIA P826 -0.81 ± 0.10bcd -0.99 ± 0.22bc
B. longum subsp. longum INIA P843 -0.75 ± 0.08cde -0.86 ± 0.22cd
B. animalis BB12 -0.13 ± 0.06f -0.16 ± 0.08e
B. longum subsp. longum BB536 -0.53 ± 0.09e -1.65 ± 0.23a
Values are the mean ± SD (n=4). Means in the same column with a different superscript differ significantly (P<0.01).
Phenomenex, Torrance, CA). Initial helium flow was 1.4 were observed among bifidobacteria studied as frozen or
ml/min kept for 1 min, 1 ml/min helium flow, with the follow- freeze-dried cultures (Table 1), although differences for a
ing temperature program: 7 min at 40∘ C, first ramp 2∘ C/min given strain were found for both traits (P<0.01).
to 90∘ C, second ramp at 3∘ C/min to 150∘ C, and a final The best stability was found in B. animalis BB12. The via-
ramp to 240∘ C at 9∘ C/min. Mass detection was performed bility of the freeze-dried microorganisms depends on several
in the scan mode, from 33 to 280 amu at 5.53 scan/s and factors such as strain, bacterial cell size, and efficacy of the
ionization by EI at 70 eV. Volatile compounds were identified cryoprotectant [22]. In this regard, du Toit et al. [8] described
by comparison of spectra with the Wiley7Nist05 library not only viability, but also different probiotic properties of the
(Wiley and Sons Inc., Germany) and by comparison of their same strains as fresh, freeze-dried, fresh heat-tolerant, and
retention times with authentic standards (Merck). Relative freeze-dried heat-tolerant strains.
abundances of compounds were expressed as percentages of The growth of bifidobacteria in milk or dairy products is
peak areas to the IS peak area. Samples were tested in dupli- limited compared with lactic acid bacteria used in fermented
cate. dairy products [23]. Concerning the ability of the selected
bifidobacterial strains to grow in milk (Table 2), seven out
2.4. Survival of Bifidobacteria Vehiculized in Cheese to Simu- of the nine strains grew in milk without any added growth
lated Gastrointestinal Conditions. Cheese samples (5 g) from factor, with increases of 1-2 log cfu in four strains.
28 d cheeses were diluted in 45 ml of acid solution (Phosphate Viability of bifidobacteria in dairy products during cold
Buffered Saline, PBS; pH 3) at 37∘ C and homogenized for 90 storage is a main concern in developing new probiotic formu-
s in a stomacher. Homogenates were incubated at 37∘ C under lations. Refrigeration in milk resulted in variable reductions
anaerobic conditions for one hour. Subsequently, 1 ml was in numbers over storage (Table 2). B. animalis BB12 showed
taken, added to 9 ml bile solution (0.15%, Ox-bile desiccated, the best stability under refrigeration. After 14 d of storage,
Oxoid), and kept at the same conditions for 1 h. Counts were reductions higher than 1 log unit were observed for B. bifidum
made on duplicate plates of RCA-MUP to test the survival INIA P826, B. longum BB536, B. infantis INIA P737, and
of bifidobacterial strains. Survival of the starter culture in B. breve INIA P712. After 28 d, further diminutions were
control cheese was examined on GM17 agar. observed. In B. breve INIA P712 and the commercial strain
B. longum BB536 the decrease during refrigerated storage
2.5. Statistical Analysis. Statistical treatment of data was was higher than that observed with other storage processes
performed by means of SPSS Statistics 22.0 software (IBM (Tables 1 and 2). This could be related to a higher tolerance
Corp., Armonk, NY, USA). Data were analyzed by ANOVA induced by the previous freeze-drying stress on cells [24].
using a general linear model. Comparison of means was Viability of strains in fermented milk has been linked to acid-
carried out by Tukey’s test or Dunnett’s test for a confidence ification, oxide-reduction potential, and relative fatty acid
interval of 99%. composition, which differ among the strains and the types of
milk used [25]. In the present work, cells suspensions were
3. Results and Discussion maintained in milk without any protective compound and
under aerobic conditions. Bifidobacterial strains are strictly
3.1. Technological Properties of Bifidobacterial Strains. Tech- anaerobic, and reductions of viability during refrigeration
nological properties of nine bifidobacterial strains, selected could be mainly attributed to redox potential. Different
due to being shared by mother and child, were tested for protective strategies like the addition of L-cysteine [26], acid
their further use in dairy products as potential probiotic casein hydrolysate, whey proteins or tryptone in yogurt [27],
adjunct cultures. Two commercial bifidobacterial strains resistant starch [28], gases [29], or encapsulation [30] have
were included for comparative purposes. Good stabilities been proposed.
Table 2: Growth in milk (log cfu/ml) and changes in bifidobacterial strains during subsequent storage at 4∘ C.
Growth in milk Storage at 4∘ C Storage at 4∘ C

Strain
(1 d) (14 d) (28 d)
B. breve INIA P712 1.45 ± 0.20e -3.60 ± 0.22a -
B. longum subsp. longum INIA P678 0.85 ± 0.06d -0.68 ± 0.05d -1.00 ± 0.02c
B. breve INIA P734 0.42 ± 0.22c -0.69 ± 0.10d -1.85 ± 0.03b
B. longum subsp. infantis INIA P737 1.88 ± 0.15f -1.58 ± 0.15b -1.94 ± 0.06b
B. bifidum INIA P671 1.29 ± 0.10e -0.21 ± 0.15e -0.28 ± 0.25de
B. pseudocatenulatum INIA P753 -0.38 ± 0.23b -0.09 ± 0.12e -0.34 ± 0.16d
B. adolescentis INIA P784 -1.44 ± 0.17a -0.59 ± 0.12d -0.41 ± 0.19d
B. bifidum INIA P826 1.54 ± 0.55e -1.04 ± 0.37c -1.19 ± 0.72c
B. longum subsp. longum INIA P843 0.53 ± 0.15c -0.85 ± 0.10cd -1.62 ± 0.11b
B. animalis BB12 0.44 ± 0.04c -0.13 ± 0.10e -0.05 ± 0.11e
B. longum subsp. longum BB536 0.91 ± 0.16d -1.17 ± 0.07c -2.39 ± 0.07a
Values are the mean ± SD (n=4). Means in the same column with a different superscript differ significantly (P<0.01).
Table 3: Bifidobacterial counts (log cfu/g) in cheeses made with B. breve INIA P734 or B. bifidum INIA P671 as adjunct culture.
Strain 1d 7d 15 d 28 d
Control ND ND ND ND
B. breve INIA P734 8.44 ± 0.32a 8.55 ± 0.15a 8.50 ± 0.29a 8.27 ± 0.39a
B. bifidum INIA P671 7.10 ± 0.11a 7.13 ± 0.19a 6.94 ± 0.27a 6.61 ± 0.34a
Values are the mean ± SD (n=4). Means in the same row with the same superscript do not differ significantly (P<0.01).
According to our results, the ability to grow in milk was good survival comparable to that reported for B. animalis
not linked to their resistance to cold storage at 4∘ C. Only BB12 in cheddar cheese [13, 31].
B. bifidum INIA P671 grew in milk and after 28 d of cold In cheddar cheese made with buffalo milk with Lacto-
storage showed reductions lower than 0.3 log units. Cold bacillus acidophilus LA-5, B. bifidum Bb-11 and B. longum
storage in milk and freeze-drying may play a crucial role BB536, levels > 7 log cfu/g were reached through the 180 d
in strain survival during product storage. Thus, strains with of ripening [10]. On the contrary, B. longum BB536 counts
technological abilities in between the two commercial strains declined from approximately 8 log cfu/g to 5 log cfu/g after a
tested were selected for further studies. standard cheddar cheese making protocol and the same time
of ripening [13]. Similar results were also recoded for two
strains of B. animalis, Bf26 and Bf141, in low-fat cheddar [32]
3.2. Behavior of B. breve INIA P734 and B. bifidum INIA P671
and B. longum DJO10A in cheddar cheese [31].
in Cheese Models. The most popular food delivery systems
for probiotic cultures have been fermented milks. However,
3.2.2. Chemical Determinations. Probiotic cultures should
cheese may be more effective than yogurt-like products
not modify negatively the sensorial properties of the cheese
in delivering probiotic bacteria to the intestinal tract [23].
to which they are added. These cultures can induce changes
Considering the results obtained after freeze-drying followed
in the chemical composition and the texture; however, they
by refrigeration, and their ability to grow in milk, B. breve
do not necessarily have a noticeable effect on flavor [33].
INIA P734 and B. bifidum INIA P671 were selected as adjunct
In the present work, cheese pH values (data not shown)
cultures for cheese making.
showed minor differences (P<0.01) between cheeses that were
unrelated to the addition of bifidobacteria. Consequently,
3.2.1. Microbial Determinations. The starter culture used in the starter culture was not affected by the addition of the
the present work was not affected by the use of bifidobacteria bifidobacterial strains in terms of milk fermentation.
as adjunct cultures. Counts of total viable bacteria in all Citric, pyruvic, lactic, and acetic acids were detected in
cheeses remained at levels >9.5 log cfu/g during the 28 all the cheeses throughout ripening (Table 4). Citric content
d ripening period, with no significant differences between increased in cheeses with B. bifidum INIA P671 compared to
cheeses with bifidobacteria and control cheese (P<0.01) (data control cheese (P<0.01) but not in cheese with B. breve INIA
not shown). B. breve INIA P734 and B. bifidum INIA P671 P734, which exhibited a significant increase of acetic acid over
presented good stability after cheese making and through ripening higher than in control cheese. Lactic acid content
ripening (Table 3). Both strains survived cheese making and was lower in both cheeses than in control. Sugars (lactose,
their levels increased by more than 1 log unit, probably due glucose, and galactose) were not detected.
to cell entrapment in pressed curd. Bifidobacterial counts Overall proteolysis (OPA test) in 28 d cheeses was not
remained stable (P<0.01) during cheese ripening, exhibiting affected by the addition of bifidobacterial adjuncts. Values for
Table 4: Organic acids in cheeses with bifidobacteria and control cheese.
Organic acid Ripening (days) Control cheese B. breve INIA P734 B. bifidum INIA P671
Acetic acid 1 944.81 ± 16.03 1049.32 ± 136.62∗ 879.06 ± 26.00∗
15 1040.58 ± 25.59 1150.45 ± 162.72∗ 968.51 ± 36.69∗
30 1109.49 ± 52.71 1232.27 ± 108.90∗ 1079.71 ± 77.67
Citric acid 1 1539.38 ± 75.12 1428.70 ± 107.12∗ 1638.72 ± 11.55∗
15 1712.67 ± 4.87 1577.84 ± 43.60∗ 2145.82 ± 117.08∗
30 1774.38 ± 32.94 1719.40 ± 111.78∗ 2465.29 ± 23.82∗
Lactic acid 1 19650.38 ± 494.24 15965.66 ± 2051.09∗ 16145.76 ± 602.30∗
15 19718.31 ± 1492.70 15841.27 ± 1410.43∗ 16916.74 ± 431.25∗
30 18869.98 ± 1499.33 16084.38 ± 2180.85∗ 16963.25 ± 1033.72∗
Pyruvic acid 1 111.26 ± 15.95 132.94 ± 11.13∗ 151.05 ± 7.35∗
15 112.36 ± 7.19 116.10 ± 3.64∗ 154.28 ± 14.54∗
30 124.02 ± 3.56 123.65 ± 21.41 170.84 ± 18.62∗
Values are presented as the mean ± SD (n=4) and expressed as micrograms of acid per gram of cheese. Means with * in the same row differ significantly (P<0.01,
Dunnett’s test) from the control cheese.
Table 5: Volatile compounds (with significant differences) in model cheeses made with B. breve INIA P734 and B. bifidum INIA P671 as
adjunct cultures.
QI Control B. breve INIA P734 B. bifidum INIA P671

Miscellaneous
Acetaldehyde 44 1.75 ± 0.04 1.41 ± 0.33∗ 1.05 ± 0.37∗
Carbon disulfide TIC 22.60 ± 10.39 51.41 ± 3.51∗ 38.68 ± 11.88∗
Dimethyl sulfide TIC 7.05 ± 2.78 4.35 ± 0.85∗ 5.27 ± 1.69
Ethene, trichloro- 130, 95, 60 ND 0.99 ± 0.25∗ ND
Carboxylic acids
Acetic acid 43, 45, 60 75.63 ± 7.55 235.32 ± 153.49∗ 89.79 ± 39.04
Butanoic acid TIC 62.93 ± 4.35 131.73 ± 56.99∗ 70.73 ± 13.61
Esters
Ethyl acetate TIC 3.50 ± 0.45 10.22 ± 7.50∗ 5.41 ± 0.99∗
Ethyl butanoate 71, 88, 60, 101 2.28 ± 0.58 2.42 ± 0.21 2.70 ± 0.36∗
Ketones
2-Propanone (acetone) TIC 42.59 ± 10.55 30.38 ± 4.09∗ 31.64 ± 8.95∗
2-Butanone TIC 24.43 ± 2.90 19.63 ± 0.99∗ 21.03 ± 2.85∗
2,3-Butanedione (diacetyl) 43, 86 15.81 ± 4.09 29.88 ± 8.73∗ 30.82 ± 0.82∗
3-Hydroxy-2-butanone (acetoin) 43, 45, 88 99.75 ± 61.24 244.38 ± 121.52∗ 209.68 ± 22.27∗
Terpenes
Camphane 95, 81, 123 1.23 ± 0.05 1.06 ± 0.14∗ 1.01 ± 0.13∗
Volatile compounds levels are expressed as relative abundances to the internal standard cyclohexanone calculated from (peak area/IS peak area) × IS
concentration. (IS= cyclohexanone; IS concentration=500 𝜇g per mg of cheese). TIC, total ion count; ND, not detected. Means with ∗ in the same row differ
significantly from control cheese according to Dunnett’s test (P < 0.01).
absorbance at 340 nm were 0.47 ± 0.02 in control cheese, 0.57 diacetyl and acetoin were higher for one or both bifidobacte-
± 0.08 in cheese with INIA P734, and 0.55 ± 0.03 in cheese rial cheeses with respect to control cheeses. Higher acetic acid
with INIA P671, without significant (P<0.01) differences values could be attributed to the metabolic activity of bifi-
among them. dobacteria through the fructose-6-phosphate shunt pathway
In the volatile fraction, 29 compounds (3 carboxylic acids, utilizing residual lactose [34]. Acetic acid is detected at high
2 esters, 5 ketones, 10 terpenes, 2 hydrocarbons, 2 benzene concentrations in similar cheeses, like cheddar, and normally
compounds, and 5 miscellaneous compounds) were identi- contributes to its flavor, although very high concentrations
fied. Thirteen compounds showed significant (P<0.01) dif- could produce off flavors [35].
ferences in cheeses made with bifidobacteria with respect to Acetoin was higher in both cheeses with bifidobacteria. It
control cheese (Table 5) at the end of the ripening period. has been reported that bifidobacteria may convert pyruvate to
Carbon disulfide, acetic and butanoic acids, their ethyl-esters, acetoin instead of organic acids to maintain their internal pH
[36]. The increased production of acetoin, 2-butanone, and Data Availability

acetic acid has been correlated with a higher yield of ATP for
supporting the pH homeostasis by F1 F0 ATPase [37, 38]. The data used to support the findings of this study are
Overall, the GC-MS results indicated that the bifidobac- available from the corresponding author upon request.
terial strains had a considerable effect on the generation of
esters and ketones throughout ripening that can contribute Conflicts of Interest
to cheese flavor.
3.3. Survival of Bifidobacteria and Starter Culture in Cheese
to Simulated Gastrointestinal Conditions. Cheese can act as a Acknowledgments
buffer against the high acidic conditions of the gastrointesti-
nal tract, favoring probiotic survival. Moreover, its high fat This work was supported by projects RTA2013-00029-00-
content may offer additional protection to probiotic bacteria 00 and RTA2017-00002-00-00 from the Spanish Ministry
during passage through the gastrointestinal tract [39, 40]. of Science, Innovation and Universities. The authors highly
An essential step towards the selection of potential probiotic appreciated the assistance of Dr. Sonia Garde in the physical-
candidates is to examine their resistance under GI stress chemical analysis of model cheeses.
conditions [9]. Here, cheeses with bifidobacteria and control
cheese were submitted at the end of the ripening to a References
simulated gastrointestinal passage.
[1] Z. T. Lewis and D. A. Mills, “Differential Establishment of
In the present study, the starter culture survived in control
Bifidobacteria in the Breastfed Infant Gut,” in Intestinal Micro-
cheeses homogenates at high levels, with counts of 9.42 ± biome: Functional Aspects in Health and Disease, vol. 88 of Nestlé
0.09 log cfu/g before digestion and 8.75 ± 0.15 cfu/g after Nutrition Institute Workshop Series, pp. 149–159, 2017.
digestion. Consequently, bacteria from the starter culture [2] F. C. Prado, J. L. Parada, A. Pandey, and C. R. Soccol, “Trends
might arrive at high levels to the intestine where they could in non-dairy probiotic beverages,” Food Research International,
play a beneficial role. Simulated digestion resulted in a vol. 41, no. 2, pp. 111–123, 2008.
decrease in the viability of approximately 1.7 log units for [3] D. Granato, G. F. Branco, A. G. Cruz, J. D. A. F. Faria, and
the bifidobacterial strains, with final counts of B. breve INIA N. P. Shah, “Probiotic dairy products as functional foods,”
P734 and B. infantis INIA P671 of 6.55 ± 1.26 and 4.96 ± Comprehensive Reviews in Food Science and Food Safety, vol. 9,
0.16 log cfu/g log cfu/g, respectively. Tolerance of probiotic no. 5, pp. 455–470, 2010.
bacteria to acid and bile has been described as variable and [4] T. Mattila-Sandholm, P. Myllärinen, R. Crittenden, G. Mogen-
strain dependent [41]. Moreover, a protective effect of milk sen, R. Fondén, and M. Saarela, “Technological challenges for
or milk components against low pH has been reported in future Probiotic foods,” International Dairy Journal, vol. 12, no.
both lactic acid bacteria and bifidobacteria [42, 43]. In this 2, pp. 173–182, 2002.
aspect, the acid tolerance of probiotics seems to be better in [5] M. Ventura, M. O’Connell-Motherway, S. Leahy, J. A. Moreno-
milk and cheese than in PBS or yogurt, respectively [44, 45]. Munoz, G. F. Fitzgerald, and D. van Sinderen, “From bacterial
Milk fat, solid consistency, or buffering capacity of the food genome to functionality; case bifidobacteria,” International
matrix may be involved in the protective effect observed Journal of Food Microbiology, vol. 120, no. 1-2, pp. 2–12, 2007.
on bifidobacterial survival during in vitro gastrointestinal [6] T. Vasiljevic and N. P. Shah, “Probiotics—From Metchnikoff to
challenge studies [16, 46]. According to our results, values bioactives,” International Dairy Journal, vol. 18, no. 7, pp. 714–
around 5-6.5 log units after simulated digestion would lead to 728, 2008.
7-8.5 log cfu for both bifidobacterial strains after the ingestion [7] N. P. Shah, “Functional cultures and health benefits,” Interna-
of 100 g of ripened cheese. In consequence, this study shows tional Dairy Journal, vol. 17, no. 11, pp. 1262–1277, 2007.
the suitability of semihard cheese as a vehicle for delivery of [8] E. du Toit, S. Vesterlund, M. Gueimonde, and S. Salminen,
these two bifidobacterial strains. “Assessment of the effect of stress-tolerance acquisition on some
basic characteristics of specific probiotics,” International Journal
of Food Microbiology, vol. 165, no. 1, pp. 51–56, 2013.
4. Conclusions [9] P. Charnchai, S. S. Jantama, C. Prasitpuriprecha, S. Kan-
chanatawee, and K. Jantama, “Effects of the food manufacturing
Technological properties were recorded for nine bifidobacte- chain on the viability and functionality of Bifidobacterium
rial strains shared by mother and child. The selected strains, animalis through simulated gastrointestinal conditions,” PLoS
B. breve INIA P734 and B. bifidum INIA P671, survived ONE, vol. 11, no. 6, Article ID e0157958, 2016.
cheese making and the ripening period, not affecting the [10] M. A. Murtaza, N. Huma, M. A. Shabbir, M. S. Murtaza, and M.
cheese quality. Moreover, these bifidobacteria vehiculated Anees-ur-Rehman, “Survival of micro-organisms and organic
in the 28 d ripened cheeses showed good resistance to the acid profile of probiotic Cheddar cheese from buffalo milk
simulated gastrointestinal conditions, suggesting that they during accelerated ripening,” International Journal of Dairy
may survive through the human GI transit at acceptable Technology, vol. 70, no. 4, pp. 562–571, 2017.
levels. In conclusion, B. breve INIA P734 and B. bifidum INIA [11] C. Stanton, G. Gardiner, P. B. Lynch, J. K. Collins, G. Fitzgerald,
P671 were considered good candidates as adjunct cultures in and R. P. Ross, “Probiotic cheese,” International Dairy Journal,
semihard cheeses as a vehicle of potential probiotics. vol. 8, no. 5, pp. 491–496, 1998.
[12] J. D. S. O. de Almeida, C. O. Dias, S. S. Pinto et al., “Probiotic [27] R. I. Dave and N. P. Shah, “Ingredient Supplementation Effects
Mascarpone-type cheese: Characterisation and cell viability on Viability of Probiotic Bacteria in Yogurt,” Journal of Dairy
during storage and simulated gastrointestinal conditions,” Inter- Science, vol. 81, no. 11, pp. 2804–2816, 1998.
national Journal of Dairy Technology, vol. 71, pp. 195–203, 2018. [28] F. Baruzzi, S. de Candia, L. Quintieri, L. Caputo, and F. De
[13] S. Mc Brearty, R. P. Ross, G. F. Fitzgerald, J. K. Collins, J. Leo, “Development of a synbiotic beverage enriched with bifi-
M. Wallace, and C. Stanton, “Influence of two commercially dobacteria strains and fortified with whey proteins,” Frontiers in
available bifidobacteria cultures on Cheddar cheese quality,” Microbiology, vol. 8, article 640, 2017.
International Dairy Journal, vol. 11, no. 8, pp. 599–610, 2001. [29] B. Ebel, F. Martin, L. D. T. Le, P. Gervais, and R. Cachon,
[14] K. S. Chaves and M. L. Gigante, “Prato cheese as suitable carrier “Use of gases to improve survival of Bifidobacterium bifidum by
for Lactobacillus acidophilus La5 and Bifidobacterium Bb12,” modifying redox potential in fermented milk,” Journal of Dairy
International Dairy Journal, vol. 52, pp. 10–18, 2016. Science, vol. 94, no. 5, pp. 2185–2191, 2011.
[15] A. R. Madureira, C. I. Pereira, K. Truszkowska, A. M. Gomes, [30] A. López-Rubio, E. Sanchez, Y. Sanz, and J. M. Lagaron, “Encap-
M. E. Pintado, and F. X. Malcata, “Survival of probiotic bacteria sulation of living bifidobacteria in ultrathin PVOH electrospun
in a whey cheese vector submitted to environmental conditions fibers,” Biomacromolecules, vol. 10, no. 10, pp. 2823–2829, 2009.
prevailing in the gastrointestinal tract,” International Dairy [31] M. Scheller and D. J. O’Sullivan, “Comparative analysis of an
Journal, vol. 15, no. 6-9, pp. 921–927, 2005. intestinal strain of Bifidobacterium longum and a strain of
[16] Q. G. S. Meira, M. Magnani, F. C. de Medeiros Júnior et al., Bifidobacterium animalis subspecies lactis in Cheddar cheese,”
“Effects of added Lactobacillus acidophilus and Bifidobacterium Journal of Dairy Science, vol. 94, no. 3, pp. 1122–1131, 2011.
lactis probiotics on the quality characteristics of goat ricotta
[32] V. Demers-Mathieu, D. St-Gelais, J. Audy, É. Laurin, and I.
and their survival under simulated gastrointestinal conditions,”
Fliss, “Effect of the low-fat Cheddar cheese manufacturing
Food Research International, vol. 76, pp. 828–838, 2015.
process on the viability of Bifidobacterium animalis subsp.
[17] A. Akbarian Moghari, S. H. Razavi, M. R. Ehsani, and M. lactis, Lactobacillus rhamnosus, Lactobacillus paracasei/casei,
Mousavi, “Development and Critical Quality Characterization and Lactobacillus plantarum isolates,” Journal of Functional
of Functional UF-Feta Cheese by Incorporating Probiotic Bac- Foods, vol. 24, pp. 327–337, 2016.
teria,” Journal of Food Processing and Preservation, vol. 39, no. 6,
[33] C. P. Champagne, N. J. Gardner, and D. Roy, “Challenges in the
pp. 599–605, 2015.
addition of probiotic cultures to foods,” Critical Reviews in Food
[18] A. Peirotén, J. L. Arqués, M. Medina, and E. Rodrı́guez- Science and Nutrition, vol. 45, no. 1, pp. 61–84, 2005.
Mı́nguez, “Bifidobacterial strains shared by mother and child as
source of probiotics,” Beneficial Microbes, vol. 9, no. 2, pp. 231– [34] A. R. Desai, I. B. Powell, and N. P. Shah, “Survival and activity
238, 2018. of probiotic lactobacilli in skim milk containing prebiotics,”
Journal of Food Science, vol. 69, no. 3, pp. FMS57–FMS60, 2004.
[19] N. Gómez-Torres, M. Ávila, P. Gaya, and S. Garde, “Prevention
of late blowing defect by reuterin produced in cheese by a [35] P. F. Fox and J. M. Wallace, “Formation of Flavor Compounds
Lactobacillus reuteri adjunct,” Food Microbiology, vol. 42, pp. in Cheese,” Advances in Applied Microbiology, vol. 45, pp. 17–85,
82–88, 2014. 1997.
[20] F. C. Church, H. E. Swaisgood, D. H. Porter, and G. L. Catig- [36] H. M. Østlie, J. Treimo, and J. A. Narvhus, “Effect of temperature
nani, “Spectrophotometric Assay Using o-Phthaldialdehyde on growth and metabolism of probiotic bacteria in milk,”
for Determination of Proteolysis in Milk and Isolated Milk International Dairy Journal, vol. 15, no. 10, pp. 989–997, 2005.
Proteins,” Journal of Dairy Science, vol. 66, no. 6, pp. 1219–1227, [37] B. Sánchez, M.-C. Champomier-Vergès, M. D. C. Collado et
1983. al., “Low-pH adaptation and the acid tolerance response of
[21] J. Bouzas, C. A. Kantt, F. Bodyfelt, and J. A. Torres, “Simulta- Bifidobacterium longum biotype longum,” Applied and Environ-
neous Determination of Sugars and Organic Acids in Cheddar mental Microbiology, vol. 73, no. 20, pp. 6450–6459, 2007.
Cheese by High-Performance Liquid Chromatography,” Journal [38] S. Settachaimongkon, H. J. F. van Valenberg, V. Winata et al.,
of Food Science, vol. 56, no. 1, pp. 276–278, 1991. “Effect of sublethal preculturing on the survival of probiotics
[22] F. Fonseca, C. Béal, and G. Corrieu, “Method of quantifying the and metabolite formation in set-yoghurt,” Food Microbiology,
loss of acidification activity of lactic acid starters during freezing vol. 49, pp. 104–115, 2015.
and frozen storage,” Journal of Dairy Research, vol. 67, no. 1, pp. [39] A. G. da Cruz, F. C. A. Buriti, C. H. B. de Souza, J. A. F. Faria, and
83–90, 2000. S. M. I. Saad, “Probiotic cheese: health benefits, technological
[23] D. Roy, “Technological aspects related to the use of bifidobacte- and stability aspects,” Trends in Food Science & Technology, vol.
ria in dairy products,” Le Lait, vol. 85, no. 1-2, pp. 39–56, 2005. 20, no. 8, pp. 344–354, 2009.
[24] O. D. Amund, “Exploring the relationship between exposure [40] G. Gardiner, R. P. Ross, J. K. Collins et al., “Development of
to technological and gastrointestinal stress and probiotic func- a probiotic cheddar cheese containing human-derived Lacto-
tional properties of lactobacilli and bifidobacteria,” Canadian bacillus paracasei strains,” Applied and Environmental Microbi-
Journal of Microbiology, vol. 62, no. 9, pp. 715–725, 2016. ology, vol. 64, no. 6, pp. 2192–2199, 1998.
[25] A. C. R. Florence, M. N. de Oliveira, A. Delile, and C. Béal, [41] C. G. Vinderola and J. A. Reinheimer, “Lactic acid starter and
“Survival of Bifidobacterium strains in organic fermented milk probiotic bacteria: a comparative ‘in vitro’ study of probiotic
is improved as a result of membrane fatty acid composition,” characteristics and biological barrier resistance,” Food Research
International Dairy Journal, vol. 61, pp. 1–9, 2016. International, vol. 36, no. 9, pp. 895–904, 2003.
[26] M.-P. Bolduc, Y. Raymond, P. Fustier, C. P. Champagne, and [42] E. Rodrı́guez, J. L. Arqués, R. Rodrı́guez, Á. Peirotén, J. M.
J.-C. Vuillemard, “Sensitivity of bifidobacteria to oxygen and Landete, and M. Medina, “Antimicrobial properties of probiotic
redox potential in non-fermented pasteurized milk,” Interna- strains isolated from breast-fed infants,” Journal of Functional
tional Dairy Journal, vol. 16, no. 9, pp. 1038–1048, 2006. Foods, vol. 4, no. 2, pp. 542–551, 2012.
[43] M. F. Fernández, S. Boris, and C. Barbés, “Probiotic properties

of human lactobacilli strains to be used in the gastrointestinal
tract,” Journal of Applied Microbiology, vol. 94, no. 3, pp. 449–
455, 2003.
[44] P. L. Conway, S. L. Gorbach, and B. R. Goldin, “Survival of lactic
acid bacteria in the human stomach and adhesion to intestinal
cells,” Journal of Dairy Science, vol. 70, no. 1, pp. 1–12, 1987.
[45] M. D. Sharp, D. J. McMahon, and J. R. Broadbent, “Comparative
evaluation of yogurt and low-fat cheddar cheese as delivery
media for probiotic Lactobacillus casei,” Journal of Food Science,
vol. 73, no. 7, pp. M375–M377, 2008.
[46] M. Ziarno and D. Zaręba, “Effects of milk components and food
additives on survival of three bifidobacteria strains in fermented
milk under simulated gastrointestinal tract conditions,” Micro-
bial Ecology in Health & Disease, vol. 26, Article ID 27812, 2015.
Hindawi
https://doi.org/10.1155/2019/1470543
Research Article
Improving Ethyl Acetate Production in Baijiu Manufacture by
Wickerhamomyces anomalus and Saccharomyces cerevisiae
Mixed Culture Fermentations
Guangsen Fan,1,2,3 Chao Teng,1,2,3 Dai Xu,2 Zhilei Fu,2 Pengxiao Liu,2
Qiuhua Wu,2 Ran Yang,1,2 and Xiuting Li 1,2,3
1
Beijing Advanced Innovation Center for Food Nutrition and Human Health, Beijing Technology & Business University (BTBU),
Beijing 100048, China
2
School of Food and Chemical Engineering, Beijing Technology and Business University (BTBU), Beijing 100048, China
3
Beijing Engineering and Technology Research Center of Food Additives, Beijing Technology & Business University (BTBU),
Beijing 100048, China
Correspondence should be addressed to Xiuting Li; lixt@btbu.edu.cn
Received 29 July 2018; Revised 26 November 2018; Accepted 12 December 2018; Published 13 January 2019
Copyright © 2019 Guangsen Fan et al. This is an open access article distributed under the Creative Commons Attribution License,
Ethyl acetate content has strong influence on the style and quality of Baijiu. Therefore, this study investigated the effect of
Saccharomyces cerevisiae Y3401 on the production of ethyl acetate by Wickerhamomyces anomalus Y3604. Analysis of cell growth
showed that Y3401 influences Y3604 by nutrient competition and inhibition by metabolites, while the effect of Y3604 on Y3401
was mainly competition for nutrients. Mixed fermentation with two yeasts was found to produce more ethyl acetate than a single
fermentation. The highest yield of ethyl acetate was 2.99 g/L when the inoculation ratio of Y3401:Y3604 was 1:2. Synergistic
fermentation of both yeasts improved ethyl acetate production and increased the content of other flavor compounds in liquid and
simulated solid-state fermentation for Baijiu. Saccharomyces cerevisiae had a positive effect on ethyl acetate production in mixed
culture and provides opportunities to alter the aroma and flavor perception of Baijiu.
1. Introduction esters in strong flavor Baijiu, and it is the main fragrance in

light flavor Baijiu [2].
Baijiu is normally made from sorghum alone or from a It is well known that microbial metabolism is the main
mixture of wheat, corn, peas, millet, rice, and sorghum source of ethyl acetate in Baijiu manufacture. There are many
by solid-state fermentation. It is generally considered the biological strains in the Baijiu fermentation process that
national alcoholic beverage of China, and it is a typical can produce ethyl acetate, including yeasts, bacteria, and
example of a traditional Chinese fermented food [1]. More molds [3, 4]. Studies have shown that the aroma-producing
than 1870 compounds have been identified in Baijiu, and yeasts (also named ester-producing yeasts), a kind of non-
many studies have shown that the quality and style of Baijiu Saccharomyces wild yeast, are the main strains that produce
are determined by these flavoring compounds [1]. Among ethyl acetate [5]. These yeasts can improve the fragrance of
these compounds, ethyl acetate has been identified as one the main body of Baijiu and can be used to actively change
of the main aroma components [2]. It is the only chemical its flavor [6]. Because of the special contribution to the flavor
that is used in the national standards as a clear indicator of quality of Baijiu, the aroma-producing yeasts can be called
style and quality of beverage for almost all types of Baijiu. It “flavor regulators” [7]. Coincidentally, non-Saccharomyces
is especially important for the formation of particular Baijiu yeasts are now generally regarded as having the ability to
styles, including strong flavor, light flavor, rice flavor, and improve wine or beer characteristics, such as complexity,
Xifeng flavor products. Ethyl acetate is one of the four main mouthfeel, and integration of flavors [8, 9]. Although there
has been limited research on the roles of non-Saccharomyces monopotassium phosphate 1 g, magnesium sulfate 1 g, and
yeasts in Baijiu production, many producers have extensive ddH2 O 1000 mL, pH 5.8–6.0, autoclaved at 115∘ C for 20 min)
practical knowledge of these aroma-producing yeasts and with an initial number of colonies of 1.0 × 106 CFU/mL (static
how to use them to achieve improved sensory effects in Baijiu. culture, 30∘ C, 72 h). At the end of the fermentation, the
In view of these considerations, it is beneficial to isolate, medium was ultracentrifuged at 10,000 rpm for 10 min. After
study, and apply the aroma-producing yeasts, especially those filtration, the supernatants were analyzed for ethanol by high-
with high-yield ethyl acetate production characteristics. This performance liquid chromatography (HPLC). The yeast that
approach is of great significance in efforts to improve the produced more ethanol was selected.
quality of Baijiu.
At present, our research team has access to aroma- 2.2. Identification of Yeast. The screened yeast was identified
producing yeast Y3604, identified as Wickerhamomyces by morphological observation, physiological and biochemi-
anomalus, which is reported to be among the highest strains cal characteristics, and phylogenetic analysis according to Fan
for ethyl acetate producing microorganisms [2]. When Y3604 et al. [2].
was inoculated in sorghum hydrolysate medium (SHM) with
the addition of 4% anhydrous ethanol and 0.1% acetic acid, 2.3. Microbial Interaction. Fermentations were carried out
the total ethyl acetate production was 16.92 g/L [2]. It is for the single cultures of Y3401 and Y3604, respectively,
noteworthy that the concentration of ethyl acetate produced as well as for their mixed culture. Y3401 and Y3604 were
by Y3604 was less than 2 g/L when ethanol was not added as precultured, respectively, in a YPD liquid medium at 30∘ C for
a substrate [2]. Thus, ethanol is an important substrate for the 24 h. Cells were collected by centrifugation and washed with
synthesis of ethyl acetate by yeast esterification [10]. Although saline. Using SHM as the fermentation medium, cells were
Y3604 produces a small amount of ethanol in the process of inoculated to obtain a cellular population of 1 × 106 CFU/mL.
growth and metabolism, it is insufficient for the synthesis of A 1:1 mixed-culture fermentation of Y3401 and Y3604 was
ethyl acetate. tested. The SHM was prepared according to the methods
It is well known that Baijiu fermentation occurs in a described by Fan et al. [2]. Aliquots of 50 mL of SHM were
spontaneous process and multiple species are involved [1]. fermented in 250-mL flasks at 30∘ C with shaking (180 rpm)
Microbial communities are the major drivers of fermentation for 6 days. Three flasks were randomly selected each day
processes and may include mold, bacteria, yeast, Actino- throughout the fermentation to determine yeast cell growth,
mycetes, and Archaea. These organisms perform metabolic fermenting property, and pH.
processes that can include decomposition, synthesis, and
transformation and thereby produce Baijiu with many flavor 2.4. Evaluation of Effects of Cell-Free Culture Filtrates. Cell-
substances [11, 12]. While it is apparent that there is no lack free culture filtrates were prepared from cultures that used
of functional microorganisms to produce ethanol in Baijiu conditions described by Kato et al. [14]. Separate cultures of
brewing, the most important strain for ethanol production Y3401 and Y3604 were cultivated in SHM with stirring at
is Saccharomyces cerevisiae [13]. 180 rpm at 30∘ C for 3 days. The supernatant of the culture
Given that S. cerevisiae is the most important ethanol- solution was collected by centrifugation, and the cell-free
producing strain and W. anomalus is a high-yielding ethyl culture filtrate (CFCF) was prepared by filter sterilization
acetate strain, a study of the interaction of these strains with 0.22-𝜇m-pore filters. Because the CFCF was considered
should help to improve the content of ethyl acetate in to lack some nutrients, SHM-filtrate medium was used for
the fermentation system and have significant implications the culture experiment. A 1:1 mixture of SHM and the
for improving Baijiu quality. This study has examined the cell-free culture filtrate (SHM-CFCF) was used, or 800 g/L
interaction of S. cerevisiae and W. anomalus with a view to glucose (SHM-CFCF-G) was added to this mixture to adjust
tuning the fermentation and enhancing the aroma and ester the initial sugar concentration. Each precultured isolate was
content. This research will lay a solid foundation for the inoculated into the SHM-filtrate medium to obtain a final cell
application of both yeasts in Baijiu production. count of 1 × 106 CFU/mL. Growth was then measured as the
optical density reading at 560 nm (OD560 ) after cultivation
2. Materials and Methods with stirring at 180 rpm at 30∘ C for 24 h. Growth in the
SHM-filtrate medium was compared with that in the control
2.1. Screening for High-Yielding Ethanol Yeasts. Yeasts were medium (1:1 mixture of SHM and uninoculated medium
screened from Daqu, which was provided by Gujinggong used for the filtrate preparation described above). The culture
Liquor (strong flavor, Anhui Gujing Group) and Laobaigan experiments were carried out in triplicate.
(light flavor, Hengshui Laobaigan), according to the method
described previously [2]. Each isolated colony was inoculated 2.5. Effect of Inoculation Method on Ethyl Acetate Content.
to a yeast extract peptone dextrose (YPD) medium (glucose Triplicate fermentations were carried out in 250-mL Erlen-
20 g, peptone 20 g, yeast extract 10 g, agar powder 20 g, meyer flasks containing 50 mL of SHM at 30∘ C for 6 days
and ddH2 O 1000 mL, pH 6.0–6.2, autoclaved at 115∘ C for after inoculation with precultures of Y3401 or Y3604. Simul-
20 min) in a slant tube and numbered. A loop of the yeasts taneous mixed fermentation was performed by inoculating 1
stored in each slant tube after initial screening was inoculated × 106 CFU/mL of Y3401 and Y3604 (SMF). One sequential
into 50 mL of alcoholic fermentation medium (glucose 200 mixed fermentation used an initial inoculation of 1 × 106
g, yeast extract 10 g, peptone 20 g, ammonium sulfate 1 g, CFU/mL of Y3401, followed 12 h later with 1 × 106 CFU/mL of
Table 1: The ethanol yields for each yeast.
No. Ethanol yield (g/L) No. Ethanol yield (g/L)

Y3401 70 Y3506 27
Y3402 20 Y3604 13
Y3403 35 Y3215 24
Y3501 12 Y1105 47
Y3502 10 Y1801 26
Y3503 24 Y1502 31
Y3604 to form the yeast mixture (S-W). The other sequential yeasts. The fermenting property of Y3401 and Y3604 in the
mixed fermentation reversed this process, using an initial fermentation process was measured using the carbon dioxide
inoculation of 1 × 106 CFU/mL of Y3604, which was followed (CO2 ) weight loss method [16]. Mass loss caused by CO2
12 h later with 1 × 106 CFU/mL of Y3401 to give the mixture evolution was monitored by weighing the fermentation flasks
(W-S). Single-culture fermentations by Y3604 (W) and Y3401 every day. The pH was determined with a pH meter. Remain-
(S) were also carried out under the same conditions. All ing reducing sugars were measured by the dinitrosalicylic
of the above described fermentations were carried out in acid (DNS) assay and ethanol content was determined by
static culture as per the Baijiu production process. Three HPLC using a BioRad 87H column and a refractive index
flasks were randomly selected each day throughout the detector (Varian 355 RI) according to the method of Meng
fermentation process to determine the remaining reducing et al. [12]. Ethyl acetate content was determined by GC–MS
sugars, fermenting property, ethanol content, ethyl acetate and flavor compounds were analyzed by HS-SPME GC–MS,
content, and flavor compounds (fermentation finish). following previously described methods [2, 17].
2.6. Effect of Inoculation Ratio on Ethyl Acetate Content. 2.9. Statistical Analysis. Each treatment was performed
Mixed-culture fermentations with Y3401:Y3604 ratios of 1:1, in triplicate. All statistical analyses were performed with
3:1, 6:1, 1:2, and 1:3 were tested. Y3401 and Y3604 were simul- SPSS16.0 (SPSS, Chicago, IL, USA) and OriginPro 9.1
taneously inoculated into SHM and the final cell population (OriginLab, Northampton, MA, USA). Analysis of variance
of Y3604 was 1 × 106 CFU/mL at the beginning of the (ANOVA) was used to compare the means. Mean separations
fermentation. All of these fermentations were also carried out were performed by Duncan’s multiple range tests. Differences
in static culture. The remaining reducing sugars, fermenting at P < 0.05 were considered significant.
property, ethanol content, ethyl acetate content, and flavor
compounds (fermentation finish) were determined. 3. Results and Discussion
2.7. Simulated Solid-State Fermentation for Baijiu. Simulated 3.1. Screening and Identification of High-Yielding Ethanol
solid-state fermentation, prepared as in previous studies, was Yeast. A total of 46 yeasts were isolated and screened for
performed to study the effect of interactions between Y3401 ethanol yield from Daqu. Among all the strains, only 12
and Y3604 on the ethyl acetate content in Baijiu [15]. Four yeasts produced more than 10 g/L of ethanol. One isolate
separate batches were prepared by simultaneously adding (Y3401) achieved high ethanol production (70 g/L) and was
precultured Y3401 and Y3604 to light flavored Daqu in selected for further study (Table 1). Initially, strain Y3401 was
the following combinations: A, Y3401 + Y3604; B, Y3401 + preliminarily identified by morphology and microstructure.
Y3604 + Daqu; C, Daqu; D, not inoculated. Daqu (Hengshui Its colonies on Wallerstein laboratory nutrient agar culture
Laobaigan) was ground and inoculated into batches B and C medium (WL; glucose 50 g, yeast extract 4 g, tryptone
(at 12.5% w/w). Y3401 and Y3604 were separately precultured 5 g, monopotassium 0.55 g, potassium chloride 0.425 g,
to a final cell population of 1 × 106 CFU/mL, and then calcium chloride 0.125 g, magnesium sulfate 0.125 g, ferric
10 mL of each yeast culture was simultaneously inoculated chloride 0.0025 g, manganese sulfate 0.0025 g, agar 20 g,
into batches A and B at the beginning of the fermenta- bromocresol green 0.022 g, and dd H2 O 1000 mL, pH 6.5,
tion. The fermentations were carried out in static condi- autoclaved at 115∘ C for 20 min) were yellow-green centered
tions for 30 days at room temperature. Flavor compounds with a yellow edge, 2–3 mm in diameter, opaque, raised, and
were analyzed by headspace solid-phase microextraction gas sticky, with a wet, smooth surface and inerratic edges. Under
chromatography–mass spectrometry (HS-SPME GC–MS). a high-magnification zoom lens (10 × 40), morphological
All fermentation experiments were conducted in triplicate. characterization of Y3401 showed that cells were ellipsoidal,
occurring as a single cell or as parental bud pairs, and
2.8. Analytical Methods. Yeast cell growth during fermen- asexual budding reproduction occurred at the ends of the
tation was obtained by viable cell quantification using the cells. Then strain Y3401 was identified based on physiological
classical plate count method. Samples were taken aseptically and biochemical tests. It was observed to ferment glucose
throughout the fermentations and diluted appropriately with and sucrose, but not maltose, galactose, raffinose, lactose,
saline. YPD agar plates were used for enumeration of the or trehalose. In carbohydrate utilization screening, glucose,
sucrose, succinic acid, ethyl alcohol, glycerol, gluconic acid, property of S. cerevisiae [19, 25]. Mixed-culture fermenta-
ribose, and lactic acid were positive as sole carbon sources, tion using S. cerevisiae and non-Saccharomyces resulted in
but sorbitol, xylose, rhamnose, erythritol, d-(+)-gluconic sluggish fermentation, compared with fermentations using
acid 𝛿-lactone, and methanol were negative. Ammonium pure cultures of S. cerevisiae [25]. In our study, it was found
sulfate, potassium nitrate, ethylamine, and l-lysine were that there were some effects in the early stage of coculture.
utilized as sole nitrogen sources for growth, but potassium However, in the late stage of fermentation, the fermenting
nitrite and creatinine were not utilized. Further identification property in the coculture system was gradually restored to
was confirmed by 26S rDNA sequencing and analysis. Strain that of Y3401 in single culture because of the increase in
Y3401 was confirmed as S. cerevisiae based on the similarity of the number of S. cerevisiae. This result is in accordance with
results observed in BLAST analysis and phylogenetic analysis, observations of S. cerevisiae and Kloeckera apiculate and is
and the sequence was submitted to GenBank (Supplementary evident in other studies of other non-Saccharomyces yeasts
Figure S1, NCBI accession no. MG548387). It was deposited [21, 26].
in the China General Microbiological Culture Collection The pH was monitored during the fermentations, as
Center (CGMCC) under accession no. 14828. shown in Figure 1(c). In single culture, the pH decreased
quickly in the first 2 days, from 5.50 to 3.80 for Y3401 and
3.2. Influence of Microbial Interaction on Cell Growth. Cell from 5.50 to 4.08 for Y3604, and then increased slowly to a
growth, fermenting property, and pH were monitored in final pH of 4.27 and 4.32, respectively. The pH of the mixed
single and mixed cultures. Figure 1(a) shows viable cells culture showed a trend similar to that of the single cultures,
of Y3401 and Y3604 in single and mixed cultures. In all especially Y3401. In the early stage of fermentation, the yeast
cultures tested, the growth trends of both yeasts were similar. formed acidic substances such as acetic acid, resulting in a
Both yeasts reached the maximum population within 3 days decrease in pH [26]. After initial breeding, the yeast entered
and then decreased slightly as fermentation progressed. It the stage of alcohol fermentation, which led to a constant
is important to mention that both yeasts exhibited a lower rise of alcohol concentration. The yeast would be expected to
growth rate in coculture and the final biomass was lower secrete proteases at this stage, hydrolyzing protein to amino
than in the respective pure cultures (Figure 1(a)). The results acids, which would then degenerate to produce ammonia.
demonstrated that the growth of each yeast in mixed culture The formation of ethanol and NH3 resulted in an increase
was influenced by the other [18, 19]. This result concurs with in the pH [18]. This result was in agreement with previous
a previous report in which there was growth between S. reports[18, 26], and, in a previous study, we found that Y3604
cerevisiae and W. anomalus, and this fact is evident in other had good pH tolerance and was able to grow at pH 2.0.
studies for other non-Saccharomyces yeasts where population Furthermore, acidic conditions are favored for production of
is controlled during the fermentation [20–22]. It is also ethyl acetate by Y3604 [2]. Therefore, we speculate that the
noteworthy that the growth rate and biomass of Y3401 were decrease of pH caused by the growth of Y3401 would not be
faster and higher than Y3604 in either single or mixed an adverse influence on Y3604 to produce ethyl acetate.
culture. However, some studies have shown that W. anomalus
grows better than S. cerevisiae, which may be a result of 3.3. Influence of Cell-Free Culture Filtrate on Cell Growth.
different strains [23]. The maximum population of Y3401 and During mixed fermentations, several factors can affect the
Y3604 reached 1.3 × 108 CFU/mL and 7.7 × 107 CFU/mL in growth of strains, such as competition for nutrients (mainly
single cultures and 8.9 × 107 CFU/mL and 5.0 × 107 CFU/mL carbon sources), the presence of toxic compounds, low
in mixed cultures, respectively. Given that S. cerevisiae is available oxygen conditions, high ethanol concentration, cell-
known to preferentially utilize reducing sugars to proliferate cell contact, and quorum sensing [20, 27]. There was a certain
rapidly, it appears to have competed with W. anomalus for degree of interaction between Y3401 and Y3604 in mixed
the carbon source, resulting in slow growth of W. anomalus culture and the cell population of both reached a maximum
and a disparity in cell number for the two yeasts in coculture after 3 days, which means that nutrients or metabolites in
condition [18]. the medium after 3 days became a limiting factor for yeast
Carbon dioxide weight loss is commonly used to reflect growth. Therefore, we briefly analyzed the interaction of
the fermenting property of yeast in fermentation or during both strains from the perspectives of carbon source and
the Baijiu brewing process [24]. As shown in Figure 1(b), the metabolites using the CFCF from day 3. As shown in Table 2,
fermenting property of Y3401 was superior to that of Y3604, the growth of Y3401 was affected by the carbon source (A1
being in accordance with the results of Medina et al. [25]. and A2 in Table 2) and was weakly affected by metabolites
We also noticed that the fermenting property of the mixed- of Y3604 (A3 and A4 in Table 2). The metabolites of Y3401
strain fermentation was similar to that of Y3401, and it had had an inhibitory effect on the growth of Y3604 (B1 and
an advantage over that of Y3604. Thus, it can be inferred B2 in Table 2), which is consistent with previous reports
that Y3604 has little effect on the fermenting property of [23]. By analysis of results B3 and B4, it appears that the
Y3401, and Y3401 improved the fermenting property of the growth of Y3604 was inhibited by its own metabolites. These
mixed culture. In this respect, it is feasible to produce more results were consistent with the findings of a previous study
ethyl acetate by Y3604 by using the ethanol, as the precursor of the interaction between S. cerevisiae and Pichia anomala in
for ethyl acetate, produced by Y3401. In fact, it is generally coculture [18]. In other previous studies of mixed culture fer-
believed that non-Saccharomyces can inhibit the fermenting mentations, yeasts were found to produce other metabolites
7.5 25
20
7.0
＃／2 weightlessness (g/L)

Biomass (Log(cfu/mL))
15
6.5
10
6.0
5
5.5 0
0 1 2 3 4 5 6 0 1 2 3 4 5 6
Time (d) Time (d)
S. cerevisiae Y3401 in single culture S. cerevisiae Y3401 in single culture
W. anomalus Y3604 in single culture W. anomalus Y3604 in single culture
W. anomalus Y3604 in mixed culture S. cerevisiae Y3401 and W. anomalus Y3604 in mixed culture
S. cerevisiae Y3401 in mixed culture
(a) (b)
5.6
5.2
4.8
pH
4.4
4.0
3.6
3.2
0 1 2 3 4 5 6
Time (d)
S. cerevisiae Y3401 in single culture

W. anomalus Y3604 in single culture
S. cerevisiae Y3401 and W. anomalus Y3604 in mixed culture
(c)
Figure 1: Cell growth, fermenting property and pH in single and mixed cultures of S. cerevisiae Y3401 and W. anomalus Y3604 with the
inoculation ratio of 1:1. (a), Cell growth of S. cerevisiae Y3401 and W. anomalus Y3604 in single and mixed cultures, black square, S. cerevisiae
Y3401 in single culture, red circle, W. anomalus Y3604 in single culture, green triangle down, S. cerevisiae Y3401 in mixed culture, blue triangle
up, W. anomalus Y3604 in mixed culture; (b), Fermenting property of S. cerevisiae Y3401 and W. anomalus Y3604 in single and mixed cultures,
black square, S. cerevisiae Y3401 in single culture, red circle, W. anomalus Y3604 in single culture, blue triangle up, S. cerevisiae Y3401 and
W. anomalus Y3604 in mixed culture; (c), pH of S. cerevisiae Y3401 and W. anomalus Y3604 in single and mixed cultures, black square, S.
cerevisiae Y3401 in single culture, red circle, W. anomalus Y3604 in single culture, blue triangle up, S. cerevisiae Y3401 and W. anomalus Y3604
in mixed culture. Results are the average and bars indicate the SD.
besides ethanol, such as short- to medium-chain fatty acids or exhibit different fungistatic effects against different strains
peptides, which can become inhibitory to other yeast species [31]. These results have special significance for optimizing the
[28–30]. Production of these metabolites varies significantly mixed fermentation of both strains to improve ethyl acetate
with yeast species and strain [30], while the metabolites also content.
Table 2: Growth suppression by addition of cell free filtrate.
A B
No. Culture medium𝐴 Relative value Relative value
(S. cerevisiae Y3401) (W. anomalus Y3604)
1 SHM-CFCF-Y3401 0.91±0.02a 0.74±0.05a
2 SHM-CFCF-G-Y3401 0.99±0.02b 0.75±0.04a
3 SHM-CFCF-Y3604 0.93±0.01a 0.82±0.02b
4 SHM-CFCF-G-Y3604 0.97±0.05ab 0.85±0.02b
𝐴
SHM-CFCF-Y3401: 1:1 mixture of SHM and the cell-free culture filtrate of S. cerevisiae Y3401; SHM-CFCF-G-Y3401: Adding glucose into 1:1 mixture of
SHM and the cell-free culture filtrate of S. cerevisiae Y3401; SHM-CFCF-Y3604: 1:1 mixture of SHM and the cell-free culture filtrate of W. anomalus Y3604;
SHM-CFCF-G-Y3604: Adding glucose into 1:1 mixture of SHM and the cell-free culture filtrate of W. anomalus Y3604.
Note: Same lowercase letters in each column do not differ significantly at 5% probability by Duncan’s multiple range tests.
3.4. Optimization of Mixed Fermentations for Ethyl Acetate time of inoculation of Y3401. In general, earlier inoculation
Yield. The previous study gave us a preliminary understand- of Y3401 gave higher fermentation capacity, especially in the
ing of the interaction between Y3401 and Y3604. Next, we first 2 days. These results are basically in line with the results
studied how the strains cofermented to improve the content of previous reports [18, 32]. The above interpretations of the
of ethyl acetate with different inoculation methods and changes in reducing sugars also applied to the fermenting
inoculation ratios in static cultures. In addition to focusing on property. At the same time, the fermenting property of all
the content of ethyl acetate, we also analyzed reducing sugars, fermentation systems decreased gradually with time and was
fermenting property, ethanol content, and flavor components very low after 3 days. This may have been caused by strong
after fermentation. Thus, a comprehensive evaluation was consumption of nutrients, especially reducing sugars, and
conducted for both yeasts in the cofermentation from mul- the accumulation of metabolites in the fermentation system,
tiple perspectives. resulting in a decrease in cell growth.
The results for ethanol analysis are illustrated in Supple-
3.4.1. Effect of Inoculation Method on Ethyl Acetate Content. mentary Figure S3(c). It is apparent that Y3604 was able to
The utilization of reducing sugar is an important index for produce ethanol in static culture, while the yield was less than
judging the growth of yeast [18]. Interestingly, significant that of Y3401. This observation is similar to reports of other
difference was observed in reducing sugar consumption non-Saccharomyces [23, 33, 34]. For mixed fermentations, the
between the single and mixed fermentations (Supplementary amount of ethanol produced was higher than that in single
Figure S2(a)). The results showed that fermentation went to culture of Y3604, implying that Y3401 increased the amount
completion for all fermentations, and, at day 3, the mixed of ethanol in the fermentation system. Literature reports
fermentation systems and the Y3401 single culture contained suggest that ethanol production is significantly increased
less than 10 g/L reducing sugar. In other words, in single with S. cerevisiae inoculation in mixed fermentations and that
culture of Y3604, the rate of reducing sugar consumption the lowest ethanol levels are seen in the pure cultures of non-
was lower than that of Y3401 or the mixed culture. Two Saccharomyces [20, 32, 35]. For inoculation timing, earlier
possible explanations were proposed: first, the inoculum size inoculation of Y3401 gave the higher yields of ethanol, in
in single culture was smaller than that in mixed culture; agreement with some previous reports [32, 36]. In summary,
second, Y3401 uses sugar faster than Y3604. At the same time, Y3401 was able to provide ethanol, which is a precursor
it was apparent that earlier inoculation of Y3401 saw faster of ethyl acetate, for Y3604 to produce more ethyl acetate.
utilization of sugar in the mixed fermentation system, and S. Medina et al. [25] reported a significant increase in flavor
cerevisiae showed the highest fermentability in single culture compounds, such as ethyl acetate, by cofermentation of S.
in accordance with previous reports [18, 20]. We concluded cerevisiae with non-Saccharomyces in wine.
that Y3604 had little or no effect on the utilization of sugar by In previous reports, the use of a non-Saccharomyces–S.
Y3401. This further indicates from another perspective that cerevisiae couple was found to significantly boost the pro-
Y3604 had limited effect on the growth of Y3401. Similar duction of most detected compounds, more particularly in
results for other non-Saccharomyces have been reported higher alcohols, esters, acids, and terpenes, while there are
previously [18, 20, 27]. few reports on the optimal conditions for increasing the
In analyzing the fermentations, Supplementary Figure yield of ethyl acetate in mixed fermentation [32, 35, 37–
S2(b) shows that the curve profile of fermenting property 40]. Ethyl acetate production was different among different
was the opposite to that for the reducing sugars, although culture fermentation systems in our study (Figure 2). Mixed
the internal laws reflected by both curves were basically culture produced more ethyl acetate than single culture
the same. The results showed that the fermenting property during fermentation, and ethyl acetate production was higher
of Y3401 was superior to Y3604. The fermenting property in mixed fermentation systems with sequential inoculation
in the mixed fermentation system, which was inoculated than in simultaneous mixed fermentation. Among the mixed
with Y3401, was higher than that in a single system of W. fermentations, W-S was the best method of inoculation for
anomalus, and the fermenting property was related to the ethyl acetate production with 2.86 g/L, which was 3.28 times
3.6 than in single fermentation. Ye et al. [20] also reported

that the simultaneous mixed culture of S. cerevisiae and
W. anomalus demonstrated an increase in phenethyl acetate
Concentration of ethyl acetate (g/L)
3.0
content. It is also noteworthy that a few flavor compounds,
such as caprylic acid and ethyl caprylate, were produced in
2.4
mixed fermentation because of the inoculation of Y3401;
these compounds were not present in the single fermentation
1.8 by Y3604. Previous reports showed that the presence and
persistence of S. cerevisiae and its metabolic interactions
1.2 with W. anomalus in the mixed fermentations influenced the
production of volatile compounds [20, 42].
0.6
3.4.2. Effect of Inoculation Ratio on Ethyl Acetate Content.
Overall, the reducing sugars were almost fully consumed
0.0 within 3 days in all mixed fermentations, and the consump-
0 1 2 3 4 5 6
tion rate of reducing sugars increased as the proportion of
Time (d)
Y3401 increased (Supplementary Figure S3(a)). In addition,
S S-W the consumption of reducing sugars was similar when the
W W-S inoculation ratios of Y3401:Y3604 were 6:1 and 3:1. These
SMF
ratios also gave the fastest consumption of reducing sugars.
Figure 2: The change of concentration of ethyl acetate in different The utilization of reducing sugars was about the same for
fermentation with different inoculation methods. Black square, inoculation ratios of 1:1 and 1:2. These results are consistent
single-culture fermentation by S. cerevisiae Y3401 (S); red circle, with a previous finding that showed that the consumption
single-culture fermentation by W. anomalus Y3604 (W); blue rate of reducing sugars was higher when the proportion of
triangle up, simultaneous mixed fermentation was performed by S. cerevisiae was higher [26]. In accordance with the above
inoculating 1×106 CFU/mL of S. cerevisiae Y3401 and W. anomalus
results, the growth rate of Y3401 was higher than that of
Y3604 (SMF); green diamond, inoculating 1×106 CFU/mL of S.
Y3604.
cerevisiae Y3401 for 12 h firstly, then 1×106 CFU/mL of W. anomalus
Y3604 was added (S-W); violet triangle down, inoculating 1×106 Supplementary Figure S3(b) shows that when Y3401
CFU/mL of W. anomalus Y3604 for 12 h firstly, then 1×106 CFU/mL was dominant, the fermenting property was better than
of S. cerevisiae Y3401 was added (W-S). Results are the average and when Y3604 was dominant. Among the mixed cultures,
bars indicate the SD. the fermenting property was highest when the inoculation
ratio of Y3401:Y3604 was 3:1. It is worth noting that the
lowest fermenting property was observed for a Y3401:Y3604
ratio of 1:1. This was somewhat different from the trend of
the level achieved by single culture of Y3604. Although reducing sugars consumption, perhaps because the inter-
ethanol production in S-W and SMF was slightly higher action between them was most obvious in this case, and
than that in W-S, both produced less ethyl acetate than W- some nutrients, including reducing sugars, were consumed
S. This may have been caused by rapid growth of Y3401, and converted to antimicrobial metabolites in the course of
which was more vigorous than Y3604, in the S-W and interaction [23, 43, 44].
SMF fermentations, resulting in nutrient competition and The yield of ethanol usually reached the highest level on
metabolite inhibition to Y3604 [20, 26, 41]. the third or fourth day, and the content of ethanol decreased
The results of HS-SPME GC–MS analysis of flavor slightly in the later stages of fermentation, because the rate of
fractions are shown in Supplementary Table S1. Significant ethanol synthesis was lower than the rate of its consumption
differences between culture types were observed for all and conversion to other substances (Supplementary Figure
the aroma compounds analyzed. It was found that mixed S3(c)). In addition, Supplementary Figure S3(c) shows that
fermentations showed higher content of flavor compounds ethanol production increased with the increasing propor-
than single fermentation by Y3604, especially for esters, tion of Y3401. Generally, compared with Y3604 in single
ethanol, and higher alcohols. A previous study indicated that fermentation, the ethanol content increased when Y3401 was
mixed fermentations of S. cerevisiae and W. anomalus show cocultured with Y3604, which introduced a large number of
interesting oenological properties and can provide a favorable precursors for the synthesis of ethyl acetate (Supplementary
combination for production of esters and linear alcohols [38]. Figure S2(c); Figure S3(c)) [18, 32].
Because of the inoculation of Y3401 in mixed fermentation, Figure 3 shows that the amount of ethyl acetate increased
ethanol content increased significantly when compared with first and then decreased with time for the different inoc-
single fermentation. This result also led to a significant rise in ulation ratios. The yield of ethyl acetate was higher when
ethanol conversion to ethyl acetate. Thus, the presence of S. Y3604 was dominant in mixed fermentation, while the yield
cerevisiae in the mixed fermentations significantly increased was the least when the two yeasts were in equal proportion.
the ethyl acetate production [20]. In addition, levels of When Y3604 was dominant, the highest ethyl acetate yield
phenethyl alcohol and the corresponding phenethyl acetate was 2.99 g/L when the inoculation ratio of Y3401:Y3604 was
with a rose-like odor were higher in mixed fermentation 1:2. When Y3401 was dominant, the higher ethyl acetate yield
3.6 the content of phenethyl alcohol increased as the proportion

of Y3401 increased. The content of phenethyl alcohol in
Concentration of ethyl acetate (g/L)
3.0 the mixed fermentation system was higher than that in

single fermentation by each of the yeasts, which means that
2.4 the yeasts showed a synergistic effect in the production of
phenethyl alcohol (Supplementary Tables S1 and S2). This
1.8 result is similar to previous reports [46].
1.2 3.5. Simulated Solid-State Fermentation for Baijiu with Y3401

and Y3604. At present, Baijiu production is carried out
0.6 as a solid-state fermentation [15, 43]. In using the Y3401
and Y3604 strains to enhance the taste of Baijiu, we also
0.0 studied the flavor compounds associated with these two
0 1 2 3 4 5 6 yeasts in the simulated solid-state fermentation for Baijiu.
Time (d) Analysis revealed (Table 3) that many flavor compounds were
Y3401:Y3604 6:1 Y3401:Y3604 1:2 present in the simulated solid-state fermentation, including
Y3401:Y3604 3:1 Y3401:Y3604 1:3 alcohols, esters, ketones, acids, and alkanes. The combina-
Y3401:Y3604 1:1 Y3604 tion of these substances determines the quality of Baijiu.
Figure 3: The change of concentration of ethyl acetate in different The highest abundance of flavor compounds occurred in
fermentation with different inoculation ratio. Black square, inocula- experiment B (Y3401/Y3604/Daqu). It is considered that
tion ratio of S. cerevisiae Y3401 and W. anomalus Y3604 is 6:1; green isoamyl alcohol, ethyl phenylacetate, ethyl tetradecanoate,
star, inoculation ratio of S. cerevisiae Y3401 and W. anomalus Y3604 ethyl 9-hexadecenoate, ethyl palmitate, ethyl oleate, styrene,
is 3:1; blue triangle up, inoculation ratio of S. cerevisiae Y3401 and 1-caryophyllene, and pentadecane are probably related to the
W. anomalus Y3604 is 1:1; purple triangle down, inoculation ratio of metabolisms of Y3401 and Y3604, while the formation of
S. cerevisiae Y3401 and W. anomalus Y3604 is 1:2; green diamond,
ethyl isovalerate, ethyl pentadecanoate, isovaleric acid, and
inoculation ratio of S. cerevisiae Y3401 and W. anomalus Y3604 is
1:3; red circle, single-culture fermentation by W. anomalus Y3604. phenylacetaldehyde are probably related to the interaction of
Results are the average and bars indicate the SD. both yeasts and the microorganisms provided by Daqu. The
results show that the flavor profile of Baijiu can be altered by
the addition of extrinsic microbes. This effect was not caused
by the flavor production ability of the extrinsic microbes,
was obtained when the ratio of Y3401:Y3604 was 3:1. These but by the interaction between the extrinsic and intrinsic
results may be explained by several factors. Although Y3604 microbes [23]. When compared with experiment C (Daqu),
has high ethanol tolerance, its growth and metabolism would experiments A (Y3401/Y3604) and B (Y3401/Y3604/Daqu)
always be inhibited under high ethanol concentration, which showed significant increases in ethyl acetate, phenethyl alco-
was the case with Y3401 [20, 45]. The metabolites of Y3401 hol, and methyl catechol, which have significant effects on the
are also known to have some effect on Y3604 [26, 27, 41]. quality of Baijiu. Thus, it is apparent that the synergistic effect
Therefore, the higher yield of ethyl acetate occurred when of Y3401 and Y3604 can improve esterification and enhance
Y3604 was the predominant strain because more substrate the flavor of Baijiu.
ethanol would be produced by Y3401. However, when the
proportion of Y3604 was too high, it inevitably had some
4. Conclusion
influence on Y3401 and affected its ability to provide ethanol,
which is one of the precursors of ethyl acetate [20, 45].
It is well known that Baijiu prepared by spontaneous fer-
Similarly, when Y3401 was the predominant strain, although
mentation does not always meet the expectations of con-
more ethanol was generated, the synthesis of ethyl acetate by
Y3604 was affected because the normal metabolism of Y3604 sumers. Although the use of additional inoculated functional
was suppressed by high ethanol [20, 45]. Therefore, in this microbes is an attractive way to improve Baijiu quality, the
case, the higher yield of ethyl acetate occurred at a relatively microbial interactions are poorly understood, and the use
low Y3401:Y3604 ratio of 3:1. It is noteworthy that when the of selected microbes does not always have a positive result.
cultures were inoculated in equal proportions, the yield of This work investigated the microbial interactions between S.
ethyl acetate may have been lower because of more intense cerevisiae and W. anomalus as two functional microbes. We
interaction. found that, under suitable culture conditions, S. cerevisiae can
The levels of volatile compounds for different inoculation enhance the production of ethyl acetate by W. anomalus dur-
ratios are shown in Supplementary Table S2. Except for ing Baijiu fermentation. The highest yield of ethyl acetate was
ethanol, phenethyl alcohol, and ethyl acetate, the differences 2.99 g/L in SHM medium with a Y3401:Y3604 inoculation
between the flavor compounds were minor for the different ratio of 3:1. This process of tuning mixed fermentations for
inoculation ratios. Ethanol and ethyl acetate levels were Baijiu production can be used to improve product quality and
basically consistent with the previous results. The change of complexity to ultimately produce beverages with distinctive
phenethyl alcohol content was similar to that of ethanol, and sensory properties.
Table 3: The volatile compounds in the different simulated solid-state fermentations (𝜇g/kg).
Odor thresholds
Volatile compounds A B C D
(𝜇g/L)
Ethanol 521±42a 723±71b 535±112a 150±37a 100,000
Isoamyl alcohol 27±12a 133±21b - - 179,190.83
𝛽-Phenethyl alcohol 695±131c 3,436±243d 53±13b 19±1a 28,922.73
1-Octen-3-ol 12±11a 115±22b 236±91c 732±244d 6.12
2-Phenyl-propan-2-ol - 166±92b 35±11a - /
Σ Higher alcohols 1,255 4,573 859 901
Ethyl acetate 833±91c 625±72b 64±13a - 32,551.60
Ethyl caprylate 57±12a 76±32a 45±21a - 12.87
Ethyl caprate - 23±1a 22±2a - 1122.30
Ethyl phenylacetate 39±26a 182±81b - - 406.83
Ethyl isovalerate - 73±27 - - 6.89
Dimethyl phthalate 9±7a 18±3a 23±11a - /
Ethyl tetradecanoate 34±9a 87±26b - - 800
Dibutyl phthalate 64±8a 322±105b - - /
Ethyl pentadecanoate - 87±23 - - 7,000
Ethyl 9-hexadecenoic acid 9±7a 88±37b - - 1,500
Ethyl palmitate 584±107a 1,632±209b - - 2,000
Ethyl oleate 587±104a 1,563±212b - - /
Σ Esters 2,216 4,776 154 -
2-Octanone 583±109bc 861±232c 464±68ab 288±99a /
Acetophenone 157±87b 36±27a - - /
3-Octanone - 62±17b 33±8a 143±18c /
Σ Ketones 740 959 497 431
Methyl catechol 981±32b 2,361±192c - 57±37a 23
4-Vinylguaiacol 2,153±128b 94±47a 87±21a - 1,100
4-Ethylguaiacol - 11,609±296b 23±16a 64±28a 33
Σ Phenols 3,134 14,064 110 121
Isooctanoic acid 13±1a 21±16a 11±9a - /
Isovaleric acid - 93±17 - - 1045.47
Σ Acids 13 114 11 -
Azulene 109±28b 253±57c 23±2a 127±69 b
/
Styrene 23±8a 114±27b - - 80
1-Caryophyllene 114±37a 108±67a - - /
Σ Alkenes 246 475 23 127
Pentadecane 32±8a 44±27a - 74±36a /
Hexadecane 23±0a 52±12b 18±17a - 300,000-400,000
Eicosane 9±1a 18±11a - - /
Σ Alkanes 64 114 18 74
Phenylacetaldehyde - 22±1a 13±0a - 5.2
Sum 7,668 25,075 1,672 1,654
A: Only S. cerevisiae Y3401 and W. anomalus Y3604 were in the solid-state fermentations system; B: S. cerevisiae Y3401, W. anomalus Y3604 and Daqu were in
the solid-state fermentations system; C, Only Daqu was in the solid-state fermentations system; D, no inoculation was in the solid-state fermentations system.
Note: Data are average of three replicates ± standard deviations; “-”, not detected; Same lowercase letters in each line do not differ significantly at 5% probability
by Duncan’s multiple range tests; “/”, not available.
Data Availability [6] X.-Y. Luo, S.-Y. Qiu, M.-Z. Chen, A.-M. Lu, and X.-D. Wang,
“Isolation and identification of aroma-producing yeast in
The data used to support the findings of this study are Moutai-flavor Daqu,” Food and Fermentation Industries, vol. 42,
available from the corresponding author upon request. no. 12, pp. 26–31, 2016.
[7] Z.-H. Li, B.-L. Ren, and J.-H. Zhu, “Isolation and identification
Conflicts of Interest of an ethyl acetate producing yeast strain C-42,” in Science and
Technology of Food Industry, vol. 35, pp. 188–191, 8 edition, 2014.
The authors declare that they have no competing interests. [8] N. P. Jolly, C. Varela, and I. S. Pretorius, “Not your ordinary
yeast: Non-Saccharomyces yeasts in wine production uncov-
Authors’ Contributions ered,” FEMS Yeast Research, vol. 14, no. 2, pp. 215–237, 2014.
[9] C. Varela, “The impact of non-Saccharomyces yeasts in the
Guangsen Fan and Chao Teng contributed equally to this production of alcoholic beverages,” Applied Microbiology and
work. Biotechnology, vol. 100, no. 23, pp. 9861–9874, 2016.
[10] K. M. Sumby, P. R. Grbin, and V. Jiranek, “Microbial modulation
Acknowledgments of aromatic esters in wine: Current knowledge and future
prospects,” Food Chemistry, vol. 121, no. 1, pp. 1–16, 2010.
We thank Prof. Yu Liangli and Austin Schultz for insightful [11] P. Wang, Q. Wu, X. Jiang, Z. Wang, J. Tang, and Y. Xu,
discussions and providing language help. This research was “Bacillus licheniformis affects the microbial community and
supported by the National Natural Science Foundation of metabolic profile in the spontaneous fermentation of Daqu
China [grant numbers 31701592 and 31671798), General starter for Chinese liquor making,” International Journal of Food
Financial Grant from the China Postdoctoral Science Foun- Microbiology, vol. 250, pp. 59–67, 2017.
dation (grant number 2016M590026), and the Foundation of [12] X. Meng, Q. Wu, L. Wang, D. Wang, L. Chen, and Y. Xu,
Beijing Technology and Business University (grant number “Improving flavor metabolism of Saccharomyces cerevisiae by
mixed culture with Bacillus licheniformis for Chinese Maotai-
LKJJ2017-10).
flavor liquor making,” Journal of Industrial Microbiology and
Biotechnology, vol. 42, no. 12, pp. 1601–1608, 2015.
Supplementary Materials [13] Q. Wu, S. Cao, and Y. Xu, “Effects of glutinous and nongluti-
nous sorghums on Saccharomyces cerevisiae fermentation for
Table S1: some of the main volatile compounds at the end of Chinese liquor making,” International Journal of Food Science
the different fermentations by different inoculation methods. & Technology, vol. 52, no. 6, pp. 1348–1357, 2017.
Table S2: some of the main volatile compounds at the end [14] S. Kato, S. Haruta, Z. J. Cui, M. Ishii, and Y. Igarashi, “Network
of the different fermentations by different inoculation ratio. relationships of bacteria in a stable mixed culture,” Microbial
Figure S1: neighbor-joining phylogenetic tree based on 26S Ecology, vol. 56, no. 3, pp. 403–411, 2008.
rDNA gene sequence of strain Y3401 and its closest relative [15] Y. Han, S. Liu, J. Yang et al., “Residue behavior and processing
species. Figure S2: the change of remaining reducing sugar, factors of eight pesticides during the production of sorghum
fermenting property, and concentration of ethanol in differ- distilled spirits,” Food Control, vol. 69, pp. 250–255, 2016.
ent fermentation with different inoculation methods. Figure [16] X. Sun, L. Liu, Y. Zhao et al., “Effect of copper stress on growth
S3: the change of remaining reducing sugar, fermenting prop- characteristics and fermentation properties of Saccharomyces
erty, and concentration of ethanol in different fermentation cerevisiae and the pathway of copper adsorption during wine
with different inoculation ratio. (Supplementary Materials) fermentation,” Food Chemistry, vol. 192, Article ID 17789, pp.
43–52, 2015.
References [17] G. Fan, B. Sun, Z. Fu et al., “Analysis of physicochemical
indices, volatile flavor components and microbial community of
[1] H. Liu and B. Sun, “Effect of Fermentation Processing on the a light-flavor Daqu,” Journal of the American Society of Brewing
Flavor of Baijiu,” Journal of Agricultural and Food Chemistry, Chemists, vol. 76, no. 3, pp. 209–218, 2018.
vol. 66, no. 22, pp. 5425–5432, 2018. [18] J. Tang, H.-Y. Wang, and Y. Xu, “Effect of mixed culture of
[2] G. Fan, B. Sun, D. Xu et al., “solation and identification of a high- Saccharomyces cerevisiae and Pichia anomala on fermentation
yield ethyl acetate-producing yeast from Gujinggong Daqu and efficiency and flavor compounds in Chinese liquor,” Microbiol-
its fermentation characteristics,” Journal of the American Society ogy China, vol. 39, no. 7, pp. 921–930, 2012.
of Brewing Chemists, vol. 76, no. 2, pp. 117–124, 2018. [19] M. Ciani, L. Beco, and F. Comitini, “Fermentation behaviour
[3] J. Guo and S. Jia, “Effects of enzymes on ester production during and metabolic interactions of multistarter wine yeast fermenta-
the course of a Chinese liquor fermentation as discussed by tions,” International Journal of Food Microbiology, vol. 108, no.
correlation analysis and path analysis,” Journal of the Institute 2, pp. 239–245, 2006.
of Brewing, vol. 120, no. 4, pp. 565–570, 2014. [20] M. Ye, T. Yue, and Y. Yuan, “Effects of sequential mixed cultures
[4] Y. Chen, F. Li, J. Guo, G. Liu, X. Guo, and D. Xiao, “Enhanced of Wickerhamomyces anomalus and Saccharomyces cerevisiae on
ethyl caproate production of Chinese liquor yeast by over- apple cider fermentation,” FEMS Yeast Research, vol. 14, no. 6,
expressing EHT1 with deleted FAA1,” Journal of Industrial pp. 873–882, 2014.
Microbiology and Biotechnology, vol. 41, no. 3, pp. 563–572, 2014. [21] Á. Benito, F. Calderón, F. Palomero, and S. Benito, “Combine
[5] O. Kurita, “Increase of acetate ester-hydrolysing esterase activity use of selected Schizosaccharomyces pombe and Lachancea
in mixed cultures of Saccharomyces cerevisiae and Pichia thermotolerans yeast strains as an alternative to the traditional
anomala,” Journal of Applied Microbiology, vol. 104, no. 4, pp. malolactic fermentation in red wine production,” Molecules, vol.
1051–1058, 2008. 20, no. 6, pp. 9510–9523, 2015.
[22] H. Erten and H. Tanguler, “Influence of Williopsis saturnus behaviour and wine aroma of cherry wines,” Food Microbiology,
yeasts in combination with Saccharomyces cerevisiae on wine vol. 44, pp. 15–23, 2014.
fermentation,” Letters in Applied Microbiology, vol. 50, no. 5, pp. [38] P. M. Izquierdo Cañas, E. Garcı́a-Romero, J. M. Heras Manso,
474–479, 2010. and M. Fernández-González, “Influence of sequential inocu-
[23] Q. Wu, Y. Kong, and Y. Xu, “Flavor profile of Chinese liquor lation of Wickerhamomyces anomalus and Saccharomyces cere-
is altered by interactions of intrinsic and extrinsic microbes,” visiae in the quality of red wines,” European Food Research and
Applied and Environmental Microbiology, vol. 82, no. 2, pp. 422– Technology, vol. 239, no. 2, pp. 279–286, 2014.
430, 2016. [39] K. Medina, E. Boido, L. Fariña et al., “Increased flavour diversity
[24] Y.-J. Yang, X.-N. Lin, and Y.-J. Xia, “Effects of different nutrition of Chardonnay wines by spontaneous fermentation and co-
additives on ethanol tolerance and fermentation performance of fermentation with Hanseniaspora vineae,” Food Chemistry, vol.
Chinese rice wine yeast,” Food and Fermentation Industries, vol. 141, no. 3, pp. 2513–2521, 2013.
44, no. 1, pp. 37–43, 2018. [40] K. Hu, G.-J. Jin, W.-C. Mei, T. Li, and Y.-S. Tao, “Increase
[25] K. Medina, E. Boido, E. Dellacassa, and F. Carrau, “Growth of of medium-chain fatty acid ethyl ester content in mixed H.
non-Saccharomyces yeasts affects nutrient availability for Sac- uvarum/S. cerevisiae fermentation leads to wine fruity aroma
charomyces cerevisiaeduring wine fermentation,” International enhancement,” Food Chemistry, vol. 239, pp. 495–501, 2018.
Journal of Food Microbiology, vol. 157, no. 2, pp. 245–250, 2012. [41] M. Sadoudi, R. Tourdot-Maréchal, S. Rousseaux et al., “Yeast-
[26] P.-F. Pu, H. Yang, R.-F. Peng, J.-J. Du, and X.-Z. Yan, “Interaction yeast interactions revealed by aromatic profile analysis of
of two kinds of yeast during Haihong wine fermentation,” China Sauvignon Blanc wine fermented by single or co-culture of non-
Brewing, vol. 36, no. 9, pp. 69–73, 2017. Saccharomyces and Saccharomyces yeasts,” Food Microbiology,
[27] F. Pérez-Nevado, H. Albergaria, T. Hogg, and F. Girio, “Cellular vol. 32, no. 2, pp. 243–253, 2012.
death of two non-Saccharomyces wine-related yeasts during [42] M. Ciani, F. Comitini, I. Mannazzu, and P. Domizio, “Controlled
mixed fermentations with Saccharomyces cerevisiae,” Interna- mixed culture fermentation: a new perspective on the use
tional Journal of Food Microbiology, vol. 108, no. 3, pp. 336–345, of non-Saccharomyces yeasts in winemaking,” FEMS Yeast
2006. Research, vol. 10, no. 2, pp. 123–133, 2010.
[28] P. Branco, D. Francisco, M. Monteiro et al., “Antimicrobial [43] Y. Zhi, Q. Wu, H. Du, and Y. Xu, “Biocontrol of geosmin-
properties and death-inducing mechanisms of saccharomycin, producing Streptomyces spp. by two Bacillus strains from Chi-
a biocide secreted by Saccharomyces cerevisiae,” Applied Micro- nese liquor,” International Journal of Food Microbiology, vol. 231,
biology and Biotechnology, vol. 101, no. 1, pp. 159–171, 2017. pp. 1–9, 2016.
[29] G. H. Fleet, “Yeast interactions and wine flavour,” International [44] U. Błaszczyk, P. Sroka, P. Satora, and R. Duliński, “Effect of
Journal of Food Microbiology, vol. 86, no. 1-2, pp. 11–22, 2003. Wickerhamomyces anomalus and Pichia membranifaciens killer
[30] M.-G. Lambrechts and I.-S. Pretorius, “Yeast and its importance toxins on fermentation and chemical composition of apple
to wine aroma - a review,” South African Journal of Enology and wines produced from high-sugar juices,” Journal of Food and
Viticulture, vol. 21, pp. 97–125, 2000. Nutrition Research, vol. 56, no. 2, pp. 189–199, 2017.
[31] M. Ciani and F. Fatichenti, “Killer toxin of Kluyveromyces phaffii [45] R. F. Basso, A. R. Alcarde, and C. B. Portugal, “Could non-
DBVPG 6076 as a biopreservative agent to control apiculate Saccharomyces yeasts contribute on innovative brewing fermen-
wine yeasts,” Applied and Environmental Microbiology, vol. 67, tations?” Food Research International, vol. 86, pp. 112–120, 2016.
no. 7, pp. 3058–3063, 2001.
[46] M. Zha, B. Sun, Y. Wu, S. Yin, and C. Wang, “Improving
[32] M. Gobbi, F. Comitini, P. Domizio et al., “Lachancea ther- flavor metabolism of Saccharomyces cerevisiae by mixed culture
motolerans and Saccharomyces cerevisiae in simultaneous and with Wickerhamomyces anomalus for Chinese Baijiu making,”
sequential co-fermentation: A strategy to enhance acidity and Journal of Bioscience and Bioengineering, vol. 126, no. 2, pp. 189–
improve the overall quality of wine,” Food Microbiology, vol. 33, 195, 2018.
no. 2, pp. 271–281, 2013.
[33] I. W. González-Robles, M. Estarrón-Espinosa, and D. M. Dı́az-
Montaño, “Fermentative capabilities and volatile compounds
produced by Kloeckera/Hanseniaspora and Saccharomyces yeast
strains in pure and mixed cultures during Agave tequilana juice
fermentation,” Antonie van Leeuwenhoek-Journal of Microbiol-
ogy, vol. 108, no. 3, pp. 525–536, 2015.
[34] A. Contreras, C. Hidalgo, P. A. Henschke, P. J. Chambers, C.
Curtin, and C. Varela, “Evaluation of non-Saccharomyces yeasts
for the reduction of alcohol content in wine,” Applied and
Environmental Microbiology, vol. 80, no. 5, pp. 1670–1678, 2014.
[35] I. Loira, R. Vejarano, M. A. Bañuelos et al., “Influence of
sequential fermentation with Torulaspora delbrueckii and Sac-
charomyces cerevisiae on wine quality,” LWT- Food Science and
Technology, vol. 59, no. 2, pp. 915–922, 2014.
[36] S. Benito, “The impacts of Lachancea thermotolerans yeast
strains on winemaking,” Applied Microbiology and Biotechnol-
ogy, vol. 102, no. 16, pp. 6775–6790, 2018.
[37] S. Y. Sun, H. S. Gong, X. M. Jiang, and Y. P. Zhao, “Selected non-
Saccharomyces wine yeasts in controlled multistarter fermenta-
tions with Saccharomyces cerevisiae on alcoholic fermentation
Hindawi
https://doi.org/10.1155/2018/7389381
Research Article
Long-Term Storage of Vegetable Juices Treated by High
Hydrostatic Pressure: Assurance of the Microbial Safety
Justyna NasiBowska ,1 Barbara SokoBowska,1,2 and Monika Fonberg-Broczek2

1
Department of Microbiology, Prof. Wacław Dąbrowski Institute of Agricultural and Food Biotechnology,
36 Rakowiecka Str., 02-532 Warsaw, Poland
2
Laboratory of Biological Materials, Institute of High Pressure Physics Polish Academy of Sciences,
29/37 Sokołowska Str., 01-142 Warsaw, Poland
Correspondence should be addressed to Justyna Nasiłowska; nasilowska@ibprs.pl
Received 3 August 2018; Revised 30 October 2018; Accepted 29 November 2018; Published 12 December 2018
Guest Editor: Marı́a de Guı́a Córdoba
Copyright © 2018 Justyna Nasiłowska et al. This is an open access article distributed under the Creative Commons Attribution
cited.
Food business operators search for new, mild technologies, which extend the shelf life of product without changing the sensory
and nutritional properties. High hydrostatic pressure (HHP) meets these requirements; however it also triggers sublethal injury of
bacterial cells. Sublethal injuries could spoil the product during storage and potentially pose major public health concerns. This
study aims to examine the changes of sublethally injured pathogens cells in two vegetable juices: carrot juice (pH 6.0-6.7) and
beetroot juice (pH 4.0-4.2) that are induced by HHP (300-500 MPa). The possibilities of recovery of bacterial cells during 28 days
of juices storage at two different temperatures (5∘ C and 25∘ C) were determined using plate count methods. During the entire period
of storage of carrot juice at refrigerated temperature, the propagation and regeneration of L. innocua strains were observed. Storage
at 25∘ C showed that the number of these bacteria drastically decreased between 14 and 21 days. The above phenomenon was not
detected in E. coli case. There was no cells recovery during long-term refrigerated storage for all strains in beetroot juice. However,
in some cases spoiling of this product intermittently occurred at 25∘ C storage temperature. This work demonstrates that carrot juice
supports growth and regeneration of HHP-sublethally injured L. innocua, while beetroot juice can be classified as a safe product.
1. Introduction [10, 11]. The initial microbial load is typically approximately

6.0 log CFU/mL [11, 12], including pathogens [11, 13]. One
Vegetable juices belong to the group of functional food and of the reasons of vegetable juice contamination with poten-
play an important role in human’s diet. Some reviews of tially hazardous microorganisms is natural fertilizers that
the previous studies indicated that they could help prevent are often applied in ecological agricultures [14]. Pathogenic
several major civilization diseases, such as heart problems, bacteria survive in soil for a relatively long period of time,
cancer, diabetes, and obesity, as well as the prevention and depending on environmental conditions. It is significant that
alleviation of several micronutrients deficiencies [1–3]. In the low-acid condition of raw, unprocessed vegetable juices
view of its health-related properties, they have attracted great is conductive to the growth of pathogenic microorganisms,
interest among consumers. Both carrot (Daucus carota) and such as Salmonella spp., Listeria monocytogenes, Escherichia
red beet (Beta vulgaris) are traditional and popular vegetables coli O157:H7, Staphylococcus aureus, or Campylobacter jejuni
in many parts of the world. They contain natural antioxidants, [11, 13–17]. Wherefore, some manufacturers lower pH of
high amount of vitamins, minerals, and trace elements [4–8]. vegetable juices using ascorbic acid or addition of apple juice
However, raw vegetable juices have limited market potential, to extend the shelf life and provide safety of the fresh juice.
due to its short shelf life, and should normally be consumed Despite these efforts, the most often detected pathogens in
within a few days [9]. Moreover, vegetable juices are the most unpasteurized fresh beetroot and carrot juices are Listeria
contaminated among the commercially available raw juices species and coliforms [11, 18].
High hydrostatic pressure (HHP) has been officially then stored and tested for these organisms during shelf life
approved by The U.S. Food and Drug Administration, as a [36, 37], which is used for estimation of the growth potential
nonthermal pasteurisation technology [19]. Nowadays, HHP (𝛿).
has attracted widespread attention of food industry members The aim of this study was to evaluate the survival rate
and is the most successfully commercialized nonthermal and the regeneration possibilities of HHP-sublethally injured
processing technology [19, 20]. This technology enables bacterial cells in two types of vegetable juices during long-
better quality of food to be obtained, rather than that term storage at two different temperatures. In addition to
processed using traditional methods. Primarily, it not notably this, the understanding of the behaviour of HHP-sublethally
changes the sensory and nutritional attributes of product injured cells during storage may be helpful to design and
but reduces the microbial counts responsible for spoilage control the process, as well as establish the hold time limits
and for shortening the shelf life [21–26]. Despite the above for storage.
benefits, HHP triggers sublethal injury of bacterial cells
[27–31]. 2. Materials and Methods
Generally, HHP induces varying levels of sublethal injury.
High pressure changes cell morphology and genetic mecha- 2.1. Microorganisms and Growth Conditions. E. coli ATCC
nism and inhibits the metabolic reactions, which are essential 7839 (obtained from American Typed Culture Collection,
for the cell maintenance [26]. Magnitude of these phenomena Manassas, USA) and L. innocua CIP80.11T (obtained from
may be different depending on the genus or even species the Culture Collection of the Institut Pasteur, Paris, France)
of microorganism, type of substrate, and processing param- wild strains, which were isolated from unpasteurized, com-
eters. Different food preservation strategies bring different mercial beetroot juice, L. innocua 23/13 and E. coli 61/14,
stress factors that affect the microbiota of product. Scientific obtained from the Department’s collection of Fruit and
research has yielded some important information on the Vegetable Product Technology at IAFB (Warsaw, Poland),
factors, affecting the injuries and recoveries of bacterial were used in this investigation. The strains were stored
cells in food matrices [32, 33]. Nowadays, it is apparent in a Cryobank at a temperature below -27 ± 3∘ C before
that both phenomena depend on type of technology, as using. First, pure culture immobilized on sterile beads was
well as environmental conditions such as food pH, stor- added to 10 ml of sterile Brain Heart Infusion (BHI) broth
age temperature, addition of various components on the (BioMerieux, I’Etoile, France). Broth subcultures were incu-
food including nutrients, preservatives, etc. The regulatory bated at 37∘ C for 24 h, then each overnight culture was
network allows the stressed bacteria to react on changes moved with a 10 𝜇L loop on a Petri dish, with the usage of
by activating the proper mechanism, which allows them streak plate technique with Tryptic Soy (TSA) agar (Biocar
to adapt [33]. Sublethally injured cells may exist in the Diagnostics, Beauvais, France) for E. coli or Tryptic Soy Yeast
population, although most microbes are killed. Moreover, Extract (TSYE) agar (Biocar Diagnostics, Beauvais, France)
food matrices can be bacteriostatic as well as bactericidal, due for L. innocua. Next, the culture from the plate was added,
to intrinsic factors including water activity, pH, salt content, using 10 𝜇L loop, to 250 mL Erlenmeyer flasks containing
etc. The injured cells can develop adaptive responses to stress, 200 mL of Tryptic Soy Broth (TSB) (Biocar Diagnostics,
resuscitate in a medium containing the necessary nutrients, Beauvais, France), or Tryptic Soy Broth with Yeast Extract
and grow during storage. On the other hand, the injured cells (TSBYE) (Biocar Diagnostics, Beauvais, France) in order,
may develop sensitivity to physical and chemical environ- that prepare the second subculture, which was incubated at
ments, to which normal cells are resistant [33] and lose the 37∘ C for 18 h to obtain the stationary phase culture. Then
ability to grow on defined culture media. The presence of 10 mL of second subculture was added to fresh, sterile broth
sublethally injured cells in food poses major public health (TSB or TSYEB) and incubated at 37∘ C for 18 h. The cultures
concerns and is crucial in assessing the microbial response were then harvested by centrifugation (4000 × g, 10 min.,
to food preservation strategies [34]. On the other hand, only 4∘ C). The sedimented cells were aseptically resuspended
a small portion of merchant suppliers offer HHP-treated into phosphate-buffered saline (PBS, pH 7.4) and again
vegetable juices [25]. Moreover, no high pressure food is centrifuged. The washing procedure was repeated twice more.
currently available under room temperature on the market Following this, the model of bacterial cells suspensions was
[20, 26]. prepared in PBS. Just before HHP treatment, pasteurized
According to European Commission Regulation (EC) No. beetroot juice supplemented with 5% apple juice (Victoria
2073/2005 [35] manufacturers are obliged to ensure microbial Cymes, pH 4.0-4.2) and carrot juice (Vital Fresh, pH 6.0-
safety of food products up to the end of the declared shelf life. 6.7) were inoculated with bacterial suspensions, in an amount
Apart from microbiological criteria for foodstuffs, above doc- of about 7.0 log CFU/mL, determined by spread plating
ument specifies the methods to demonstrate the possibilities appropriate dilutions on to TSA/TSYEA, and transferred into
of propagation of microorganisms during the shelf life of the sterile polyethylene tubes (Sarstedt, Newton, USA) in 13 mL
product. One of these tools is the microbiological challenge portions in duplicate.
testing. Challenge testing is a practical study that evaluates
the behaviour of crucial organisms (e.g., pathogens), which 2.2. HHP Equipment. The samples were exposed to high
display opportunity of grow and/or survive in the food pressure treatment, with the use of U 4000/65 apparatus
matrices and if so, how fast they will grow. Examined food (Unipress, Warsaw, Poland). The volume of the treatment
product is contaminated by relevant microorganisms and chamber was 0.95 L, and the maximum working pressure
Table 1: High hydrostatic pressure conditions.
HHP parameters
Strains beetroot juice carrot juice
pressure/time
Listeria innocua CIP 80.11T 300 MPa/ 5 minutes 400 MPa/ 5 minutes
Listeria innocua-wild type strain 23/13 300 MPa/ 10 minutes 400 MPa/ 5 minutes
Escherichia coli ATCC 7839 300 MPa/ 10 minutes 500 MPa/ 5 minutes
Escherichia coli-wild type strain 61/14 300 MPa/ 10 minutes 500 MPa/ 5 minutes
was 600 MPa. The pressure-transmitting fluid, that was used, Tukey’s test, using Statistica version 13 (TIBCO Software
was distilled water and polypropylene glycol (1:1, v/v). The Inc., Palo Alto, CA, USA). The differences were considered
working temperatures of the apparatus range from −10∘ C significant at p<0.05. Statistical comparison was made for
to +80∘ C. Pressure of up to 400 MPa was generated in 70- results, obtained for strains of the same species at the same
80 s, and the release time was 2-4 s. Samples were subjected temperature and matrix.
to high hydrostatic pressure at various pressure, depending
on the strain and juice (300, 400, 500 MPa), at an ambient
temperature (i.e., approximately 20∘ C) and held for 5 or 3. Results and Discussion
10 min (Table 1). The use of different pressure parameters was
aimed at induction of the highest level of sublethal bacterial 3.1. Effect of Storage Temperature on E. coli and L. innocua
injuries in the sample. These process conditions trigger the in Vegetable Juices. In the present study, two types of high
highest level of sublethal injury of these cell strains and were pressure treated-vegetable juices (beetroot and carrot) were
chosen based on our earlier studies [38, 39]. Temperature analyzed during four weeks of storage time to test their
increase, due to the adiabatic heating, was approximately microbiological safety. We tested if sublethally injured by
3∘ C per 400 MPa. The pressurization times reported do HHP bacterial cells would be able to regenerate and survive
not include the come-up and come-down time. For each in those vegetable juices. The second goal was to investigate
tested strain, juice, and storage temperature, the assays were if storage at ambient temperature would support the growth
performed with usage of the two independent samples, which of HHP-treated bacteria in comparison to refrigerated con-
were coming from the two independent processes. After the ditions. As a preliminary experiment, we studied the effect
treatment, the samples were stored at 5∘ C and 25∘ C up to 28 of HHP on tested species, in both, previously mentioned
days and periodically analyzed. Unpressurized samples were types of juices in a range of pressure 200-500 MPa up to
used as a control. 10 minutes. The next step that was done was the screen-
ing analysis to choose the parameters, which induce the
highest level of sublethal injury of those bacterial strains.
2.3. Plate Count Analytical Methods. The viability of each The results showed that in carrot juice pressure of 400 MPa
strain was assayed by counting colony-forming units imme- for 5 minutes triggers sublethal injuries of Listeria innocua
diately after HHP processing. Thereafter, both treated and strains, while extending the parameters inactivates these
untreated juices were enumerated at regular intervals during bacteria. In turn, Escherichia coli strains were sublethally
refrigerated storage. At each sampling time, a tube with injured under pressure of 500 MPa for 5 minutes [data not
the sample was opened aseptically and analyzed. Further shown]. Induction of sublethal injuries of those bacterial
decimal dilutions in Tryptone Salt Broth (Biokar Diagnostics, cells in beetroot juice needed milder parameters: 300 MPa
Beauvais, France), of each sample, were prepared. Appro- up to 10 minutes [38, 39]. Because of the aforementioned,
priate dilutions of samples were spread on agars. Counts of this experiment shows the results carried out only with the
total viable cells were determined by spread plate on TSA use of thoseparameters, which prompted the highest level of
or TSYEA. Selective agars, that were agars supplemented sublethal injuries (Table 1).
with critical NaCl (POCh, Gliwice, Poland) concentration of The survivability of strains, in untreated juice samples,
5% (w/v), were used to determine noninjured cells in the pop- is shown in Figure 1. Despite the acid pH of beetroot juice,
ulation. That was the maximum concentration of NaCl that significant decrease of population for all the tested strains was
caused no reduction in the colony count of unstressed cells, not observed during storage at both temperatures (p≥0.05).
estimated in the preliminary trial. The number of sublethally Number of viable cells, of tested strains in beetroot juice at
injured survivors was quantified by the difference, between both temperatures, decreased by less than 1.0 log CFU/mL
the viable and noninjured cells. Plates with nonselective during all period of storage. Exclusively, number of L.
agars were incubated for 24 h/37∘ C and selective agars for innocua wild type strain in beetroot juice, stored at 25∘ C,
48 h/37∘ C. The plates containing less than 300 CFU/mL were reduced about 2.1 log CFU/mL. In carrot juice, stored at 5∘ C
selected for counting. number of viable cells of tested strains was between 7 and 10
log CFU/mL. During the entire period of storage, the viability
2.4. Statistical Analysis. Statistical analysis of the results of E. coli was stable, while the propagation of L. innocua was
was performed by two-way ANOVA statistical model with observed. Number of L. innocua in population had increased
12 12
log [CFU/mL] 10 10
log [CFU/mL]
8 8
6 6
4 4
2 2
0 0
0 7 14 21 28 0 7 14 21 28
storage time [days] storage time [days]
(a) (b)
12 12
10 10
log [CFU/mL]
log [CFU/mL]
8
6 6
4 4
2 2
0 0
0 7 14 21 28 0 7 14 21 28
(c) (d)
Figure 1: Survival of L. innocua strains: (e) CIP80.11T, (◼) 23/13 and E. coli strains, (󳵳) ATCC 7839IP80.11T, and (X) 61/14 in untreated juice
samples: (a) carrot juice stored at 5∘ C, (b) beetroot juice stored at 5∘ C, (c) carrot juice stored at 25∘ C, and (d) beetroot juice stored at 25∘ C, for
up to 28 days.
by 1.8 and 3.3 log depending on the strain. In turn, results studies was pasteurized). Additionally, authors had searched
obtained at 25∘ C had shown that amount of viable E. coli cells for influence of carrot juice properties on E. coli. Their
increased about 1.0 log CFU/mL, while significant differences results were similar to our findings. They observed that the
were found for L. innocua. Survival rates of both L. innocua number of E. coli in carrot juice remained constant, while
strains correlated negatively with temperature. The number juice was stored up to 14 days at 4∘ C; however it increased
of these bacteria drastically decreased, between 14 and 21 days during storage at 8∘ C and 12∘ C. Moreover, heat treating of
of storage, at 25∘ C. Monitoring of carrot juice pH (suspended carrot juice prior to inoculation had no effect on growth on
with L. innocua strains) showed that this parameter decreased E. coli. The same results were achieved by Gómez Aldapa
from 6.2 to 4.2 during 28 days of storage, while pH of carrot et al. (2013). It has been reported that the growth of the
juice without bacteria was found stable for all time of storage cocktail of diarrheagenic E. coli pathotype in carrot juice was
(6.18 ± 0.04). inhibited at refrigerated temperature. After 24 h number of
Patterson et al. (2012) have suggested that carrot juice is all diarrheagenic E. coli pathotypes increased during storage
inherently detrimental to the growth of L. monocytogenes. at 12∘ C, 20∘ C, 30∘ C, and 37∘ C. Some researchers had been
They observed survivability of pathogenic bacteria in two trying to answer, how long pathogens would survive in acid
variants of carrot juice control samples, during 10 days juices if a contamination occurred [40–42]. Escherichia coli
of storage at 4∘ C, 8∘ C, and 12∘ C. Both, heat and nonheat O157:H7 survived in pineapple juice (pH 3.57) for 120 days
sterilized, carrot juice control samples were inoculated by in refrigerated temperature, but during ambient temperature
cocktail of L. monocytogenes and then stored. Number of L. storage, some decline in count was noted. In turn, avocado
monocytogenes, suspended in nonheat carrot juice, decreased juice (pH 6.2) supported growth of these bacteria at both
at refrigerated temperatures by 6.56 log CFU/mL to 5.06 temperatures [40]. Significant number of Listeria monocyto-
log CFU/mL and 6.00 log CFU/mL, respectively. In case of genes suspended in tomato juice survived during storage at
prior heat sterilized carrot juice, Listeria numbers increased 5∘ C and 30∘ C for 12 days; however counts of those bacteria
during storage at all temperatures. Presumably, these dif- slightly decreased in refrigerated temperature [41]. Oyarzábal
ferences are associated with thermal-sensitive properties of et al. (2003) showed that Escherichia coli O157:H7, Listeria
antimicrobial compounds in carrot juice (carrot juice of our monocytogenes, and Salmonella were recoverable through 12
10 10
8 8
log [CFU/mL]
log [CFU/mL]
6 6
4 4
2 2
0 0
0 7 14 21 28 0 7 14 21 28
(a) (b)
Figure 2: Survival of L. innocua strains in HHP treated carrot (—) and beetroot juice (----) stored at 5∘ C (a) and 25∘ C (b) for up to 28 days. L.
innocua (e) CIP80.11T and (◼) L. innocua 23/13. HHP sublethal treatment conditions for each strain are in Table 1. The error bars represent
the standard deviation of measurements for 2 samples in two separate sample runs. Limit of detection was 1 log CFU/mL.
10 10
8 8
log [CFU/mL]
log [CFU/mL]
6 6
4 4
2 2
0 0
0 7 14 21 28 0 7 14 21 28
(a) (b)
Figure 3: Survival of E. coli strains in HHP treated carrot (—) and beetroot juice (----) stored at 5∘ C (a) and 25∘ C (b) for up to 28 days. E. coli
ATCC 7839IP80.11T (󳵳) and E. coli 61/14 (X). HHP sublethal treatment conditions for each strain are in Table 1. The error bars represent the
standard deviation of measurements for 2 samples in two separate sample runs. Limit of detection was 1 log CFU/mL.
weeks of storage at -23∘ C in apple, orange, pineapple, and strain was also below the detection level (1.0 log CFU/mL).
white grape juice concentrates (pH 3.6-3.7) and banana puree E. coli growth during long-term refrigerated storage was
(pH 5.5). not observed, neither in carrot juice nor in beetroot juice
(Figure 3(a)). However, the progress of the cell reduction in
the population was noticeably faster in beetroot juice during
3.2. Effect of Long-Term Storage and Temperature on Survival 4-week refrigerated storage. The number of the E. coli cells
and Regeneration of HHP-Sublethally Injured E. coli and of collection and wild type strain in populations decreased.
L. innocua in Vegetable Juices. The impact of long-term In the case of carrot juice, the decrease was 3.57 and 2.05
storage on the survival of HHP-injured bacterial strains, in log CFU/ml. When it comes to beetroot juice, the decrease
carrot and beetroot juices, is shown in Figures 2 and 3. was 5.42 and 3.19 log CFU/ml, in reference to initial microbial
Survival rates of L. innocua in carrot juice during 4-week counts, just after HHP treatment. The E. coli population in
refrigerated storage were similar to both collection and wild beetroot juice accomplished nearly 1.0 log CFU/mL after 21
type strain (Figure 2(a)). It was observed that the number days of refrigerated storage. However, extending the storage
of the bacterial population significantly increased, by 3.64 time to 4 weeks showed microbial growth of these bacteria.
log CFU/ml and 2.98 log CFU/ml, respectively, in reference The number of L. innocua in the population increased
to initial HHP-treated viable cell counts. In beetroot juice, by over 3.0 log CFU/mL during the 4 days of storage of
the reduction of the L. innocua cells in the population was carrot juice at 25∘ C (Figure 2(b)). The subsequent storage
noticed (Figure 2(a)). On the 21st day of storage, cells of the resulted in the rapid decrease of the amount of these bacteria
wild type strain were not detected. A week later, the collection in samples. After the 3-week period, the growth was not
Table 2: Results of the growth potential.
Type of sample Time [days of storage] log CFU/mL growth potential (𝛿)
Listeria innocua T=0 5,16
3,65
CIP 80.11T T=28 8,82
Listeria T=0 6,12
innocua-wild type 2,98
∘ T=28 9,10
Carrot juice stored at 5 C strain 23/13
Escherichia coli T=0 7,42
-3,56
ATCC 7839 T=28 3,86
Escherichia coli -wild T=0 7,48
-2,05
type strain 61/14 T=28 5,43
-5,37
CIP 80.11T T=28 0,00
Listeria T=0 5,15
innocua-wild type -5,15
Beetroot juice stored at 5∘ C strain 23/13
T=28 0,00
-4,35
ATCC 7839 T=28 2,18
Escherichia coli -wild T=0 6,50
-3,38
-5,16
CIP 80.11T T=28 0,00
Listeria T=0 6,12
∘ T=28 0,00
Carrot juice stored at 25 C strain 23/13
-1,42
ATCC 7839 T=28 6,06
Escherichia coli-wild T=0 7,48
0,46
-1,06
CIP 80.11T T=28 4,31
Listeria T=0 5,15
∘ T=28 0,00
Beetroot juice stored at 5 C strain 23/13
-6,53
ATCC 7839 T=28 0,00
Escherichia coli-wild T=0 6,50
-3,50
The growth potential (𝛿) is the difference between the log at the end of shelf life and the log of the initial concentration.
Criteria:
𝛿 > 0.5 log CFU/mL, growth of bacteria possible.
𝛿 ≤ 0.5 log CFU/mL, growth of bacteria impossible.
observed. Growth of E. coli was noticed, only in the first under 1.0 log CFU/mL, at the end of the period of storage at
48th h of storage at 25∘ C (Figure 3(b)). During the next 12 25∘ C. During the same storage conditions, E. coli wild type
days of storage, survival of E. coli strains in HHP, carrot juice strain increased and reached 3.0 log CFU/mL on the 28th day.
was found stable and reached about 9 log CFU/mL. However, The results of the growth potential (𝛿) are shown in Table 2.
after that time, the population of the wild type strain slightly Only in the case of L. innocua strains in carrot juice, stored
decreased by 2.40 log CFU/mL (Figure 3(b)). The number at 5∘ C, the growth potential was above 0.5 log CFU/mL. This
of L. innocua cells in the population decreased after 7 days result means that the carrot juice supported growth of L.
of beetroot juice storage at 25∘ C (Figure 2(b)). Extension of innocua, which was stored at refrigerated conditions. In other
the storage time caused unitary spoilage of this product. On juice samples, the value of bacterial growth potential was less
the last day of storage, the number of L. innocua collection than the critical value. Hence, these conditions retard the
strain cells reached to 4.26 log CFU/mL, while the number of propagation of tested strains.
wild type strains was under the detection limit. The opposite The changes of sublethal injuries of bacterial cells in
phenomenon was observed with E. coli (Figure 3(b)). The vegetable juices, during long-term storage at 5∘ C and 25∘ C,
number of collection strains in HHP-beetroot juice was are shown in Tables 3 and 4, respectively. Initial levels
Table 3: Changes of sublethal injuries of bacterial strains during juices long-term storage at 5∘ C.
Sublethal injuries in beetroot juice Sublethal injuries in carrot juice
Type of juice
[log CFU/ml] [log CFU/ml]
Strains/storage time [days] 0d 1d 4d 7d 14 d 21 d 28 d 0d 1d 4d 7d 14 d 21 d 28 d
Listeria innocua ab ab abc bcd abc bcd e a b c bc c c
2.95 ± 0.32 3.13 ± 0.07 2.51 ± 0.19 2.13 ± 0.08 2.59 ± 0.11 2.15 ± 0.46 Nd 3.15 ± 0.99 1.52 ± 0.16 0.22 ± 0.10 0.48 ± 0.26 0.07 ± 0.01 0.02 ± 0.03 -0.02 ± 0.02c
CIP 80.11T
Listeria innocua-wild type
3.22 ± 0.22ab 3.56 ± 0.63a 2.59 ± 0.61abc 1.56 ± 0.24cd 0.89 ± 0.41de Nde Nde 4.46 ± 0.37a 1.04 ± 0.29bc 0.19 ± 0.17c 0.26 ± 0.01 c 0.02 ± 0.02 0.08 ± 0.01c 0.00 ± 0.00c
strain 23/13
Escherichia coli ATCC
4.53 ± 0.04a 1.73 ± 0.38b 0.98 ± 0.03bc 0.86 ± 0.23bc 0.83 ± 0.25bc 0.18 ± 0.25a 1.79 ± 0.95b 4.66 ± 0.63a 4.18 ± 0.01ab 2.96 ± 0.24 cde 1.69 ± 0.15 def 1.83 ± 0.09 def 1.97 ± 0.03 def 1.49 ± 0.18f
7839
Escherichia coli-wild type
2.90 ± 0.56ab 3.63 ± 0.46a 4.41 ± 0.25a 2.68 ± 0.97a 1.13 ± 0.60b 0.52 ± 0.31a 1.71 ± 0.41b 2.98 ± 0.02bcd 3.46 ± 0.02bc 3.04 ± 0.23 bcd 1.11 ± 0.76ef 2.01 ± 0.12def 2.67 ± 0.57cde 5.43 ± 0.14a
strain 61/14
All data were the mean ± SD, n=2.
a-f: values in rows denoted with the same letter are significantly different (p<0.05).
Nd: not detected.
7
8
Table 4: Changes of sublethal injuries of bacterial strains during juices long-term storage at 25∘ C.
Sublethal injuries in beetroot juice Sublethal injuries in carrot juice
Type of juice
[log CFU/ml] [log CFU/ml]
Strains/storage time [days] 0d 1d 4d 7d 14 d 21 d 28 d 0d 1d 4d 7d 14 d 21 d 28 d
Listeria innocua a bc bc c a bc a b b b b b
2.95 ± 0.32 1.75 ± 0.19 ab 1.12 ± 0.91 0.35 ± 0.49 0.00 ± 0.00 2.95 ± 0.08 0.05 ± 0.10 3.15 ± 0.99 0.11 ± 0.14 0.48 ± 0.70 0.10 ± 0.09 0.39 ± 0.55 Nd Nd b
CIP 80.11T
Listeria innocua-wild type
3.22 ± 0.22 a 0.41 ± 0.27 bc 0.00 ± 0.00 c 0.00 ± 0.00 c 0.55 ± 0.78 bc Ndc Ndc 4.46 ± 0.37a 0.06 ± 0.08 b 0.08 ± 0.08 b 0.08 ± 0.06 b 0.69 ± 0.78 b Nd b Nd b
strain 23/13
Escherichia coli ATCC
4.53 ± 0.04 a 0.58 ± 0.21ab 2.41 ± 1.08 ab 1.18 ± 0.10 ab 2.58 ± 2.24 ab 1.50 ± 0.45 ab 0.00 ± 0.95b 4.66 ± 0.58a 1.12 ± 0.04d 0.00±0.00f 0.27 ± 0.02ef 0.68 ± 0.10 def 2.60 ± 0.05c 3.60 ± 0.45b
7839
Escherichia coli-wild type
2.90 ± 0.56 ab 0.42 ± 0.11b 1.07 ± 0.10 ab 1.15 ± 0.27 ab 0.67 ± 0.32 ab 0.64 ± 0.25 ab 1.00 ± 0.00 ab 2.98 ± 0.02bc 0.42 ± 0.02def 0.27 ± 0.07 def 0.42 ± 0.07 def 0.45 ± 0.02 def 1.02 ± 0.09de 2.63 ± 0.42c
strain 61/14
All data were the mean ± SD, n=2.
a-f: values in rows denoted with the same letter are significantly different (p<0.05).
Nd: not detected.
of sublethal injury of the strains, after HHP treatment, Lots of studies confirmed that natural microbiota of
were 2.9-4.5 log CFU/ml. The regeneration of sublethally HHP-treated vegetable juices may recover during storage.
injured cells suspended in carrot juice was observed. The Picouet et al. (2015) monitored that three microbial groups
regeneration of L. innocua after the first day of storage at 5∘ C were recovered, between 7th and 21st days of refrigerated stor-
(Table 3) and at 25∘ C (Table 4) was significant. The number of age, in HHP-treated carrot juice under 600 MPa for 5 min.
injured cells of E.coli collection strain significantly decreased Despite that, the total anaerobes bacteria remained below
(p<0.05), up to the 7th day of refrigerated storage. Thereafter, the detection limit in the first week of storage. On day 21,
some differences in the number of sublethally injured cells these bacteria reached 1.2 log CFU/mL in nonacidified (pH
were found, although they were not statistically significant 6.48) and 4.3 log CFU/mL in acidified (pH 5.5) juice. In turn,
(p≥0.05). Up to the first 7 days of storage, the regeneration of yeast and molds counts reached an amount equal to or below
sublethally injured cells of wild type E. coli was also observed. 3.0 log CFU/mL. The authors concluded that acidification
Extending the storage time resulted in the gradual increase of carrot juice did not advantageously extend the shelf life
in the number of injured cells of wild type E. coli. At the 28th of the product. Zhang et al. (2016) showed that indigenous
day of storage, the level of injured cells reached about doubled microbiota of carrot juice, preserved by HHP (550 MPa,
(5.43 log CFU/mL). Decreasing tendency of sublethal injury 6 min.), slightly increased after 20 days of storage at refrig-
of E. coli, during storage of the HHP-carrot juice at 25∘ C, erated temperature. Similarly to aforementioned, Patterson
was also observed. This phenomenon was much faster, than et al. (2012) observed that HHP-injured natural microbiota
at 5∘ C (Table 4). After 24 hours of storage, the number of of carrot juice (500 and 600 MPa, 1 min) recovered faster at
regenerated cells of collection strain was 0.48 log CFU/mL 12∘ C (7 log CFU/mL at the 10th day of storage), rather than
at 5∘ C and 3.54 log CFU/mL at 25∘ C. In most instances, at 4∘ C (3 log CFU/mL at the 22nd day of storage). Moreover,
there was no significant cells recovery, during long-term they noticed that pressure treatment, significantly delayed
refrigerated storage for all strains in beetroot juice (Table 3). the recovery and growth of the surviving microorganisms,
However, the number of sublethally injured cells decreased in reference to untreated juice sample. Sokołowska et al.
with in view of bacterial population dying (Figures 2(a) and (2014a) observed that total count of spoilage microorganism
3(a)). Long-term storage of beetroot juice at 25∘ C showed that in HHP-beetroot juice (400 MPa, 10 min) was unchanged for
recovery of injured pathogen cells may occur, albeit spoiling 10 days of refrigerated storage. Then, there was an increase
of this product intermittently occurred (Table 4, Figures 2(b) of contamination to more than 3.0 log CFU/mL. In turn,
and 3(b)). indigenous microbiota in fruit juices normally had been
Alkaline pH matrices have shown that it is incredibly not recovered during long-term storage, even if juice was
challenging, to achieve microbial decontamination by HHP preserved by mild-HHP treatment [49, 50]. Kimura et al.
[20]. Despite the belief that HHP technology is intended for (2017) observed that the degree of damage by HHP may
acid products, scientific researchers are still searching for differ cell-by-cell, and oxidative stress may continue after
the application of high pressure on this kind of matrices HHP treatment. Depending on the storage environment,
[6, 24, 25, 43]. Similarly to our study, Patterson et al. resuscitation and recovered cells may multiply, before other
(2012) observed that the population of HHP-injured E. coli injured cells complete resuscitation. Microbial cells, surviving
(500 MPa, 1 min.) had decreased during subsequent storage pressurization, also became sublethally injured and devel-
of carrot juice. Just after pressure treatment, inactivation oped sensitivity to environments, which the normal cells were
was 1.82 log CFU/mL, while by day 10, the number of these resistant to [51].
bacteria reached undetectable levels, independent from the The new edition of ISO 11290-1:2017 Microbiology of the
storage temperature. The same HHP condition inactivated food chain—Horizontal method for the detection and enu-
cocktail of L. monocytogenes in carrot juice. During the 14 meration of Listeria monocytogenes and of Listeria spp.—Part
days of storage at any temperature, it remained below the 1: Detection method, does not take into consideration resus-
limit of detection. The study of injury induced by HHP in citation step. From human’s health safety point of view it may
microorganisms and subsequent recovery in fruit juices has be risky decision, especially due to the fact that systematic
been reported by several groups of researchers [21, 22, 34, (invasive) form of listeriosis is now recognized as occurring
44, 45]. So far, the pressure-induced injured microorganisms more frequently in small outbreaks than previously recog-
in beetroot juice have been reported in few publications nized [52]. Due to the fact that injured bacterial cells display
[31, 46–48]. Unfortunately, there is small data about the limited possibility, or even inability to grow on selective
influence of storage. Buzrul et al. (2008) used mild HHP agars, and due to the above-mentioned fact, sublethally
(350 MPa for 5 min.) to inactivate Escherichia coli and Listeria injured cells should require additional attention to quality
innocua in kiwifruit (pH 3.32) and pineapple juice (pH 3.77). control sectors of food operators. This aspect needs especially
They investigate the effect of storage on the survival of better understanding, in case if products are preserved by
these microorganisms, in above mentioned juices, at different nonthermal alternative technologies, by virtue of induction
temperatures (4∘ C, 20∘ C, 37∘ C). Inactivation increased more of sublethal injuries. The Codex Alimentarius Commission
than 1.0 log CFU/mL, during storage at 4∘ C for 24 h, for both (CAC) proposed the following criterion to characterize food
bacteria in both juices. During subsequent 3 weeks of storage, products that support L. monocytogenes growth. As it was
at all tested temperatures, no injury recovery was detected in written in CAC: “a RTE food in which there is a greater than
both juices. The same phenomenon was observed by Jordan average of 0.5 log increase in the level of the organism, for at
et al. (2001) for E. coli in orange, tomato, and apple juices. least the expected shelf life (as labeled by the manufacturer)
under reasonably foreseeable conditions of distribution, stor- [2] Z. Pietrzkowski, B. Nemzer, A. Sp et al., “Influence of
age and use to consumption, including a safety margin” betalain-rich extract on reduction of discomfort associated with
(CAC, 2009). Processed and ready-to-eat (RTE) foods with osteoarthritis,” New Medicin, vol. 1, pp. 12–17, 2010.
a prolonged shelf life under refrigeration are at risk products [3] T. Clifford, G. Howatson, D. J. West, and E. J. Stevenson, “The
for listeriosis [40]. Uyttendaele et al. (2009) observed the potential benefits of red beetroot supplementation in health and
growth of L. monocytogenes in three types of ready-to-eat disease,” Nutrients, vol. 7, no. 4, pp. 2801–2822, 2015.
products, stored under refrigerated temperature in challenge [4] I. Domagała-Światkiewicz and M. Gastoł, “Comparative study
testing. They suggest that whether a food supports the growth on mineral content of organic and conventional carrot, celery
of L. monocytogenes, or not is mainly determined by the and red beet juices,” Acta Scientiarum Polonorum, Hortorum
Cultus, vol. 11, no. 2, pp. 173–183, 2012.
physicochemical factors (pH, aw , packaging atmosphere) of
[5] “USDA Food composition Databases,” https://ndb.nal.usda
the food matrix, rather than being defined as such by the food
.gov/ndb/search/list 28.02.2018.
type.
[6] S. Zhu, C. Wang, H. S. Ramaswamy, and Y. Yu, “Phase transi-
tions during high pressure treatment of frozen carrot juice and
4. Conclusion influence on Escherichia coli inactivation,” LWT—Food Science
and Technology, vol. 79, pp. 119–125, 2017.
The results of this study indicate that carrot juice supports
[7] J. Czapski, K. Mikołajczyk, and M. Kaczmarek, “Relationship
growth and regeneration of HHP-sublethally injured L. between antioxidant capacity of red beet juice and contents
innocua. Based on the above data, HHP-treated beetroot juice of its betalain pigments,” Polish Journal of Food and Nutrition
can be classified as a safe product, while carrot juice may Sciences, vol. 59, no. 2, pp. 119–122, 2009.
be classified as a high risk food. Our results confirmed that [8] J. Wruss, G. Waldenberger, S. Huemer et al., “Compositional
HHP-treated vegetable juices need to be kept in refrigerated characteristics of commercial beetroot products and beetroot
conditions. However, more scientific studies need to be con- juice prepared from seven beetroot varieties grown in Upper
ducted to find an understanding of the bacterial mechanisms, Austria,” Journal of Food Composition and Analysis, vol. 42, pp.
involved in cell recovery during storage in food matrices. 46–55, 2015.
Predictive microbiology is a useful method to help esti- [9] C. Alklint, L. Wadsö, and I. Sjöholm, “Effects of modified at-
mate food safety and shelf life of product, having established mosphere on shelf-life of carrot juice,” Food Control, vol. 15, no.
the foods’ intrinsic and extrinsic characteristics. However, 2, pp. 131–137, 2004.
good manufacturing practices (GMP), hygiene practices [10] G. M. Sapers, “Washing and sanitizing raw materials for
(GHP), the development, and implementation of procedures, minimally processed fruit and vegetable products,” in Microbial
based on HACCP, are fundamental in maintaining food Safety of Minimally Processed Foods, J. S. Novak, G. M. Sapers,
safety, the setting, and validating of food shelf life. and V. K. Juneja, Eds., pp. 221–253, CRC Press, Boca Raton, Fla,
USA, 2003.
[11] B. Sokolowska, M. Chotkiewicz, J. Niezgoda, A. Dekowska,
Data Availability and B. Sokołowska, “Evaluation of microbial contamination of
commercially available unpasteurized, freshly squeezed fruit
The data used to support the findings of this study are
and vegetable juices,” Zeszyty Problemowe Postępów Nauk Rol-
available from the corresponding author upon request. niczych, vol. 569, pp. 219–228, 2011.
[12] M. Fonberg-Broczek, B. Windyga, G. Prestamo, H. Sciezynska,
Ethical Approval A. Grochowska, and K. Grecka, “Application of high pressure
processing (HPP) for pasteurisation of fresh squizzed juices,”
Ethical clearance was not required and was not necessary for Bromat. Chem. Toksykol suplement, pp. 129–133, 2006.
this study. [13] M. D. R. Torres-Vitela, C. A. Gómez Aldapa, J. F. Cerna-Cortes,
A. Villarruel-López, E. Rangel-Vargas, and J. Castro-Rosas,
“Presence of indicator bacteria, diarrhoeagenic Escherichia coli
Conflicts of Interest pathotypes and Salmonella in fresh carrot juice from Mexican
restaurants,” Letters in Applied Microbiology, vol. 56, no. 3, pp.
The authors declare that there are no conflicts of interest
180–185, 2013.
regarding the publication of the article.
[14] Z. Libudzisz, K. Kowal, and Z. Zakowska, “Technical microbi-
ology, Microorganisms in biotechnology, environmental pro-
Acknowledgments tection and food production” (Polish), Wydawnictwo Naukowe
PWN, t. II, pp. 235-288, 2008.
This work was supported by the Prof. Wacław Dąbrowski [15] D. C. Machado, C. M. Maia, I. D. Carvalho, N. F. Da Silva, M.
Institute of Agricultural and Food Biotechnology. C. Dantas Porfı́rio Borges Andre, and Á. B. Serafini, “Microbi-
ological quality of organic vegetables produced in soil treated
with different types of manure and mineral fertilizer,” Brazilian
References Journal of Microbiology, vol. 37, no. 4, pp. 538–544, 2006.
[1] G. J. Kapadia, M. A. Azuine, R. Sridhar et al., “Chemoprevention [16] K. Jones and J. Heaton, “Microbial contamination of fruit and
of DMBA-induced UV-B promoted, NOR-1-induced TPA pro- vegetables,” The Magazine of Health Protection Agency, vol. 7, pp.
moted skin carcinogenesis, and DEN-induced phenobarbital 28–31, 2007.
promoted liver tumors in mice by extract of beetroot,” Pharma- [17] K. R. Aneja, R. Dhiman, N. K. Aggarwal, V. Kumar, and M. Kaur,
cological Research, vol. 47, no. 2, pp. 141–148, 2003. “Microbes associated with freshly prepared juices of citrus and
carrots,” International Journal of Food Science, vol. 2014, Article [33] A. M. Wesche, J. B. Gurtler, B. P. Marks, and E. T. Ryser,
ID 408085, 7 pages, 2014. “Stress, sublethal injury, resuscitation, and virulence of bacterial
[18] J. W. Buck, R. R. Walcott, and L. R. Beuchat, “Recent trends foodborne pathogens,” Journal of Food Protection, vol. 72, no. 5,
in microbiological safety of fruits and vegetables,” Plant Health pp. 1121–1138, 2009.
Progress, vol. 4, no. 1, p. 25, 2003. [34] M. Linton, J. M. J. McClements, and M. F. Patterson, “Survival
[19] H.-W. Huang, S.-J. Wu, J.-K. Lu, Y.-T. Shyu, and C.-Y. Wang, of Escherichia coli O157:H7 during storage in pressure-treated
“Current status and future trends of high-pressure processing orange juice,” Journal of Food Protection, vol. 62, no. 9, pp. 1038–
in food industry,” Food Control, vol. 72, pp. 1–8, 2017. 1040, 1999.
[20] D. F. Farkas, “A short history of research and development [35] European Commission Regulation (EC) No 2073/2005 of 15
efforts leading to the commercialization of high-pressure pro- November 2005 on microbiological criteria for foodstuffs, 2005.
cessing of foods,” in High Pressure Processing of Food, V. [36] Guidance Note No. 18, Validation of product shelf-life, Revision
M. Balasubramaniam, G. V. Barbosa-Cánovas, and H. L. M. 3, Food Safety Authority of Ireland, 2017.
Lelieveld, Eds., pp. 19–36, Principles, technology and applica- [37] A. Serraino and F. Giacometti, “Introduction to challenge test
tions, Springer, New York, NY, USA, 2016. and microbiological characterisation of local products,” Italian
[21] S. Buzrul, H. Alpas, A. Largeteau, and G. Demazeau, “Inac- Journal of Food Safety, vol. 3, no. 1, pp. 34-35, 2014.
tivation of Escherichia coli and Listeria innocua in kiwifruit
[38] J. Nasiłowska, B. Sokołowska, and M. Fonberg-Broczek, “The
and pineapple juices by high hydrostatic pressure,” International
impact of high hydrostatic pressure on inactivation and sub-
Journal of Food Microbiology, vol. 124, no. 3, pp. 275–278, 2008.
lethal injury of foodborne pathogenes in beetroot juice,” Postępy
[22] A. Bayindirli, H. Alpas, F. Bozoglu, and M. Hızal, “Efficiency of Nauki i Technologii Przemysłu Rolno-Spożywczego, vol. 71, no. 1,
high pressure treatment on inactivation of pathogenic microor- pp. 21–27, 2016.
ganisms and enzymes in apple, orange, apricot and sour cherry
[39] J. Nasiłowska, B. Sokołowska, and M. Fonberg-Broczek, “The
juices,” Food Control, vol. 17, no. 1, pp. 52–58, 2006.
behaviour of Listeria innocua strains under pressure treatment
[23] P. A. Picouet, C. Sárraga, S. Cofán, N. Belletti, and M. Dolors - inactivation and sublethal injury,” Polish Journal of Food and
Guàrdia, “Effects of thermal and high-pressure treatments Nutrition Sciences, 2018.
on the carotene content, microbiological safety and sensory
properties of acidified and of non-acidified carrot juice,” LWT- [40] I. Mutaku, W. Erku, and M. Ashenafi, “Growth and survival of
Food Science and Technology, vol. 62, no. 1, pp. 920–926, 2015. Escherichia coli O157:H7 in fresh tropical fruit juices at ambient
and cold temperatures,” International Journal of Food Sciences
[24] W. Żyngiel and J. Kolenda, “The influence of high pressure
and Nutrition, vol. 56, no. 2, pp. 133–139, 2005.
processing parameters on quality and stability of preserved
carrot juices,” Bromatologia i Chemia Toksykologiczna, pp. 408– [41] I. Diakogiannis, C. Proestos, T. Varzakas, and P. Markaki,
413, 2009. “Survival of Listeria Monocytogenes in Tomato Juice at 5 and
30∘C Storage,” Current Research in Nutrition and Food Science
[25] Y. Zhang, X. Liu, Y. Wang, F. Zhao, Z. Sun, and X. Liao, “Quality
Journal, vol. 5, no. 1, pp. 01–05, 2017.
comparison of carrot juices processed by high-pressure process-
ing and high-temperature short-time processing,” Innovative [42] O. A. Oyarzábal, M. C. L. Nogueira, and D. E. Gombas, “Sur-
Food Science & Emerging Technologies, vol. 33, pp. 135–144, 2016. vival of E. coli O157:H7, Listeria monocytogenes, and Salmonella
[26] H.-W. Huang, H.-M. Lung, B. B. Yang, and C.-Y. Wang, in juice concentrates,” Journal of Food Protection, vol. 66, no. 9,
“Responses of microorganisms to high hydrostatic pressure pp. 1595–1598, 2003.
processing,” Food Control, vol. 40, no. 1, pp. 250–259, 2014. [43] M. F. Patterson, A. M. McKay, M. Connolly, and M. Linton,
[27] M. F. Patterson, M. Quinn, R. Simpson, and A. Gilmour, “The effect of high hydrostatic pressure on the microbiological
“Sensitivity of vegetative pathogens to high hydrostatic pressure quality and safety of carrot juice during refrigerated storage,”
treatment in phosphate-buffered saline and foods,” Journal of Food Microbiology, vol. 30, no. 1, pp. 205–212, 2012.
Food Protection, vol. 58, no. 5, pp. 524–529, 1995. [44] S. L. Jordan, C. Pascual, E. Bracey, and B. M. Mackey, “Inac-
[28] C.-Y. Wang, H.-W. Huang, C.-P. Hsu, and B. B. Yang, “Recent tivation and injury of pressure-resistant strains of Escherichia
advances in food processing using high hydrostatic pressure coli O157 and Listeria monocytogenes in fruit juices,” Journal of
technology,” Critical Reviews in Food Science and Nutrition, vol. Applied Microbiology, vol. 91, no. 3, pp. 463–469, 2001.
56, no. 4, pp. 527–540, 2016. [45] C. Garcia-Graells, K. J. A. Hauben, and C. W. Michiels, “High-
[29] L. Espina, D. Garcı́a-Gonzalo, and R. Pagán, “Detection of pressure inactivation and sublethal injury of pressure-resistant
thermal sublethal injury in Escherichia coli via the selective Escherichia coli mutants in fruit juices,” Applied and Environ-
medium plating technique: mechanisms and improvements,” mental Microbiology, vol. 64, no. 4, pp. 1566–1568, 1998.
Frontiers in Microbiology, vol. 30, no. 7, p. 1376, 2016. [46] B. Sokołowska, S. Skapska, M. Fonberg-Broczek et al., “The
[30] B. Yang, Y. Shi, X. Xia et al., “Inactivation of foodborne effect of high hydrostatic pressure on the survival of Saccha-
pathogens in raw milk using high hydrostatic pressure,” Food romyces cerevisiae in model suspensions and beetroot juice,”
Control, vol. 28, no. 2, pp. 273–278, 2012. High Pressure Research, vol. 33, no. 1, pp. 165–171, 2013.
[31] B. Sokołowska, S. Ska¸pska, J. Niezgoda, M. Rutkowska, A. [47] B. Sokołowska, S. Skąpska, M. Fonberg-Broczek et al., “The
Dekowska, and S. J. Rzoska, “Inactivation and sublethal injury impact of high hydrostatic pressure (HHP) on native microflora
of Escherichia coli and Listeria innocua by high hydrostatic and the color of beetroot juice – a preliminary shelf-life
pressure in model suspensions and beetroot juice,” High Pres- study,” in Industrial, Medical and Environmental Applications of
sure Research, vol. 34, no. 1, pp. 147–155, 2014. Microorganisms: Current Status and Trends, A. Mendez-Vilas,
[32] N. G. Besse, “Influence of various environmental parameters Ed., vol. 33, pp. 380–384, Academic Publisher, Wageningen,
and of detection procedures on the recovery of stressed L. Netherlands, 2014.
monocytogenes: A review,” Food Microbiology, vol. 19, no. 2-3, [48] B. Sokołowska, Ł. Woźniak, S. Skąpska, I. Porębska, J.
pp. 221–234, 2002. Nasiłowska, and S. J. Rzoska, “Evaluation of quality changes of
beetroot juice after high hydrostatic pressure processing,” High

Pressure Research, vol. 37, no. 2, pp. 214–222, 2017.
[49] E. Varela-Santos, A. Ochoa-Martinez, G. Tabilo-Munizaga et
al., “Effect of high hydrostatic pressure (HHP) processing on
physicochemical properties, bioactive compounds and shelf-life
of pomegranate juice,” Innovative Food Science and Emerging
Technologies, vol. 13, pp. 13–22, 2012.
[50] E. Juarez-Enriquez, I. Salmeron-Ochoa, N. Gutierrez-Mendez,
H. S. Ramaswamy, and E. Ortega-Rivas, “Shelf life studies on
apple juice pasteurised by ultrahigh hydrostatic pressure,” LWT-
Food Science and Technology, vol. 62, no. 1, pp. 915–919, 2015.
[51] H. Alpas, N. Kalchayanand, F. Bozoglu, and B. Ray, “Interac-
tions of high hydrostatic pressure, pressurization temperature
and pH on death and injury of pressure-resistant and pressure-
sensitive strains of foodborne pathogens,” International Journal
[52] R. L. Buchanan, L. G. M. Gorris, M. M. Hayman, T. C. Jackson,
and R. C. Whiting, “A review of Listeria monocytogenes: An
update on outbreaks, virulence, dose-response, ecology, and
risk assessments,” Food Control, vol. 75, pp. 1–13, 2017.
Hindawi
https://doi.org/10.1155/2018/1514795
Research Article
Comparative Studies of Pectinase Production by Bacillus subtilis
strain Btk 27 in Submerged and Solid-State Fermentations
1
Oliyad Jeilu Oumer and Dawit Abate2
1
Addis Ababa University, Institute of Biotechnology, P.O. Box 1176, Ethiopia
2
College of Natural Science, Addis Ababa University, P.O. Box 1176, Ethiopia
Correspondence should be addressed to Oliyad Jeilu Oumer; oliyad.jeilu@ambou.edu.et
Received 19 July 2018; Revised 25 September 2018; Accepted 26 November 2018; Published 4 December 2018
Copyright © 2018 Oliyad Jeilu Oumer and Dawit Abate. This is an open access article distributed under the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is
properly cited.
The request for enzymes in the global market is expected to rise at a fast pace in recent years. With this regard, there has been a great
increase in industrial applications of pectinase owing to their significant biotechnological uses. This study was undertaken with main
objectives of meeting the growing industrial demands of pectinase, by improving the yield without increasing the cost of production.
In addition, this research highlights the underestimated potential of agroresidues for the production of biotechnologically important
products. In this study, the maximum pectinase production attained was using wheat bran, among the tested agroresidues. The
production of pectinase was improved from 10.1 ± 1.4 U/ml to 66.3 ± 1.2 U/ml in submerged fermentation whereas it was in
solid state fermentation from 800.0 ± 16.2 U/g to 1272.4 ± 25.5 U/g. The maximum pectinase production was observed using YEP
(submerged fermentation) and wheat bran (solid state fermentation) at initial pH of 6.5, at 37∘ C and by supplementing the medium
with 3 mM MgSO4.7H2O.
1. Background Pectinase usage accelerates tea fermentation and also destroys

the foam forming property of instant tea powders by destroy-
Microbial enzymes are considered as an efficient tool for ing pectins. They are also used in coffee fermentation to
ecofriendly biotechnological progressions, as the modern remove mucilaginous coat from coffee beans [7–9].
society currently concentrating on green biotechnology. As many other enzyme production techniques, there are
Pectinases are a group of enzymes that contribute to the two fermentation methods that we can use for pectinases
degradation of pectin, which is a complex acidic polysaccha- production, which are solid state fermentation (SSF) and
ride present in the primary cell wall and middle lamella of submerged fermentation (SmF). Solid state fermentation
higher plant tissues. The significance of these enzymes for is well defined as the cultivation of microorganisms on
the development of environment friendly industrial processes moist solid supports with very little amount of moisture
has already been established [1]. content/water. In contrast, in submerged fermentation (SmF)
In various industrial sectors whenever pectin degradation the nutrients and microorganisms are both submerged in
is needed pectinolytic enzymes can be applied. Numerous water (Singh Nee Nigam and Pandey 2009).
microorganisms have been known and used to produce It is estimated that about 90% of all industrial enzymes are
different types of pectinolytic enzymes [2]. About 25% of the produced in submerged fermentation because SmF is much
global food and industrial enzyme sales accounts by micro- easier for accessing and scaling up the production process.
bial pectinases [3, 4] and their market is increasing day by day. In this respect SmF processing offers an insurmountable
The applications of pectinase include fruit juice clarification, advantage over SSF. However, solid state fermentations have
juice extraction, refinement of vegetable fibers, degumming numerous rewards over submerged fermentations including
of natural fibers, and wastewater treatment and act as an higher concentration of products and less effluent generation
analytical tool in the assessment of plant products [4–6]. [10].
Higher cost of the production is perhaps the major Apple pectin. The pH of the nutrient media was adjusted
constraint in commercialization of new sources of enzymes. to 7.0 ± 0.5 and sterilized. 50 mL of nutrient media in
Though, using high yielding strains, optimal fermentation 250 mL Erlenmeyer flasks were inoculated with 1% (v/v) of
conditions and cheap raw materials as a carbon source can inoculum and incubated at 30∘ C, 120 rpm for 48 hours.
reduce the cost of enzyme production for subsequent appli- After incubation, samples were collected and centrifuged at
cations in industrial processes [4]. In this view, agroindustrial 10,000 rpm for 5 min at 4∘ C. The supernatant was used for
waste materials can be used both as source of energy for measuring the enzyme activity. The Pectinase activity was
growth and as carbon for synthesis of cell biomass and other determined in the supernatant as U/ml.
products. With this regard, solid state fermentation (SSF)
permits the use of agricultural and agroindustrial residues 2.4. Effect of Agro Residues (Substrate). Agricultural residues
as substrates which are converted into bulk chemicals and such as Coffee pulp, Orange peel, and lemon peel and wheat
fine products with high commercial value. The selection of bran were used as substrate for solid state fermentation. In
a substrate for enzyme production in an SSF process depends 250 ml conical flask, 5.0 g of each agro residue was moistened
on several factors, mainly related with cost and availability by 60% of distilled water and autoclaved at 121∘ C for 15
of the substrate ([1]; Singh Nee Nigam and Pandey 2009). minutes. The flasks were inoculated with 2.0 ml of inoculum,
As agroindustrial residues are renewable and in an abundant mixed well to evenly distribute the inoculum and incubated
supply (∼3.5 billion tonnes/year), they represent a potential at 37∘ C for 48 h.
low cost raw material for microbial enzyme production
(Singh Nee Nigam and Pandey 2009).
Previously, we endeavored to screen microorganism for 2.5. Extraction of Pectinase from the Solid Substrate. Extrac-
pectinase production and examine their potential in mucilage tion of Pectinase from SSF was done according to the method
removal from coffee beans [9]. Herein study, we attempt of Xiros et al. 2008. After 48 hour of incubation 50 ml of
to advance the economical and ecofriendly productivity of distilled water was added into the solid substrate, shaken
pectinase from Bacillus subtilis strain Btk 27. In addition, we the flasks for 1 h at 120 rpm on orbital shaker thoroughly
attempted a very diligent and comprehensive SmF and SSF and slurry is formed. Then, the flasks were kept at 4∘ C
comparative pectinase production optimizations. for 30 min under static conditions to facilitate the enzyme
extraction. The slurry was centrifuged at 10,000g for 10 min
at 4∘ C, and the clear supernatant was collected to assay the
2. Material and Methods pectinase activity. The Pectinase activity was determined in
the supernatant as U/g of solid substrate used.
2.1. Inoculum Preparation. Fresh culture of Bacillus subtilis
strain Btk 27 was inoculated into sterilized yeast extract
pectin (YEP) medium. The pH of the medium was adjusted 2.6. The Effect of Moisture Content. To study the effect of
at 7.0 ± 0.5. The inoculated flask was incubated at 30∘ C on a moisture content on the production of pectinase enzyme
rotary shaker at 120 rpm. Culture was grown in 50 ml media using SSF, the optimized solid substrate was moistened at
in 250 ml Erlenmeyer flasks. This inoculum was used for 45%, 55%, 65%, 75% and 85% moisture content using distilled
subsequent experiments. water before sterilization. Then, the autoclaved substrate was
inoculated with 2 ml of inoculum and incubated at 37∘ C for
48 h. After the end of incubation, the pectinase activity was
2.2. Pectinase Enzyme Assay. Pectinase enzyme assay was determined.
based on the determination of reducing sugars produced as
a result of enzymatic hydrolysis of pectin by dinitro salicylic
acid reagent (DNS) method (Miller, 1959). For enzyme assay, 2.7. Effect of pH. The pH of the optimized nutrient media
1.5 mL of freshly grown culture was taken and centrifuged and agroresidue was adjusted to pH that ranges from 4.0-9.0
at 10,000 rpm for 5 min. The supernatant (100 𝜇L) from the with 0.5 intervals before sterilization. The sterilized nutrient
culture broth was served as the source of the enzyme. The medium and solid substrate were inoculated and incubated at
enzyme unit was defined as the amount of enzyme that 37∘ C, 120 rpm (for SmF only), for 48 hours.
catalyzes 𝜇mol of galacturonic acid per minute (𝜇mol min−1 )
under the assay conditions. Relative activity was calculated as 2.8. Effect of Temperature. The sterilized and optimized
the percentage enzyme activity of the sample with respect to agroresidue and nutrient media were inoculated and incu-
the sample for which maximum activity is obtained. bated at 25∘ C, 30∘ C, 37∘ C, 40∘ C, 45∘ C and 50∘ C for 48 h to
study the effect of temperature on enzyme production.
𝐴𝑐𝑡𝑖V𝑖𝑡𝑦 𝑜𝑓 𝑠𝑎𝑚𝑝𝑙𝑒 (𝑈) × 100
Relative Activity = (1)
𝑀𝑎𝑥𝑖𝑚𝑢𝑚 𝑒𝑛𝑧𝑦𝑚𝑒 𝑎𝑐𝑡𝑖V𝑖𝑡𝑦 (𝑈) 2.9. Effect of Agitation. To study the effect of agitation on SmF,
the optimized nutrient media was inoculated and incubated
2.3. Effect of Nutrient Media. The effect of nutrient media at different speeds such as static (0), 120 rpm, 150 rpm and
on the production of pectinase in submerged fermentation 180 rpm at optimized temperature.
was studied using Yeast extract, Luria-Bertani broth, Nutrient
broth, Peptone, Trypton soybean meal, and Malt extract. Each 2.10. Effect of Inoculum Size. To examine the effect of inocu-
nutrient media (1% w/v) was supplemented with 0.25% (w/v) lums size on pectinase production, the optimized nutrient
media and agroresidue were inoculated with various inocu- Table 1: Effect of nutrient media on pectinase production.
lum sizes such as 0.5% v/v, 1% v/v, 2% v/v, 3% v/v and 4% v/v
for SmF and 5% v/v, 10% v/v, 15% v/v, and 20% v/v for SSF. Nutrient media Enzyme activity (U/ml) ∗
Yeast extract 10.1 ± 1.4a
Luria-Bertani 6.0 ± 0.8c
2.11. Effect of Salts. To study the effect of salts on pectinase
production, the optimized nutrient media and agroresidue Peptone 6.3 ± 0.2b
were supplemented with 3 mM of various salts such as: Tryptone soybean meal 5.0 ± 1.4c
CaCl2 .2H2 O, MgSO4 .7H2 O, CuCl2 .2H2 O, CoCl2 .2H2 O, Malt extract 4.8 ± 0.1c
ZnCl2, FeSO4 .7H2 O, and NaCl. In SSF, these salts were Nutrient broth 3.5 ± 0.1c
dissolved in the distilled water which was used for adjusting (i) ∗Values are mean ± S.D. of 3 replicates.
moisture level before incorporating them into the solid (ii) Values followed by different superscripts are significantly different at
substrate. (P<0.05).
(iii) Values followed by same superscripts are not significantly different at
(P<0.05).
2.12. Effect of Carbon Sources. To examine the effect of
carbon sources on Pectinase production both in SmF and Table 2: Effect of agroresidues on Pectinase production.
SSF, various carbon sources such as dextrose, fructose,
arhabinose, galacturonic acid, galactose, sucrose, and xylose Agro Residues Enzyme activity (U/g) ∗
were supplemented into optimized nutrient media and agro Coffee 93.4 ± 7.3a
residues at a concentration of 1% w/v along with 0.25% Apple Lemon 136.8 ± 51.1a
pectin (in case of SmF). In case of SSF, these carbon sources Orange 113.6 ± 2.4a
were dissolved in the distilled water which was used for Wheat bran 800.0 ± 16.2b
adjusting moisture level before incorporating them into the (i) ∗Values are mean ± S.D. of 3 replicates.
solid substrate. (ii) Values followed by different superscripts are significantly different at
(P<0.05).
(iii) Values followed by same superscripts are not significantly different at
2.13. Effect of Nitrogen Sources. The effect of Nitrogen sources (P<0.05).
on pectinase production both in SmF and SSF were studied
by supplementing various organic and inorganic nitrogen
sources, namely casein, peptone, tryptone, glycine, urea, pectinase activity at the end of incubation. The highest
ammonium chloride, ammonium nitrate, ammonium sulfate pectinase production attained was using yeast extract (10.1 ±
of 1% (w/v) into optimized nutrient media and agro residue. 1.4 U/ml). Furthermore; the production of pectinase in yeast
In case of SSF, these nitrogen sources were dissolved in the extract was significantly higher than any of the other media
distilled water which was used for adjusting moisture level (Table 1).
before incorporating them into the solid substrate.
3.2. Effect of Agro Residues. Among the studied agroresidues,
2.14. Effect of Vitamins. To examine the effect of vitamin on the maximum pectinase activity achieved was 800.0 ±
pectinase production both in SmF and SSF, the optimized 16.2 U/g using wheat bran. In contrast, the lowest pectinase
medium and agroresidue were sterilized and supplemented production was 93.4 ± 7.3 U/g from coffee husk (Table 2).
with different concentrations of multivitamin solution such Production of pectinase using coffee pulp, lemon peel and
as 0.1% v/v, 0.2% v/v, 0.3% v/v, and 0.4% v/v. orange peel were not significantly different. Therefore, the
subsequent SSF studies were carried out using wheat bran as
2.15. Effect of Time of Incubation. To study the effect of substrate.
incubation time, within 12-hour interval aliquots of samples
were taken and the pectinase activity was assayed. 3.3. Moisture Content. In order to study the effect of moisture
content on SSF, wheat bran was moistened at a range of 35
2.16. Data Analysis. All statistical analyses were performed - 85% moisture content using distilled water. The maximum
using experimental results which were expressed as means pectinase production was at 75% initial moisture content
± SD of three parallel replicates. Mean of the results were (Figure 1).
compared using post- hoc multiple comparison analysis
performed using Tukey homogenous test using GraphPad 3.4. Effect of pH. To study the effect of initial pH of growth
Prism 5 software at a significance level of p< 0.05. The results media both on SmF and SSF pectinase production, YEP and
were analyzed using Origin pro 8 data analysis and GraphPad wheat bran were adjusted to a pH range of 4.0 - 9.0. In both
Prism 5 desktop version software. fermentations, the maximum pectinase activity attained was
at the 6.5 initial pH (Figure 2).
3. Results
3.5. Effect of Temperature. The wheat bran with appropriate
3.1. Nutrient Media. The inoculated nutrient media were moisture and as well YEP, were inoculated and incubated at
incubated at 30∘ , 120 rpm for 48 hours and assayed for various temperatures. The maximum pectinase production
100 Table 3: Effect of Incubation temperature on pectinase production.
Incubation SmF SSF

Relative Activity (%)
90 temperature (∘ C) Relative activity (%) Relative activity (%)

25 56.3a 50.3a
80 30 76.7b 74.2b
37 100.0c 100.0c
70 40 84.0b 86.0b
45 42.0d 52.1a
60 50 0.1e 8.3d
30 40 50 60 70 80 90 100 (i) Values followed by different superscripts are significantly different at
Moisture content (%) (P<0.05).
(ii) Values followed by same superscripts are not significantly different at
Figure 1: Effect of moisture content on pectinase production. (P<0.05).
100
Table 4: Effect of agitation speed on pectinase production.
80 Enzyme Units Relative Activity
Agitation (rpm)
(U/ml) ∗
(%)
60 0 7.2 ± 0.4a 55.0
120 13.1 ± 1.8b 100.0
40 150 11.7 ± 1.2b 89.3
180 11.1 ± 0.6b 84.7
20 (i) ∗Values are mean ± S.D. of 3 replicates.
(ii) Values followed by different superscripts are significantly different at
(P<0.05).
0 (iii) Values followed by same superscripts are not significantly different at
4 5 6 7 8 9 10 (P<0.05).
pH
SmF
SSF
study their effects on productivity of pectinase. In case
of SmF, CaCl2 .2H2 0, MgSO4 .7H2 O, CoCl2 .6H2 0 and NaCl
Figure 2: Effect of initial pH of growth media on pectinase significantly enhanced the enzyme production compared to
production. the control. Both CaCl2 .2H2 0 and MgSO4 .7H2 O significantly
increased pectinase activity by three folds. The maximum
pectinase production attained was 54.0 ± 2.5 U/ml by supple-
attained was at 37∘ C for both fermentation techniques menting YEP with MgSO4 .7H2 O (Table 6).
(Table 3). Thus, the succeeding studies were performed at In case of SSF supplementation of wheat bran with
incubation temperature of 37∘ C. CaCl2 .2H2 0, MgSO4 .7H2 O and NaCl showed enhanced
trend of pectinase production although not significant.
3.6. Effect of Agitation. To study the effect of agitation on The maximum pectinase production observed was 1169.7 ±
submerged fermentation, the inoculated YEP was incubated 147.8 U/g by supplementing MgSO4 .7H2 O (Table 6). How-
at optimized conditions with different agitation speed. An ever, FeSO4 .7H2 0 and ZnSO4 .7H2 O significantly reduced
enzyme activity of 13.1 ± 1.8 U/ml was recorded at 120 rpm pectinase production. The lowest pectinase activity achieved
which was the highest. In contrast, 7.2 ± 0.4 U/ml was found was 566.9 ± 51.0 U/g by ZnSO4 .7H2 O. The subsequent SmF
to be the lowest at the agitation speed of 0 rpm (Table 4). and SSF studies were performed by supplementing 3 mM of
MgSO4 .7H2 O into YEP and wheat bran.
3.7. Effect of Inoculum Size. The effect of inoculum size on
both fermentation techniques was studied and the highest 3.9. Effect of Carbon Sources. YEP and wheat bran were
pectinase production in SmF achieved was 15.4 ± 0.4 U/ml at supplemented with 1% of different carbon sources along
1% v/v inoculum size (Table 5). The subsequent SmF studies with 3.0 mM of MgSO4 .7H2 O to study their effect. In case
were performed at 1% v/v inoculum size. Whereas in case of of SmF, supplementation with carbon sources (except for
SSF, the maximum pectinase production achieved was 1018.1 sucrose) significantly decreased the pectinase production
± 47.8 U/g using 10% v/v inoculums size (Table 5). (Table 7). The highest pectinase production achieved was
on the control. Therefore, the subsequent SmF studies were
3.8. Effect of Salts on Pectinase Production. YEP and Wheat carried out on YEP in the presence of 0.25% apple pectin
bran were supplemented with 3.0 mM of different salts to without any other carbon source.
Table 5: Effect of inoculum size on pectinase production.
Inoculum Size SmF SSF

Inoculum Size (%)
(%) Enzyme activity (U/ml) ∗ Relative activity (%) Enzyme activity (U/g) ∗ Relative activity (%)
0.5 13.9 ± 1.0a 90.3 5 817.4 ± 6a 80.3
1 15.4 ± 0.4a 100.0 10 1018.1 ± 47.8b 100.0
2 14.2 ± 0.2a 92.2 15 841.8 ± 60.4a 82.7
3 10.2 ± 1.4b 66.2 20 735.8 ± 48.0a 72.3
(i) ∗Values are mean ± S.D. of 3 replicates.
(ii) Values followed by different superscripts are significantly different at (P<0.05).
(iii) Values followed by same superscripts are not significantly different at (P<0.05).
Table 6: Effect of salts on pectinase production.
SmF SSF
Metal Ions Enzyme activity Relative Activity Enzyme activity Relative Activity
(U/ml) ∗ (%) (U/g) ∗ (%)
CaCl2 .2H2 0 48.8 ± 4.2a 302.5 1159.1 ± 100.1a 115.3
CoCl2 .6H2 0 40.4 ± 3.6b 252.5 974.0 ± 41.7ab 96.9
FeSO4 .7H2 0 8.8 ± 1.3c 55.0 766.1 ± 91.2b 76.2
MgSO4 .7H2O 54.0 ± 2.5a 337.5 1169.7 ± 147.8a 116.3
NaCl 44.6 ± 5.1ab 278.8 1025.6 ± 135.1a 102.3
ZnSO4 .7H2 O 14.3 ± 0.44c 89.4 566.9 ± 51.0b 56.4
Control 16.0 ± 1.4c 100.0 1005.4 ± 47.8a 100.0
(iv) The control is not supplemented with salts.
Table 7: Effect of carbon sources on pectinase production.
SmF SSF
Carbon sources Enzyme activity Relative Activity Enzyme activity
(U/ml) ∗ (%) (U/g) ∗
Arhabinose 8.5 ± 2.1a 14.7 769.2 ± 99.54a 65.6
Dextrose 43.4 ± 2.9b 75.2 1045.7 ± 316.2a 89.2
Fructose 42.1 ± 0.2b 73.0 946.1 ± 186.0a 80.7
Galactose 14.1 ± 5.3ac 24.4 1045.7 ± 232.2a 89.2
D-Galacturonic Acid 20.9 ± 7.0c 36.2 666.5 ± 280.7a 56.9
Pectin - - 836.5 ± 100.3a 71.4
Sucrose 52.0 ± 3.4d 90.1 781.9 ± 233.3a 66.7
Xylose 13.6 ± 1.6ac 23.6 707.2 ± 62.17a 60.3
Control 57.7 ± 6.04d 100.0 1172.3 ± 24.68a 100.0
(iv) The control is unsupplemented with any carbon source.
In case of SSF, the highest activity attained was 1172.3 supplemented with different nitrogen sources at 1% (w/v).
± 24.68 U/g in the control which was not supplemented by In case of SmF, the highest pectinase production was at
any carbon source (Table 7). Therefore, the subsequent SSF 67.7 ± 4.7 U/ml by supplementing Yeast extract with casein.
studies were also carried out without any carbon source The other tested nitrogen sources significantly decreased
supplementation. pectinase production. Where as in case of SSF, the highest
pectinase production observed was 1261.2 ± 64.0 U/g when
3.10. Effect of Nitrogen Sources. To study the effect of nitrogen supplemented with ammonium sulphate (NH4 SO4 ). How-
sources on pectinase production, YEP and wheat bran were ever, the effect wasn’t significant (Table 8).
Table 8: Effect of nitrogen sources on pectinase production.
SmF SSF
Nitrogen Sources Enzyme activity Enzyme activity Relative Activity
(U/ml) ∗ (U/g) ∗ (%)
NH4 Cl 44.7 ± 4.8a 73.4 975.7 ± 184.0a 84.1
NH4 NO3 29.4 ± 1.6b 48.3 1230.0 ± 30.2a 106.0
NH4 SO4 34.9 ± 2.4b 57.3 1261.2 ± 64.0a 108.7
Casein 67.7 ± 4.7c 111.2 1008.6 ± 19a 87.0
Glycine 33.9 ± 0.7b 55.7 970.5 ± 43.0ab 83.7
Peptone 33.8 ± 2.4b 55.5 933.4 ± 31.8ab 80.5
Urea 32.2 ± 3.7b 53.0 884.7 ± 83.4b 76.3
Yeast Extract - - 1076.9 ± 17.2a 92.8
Control 60.9 ± 1.1c 100.0 1160.0 ± 2.50a 100.0
(iv) The control is unsupplemented with any nitrogen source.
Table 9: Effect of vitamins on pectinase production.
SmF SSF
Vitamin (𝜇l) Enzyme activity Enzyme activity
Relative Activity (%) Relative Activity (%)
(U/ml) ∗ (U/g) ∗
50 65.2 ± 3.6a 98.3 858.6 ± 50.9a 67.5
100 68.6 ± 7.5a 103.5 746.0 ± 80.3a 58.6
150 64.8 ± 5.8a 97.7 814.9 ± 16.3a 64.0
200 69.6 ± 6.5a 104.9 787.8 ± 48.9a 61.9
Control 66.3 ± 1.2a 100.0 1272.4 ± 25.5b 100.0
(i) ∗Values are mean ± SD of 3 replicates.
(ii) Values followed by different superscripts are significantly different at (P<0.05.
(iv) The control is unsupplemented with vitamin.
3.11. Effect of Vitamins. To study the effect of vitamins on 100

pectinase production, multivitamin solution was incorpo-
rated into YEP and Wheat bran. There was no significant
80
effect on SmF pectinase production, however, significant
declining of enzyme production was observed on SSF
(Table 9). 60
3.12. Effect of Incubation Period. To study the effect of incuba- 40

tion period, the inoculated YEP and Wheat bran were assayed
for pectinase activity within 24 hours interval. Accordingly, 20
the highest pectinase enzyme production on both SmF and 24 48 72 96 120 144
SSF was achieved at 48 hours of incubation. Beyond 48 hour Time Of Incubation ( Hour )
of incubation the production of pectinase both on SmF and
SSF
SSF, declined (Figure 3). SmF
Figure 3: Effect of Time of Incubation on Pectinase production.

4. Discussions
Emerging new applications of pectinase, underline the
importance of screening pectinase producing microorgan- pH, aeration, inoculums and the presence of inducer or
isms with novel properties, greater enzyme activity and large- repressor substrates [12]. In this study, parameters that affect
scale production of these enzymes [11]. The potential of the pectinase production have been standardized and diligent
microorganisms to produce extracellular enzymes is influ- optimization steps were carried out to make the production
enced by environmental conditions such as temperature, of pectinase enzyme to be cost effective and commercially
viable. Since, to meet the growing industrial demands for of pectinase is more related to the optimum conditions
pectinase, it is necessary to improve yield without increasing required for the growth of specific microorganism employed
the cost of production. Thus, in this study the biotechno- to conduct the fermentation than other factors, so it may
logical capacities of agricultural wastes are considered for have remained in a particular range for some microorganism,
economical production of pectinase. In addition, a compre- irrespective of the type of fermentation [15]. These results are
hensive comparative SmF and SSF optimization studies are in agreement with the following: Banu et al. [16] also found
undertaken. that P. chrysogenum exhibited maximum polygalacturonase
In this study, among the tested nutrient media, the highest production at initial pH of 6.5. The pectinase produced by
production of Pectinase on submerged fermentation was 10.1 Bacillus sphaericus (MTCC 7542) had the maximum activity
± 1.4 U/ml using Yeast Extract. The result is in agreement at pH 6.8 initial pH of Medium [2].
with; Kashyap et al., [13] reported the combination of Yeast Temperature is very important factor for microbial
Extract with pectin to be the best medium for pectinase growth as well as microbial product formation. The incuba-
production. Bacillus shaericus MTCC 7542 produced maxi- tion temperature greatly affects the microbial growth rate,
mum polygalactouronase when grown on mineral medium enzyme secretion, enzyme inhibition, and protein denatura-
containing yeast extract as sole nitrogen source [2]. Yeast tion [11]. In this study the maximum pectinase production
extract is the best nitrogen source for pectinase production, was observed at 37∘ C for both on submerged and solid-
probably due to its high content in minerals, vitamins, state fermentations. The result is in good agreement with;
coenzymes and nitrogen components. Namasivayam et al. [17] reported an optimum temperature
Among the tested agroresidues for pectinase production, for maximum activity of pectinase from B. cereus to be
maximum enzyme production on solid state fermentation 37∘ C. The optimum temperature for pectinase production
achieved was 800.0 ± 16.2 U/g from wheat bran. In the same was found to be 37∘ C whereas no other temperature was
way, Namasivayam et al. 2011 working on B. cereus isolated suitable to such extent for growth and enzyme secretion [18].
from market solid waste reported that pectinase production Agitation plays a vital role in mass transfer in a submerged
was enhanced by wheat bran. Of the various substrates fermentation. In this study agitation increased pectinase
reported in the literature, wheat bran has been the prime production significantly. Kashyap et al. [13] reported that aer-
among all [10]. El-Shishtawy et al. 2014 conducted solid state ation has a significant influence on the pectinase production
production of pectinase from B. megatherium using wheat by Bacillus sp. DT7. Darah et al. [19] explained that, at lower
bran, grasses, palm leaves, and date seeds and the maximum agitation speed, the inadequate mixing of the broth towards
pectinase achieved was 350 U/g using wheat bran. Wheat the later stages of growth affected the enzyme synthesis, while
bran characterized by its better air circulation, loose particle the drastic dropping in enzyme activity at higher agitation
binding and efficient penetration, and cheaper; therefore speeds was due to shearing effect on the cells.
it showed a better prospect economically in fermentation The initial load of microorganisms also influences the
processes [14]. final level of the enzyme synthesized. In this study, the max-
Moisture is one of the most important parameter in imum enzyme production observed was at 1% v/v inoculum
solid state fermentation (SSF) that influences the growth of size and at 10% v/v in case of SmF and SSF, respectively. The
the organism and thereby enzyme production. Moisture is results are in agreement with the following: Ahlawat et al.
reported to cause swelling of the substrates, thereby facilitat- [18] reported SmF pectinase production by Bacillus subtilis
ing better utilization of the substrate by microorganisms [14]. at inoculums size of 1% (v/v) was much higher compared to
The maximum pectinase production from Bacillus subtilis 2% (v/v). Kashyap et al. [20] reported that 10% (w/v) of an
strain Btk27 was recorded at 75% initial moisture content. inoculum size for SSF production of pectinase using Bacillus
Kashyap et al. 2003 also reported that 75% initial moisture sp. DT7. Adequate nutrient supply could be the reason of
content for enhanced production of pectinase by Bacillus sp. the higher enzyme production with optimum inoculums size.
DT7. The moisture level in SSF process varies between 70 Also, the pectinase production reduction beyond optimum
and 80% for bacteria [10]. Any further increase in moisture inoculums size could be due to rapid depletion of nutrients
content resulted in the decrease of enzyme yields may be due and development of oxygen stress resulting from a high
to clumping of solid particles which results in the decrease microbial load.
of interparticle space and diffusion of nutrients. In contrast, In this study, CaCl2 .2H2 0, CoCl2 .6H2 0, MgSO4 .7H2 O,
the low moisture content leads to the decreased solubility of and NaCl enhanced pectinase production on submerged
nutrients present in the wheat bran thereby decreased enzyme fermentation. Both CaCl2 .2H2 0 and MgSO4 .7H2 O signifi-
yields. cantly increased pectinase production by three folds. These
The initial pH of the fermentation medium plays a vital results are in agreement with the following: Kashyap et
role in determining the level of metabolite synthesis. The al. [13] reported more than three-fold increase in pecti-
stability of the microbial metabolite is also dependent on the nase production by supplementing MgSO4 and CaCl2 .
hydrogen ion concentration of the medium. In present study While CaCl2 .2H2 0, MgSO4 .7H2 O, and NaCl also increased
the maximum pectinase production attained both on solid pectinase production on solid state fermentation however
state fermentation and on submerged fermentation was at the their effect was not significant. The maximum pectinase
6.5 initial pH. It has been reported that optimum pH in both activity observed was 1169.7 ± 147.8 U/g by supplementing
cases of fermentation SSF and SmF was similar. This may MgSO4 .7H2 O. Banu et al. [16] observed little effect of Mg2+
be due to the fact that the optimum pH for the production and Ca2+ on pectinase from P. chrysogenum.
An adequate supply of carbon as energy source is critical results of this study are in contrast with the above reports.
for optimum growth affecting the growth of organism and This could be due to the multivitamin solution in this study
its metabolism. In the present study, the maximum pectinase contained ZnSO4 .7H2 O as a component. As it observed in
production observed both on submerged fermentation and this study, by supplementing ZnSO4 .7H2 O there was no
solid-state fermentation were on the controls. Supplementing significant effect on pectinase production using submerged
carbon sources decreased pectinase production on both solid fermentation; however, it significantly decreased pectinase
state and submerged fermentations. According to Ahlawat et production on solid state fermentation.
al., [18] low enzyme production with other carbon sources is The time of fermentation had a profound effect on micro-
might be because of catabolite repression. Glucose is known bial product formation [4]. The level of enzyme production
to repress the transcription of genes encoding enzymes varies with the time duration of the fermentation process. In
required for the utilization of alternative carbon sources; this study, the pectinase activity was increased continuously
some of these genes are also repressed by other sugars such until 48 hours of incubation. Onwards 48 hour of incubation
as galactose, sucrose, and arabinose and the process is known the pectinase activity was decreased. Thus, optimum time of
as catabolite repression [21, 22]. This result agrees with the pectinase synthesis was to be 48 hour after inoculation [30].
study of Solı́s -Pereira et al., [23] where the production of The reduction in pectinase production after 48 h might be
polygalacturonase was lower when free sugars were added the result of change in pH during fermentation, denaturation,
to the medium compared to the presence of pectin as the or decomposition of enzyme due to interaction with other
sole carbon source in submerged fermentation. Fawole and components of medium and depletion of nutrients in the
Odunfa [24] found that pectin and polygalacturonic acid medium [31].
promoted the production of pectic enzyme. Phutela et al. [25] In conclusion, Kashyap 2000 has reported that after
stated that pure pectin and wheat bran supported maximum optimizing growth conditions the pectinase production using
pectinase production. The same carbon supplements except submerged fermentation from Bacillus sp DT7 was 53 U/ml,
starch caused repressive effect on pectinase production by B. which was the highest report in the literature. Nevertheless,
licchenformis [26]. in our study we report that a pectinase activity of 69.6 u/ml
Nitrogenous compounds are utilized by the microbial from optimized submerged fermentation. In addition, El-
cells for the synthesis of nucleotides, amino acids, proteins, Shishtawy, 2014, has stated that solid state production of
enzymes, and other metabolites [27]. Nitrogen supplements, pectinase enhanced from 350 U/g to 610 U/g. Herein, the
when incorporated into the production medium, facilitate pectinase production from Bacillus subtilis strain Btk 27 in
better biomass production and subsequently higher metabo- solid state fermentation improved from 800 U/g to 1272 U/g.
lite secretion. In this study, the maximum pectinase pro-
duction attained on submerged fermentation was 67.7 ± 5. Conclusion
4.7 U/ml by supplementing Casein. Similar results have been
reported by other workers; Thakur et al. [28] reported that In this study, a very assiduous and all-embracing optimiza-
combination of casein hydrolysate and yeast extract gave high tion steps are carried out. The production of pectinase was
yield of polygalacturonase from Mucor circinelloides ITCC enhanced more than a 6-fold in submerged fermentation and
6025. Jayani et al., [2] working on Bacillus sphaericus (MTCC a fold in solid state fermentation. The potential of agricultural
7542), reported that a combination of yeast extract and casein wastes for the production of pectinase using solid state
hydrolysate also gave high polygalacturonase activity. Of the fermentation is highlighted in this study. In addition, for the
various nitrogen sources used, maximum pectinase activity highest productivity of pectinase from Bacillus subtilis strain
was observed when casein hydrolysate and yeast extract were Btk 27 both on submerged and solid-state fermentations, only
used together [2]. Meanwhile, among the tested nitrogen adjustment of the inoculum size and temperature without
sources, ammonium sulphate (NH4 SO4 ) and ammonium supplementing carbon source, nitrogen source, and vitamin
nitrate (NH4 NO3 ) increased the pectinase productivity on is adequate. This result conveys the very economized produc-
SSF though their effect was not significant. The result is in tion of pectinase.
good agreement with Fawole and Odunfa [24] who found
that ammonium sulphate and ammonium nitrate were good Data Availability
nitrogen sources for pectic enzyme production from A. niger.
Moreover, Sarvamangala and Dayanand [29] revealed that The data used to support the findings of this study are
ammonium sulphate did influence production of pectinase included within the article.
positively in solid-state conditions.
In present study, there wasn’t any significant effect of Ethical Approval
pectinase production on submerged fermentation by supple-
mentation of multivitamin. However, supplementing vitamin This article does not contain any studies with human partici-
significantly decreased SSF pectinase production. According pants or animals performed by any of the authors.
to Kashyap et al., [20], Pectinase production was enhanced by
65.8% when multivitamin solution was added to wheat bran. Conflicts of Interest
Similarly, Kashyap et al. [13] reported that supplementing
multivitamin solution increased Bacillus sp. DT7 pectinase There are no conflicts of interest regarding the publication of
production by 61% on submerged fermentation. However, the this manuscript.
Acknowledgments [15] Y. Khairnar, J. B, A. Mujapara et al., “Study of pectinase

production in submerged fermentation using different strains
The authors are delighted to acknowledge Addis Ababa of Aspergillus Niger,” International Journal of Microbiology
University and Ambo University for their cooperation during Research, vol. 1, no. 2, pp. 13–17, 2009.
this study. [16] A. Banu, M. Rasheedha, G. R. K. Devi et al., “Production
and characterization of pectinase enzyme from Penicillium
chrysogenum,” Indian Journal of Science and Technology, vol. 3,
References no. 4, pp. 377–381, 2010.
[1] N. Jacob, “Pectinolytic enzymes,” Biotechnology for Agro- [17] E. Namasivayam, D. John Ravindar, K. Mariappan, A. jiji, M.
Industrial Residues Utilisation: Utilisation of Agro-Residues, pp. Kumar, and R. L. Jayaraj, “Production of extracellular pectinase
383–396, 2009. by bacillus cereus isolated from market solid waste,” Journal of
Bioanalysis & Biomedicine, vol. 3, no. 3, pp. 70–75, 2011.
[2] R. S. Jayani, S. K. Shukla, and R. Gupta, “Screening of bacterial
strains for polygalacturonase activity: its production by bacillus [18] S. Ahlawat, R. P. Mandhan, S. S. Dhiman, R. Kumar, and J.
sphaericus (MTCC 7542),” Enzyme Research, vol. 2010, Article Sharma, “Potential application of alkaline pectinase from Bacil-
ID 306785, 5 pages, 2010. lus subtilis SS in pulp and paper industry,” Applied Biochemistry
and Biotechnology, vol. 149, no. 3, pp. 287–293, 2008.
[3] R. S. Jayani, S. Saxena, and R. Gupta, “Microbial pectinolytic
enzymes: a review,” Process Biochemistry, vol. 40, no. 9, pp. 2931– [19] I. Darah, M. Nisha, and S. H. Lim, “Enhancement of poly-
2944, 2005. galacturonase production from enterobacter aerogenes NBO2
by submerged fermentation,” Advanced Studies in Biology, vol.
[4] H. A. Murad and H. H. Azzaz, “Microbial pectinases and
5, no. 5, pp. 173–189, 2013.
ruminant nutrition,” Research Journal of Microbiology, vol. 6, no.
3, pp. 246–269, 2011. [20] D. R. Kashyap, S. K. Soni, and R. Tewari, “Enhanced production
of pectinase by Bacillus sp. DT7 using solid state fermentation,”
[5] C. Arunachalam and S. Asha, “Pectinolytic enzyme—a review Bioresource Technology, vol. 88, no. 3, pp. 251–254, 2003.
of new studies,” Biotechnology Advances, vol. 561, pp. 1–5, 2010.
[21] L. B. Crotti, V. A. P. Jabor, M. A. D. S. C. Chellegatti, M. J. V.
[6] M. Khan, E. Nakkeeran, and S. Umesh-Kumar, “Potential Fonseca, and S. Said, “Studies of pectic enzymes produced by
application of pectinase in developing functional foods,” Annual Talaromyces flavus in submerged and solid substrate cultures,”
Review of Food Science and Technology, vol. 4, no. 1, pp. 21–34, Journal of Basic Microbiology, vol. 39, no. 4, pp. 227–235, 1999.
2013.
[22] Q. K. Beg, M. Kapoor, R. P. Tiwari, and G. S. Hoondal, “Bleach-
[7] G. Hoondal, R. Tiwari, R. Tewari, N. Dahiya, and Q. Beg, boosting of eucalyptus kraft pulp using combination of xylanase
“Microbial alkaline pectinases and their industrial applications: and pectinase from Streptomyces sp. QG-11-3,” Res. Bullet.
A review,” Applied Microbiology and Biotechnology, vol. 59, no. Panjab Univer, vol. 57, pp. 71–78, 2001.
4-5, pp. 409–418, 2002. [23] S. Solis-Pereira, E. Favela-Torres, G. Viniegra-González, and M.
[8] C. Sieiro, B. Garcı́a-Fraga, J. López-Seijas, A. F. Da Silva, and Gutiérrez-Rojas, “Effects of different carbon sources on the syn-
T. G. Villa, “Microbial Pectic Enzymes in the Food and Wine thesis of pectinase by Aspergillus niger in submerged and solid
Industry,” Food Industrial Processes - Methods and Equipment, state fermentations,” Applied Microbiology and Biotechnology,
vol. 2, pp. 1–18, 2012. vol. 39, no. 1, pp. 36–41, 1993.
[9] O. J. Oumer and D. Abate, “Characterization of Pectinase from [24] O. B. Fawole and S. A. Odunfa, “Pectolytic moulds in Nigeria,”
Bacillus Subtilis Strain Btk 27 and Its Potential Application in Letters in Applied Microbiology, vol. 15, no. 6, pp. 266–268, 1992.
Removal of Mucilage from Coffee Beans,” Enzyme Research, vol. [25] U. Phutela, V. Dhuna, S. Sandhu, and B. S. Chadha, “Pecti-
2017, Article ID 7686904, 7 pages, 2017. nase and polygalacturonase production by a thermophilic
[10] A. Pandey, C. R. Soccol, P. Nigam, V. T. Soccol, L. P. S. Van- Aspergillus fumigatus isolated from decomposting orange
denberghe, and R. Mohan, “Biotechnological potential of agro- peels,” Brazilian Journal of Microbiology, vol. 36, no. 1, pp. 63–69,
industrial residues. II: cassava bagasse,” Bioresource Technology, 2005.
vol. 74, no. 1, pp. 81–87, 2000. [26] H. U. Rehman, S. A. U. Qader, and A. Aman, “Polygalac-
[11] S. Singh and S. K. Mandal, “Optimization of processing param- turonase: Production of pectin depolymerising enzyme from
eters for production of pectinolytic enzymes from fermented Bacillus licheniformis KIBGE IB-21,” Carbohydrate Polymers,
pineapple residue of mixed aspergillus species,” Jordan Journal vol. 90, no. 1, pp. 387–391, 2012.
of Biological Sciences, vol. 5, no. 4, pp. 307–314, 2012. [27] J. Padhiar, A. Das, and S. Bhattacharya, “Optimization of
[12] A. El-Refai, S. M Metwalli, and L. A El-Sebaiy, “Influence process parameters influencing the submerged fermentation of
of PH, inoculum, aeration and growth period on production extracellular lipases from Pseudomonas aeruginosa, Candida
of pectinolytic enzymes by penicillium awamori 16,” Chemie, albicans and Aspergillus flavus,” Pakistan Journal of Biological
Mikrobiologie, Technologie der Lebensmittel, vol. 8, pp. 115–117, Sciences, vol. 14, no. 22, pp. 1011–1018, 2011.
1984. [28] A. Thakur, R. Pahwa, S. Singh, and R. Gupta, “Production,
[13] D. R. Kashyap, S. Chandra, A. Kaul, and R. Tewari, “Production, purification, and characterization of polygalacturonase from
purification and characterization of pectinase from a Bacillus sp. mucor circinelloides ITCC 6025,” Enzyme Research, vol. 2010,
DT7,” World Journal of Microbiology and Biotechnology, vol. 16, Article ID 170549, 7 pages, 2010.
no. 1959, pp. 277–282, 2000. [29] R. P. Sarvamangala and A. Dayanand, “Exploration of regional
[14] R. M. El-Shishtawy, S. A. Mohamed, A. M. Asiri, A.-B. M. agrowastes for the production of pectinase by Aspergillusniger,”
Gomaa, I. H. Ibrahim, and H. A. Al-Talhi, “Solid fermentation Food Technology and Biotechnology, vol. 44, no. 2, pp. 289–292,
of wheat bran for hydrolytic enzymes production and sacchar- 2006.
ification content by a local isolate Bacillus megatherium,” BMC [30] M. A. Siddiqui, V. Pande, and M. Arif, “Production, purification,
Biotechnology, vol. 14, article 29, 2014. and characterization of polygalacturonase from Rhizomucor
pusillus isolated from decomposting orange peels,” Enzyme

Research, vol. 2012, Article ID 138634, 8 pages, 2012.
[31] M. Palaniyappan, V. Vijayagopal, R. Viswanathan, and T.
Viruthagiri, “Statistical optimization of substrate, carbon and
nitrogen source by response surface methodology for pectinase
production using Aspergillus fumigatus MTCC 870 in sub-
merged fermentation,” African Journal of Biotechnology, vol. 8,
no. 22, pp. 6355–6363, 2009.
Hindawi
https://doi.org/10.1155/2018/6743826
Research Article
Microbial Assessment of Tomatoes (Lycopersicon esculentum)
Sold at Some Central Markets in Ghana
Forson Akua Obeng ,1 Pokuaa Belinda Gyasi,1

Michael Olu-Taiwo,1 and F. Patrick Ayeh-kumi1,2
1
Department of Medical Laboratory Science, School of Biomedical and Allied Health Sciences, College of Health Sciences,
University of Ghana, Legon, Accra, Ghana
2
Department of Medical Microbiology, School of Biomedical and Allied Health Sciences, College of Health Sciences, University of Ghana,
Legon, Accra, Ghana
Correspondence should be addressed to Forson Akua Obeng; obeng.akua@yahoo.com
Received 9 May 2018; Accepted 10 October 2018; Published 29 November 2018
Copyright © 2018 Forson Akua Obeng et al. This is an open access article distributed under the Creative Commons Attribution
cited.
Background. Tomato (Lycopersicon esculentum) has a high water content which predisposes it to spoilage by pathogenic bacteria
that can pose significant health threats to consumers. Aim. The study aimed to determine the various pathogenic bacteria associated
with tomatoes sold in some central markets in the Accra Metropolis. Method. A total of 120 tomatoes were sampled, out of which
60 fresh, firm, undamaged tomatoes and 60 spoilt tomatoes were analysed. Cut portions of the fresh and spoilt tomatoes were
swabbed with sterile swabs and cultured on Blood agar, Nutrient agar, and MacConkey agar. The antibiogram of bacterial isolates
was determined by Kirby-Bauer disc-diffusion method. Results. Out of the 120 tomatoes analysed, a total of 66 bacterial isolates were
recovered, 68.2% were associated with spoilt tomatoes, and 31.8% were from fresh tomatoes. Klebsiella sp. (34.8%), Enterobacter sp.
(24.2%), and Citrobacter sp. (7.6%) were the predominant bacteria isolated. Agbogbloshie market (36.4%) had both fresh (18.2%) and
spoilt (18.2%) tomatoes contaminated, whilst Makola market (31.8%) had a higher spoilt (30.3%) tomatoes contaminated. Although
none of the isolates expressed resistance to ciprofloxacin, resistance was found for ampicillin (63.1%), tetracycline (60.1%), and
cefuroxime (59.1%). Conclusion. Varying levels of antibiotic resistance bacteria amongst tomatoes sold at various markets were
found. Contamination might have been caused by poor sanitation, improper handling or transportation from the farms to the
markets. The presence of antibiotic resistance bacteria amongst tomatoes raises concern on public health risks associated with the
consumption of fresh tomatoes.
1. Introduction postharvesting, handling, storage, transportation, and

processing by customers [9, 10]. Baiyewu et al. [11] have
Tomato (Lycopersicon esculentum) is a perishable vegetable also reported that another means of bacterial contamination
widely cultivated and consumed worldwide [1, 2]. It is rich is by exposing them on benches and baskets in the open
in nutrients, vitamins, dietary fibres, and phytochemicals markets for customers. The proliferation of bacteria more
[3–5]. It is known to be a very profitable crop that provides especially in damaged tomatoes could be considered to
high returns for small scale farmers in most developing be more harmful when such contaminated tomatoes are
countries [6]. Due to its nutritive value, taste, affordability, consumed in improperly cooked food [2].
and accessibility, there has been an increase in demand Some studies have been carried out on bacteria associated
by consumers [7]. However, isolation and identification of with tomatoes and tomato products in some countries. A
microorganisms that are associated with spoilage of tomatoes study carried out by Ajayi [12] in the United State has revealed
have gained some research focus [8]. that Clostridium sp., Staphylococcus sp., and Bacillus sp. were
In most developing countries, microbial infestation predominant bacteria isolated from both canned and raw
of tomatoes can occur during the harvesting period, tomatoes. In India, a study carried out on tomato puree
(a) Fresh tomatoes (b) Spoilt tomatoes (these tomatoes are often
sold at reduced prices to interested con-
sumers).
Figure 1: Pictures of some displayed tomatoes in markets.
revealed the presence of Klebsiella sp., Proteus mirabilis, a common practice by consumers before food preparation).
Vibrio sp., and Pseudomonas sp. [13]. In Nigeria, Wogu Aseptically, a sterile swab stick was used to swab the cut
and Ofuase [14] isolated Bacillus subtils, Klebsiella aerogenes, interior of the tomatoes. The swabs were then streaked onto
Pseudomonas aeruginosa, Salmonella typhi, Proteus mirabilis, Blood agar (Oxoid, UK), Nutrient agar (Oxoid, UK), and
and Staphylococcus aureus from spoilt tomatoes in Benin City. MacConkey agar (Oxoid, UK) and incubated at 37∘ C for 18-
A similar study also revealed high levels of Staphylococcus 24 hours.
sp. (22.5%), Bacillus sp. (20%), and Escherichia coli (15%) in For the spoilt tomatoes, a sterile swab was used to take
Lagos State, Nigeria [15]. In Ghana, limited information is samples from the spoilt portion of the tomatoes and this was
available on the types of pathogenic bacteria associated with streaked onto Blood agar, Nutrient agar, and MacConkey agar
tomatoes sold in markets in Accra, Ghana. This study aimed before incubation at 37∘ C for 18-24 hrs.
to isolate and identify pathogenic bacterial agents associated
with two different grades of raw tomatoes (fresh and spoilt) 2.1.3. Identification of Organisms. After incubation, the
sold in three central markets in Accra. colonies of the different culture media were examined and
recorded based on the shape, colour, border, texture, and
2. Methodology general appearance of individual bacterial colonies on each
plate, and single representative colony was Gram stained
2.1. Study Area [17]. Gram staining was done to reveal the characteristic
group and arrangement of the cells. Biochemical tests (indole
2.1.1. Sample Collection. An experimental study was carried test, methyl red test, Voges-Proskauer (VP) test, citrate test,
out by randomly purchasing tomatoes from different sell- oxidase test, coagulase test, and sugar fermentation test) were
ers at three different markets (Agbogbloshie, Makola, and then carried out for the identification of bacterial isolates.
Kaneshie) in Accra. These markets were selected because they
are major markets in the region where tomatoes are sold at 2.1.4. Susceptibility Testing. Antibiogram of all bacterial iso-
cheaper prices to consumers. lates were carried out using Kirby-Bauer disk diffusion
A total of 120 tomatoes were randomly purchased from method [18] to ampicillin (10𝜇g), chloramphenicol (10𝜇g),
the three markets in Accra. In each market, 20 fresh cefotaxime (30𝜇g), ceftriaxone (30𝜇g), gentamicin (10𝜇g),
(Figure 1(a), firm and undamaged) and 20 spoilt (Figure 1(b), cefuroxime (30𝜇g), meropenem (10𝜇g), amikacin (30𝜇g),
damaged and spoilt) tomatoes were purchased. Ten sellers cotrimoxazole (25𝜇g), ciprofloxacin (5𝜇g), and tetracycline
were selected from each market and two fresh and spoilt (10𝜇g). These antibiotics are commonly used for the treat-
tomatoes each were purchased. Samples were separately ment of bacterial infections in the general populace [19].
packaged into different sterile containers, labelled, and trans- Briefly, stored isolates were subcultured onto horse blood
ported to the laboratory immediately for bacteriological agar plates (37∘ C, 18 hrs.) and individual colonies were sus-
analysis. The elapsed time between sample collection and pended in saline to a turbidity equivalent to 0.5 McFarland
analysis did not exceed 2 hrs. standard. The suspensions obtained were then streaked on
Mueller-Hinton agar plate (Oxoid, UK) using sterile swab
2.1.2. Laboratory Analysis. Tomatoes was analysed using sticks. The paper discs were gently but firmly placed on
Ugwu et al.’s [16] method. Briefly, fresh tomatoes were indi- the inoculated plates before the plates were incubated at
vidually washed with sterile water before the tomatoes were 37∘ C for 18-24 hrs. After incubation, zones of inhibition
cut into two equal halves (this was carried out because this is were measured and interpreted according to Clinical and
Table 1: Distribution of the bacteria isolates in different grades of tomatoes from three major markets in Accra.
Fresh tomatoes
Markets (no. of sampled tomatoes)
Isolates Agbogbloshie (n = 20) Kaneshie (n = 20) Makola (n = 20 ) Total (%)
Bacillus sp. 0 2 0
Citrobacter sp. 0 0 0
Citrobacter koseri 0 0 0
Enterobacter sp. 6 1 0
Enterobacter cloacae 0 1 0
Klebsiella sp. 5 4 1
Klebsiella oxytoca 1 0 0
Klebsiella pneumoniae 0 0 0
Proteus mirabilis 0 0 0
P. aeruginosa 0 0 0
Shigella sp. 0 0 0
Total (%) 12 (18.2) 8 (12.1) 1 (1.5) 21 (31.8)
Spoilt tomatoes
Markets (no. of sampled tomatoes)
Isolates Agbogbloshie (n = 20) Kaneshie (n = 20) Makola (n = 20 )
Bacillus sp. 0 0 0
Citrobacter sp. 0 2 3
Citrobacter koseri 0 0 2
Enterobacter sp. 3 4 2
Enterobacter cloacae 2 0 0
Klebsiella sp. 2 3 8
Klebsiella oxytoca 3 2 2
Klebsiella pneumoniae 1 0 0
Proteus mirabilis 0 1 1
P. aeruginosa 0 0 2
Shigella sp. 1 1 0
Total 12 (18.2) 13 (19.7) 20 (30.3) 45 (68.2)
Total no. of isolates from fresh and spoilt tomatoes 24(36.4) 21(31.8) 21(31.8) 66(100%)
Laboratory Standard Institute [18], whilst other break points sp., Proteus mirabilis, Klebsiella oxytoca, Enterobacter cloa-
were sourced from EUCAST [20] (European Committee on cae, Citrobacter koseri, and Klebsiella pneumoniae. Tomatoes
Antimicrobial Susceptibility Testing). sampled from Agbogbloshie market (36.4%) were the most
The reference strains used for the determination of the contaminated in both fresh (18.2%) and spoilt (18.2%) toma-
MIC values were E. faecalis ATCC 29212 and Staphylococcus toes with similar prevalence of bacterial contamination. In
aureus ATCC 29213. contrast, tomatoes sampled from Kaneshie (31.8%) had few
fresh (12.1%) and spoilt (19.7%) tomatoes contaminated, and
Makola (31.8%) market had higher spoilt (30.3%) tomatoes
2.1.5. Data Analysis. The quantitative data generated from the contaminated.
study was coded and fed into Microsoft Excel and analysed Significant difference was found between Kaneshie and
using GraphPad Prism software, version 6. In all cases, P Makola markets (p = 0.0021) and Agbogbloshie and Makola
values less than 0.05 were considered statistically significant. markets (p = < 0.0001), when the prevalence of isolated
Fisher exact test was carried out to test the significance of bacteria was evaluated. However, no significant difference
prevalence of bacteria in the various markets. was found between Agbogbloshie and Kaneshie markets (p
= 0.5503).
3. Results
3.2. Occurrence of Bacteria in Sampled Fresh and Spoilt Toma-
3.1. Distribution of the Bacteria in Three Central Markets toes. Table 2 shows the percentage distribution of isolates
in Accra. Out of the 120 tomatoes purchased from the in fresh and spoilt tomatoes purchased from the different
three markets (Agbogbloshie, Kaneshie, and Makola), eleven markets. Out of a total of 66 isolates isolated, 68.2% were
different bacteria were isolated (Table 1). They were Bacillus associated with spoilt tomatoes, whilst 31.8% were on fresh
sp., Enterobacter sp., Citrobacter sp., Klebsiella sp., Shigella tomatoes.
Table 2: Total distribution of bacteria isolates in fresh and spoilt tomatoes.
Grade of Tomatoes
Isolates Fresh tomatoes Spoilt tomatoes Total (%)
Bacillus species 2 0 2 (3.0)
Citrobacter species 0 5 5 (7.6)
Citrobacter koseri 0 2 2 (3.0)
Enterobacter species 7 9 16 (24.2)
Enterobacter cloacae 1 2 3 (4.5)
Klebsiella species 10 13 23 (34.8)
Klebsiella oxytoca 1 7 8 (12.1)(
Klebsiella pneumoniae 0 1 1 (1.5)
Proteus mirabilis 0 2 2 (3.0)
P. aeruginosa 0 2 2 (3.0)
Shigella species 0 2 2 (3.0)
Total 21 (31.8) 45 (68.2) 66 (100)
Klebsiella sp. (34.8%) was the predominant isolates with 70

10 of the fresh and 13 spoilt tomatoes being positive. Enter- 60
obacter sp. (24.2%) followed with 7 of the fresh tomatoes
50
and 9 of the spoilt tomatoes. Whilst Klebsiella oxytoca (12.1%)
Percentages
was next with 1 isolate in the fresh tomatoes and 7 in the 40

spoilt ones, Citrobacter sp. (7.6%) was found in only two fresh 30
tomatoes. Except for Enterobacter cloaca which was found in 20
1 of the fresh and 2 of the spoilt tomatoes, Bacillus sp. (3%)
10
was found in 2 of the fresh tomatoes. Shigella sp., Proteus
aeruginosa, Proteus mirabilis, and Citrobacter koseri were not 0
AMP AMK COT CRX CHL CTR CTX CIP GEN TET
isolated from any of the fresh tomatoes but were found in 2
Antibiotics
of the spoilt ones, respectively. Finally, the one with the least
occurrence was Klebsiella pneumoniae which was found in Figure 2: Percentage distribution of resistance pattern of bacteria
only one of the spoilt tomatoes. isolated from tomatoes. AMP=Ampicillin, AMK=Amikacin,
COT=Cotrimoxazole, CRX=Cefuroxime, CHL=Chloramphenicol,
3.3. Antibiogram. The resistance levels of ten tested antibi- CTR=Ceftriaxone, CTX=Cefotaxime, CIP=Ciprofloxacin,
GEN=Gentamicin, and TET=Tetracycline.
otics for all the bacterial isolates are presented in Figure 2. The
results for the different bacterial species have been combined
to enable comparison. Resistance to ampicillin, amikacin,
cotrimoxazole, cefuroxime, chloramphenicol, ceftriaxone, different sellers in selected central markets (Agbogbloshie,
cefotaxime, ciprofloxacin, meropenem, and tetracycline was Kaneshie, and Makola markets) in Accra, Ghana. In contrast
found in all grades of tomatoes. to Kaneshie (34.78%) and Makola (21.74%) markets, Agbog-
In total, resistance to ampicillin (63.6%), cefuroxime bloshie (43.48%) recorded the highest level of contamination.
(59.1%), and tetracycline (60.1%) was found to be the highest This suggests that Agbogbloshie market is not as hygienic as
(Figure 2). However, a slightly lower prevalence was found compared to Makola and Kaneshie markets. The presence of
for cefotaxime, (34.8%) and ampicillin (37.9%), ceftriax- bacteria in the fresh tomatoes bought from these markets
one (28.8%), chloramphenicol (24.2%), and cotrimoxazole may be because they were improperly handled during the
(13.6%). Whilst a very low resistance level was found for sellers’ attempts to arrange them for sales [21]. The varying
gentamicin (6.1%) and amikacin (1.5%), none of the isolates differences in contamination from the three markets could
was resistant to ciprofloxacin. also be as a result of differences in the sources of farm
Furthermore, most of the Citrobacter sp., Klebsiella sp., products or wholesale points where the market sellers bought
and Enterobacter sp. were multiresistant to ampicillin, tetra- their tomatoes from [22].
cycline, or cefotaxime (Table 3). However, a few Enterobacter In this study, Klebsiella sp. (34.8%) was the prevalent
sp. (2 isolates), Citrobacter Koseri (1 isolate), and Klebsiella sp. bacteria isolated from both spoilt tomatoes (19.7%) and fresh
(1 isolate) were resistant to more than five different antibiotics. tomatoes (15.2%). This is in contrast to Ugwu et al.’s [16] study
in Nigeria which reported isolation rate of 8.9% in only spoilt
4. Discussion tomatoes and Wogu and Ofuase [16] study from Benin City,
Nigeria, with a total isolation rate of 1.6% for Klebsiella sp.
The present study reports for the first time varying prevalence Whilst in Spain, Falomir et al. [23] have isolated Klebsiella
of resistant bacteria in sampled tomatoes purchased from the pneumoniae and Klebsiella oxytoca in their work on fresh
Table 3: Distribution of Multidrug resistant (MDR) bacteria isolates in fresh and spoilt tomatoes.
Isolates (total no. isolated) No. of MDR isolates Resistant pattern % of MDR
Citrobacter species (5) 1 AMP-TET-CRX 40
1 AMP-CRX-CTD
2 AMP-TET-CRX-CTX
Citrobacter koseri (5) 1 TET-GEN-CRX-CHL-CTX 40
1 AMP-TET-COT-CRX-CHL-CTX
Enterobacter sp. (16) 1 CRX-CTR-CTX 25
1 AMP-CRX-CTR-CTX
1 AMP-TET-GEN-CRX-CTR-CTX
1 AMP-TET-COT-CRX-CHL-CTX
Enterobacter cloacae (3) 1 AMP-TET-CRX-CTX 33
Klebsiella sp. (10) 1 TET-CRX-CTR-CTX 40
1 AMP-CRX-CTR-CTX
1 AMP-TET-CRX-CHL-CTR-CTX
1 AMP-CRX-CTX
Klebsiella oxytoca (8) 1 AMP-TET-CRX 50
1 AMP-CRX-CTX
2 AMP-TET-CRX-CTX
Klebsiella pneumonia (1) 1 AMP-CRX-CTX 100
Proteus mirabilis (2) 1 AMP-CRX-CTR-CTX 50
TET= Tetracycline, COT= Cotrimoxazole, GEN= Gentamicin, CRX= Cefuroxime, CHL= Chloramphenicol, CTX= Cefotaxime, CTR= Ceftriaxone, MEM=
Meropenem, AMK= Amikacin, CIP= Ciprofloxacin, and AMP= Ampicillin.
vegetables; the varying prevalence of Klebsiella isolates in than 59.1% reported by Wogu and Ofuase [14] in previous
the different countries could be because of varying human study on tomatoes in Benin City, Nigeria. The difference
activities associated with postharvest practices before the in prevalences may be associated with varying incidence
tomatoes are displayed for sale in the different countries. In of Bacillus sp. spores in the environment [30]. In addition,
addition, Klebsiella sp. are ubiquitous organisms that can be Bacillus sp. are resistant to killing by high temperatures of
found in the environment, animals, and humans [24, 25]. the sun’s ultraviolet rays because of the endospores, hence
The bacteria could have gained access to the tomatoes during their bacterial load in the tomatoes. In this study, Proteus
postharvest period involving poor transportation and storage mirabilis isolated confirms with a previous work done by
facilities on the field with stomata that have openings, cracks, Garg et al. [14] in India with tomatoes. Proteus mirabilis is
or surface injuries as reported by Lemma et al. [6]. an opportunistic pathogen in the normal intestinal flora and
In this study, prevalence for Enterobacter sp. (24.2%) they may be associated with community-acquired infection
was found to be slightly higher than the 21.4% reported by [31]. It is widely distributed in contaminated soil and water
Adebayo-Tayo et al. [26], in Uyo Metropolis, Nigeria. Their in the natural environment and can easily find its way into
presence in tomatoes may be due to handling practices by foodstuffs which are not well handled.
the vendors [27]. The high incidence of Klebsiella sp. and The presence of Shigella sp. (3.0%) in only the spoilt
Enterobacter sp. is an indication of human contact, since tomatoes is an indication that the tomatoes may have been
improper handling of tomatoes during market days may have exposed to faecal-contaminated water or manure during
introduced these organisms into the tomatoes [28]. cultivation [32]. Shigella sp. isolated in this study is in contrast
The presence of Enterobacter sp., Citrobacter sp., Proteus to Adebayo-Tayo et al.’s [26] study in Uyo Metropolis, Nigeria,
mirabilis, and Bacillus sp. in this study is in conformity with which reported no Shigella sp. Shigella sp. can contaminate
Ogundipe et al. [15], which isolated similar bacteria with tomatoes when they are exposed to faecal-contaminated
percentages of 12.5%, 2.5%, 2.5%, and 20.0%, respectively, water or improper hygiene prior to handling of the tomatoes
from tomatoes in Lagos State, Nigeria. However, Citrobacter [33].
sp. was found to be 7.6% in this study which is lower than Furthermore, most of the isolates were susceptible to
the 30% reported by Mahamud et al. [29], in Northern gentamicin (93.9%) and amikacin (98.5%), but none of the
Nigeria on tomatoes. Citrobacter sp. and Citrobacter koseri isolates expressed resistance to ciprofloxacin. However, high
are often present in soils, water, or wastewater and can cause resistance was observed for ampicillin (63.1%), tetracycline
infections in the urinary tract and sepsis in humans. Their (60.1%), and cefuroxime (59.1%). The varying antibiotic
presence in the tomatoes could have been introduced from prevalence has been previously reported by Wogu and
the soil in which the tomatoes were planted or as a result of Ofuase [14] in a previous study on tomatoes in Benin City,
irrigation with contaminated wastewater. The percentage of Nigeria. The difference in resistance may be associated with
Bacillus sp. isolated in this study was 3.0%, which is lower varying functional groups of antibiotics and bacterial species.
The presence of bacteria with antibiotic resistance associated performed the experiments, Michael Olu-Taiwo contributed
with tomatoes sampled in this study highlights the potential reagents/materials/analysis tools, and F. Patrick Ayeh-Kumi
risk of tomatoes to consumers. conceived the study and participated in its design and
coordination.
5. Conclusion
References
The different bacterial species identified in this study suggest
that bacteria contamination on tomatoes can be a potential [1] G. N. Agrios, Plant Pathology, Academic press, New York, NY,
risk to consumers. Such contamination can lead to food USA, 4th edition, 2005.
poisoning and food-borne illnesses. As a result, efforts should [2] A. M. Valadez, K. R. Schneider, and M. D. Danyluk, “Outbreaks
be made by consumers to discourage purchasing spoilt of foodborne disease associated with tomatoes,” Tech. Rep.
tomatoes from local markets in Accra as they can predispose FSHN 12-08, 2012, http://edis.ifas.ufl.edu/fs192.
vendors and the general public to infection. [3] K. L. Bradley, Horticultural News & Research Journal, The
University of Arizona Press, 2003.
[4] B. B. Freeman and K. Reimers, “Tomato consumption and
6. Recommendations health: emerging benefits,” American Journal of Lifestyle
Medicine, vol. 5, no. 2, pp. 182–191, 2011.
To prevent any outbreak of diseases, tomatoes should be
thoroughly washed with clean water and disinfected before [5] . Mariga I. K., “Nutritional assessment of a traditional local
vegetable (Brassica oleracea var. acephala),” Journal of Medicinal
use or properly cooked before consumption.
Plants Research, vol. 6, no. 5, 2012.
If possible, consumption of raw or partially cooked
[6] Z. Lemma, W. Dawit, M. Negari, A. Chaka, T. Selvaraj, and G.
tomatoes in the form of sandwich or salads should be avoided,
Gebresenbet, “Identification of post-harvest rotting microor-
since it can predispose consumers to bacterial infections. ganisms from tomato fruits (Solanum esculentum Mill.) in Toke
The environment in which the tomatoes are sold should Kutaye District of West Shoa Zone, Ethiopia,” Journal of Stored
also be kept clean since most of the bacteria isolated are Products and Postharvest Research, vol. 5, no. 3, pp. 14–19, 2014.
associated with dirty environment. Tomato farmers as well as [7] C. B. Behravesh, D. Blaney, C. Medus et al., “Multistate outbreak
other vegetable farmers should be advised to avoid the use of of Salmonella serotype Typhimurium infections associated with
contaminated wastewater for irrigation during cultivation. consumption of restaurant tomatoes, USA, 2006: Hypothesis
generation through case exposures in multiple restaurant clus-
ters,” Epidemiology and Infection, vol. 140, no. 11, pp. 2053–2061,
7. Limitations 2012.
The current study had certain limitations; only a few tomatoes [8] B. J. Akinyele and C. O. Akinkunmi, “Fungi associated with the
were sampled due to poor cooperation of vendors and some spoilage of berry and their reaction to electromagnetic field,”
farmers (when approached). The results of this study cannot Journal of Yeast and Fungal Research, vol. 3, no. 4, pp. 49–57,
2012.
be generalized to all tomatoes sold in Ghana as variations in
seasons, handling, harvesting, and postharvesting practices [9] M. Barth, T. R. Hankinson, H. Zhuang, and F. Breidt, “Microbi-
ological spoilage of fruits and vegetables,” in Compendium of the
are different in many regions in Ghana. Other limitations
Microbiological Spoilage of Foods and Beverages, Springer, New
include lack of baseline data on handling practices of vendors
York, NY, USA, 2009.
and farmers and as a result it is impossible to determine the
[10] A. K. Yeboah, A survey on postharvest handling, preservation
source of the microorganisms detected in this study. A larger
and processing methods of tomato (Solanum lycopersicum) in
survey that will incorporate farms, farmers, and vendors to the Dormaa and Tano South Districts of the Brong Ahafo Region
determine the sources of contamination and other variables of Ghana. [Doctoral dissertation], 2011, http://ir.knust.edu.gh/
is planned pending appropriate funding. xmlui/handle/123456789/2079.
[11] R. A. Baiyewu, N. A. Amusa, O. A. Ayoola, and O. O. Babalola,
Data Availability “Survey of the postharvest diseases and aflatoxin contamination
of marketed pawpaw fruit (Carica papaya L) in South Western
The datasets used and/or analysed during the current study Nigeria,” African Journal of Agricultural Research, vol. 2, no. 4,
are available from the corresponding author upon reasonable pp. 178–181, 2007.
request. [12] A. Ajayi, “Nature of Tomatoes Microflora under Storage,”
American Journal of Experimental Agriculture, vol. 3, no. 1, pp.
89–101, 2013.
Conflicts of Interest [13] R. K. Garg, N. Batav, N. Silawat, and R. K. Singh, “Isolation
and identification of pathogenic microbes from tomato puree
and their delineation of distinctness by molecular techniques,”
regarding the publication of this paper. Journal of Applied Biology & Biotechnology, vol. 1, no. 4, pp. 24–
31, 2013.
Authors’ Contributions [14] M. D. Wogu and O. Ofuase, “Microorganisms responsible for
the spoilage of tomato fruits, Lycopersicum esculentum, sold in
Forson Akua Obeng conceived and designed the experi- markets in Benin City, Southern Nigeria,” School of Academics
ments and draft of the manuscript, Pokuaa Belinda Gyasi and Journal of Biosciences, vol. 2, no. 7, pp. 459–466, 2014.
[15] F. Ogundipe, F. Bamidele, A. Adebayo-Oyetoro, O. Ogundipe, [31] E. Frenod, “Existence result for a model of Proteus mirabilis
and O. Tajudeen, “Incidence of Bacteria with Potential Public swarm,” Differential and Integral Equations, vol. 19, no. 6, pp.
Health Implications in Raw Lycopersicon esculentum (Tomato) 697–720, 2006.
Sold in Lagos State, Nigeria,” Nigerian Food Journal, vol. 30, no. [32] E. C. Chuku, D. N. Ogbonna, B. A. Onuegbu, and M. T. V.
2, pp. 106–113, 2012. Adeleke, “Comparative studies on the fungi and bio-chemical
[16] O. C. Ugwu, F. O. Chukwuezi, and V. E. O. Ozougwu, “Microbial characteristics of snake gourd (Trichosanthes curcumerina
Agents of Tomato Spoilage in Onitsha Metropolis,” Advance in Linn) and tomato (Lycopersicon esculentus Mill) in Rivers
Biology Research, vol. 8, no. 2, pp. 87–93, 2014. State, Nigeria,” Journal of Applied Sciences, vol. 8, no. 1, pp. 168–
[17] M. Cheesbrough, District Laboratory Practice in Tropical Coun- 172, 2008.
tries, University of Cambridge, Cambridge, UK, 2nd edition, [33] F. Rahman and R. Noor, “Prevalence of pathogenic bacteria
2005. in common salad vegetables of Dhaka metropolis,” Bangladesh
[18] CLSI, Performance Stardards for Antimicrobial Disk Diffusion Journal of Botany, vol. 41, no. 2, pp. 159–162, 2012.
Tests. Approved Stardard, CLSI documents MO2, Clinical and
Laboratory Stardards Institutes, Wayne, PA, USA, 12th edition,
2015.
[19] B. VE and A. C, “Antibiotic Practices and Factors Influencing
the Use of Antibiotics in Selected Poultry Farms in Ghana,”
Journal of Antimicrobial Agents, vol. 2, no. 2, 2016.
[20] EUCAST, European Society of Clinical Microbiology and Infec-
tious Diseases) Break points for Enterobacteriaceae, 2016, http://
www.eucast.org/eucast news/news singleview/?tx ttnews%
5Btt news%5D=202&cHash=293d9a5275c1647c230f7cc7-
3a28a56f.
[21] L. R. Beuchat, “Vectors and conditions for preharvest con-
tamination of fruits and vegetables with pathogens capable of
causing enteric diseases,” British Food Journal, vol. 108, no. 1, pp.
38–53, 2006.
[22] J. W. Buck, R. R. Walcott, and L. R. Beuchat, “Recent Trends in
Microbiological Safety of Fruits and Vegetables,” Plant Health
Progress, vol. 4, no. 1, p. 25, 2003.
[23] MP. Falomir, D. Gozalbo, and H. Rico, “Coliform bacteria
in fresh vegetables: from cultivated lands to consumers,” in
Current Research, Technology and Education Topics in Applied
Microbiology and Microbial Biotechnology, pp. 175–1181, 2, 175-
1181, 2010.
[24] S. Brisse, F. Grimont, and P. A. Grimont, “The genus Klebsiella,”
in The Prokaryotes, 196, p. 159, Springer, New York, NY, USA,
2006.
[25] D. C. Pigott, “Foodborne Illness,” Emergency Medicine Clinics of
North America, vol. 26, no. 2, pp. 475–497, 2008.
[26] B. C. Adebayo-Tayo, N. N. Odu, C. U. Esen, and I. O. Okonko,
“Microorganisms associated with spoilage of stored vegetables
in Uyo metropolis, AkwaIbom state, Nigeria,” Nature and
Science, vol. 10, no. 8, 2012.
[27] A. Adeleke, “Public health risks associated with apples and
carrots sold in major markets in Osogbo, Southwest Nigeria,”
Journal of Toxicology and Environmental Health Sciences, vol. 4,
no. 8, pp. 140–144, 2012.
[28] E. Etebu, A. B. Nwauzoma, and D. D. S. Bawo, “Postharvest
spoilage of tomato (Lycopersiconesculentum Mill.) and control
strategies in Nigeria,” Journal of Biology, Agriculture and Health-
care, vol. 3, no. 10, pp. 51–61, 2013.
[29] F. M. Mahamud, D. B. Dangora, S. Mu’azu, A. U. Khan, S. Nura,
and Z. A. Gaiya, “Bio-chemical characterization of bacterial
flora associated with spoilt vegetables in kaduna markets North-
ern Nigeria,” Advances in Biological Chemistry, vol. 03, no. 01, pp.
141–145, 2013.
[30] K. O. Obieze, C. N. Obuagu, B. E. Asikong, A. E. Onyido, and B.
A. Ogolo, “Bacteriological study of vegetables from markets of
Calabar Cross-River State South Eastern Nigeria,” The Internet
Journal of Public Health, vol. 1, no. 2, 2011.
Hindawi
https://doi.org/10.1155/2018/8490614
Research Article
Survival of Coliform Bacteria in Virgin Olive Oil
Biagi Angelo Zullo, Lucia Maiuro, and Gino Ciafardini

Department of Agricultural, Environmental and Food Sciences, University of Molise, Via De Sanctis, 86100 Campobasso, Italy
Correspondence should be addressed to Gino Ciafardini; ciafardi@unimol.it
Received 5 July 2018; Accepted 1 November 2018; Published 27 November 2018
Copyright © 2018 Biagi Angelo Zullo et al. This is an open access article distributed under the Creative Commons Attribution
cited.
Coliform bacteria consist of both nonpathogen commensal and human opportunistic pathogen species isolated from different
habitats like animals, man, vegetables, and water. Olives normally carry natural nonpathogenic epiphytic bacteria, but during
growth, harvest, and processing, one of the final products, represented by virgin olive oil, can be contaminated with coliform.
Present study showed that coliform bacteria can survive and reproduce in virgin olive oil containing low level of phenolic
compounds. The laboratory inoculation trials demonstrated that when the bacterium Escherichia coli, isolated from the olives
carposphere, was transferred in olive oil containing high polar phenols content, equal to 372 mg caffeic acid equivalent per kg, the
survival was completely inhibited after 15 days of storage. On the contrary, the bacterium reproduced quickly when it was inoculated
in virgin olive oil samples containing lower concentration of polar phenols. The SDS-PAGE analysis of the E. coli proteins showed
different electrophoretic patterns when the bacterium was inoculated in the virgin olive oil with high phenolic compounds content,
confirming the strong interaction between the olive oil phenols content and the bacterial wall proteins. The SEM ultrastructural
observations confirmed the presence of a more higher number of damaged microbial cells in virgin olive oil rich of polar phenols.
This finding needs further studies since, in an era of antibiotic resistance, the development of new strategies to fight unwanted food
bacteria is promising way for the future.
1. Introduction in the newly produced olive oil during its storage. Olives
normally carry natural nonpathogenic epiphytic bacteria,
Olive oil is one of the basic components of the Mediterranean but, during growth, harvest, transportation, and further
diet which can also be found in other geographical areas processing in the mills, they can be contaminated with
where it is known for its high dietetic and nutritional pathogens from animal and human sources. Contamination
value and its varied sensory characteristics. The presence can arise through treating soil with organic fertilizers, such
of microorganisms in olive oil has been demonstrated in as sewage sludge, manure, and from irrigation water, as well
recent research carried out mainly on the survival of some as from pathogens which are able to persist and proliferate
species of yeast [1]. However, our current knowledge of the in vegetables [2, 3]. The coliform bacteria may represent
process that regulates the settlement of microorganisms in a risk factor for consumer health and therefore a food
extra virgin olive oil is rather limited. In fact, it is well safety problem, since some species are considered human
known that microorganisms persist for long periods in the pathogenic opportunists [4]. Coliform bacteria consist of
olives’ carposphere, both during the phase of development both nonpathogen commensal and pathogen species. Many
and during the ripening of the fruit attached to the plant. studies demonstrate that phenolic compounds, such as those
This occurs both in the later stages, when the fruits are widely present in virgin olive oil, have a marked biocide effect
processed as table olives or when they are ready for oil on the human opportunistic pathogen yeast species as well
extraction in the mills. Currently, we do not know if the as on bacteria [5, 6]. Medina et al. showed that, contrary
bacterial fraction of the microbiota of the olives, represented to virgin olive oil, sunflower oil and corn oil where the
by the Enterobacteriaceae family, like the coliform bacteria, polyphenols are absent did not show any antimicrobial activ-
is destroyed during the extraction process in the oil mill or ity [7]. In a similar study, extra virgin olive oil from several
Turkish regions, characterized by a total polyphenol content during the extraction process of the Lavagnina, Leccino, and
of between 159.99 and 189.64 mg per kg, showed antibacterial Taggiasca olive varieties. Samples of olive washing water,
activity against Escherichia coli, whereas refined olive oil with kneaded paste, and the extracted olive oil were analyzed
a low phenolic content did not cause any significant effect [8]. microbiologically following the methods of Ciafardini et
These findings demonstrated that the antibacterial effect of al. [12]. The yeasts and molds were evaluated using Petri
phenolic compounds is highly correlated with the content of dishes with MYGP agar medium containing: 3 g yeast extract
total polyphenols found in each type of olive oil. However, (Biolife, Milan, Italy), 3 g malt extract (BBL, Cockeysville,
the limit of the concentration below which the antibacterial MD, USA), 2.5 g soy peptone (Biolife), 2.5 g bacto tryptone
effect of the olive oil polyphenols disappears is unknown. In (BBL), 10 g D-glucose (Merck, Darmstadt, Germany), 1000
general, the level of the total polyphenols in virgin or refined mL distilled water, and pH 7 as described by Kurtzman
olive oil can vary from 0 to 800 mg per kg or more; usually and Fell [14]. This medium was supplemented with sodium
in virgin olive oil the range is between 100 and 400 mg of propionate (2 g/L) and tetracycline (20 mg/L) in order to
caffeic acid equivalent per kg. Olive oil is categorized as being inhibit growth of molds and bacteria respectively. 200 𝜇L of
low, medium, and high in polyphenols when their level is
the above decimal dilution was plated in triplicate, onto Petri
less than 100, between 100 and 300 and more than 300 mg
dishes with the medium using the spread plating techniques.
of caffeic acid equivalent per kg, respectively. Considering
The total yeasts colony form units (CFU) were counted after
that the current knowledge on the survival of the coliform
5 days of incubation at 30∘ C whereas the total molds CFU
bacteria in the oil mills during the extraction process as well
as in the olive oil characterized by a low or medium level of were evaluated after 7 days of incubation at 28∘ C. The total
polyphenols content is very scarce, the phenols-poorly olive coliform bacteria CFU were evaluated on Violet Red Bile
oils of low quality are deemed safe for human consumption Agar (VRBA, cod. CM0107 Thermo Fisher Diagnostics, MI,
only by analogy with those of good quality [9]. On the basis of Italy). The medium was inoculated with 200 𝜇L of the decimal
the above considerations, we studied the presence of coliform dilution, then the Petri dishes were incubated 16 h under
bacteria in the oil mills during the extraction process as well aerobic conditions at 37∘ C and the CFU were recorded from
as the survival of E. coli artificially inoculated in to virgin olive all samples [15].
oil with different total polar phenols content.
2.3. E. coli Isolation. A series of single colonies from all the
analyzed samples that appear purple on the VRBA medium
2. Materials and Methods were isolated for E. coli identification according to the Euro-
pean Commission Regulation UNI EN ISO 9308 [16] and
2.1. Sampling through the Olive Oil Extraction Process. The
tested separately for Gram stain, cytochrome oxidase activity,
trials were carried out using olives, paste, and olive oil,
and indole production. Moreover, the selected single colonies
produced in three oil mills located, respectively, in three
were transplanted into the Tryptic Soy Agar medium (Sigma-
different areas of Northern Italy (Liguria region) during the
Aldrich cod. 22091) containing 15 g casein peptone, 5 g soya
2015 olive oil yield production. The olives of the Lavagnina,
peptone, 5 g NaCl, 20 g agar, 1000 mL distilled water, and
Leccino, and Taggiasca variety, produced and processed,
pH 7. After 24 h of incubation at 36∘ C, the bacterial cultures
respectively in each areas of the Liguria region, were collected
were used for the cytochrome oxidase test. The enzymatic
at the beginning of the ripening period as aforementioned by
reaction was assessed after transferring the bacterial cultures
Ciafardini and Zullo [10, 11]. The fruits were processed under
onto the Petri dish on some pieces of paper filters that
typical conditions following the methods of Ciafardini et al.
had been moistened with an aqueous solution containing
[12]. In detail, during the extraction process, two samples of
1% (w/w) of N, N, N󸀠 , N󸀠 -tetramethyl-p-phenylenediamine
wash water, kneaded paste and olive oil, were taken, respec-
dihydrochloride (Sigma-Aldrich cod. 87890). The appearance
tively, from each mill and olive variety, using 1 L sterile-plastic
or not of the blue color on the filter paper was recorded
containers. Half of the samples were immediately subjected
after 5 min of incubation at room temperature. The indole
to a microbiological analysis, while the remaining samples
production was evaluated after having transferred part of
were stored at -20∘ C and subsequently used for chemical
the bacterial cultures in test tubes equipped with a screw
analysis. The olive oil routine chemical analyses were assessed
cap containing 10 mL of Tryptophan Culture Broth (Sigma-
according to the European Commission Regulation 640/2008
Aldrich cod. 09136) with the following composition: 10 g
of the European Community [13]. The total polar phenols
casein enzymatic hydrolysate, 5 g NaCl, 1 g DL-tryptophan,
were extracted three times from kneaded paste or olive
1000 mL distilled water, and pH 7.5. After 24 h of incubation
oil with a methanol:water (60:40, v/v) mixture. The Folin-
at 43∘ C, 0.5 mL of the Kovac’s reactive (4-dimethylamino-
Ciocalteu’s phenol reagent (Merck) was added to a suitable
benzaldehyde solution, Sigma-Aldrich cod. 3381) was added
aliquot of the combined extracts and the absorbance of the
to each test tube. The positive reaction occurred after 5
solution at 765 nm was evaluated after 1 h of incubation using
min of incubation at 43∘ C with the appearance of a red
a Jenway 6300 spectrophotometer (UK). Values are given as
color on the top of the substrate. The commensal E. coli
mg of caffeic acid per kg of oil.
ATCC 25922 was used as a positive denominator, while as
a negative Enterococcus faecalis ATCC 19433 was used. The
2.2. The Microbiological Analysis. The microbiological analy- selected cultures of commensal E. coli cytochrome oxidase-
sis was carried out on the products obtained in the oil mills negative and indole-positive were confirmed with the API
20E (bioMérieux, France) test and the PCR as reported for the complete elimination of the oily residues. The bacterial
by Omar et al. [17]. Then three E. coli cultures isolated, biomasses prepared separately from each type of inoculated
respectively, from the wash water of each olive variety were olive oil sample as well as the bacterium used originally as
used in the laboratory inoculation trials described below. inoculum were used for the electrophoretic analysis. The
crude bacterial extract was prepared from each inoculated
olive oil sample, using 2.5 mL of 0.5 M Tris HCl buffer, pH 6.7,
2.4. Laboratory Inoculation Trials. The inoculation trials
with 0.8 g of bacterial biomass. The proteins were extracted
were carried out in the laboratory in order to evaluate the
by breaking the cell walls with a Sonifier apparatus (Branson
survival of some olive-born coliform bacteria in olive oil
B 20 Sonifier). The power was 60 W and the cells were
characterized by a different total polar phenols’ content. The
submitted to a cycle of 5 s of sonication for a total period of
coliform bacteria used in this study were represented by three
15 min. At the end of each period of sonification a part of the
commensal E. coli strains that had been isolated as, afore-
bacterial crude extract was withdrawn, centrifuged at 10,000 g
mentioned, using the wash water samples from each olive
for 5 min and tested with the Biorad protein assay dye (Biorad
variety. The E. coli cultures were grown in 1 L flasks containing
Laboratories, Munich, Germany) with the aim of evaluating
VRB Broth, after 24 h of incubation at 37∘ C under aerobic
the amount of total proteins present in the liquid fraction.
conditions, the bacteria cells were separated by centrifugation
On average, the protein concentrations of the stocks of crude
at 5,000 g for 10 min using Hettich centrifuge, mod. Universal
bacterial extracts, used for the following experiments, varied
32 (Hettich Instrument, Tüttlengen, Germany) and then used
between 60.20 and 61.30 𝜇g of bovine albumin equivalent
for the inoculation trials. Virgin olive oil used in the trials
per mL. The analysis was performed using sodium dodecyl
came from the extraction process of the Taggiasca olives
sulphate polyacrylamide gel electrophoresis (SDS-PAGE)
collected at a different degree of ripeness which affected
according to Laemmli [18]. The analysis was accomplished
the polyphenols content of the oily fraction of the fruits.
with a PROTEAN II maxi cell (Biorad, Richmond, CA,
The trials were then carried out using three types of virgin
USA) suitable for 160x200 mm gels. The gels contained
olive oils characterized by a total polyphenols content equal,
12% polyacrylamide and the electrophoresis was run with
respectively, to 28, 110, and 372 mg of caffeic acid equivalent
constant current as suggested by the manufacturer. The SDS-
per kg of product. The samples of olive oil with the different
PAGE gels were stained with Coomassie Brilliant Blue R-250
total polyphenols content were sterilized through microfil-
(Sigma-Aldrich, Milan, Italy). The low-weight calibration Kit
tration with a nitrocellulose filter with a porosity of 0.45 𝜇m
from Pharmacia LKB-Biotechnology (Piscataway, NJ, USA)
(Minisart NML-Sartorius, Göttingen, Germany), and a mass
was used as a standard molecular mass.
equal to 2,000 mL was transferred into sterile empty Pyrex
flasks and inoculated with 2 g of E. coli biomass with 40%
humidity, suspended in 20 mL of sterile olive oil reaching 2.6. SEM Observation. The SEM observations were carried
a final concentration equal to 0.1% (w/v). The inoculated E. out using the bacterial cells recovered from the inoculated
coli biomass was prepared by collecting, in equal proportions, olive oil samples characterized by 28, 110, and 372 mg per
the biomass of the aforementioned E. coli strains isolated, kg of total polyphenols as reported in the trials described
respectively, from the wash water of the Lavagnina, Taggiasca, above. Volumes of the inoculated olive oils equal to 10 mL
and Leccino olive variety. After 1 min of agitation with a were taken after 30 days of incubation and were filtered using
vortex, all the inoculated olive oil samples were stored in a a nitrocellulose membrane filter with a porosity of 0.45 𝜇m.
dark place at room temperature for 30 days. The trials were The filters with the E. coli bacteria were then cut into several
accomplished using uninoculated olive oil samples (control) pieces, suspended in 10 mL of sterile physiological solution
and three repetitions. The survival of the E. coli inoculated in with 0.9% NaCl, and mixed slowly with a mixer for 5 min. The
the virgin olive oil samples with different total polyphenols bacteria suspended in the liquid fraction were then collected
content was assessed by the microbiological analysis of 10 mL by centrifugation at 7,000 g for 5 min. The biomasses were
of oil samples, taken after every 5 days, during the storage fixed in 1 mL of 3% glutaraldehyde (v/v) in 0.1M phosphate
time, using the same procedure as described above. At the buffer, pH 7.2 for 12 h. The samples were rinsed in the
end of the storage time, the E. coli cells were recovered from same buffer three times and then dehydrated (twice for each
the residual inoculated virgin olive oil samples and used for solution) in a graded ethanol series (20, 40, 60, 80, 95, and
the ultrastructural cells observation and the bacterial protein 100%) for 10 min each with a final wash in acetone for a
assay as described below. better CO2 substitution during the dehydration procedure,
at a pressure of 1200 bars. Subsequently, all samples were
dried in a CO2 critical point dry (Emitech K850) and then
2.5. Polyphenols’ Interaction with the Bacterial Protein. The
covered with palladium gold in Emitech K550 before SEM
polyphenols’ interaction with the bacterial proteins was stud-
observation.
ied by analyzing the protein extracted from E. coli which had
been stored for 1 month in virgin olive oil samples containing,
respectively, 28 and 372 mg of caffeic acid equivalent per 2.7. Statistical Analysis. A priori one-way analysis of variance,
kg. The bacterial cells were separated by the oily fraction using Tukey’s honest significant differences test, was per-
through the centrifugation at 7,000 g for 15 min and then formed using a statgraphics computer program (Statgraphics,
suspended in 10 mL of 0.1M phosphate buffer, pH 7.2, agitated version 6, Manugistics, Inc., Rockville, MA), and any values
vigorously for 1 min and finally centrifuged as before, to allow which were different at p < 0.01 were recorded.
3. Results and Discussion 8
Survival of Escherichia coli in olive oil

7
The microbiological analysis of the wash water, kneaded
paste, and the extra virgin olive oil produced by three olive 6
varieties showed the presence of yeasts and molds in all the
(Log CFU/mL)
5
analyzed samples, whereas coliform bacteria were found in
the wash water produced, respectively, by the Lavagnina, 4
Taggiasca, and Leccino variety, but were absent in the 3
kneaded paste and the olive oil extracted by the same olive
varieties. On the other hand, in all the wash water samples, 2
the number of coliform bacteria CFU per mL was much 1
higher compared to those of the yeasts and molds, while
0
no significant differences were observed between the CFU
0 5 10 15 20 25 30
number of the yeasts and molds detected in the samples
Incubation time (days)
of three olive varieties analyzed (Table 1). The total polar
phenols content of the extracted extra virgin olive oil varied Figure 1: Survival of E. coli inoculated in extra virgin olive oil
between 205 and 250 mg caffeic acid equivalent per kg, containing 28 (Q), 110 (◼), and 372 (󳵳) mg of total polar phenols
according to the olive variety, while the total polar phenols per kg of product.
content of the kneaded paste, in turn, varied from 1,200
to 1,800 mg caffeic acid equivalent per kg (Table 1). The
study of the distribution of coliform bacteria from the olives’
carposphere in different substrates produced in the mills storage. In turn, in the olive oil samples with 110 mg of caffeic
during the oil extraction process indicated, for the first time, acid equivalent per kg, the number of the E. coli living cells
that the kneaded paste exerts a strong selective pressure remained constant in the first 15 days of incubation and then
on the survival of the coliform bacteria originating from gradually shrank to 1.5 Log at the end of storage. However,
the fruits. Moreover, the results reported in Table 1 show from Figure 1 it is possible to note that E. coli can grow in
yeasts, molds, and a large number of coliform bacteria from the polyphenol-poorly olive oil. In fact, when the bacterium
the carposphere of the fruits to be present in wash water was inoculated in the olive oil with low polar phenols content,
where the polar phenols were absent, while in the subsequent equal to 28 mg caffeic acid equivalent per kg, the number of
products containing polar phenols like the kneaded paste the E. coli CFU per mL increased three times during the first
and the extracted olive oil, it is still possible to note the 15 days of incubation, reaching more than 6 Log CFU per mL
presence of a significant number of yeasts and molds but after 1 month of incubation. These results indicate that not all
not of coliform bacteria. This behaviour observed for all the oils classified as virgin olive oil or refined olive oil had similar
varieties of olives studied can be attributed to the different bactericidal effects and are considered unsuitable for the
phenolic compounds content of the oil mill products that, survival of coliform bacteria, since their bioactivity depends
among other cause, interfere with the viability of the different on the concentration of the total polar phenols as well as
microorganisms. Novelty of these results is important not the profile of the phenolic compounds. The edible phenolic-
only from a technological point of view, since, as known, the poor olive oils are represented by refined olive oils, where
malaxation affects the chemical composition and sensorial these compounds are lost during the chemical treatments
characteristics of the product [19, 20], but mainly in terms of the product as well as some virgin olive oils [21]. Several
of hygiene. In fact, the malaxation of the paste in the mills studies have shown that the concentration of the total polar
rich of phenolic compounds (Table 1) represents a process phenols of virgin olive oil varies with cultivars, ripeness,
where the natural sanitization of the product occurs through climate conditions, irrigation, and extraction process [10, 22–
the reduction or complete destruction of the viable coliform 24]. The experiments carried out with the E. coli stored in
bacteria from the fruits and other sources. On the contrary, virgin olive oil containing different total polyphenols content
a very different behaviour has been recorded in the newly demonstrated that the phenolic compounds when they are
produced olive oil. In fact, the survival of the bacterium E. coli present in sufficient concentrations are able to react with
artificially inoculated in virgin sterile olive oil, characterized the proteins of the bacterium. In fact, the total proteins
by an increasing content of phenolic compounds, varied extracted from E. coli stored for 1 month in olive oil with 372
according to the phenolic concentration (Table 2). The olive mg caffeic acid equivalent per kg distinguished themselves
oil polar phenols inhibited the survival of the bacterium when from those extracted from the same bacterium that was not
their concentration was greater than 110 mg of caffeic acid suspended in olive oil (control) as well as those stored in
equivalent per kg of product, whereas below this value no virgin olive oil with low level of polar phenols equal to 28
inhibitory effect was detected (Figure 1). In detail, when the mg caffeic acid equivalent per kg, by type of electrophoretic
bacterium E. coli was inoculated in the olive oil characterized pattern including between 45 and 114 kDa weight obtained
by a high polar phenols content, equal to 372 mg caffeic with the SDS-PAGE analysis (Figure 2). Research carried out
acid equivalent per kg of product, the CFU per mL of oil until now on other species of bacteria has shown that the
decreased drastically already during the first few days of phenolic compounds of olives bond tightly to the cell wall
incubation, while they were completely absent after 15 days of thus damaging them [25]; nevertheless it is as yet unknown
Table 1: Chemical and microbiological analysis of different substrates from oil mills during the olive oil extraction process of three varieties.
Wash water Kneaded paste Olive oil
Olive variety ∗ Coliforms∗∗ Coliforms Coliforms
Total phenols Yeasts Molds Total phenols Yeasts Molds Total phenols Yeasts Molds
bacteria bacteria bacteria
Lavagnina - 4.3 ± 0.4a 2.5 ± 0.3b 1.8 ± 0.1bc 1,200 ± 80 - 2.0 ± 0.2b 2.2 ± 0.1b 205 ± 10 - 1.5 ± 0.1c 1.2 ± 0.2c
Taggiasca - 4.5 ± 0.7a 2.7 ± 0.2bc 2.8 ±0.2bc 1,500 ± 120 - 3.3 ± 0.3b 2.2 ± 0.1c 230 ± 12 - 2.8 ± 0.3bc 2.0 ± 0.1c
Leccino - 6.0 ± 0.6a 2.5 ± 0.2b 0.8 ± 0.1c 1,800 ± 155 - 2.2 ± 0.1b 0.9 ± 0.08c 250 ± 14 - 1.6 ± 0.2bc 1.5 ±0.2bc
∗
mg caffeic acid equivalent/Kg (mean ± standard deviations, n = 6). ∗∗ Log UFC/g (mean ± standard deviation, n = 6): values in row having different letters are statistically different from one another at p < 0.01.
5
Table 2: Analytical indices of three types of olive oil from Taggiasca variety used in the laboratory inoculation trials.
Total phenols
Inoculated virgin Free fatty acid Peroxide value
(mg caffeic acid K232 K270 ΔK
olive oil type (% oleic acid) (meqO2 /kg)
equivalent/kg)
A 372 ± 12 0.30 ± 0.01 8.75 ± 0.07 1.705 ± 0.02 0.100 ± 0.009 -0.005 ± 0.001
B 110 ± 4.50 0.37 ± 0.02 10 ± 0.11 1.791 ± 0.03 0.110 ± 0.008 -0.004 ± 0.000
C 28 ± 2.80 0.45 ± 0.03 18 ± 0.73 1.845 ± 0.02 0.117 ± 0.005 -0.002 ± 0.000
Limit for the “extra
virgin” merceological ≤ 0.80 ≤ 20 ≤ 2.50 ≤ 0.22 ≤ 0.010
class
∗Mean ± standard deviation, 𝑛 = 3.
372 mg caffeic acid equivalent per kg, showed a generalized

kDa St 1 2 3 4 5 6 St kDa
series of slots, distributed over the entire cell wall of many
114 bacteria (Figure 5). On the basis of these results, it seems
106 94 that the damage observed on the cell wall ultrastructure
was more evident when the bacterial cells were inoculated
67 in olive oil samples characterized by a total polar phenols
content greater than 110 mg per kg (Figures 4 and 5). On
56 the contrary, the bacterial cells suspended in olive oil with
a low total phenol compounds content were not damaged
47
(Figure 3). Comparing the results of SDS-PAGE analysis
45 of the E. coli proteins reported in Figure 2 with the SEM
43
ultrastructural modifications (Figures 4 and 5), it is possible
to hypothesize that the above ultrastructural modifications
can be attributed to olive oil polar phenols that bind to
the cell wall components. Another research carried out so
far has demonstrated that the phenolic compounds react
30 permanently with the walls of the yeast Candida parapsilosis
according to their concentration in the inoculated olive oil
Figure 2: SDS-PAGE of protein crude extract from cells of E. coli [6]. In the bacteria, an SDS-PAGE analysis performed with
stored one month in olive oil with different phenolic compounds crude extract of Xanthomonas campestris have confirmed
concentration. 1, SDS-PAGE of total proteins from untreated E. coli that olive oil polyphenols are able to react with the bacterial
(control). 2, 3, SDS-PAGE of total proteins from E. coli stored in protein, producing a very strong protein-cross-linking and
olive oil samples with low total polar phenols concentration equal protein-denaturing effect [5]. However, the presence of some
to 28 mg caffeic acid equivalent per kg. 4, 5, 6, SDS- PAGE of total hydrolysed cells, shown in Figure 5, indicate that the olive oil
proteins from E. coli stored in olive oil samples with high polar phenolic compounds inhibited the survival of the bacterium
phenols content equal to 372 mg caffeic acid equivalent per kg. St, also through other mechanisms. In fact, the alterations of cell
molecular standard weigh (kDa). The arrows indicate the differences walls of E. coli observed with the SEM are compatible with
between the SDS-PAGE of protein from E. coli stored in olive oil
the oxidative stress caused by the accumulation of hydrogen
compared to the control.
peroxide and Reactive Oxygen Species (ROS) produced by
certain concentrations of olive oil phenolic compounds,
which can act as antioxidants or prooxidants depending
with which part of the bacterial cells the polyphenols of on the environmental conditions, interaction with metal,
olive oil react. In any case, the results recorded in Figure 2 structural changes, concentration, and exposure to microor-
help to clarify the mechanism of the antimicrobial action ganisms [26, 27]. Zanichelli et al. reported that the inhibition
carried out by the polyphenols as they have a strong protein- of Staphylococcus aureus by an olive oil phenolic compound
denaturing activity as shown by the SDS-PAGE analysis. SEM known as oleuropein is largely due to hydrogen peroxide [28],
observations confirmed the results of the electrophoretic while Taleb et al. demonstrated that the total polar phenols
analysis since no serious ultrastructural damage on the cell extracted from the Date syrup suppress the growth of E. coli
walls of E. coli stored in olive oil with 28 mg per kg of at a Minimum Inhibitory Concentration (MIC) of 30 mg per
total polar phenols were recorded (Figure 3). In turn, the mL and that hydrogen peroxide was produced at lethal but
bacterial cells suspended in the virgin olive oil with a total not sublethal concentrations of total polar phenols [29]. All
polar phenols concentration equal to 110 mg per kg of product these results highlight that the antibacterial activity of polar
showed single breakages which were often located at the phenols is mediated through hydrogen peroxide generation
centre of the cells (Figure 4), while the SEM ultrastructure of in inducing oxidative stress in bacteria as well as interaction
E. coli inoculated in the polar phenols-rich olive oil, equal to with bacterial proteins.
Figure 3: SEM observation of undamaged one-month E. coli cells Figure 5: SEM observation of damaged one-month E. coli cells
stored in olive oil with 28 mg of total phenolic compounds per kg stored in olive oil with 372 mg of total phenolic compounds per kg
(bar=4 𝜇m). (bar=4 𝜇m).
regulations, can be extracted only by mechanical processes

without any chemical treatments, it is possible to improve
the hygienic properties of the product by intervening on the
malaxation phase and on the phenolic content of the product.
On the basis of the results obtained by the trials, it is possible
to assert that the use of good quality edible virgin olive
oil, characterized by a sufficient total phenolic compounds
content, does not generally constitute a risk factor for the
health of consumers.
Data Availability
Figure 4: SEM observation of damaged one-month E. coli cells The original data used to support the findings of this study
stored in olive oil with 110 mg of total phenolic compounds per kg are available from the corresponding author upon request.
(bar=4 𝜇m).
4. Conclusion The authors declare that there are no conflicts of interest
regarding the publication of this paper.
Coliform bacteria consist of both nonpathogen commensal
and pathogen species widely in different habitats including
the carposphere of the olives processed in the mills. The References
contaminating coliform bacteria are destroyed in the oil mill
[1] G. Ciafardini and B. A. Zullo, “Microbiological activity in stored
during the malaxation process of the paste that is usually olive oil,” International Journal of Food Microbiology, vol. 75, no.
richer in phenolic compounds compared to the extracted 1-2, pp. 111–118, 2002.
olive oil. This technological process is important because
[2] A. J. Hamilton, F. Stagnitti, R. Premier, A.-M. Boland, and
it prevents the contamination of the newly produced olive G. Hale, “Quantitative microbial risk assessment models for
oil by the coliform bacteria originating from the fruits, the consumption of raw vegetables irrigated with reclaimed water,”
operators, or the mills. However, the newly extracted olive Applied and Environmental Microbiology, vol. 72, no. 5, pp.
oil can be contaminated later by the coliform bacteria, which 3284–3290, 2006.
can survive and reproduce in this habitat if the total phenolic [3] J. C. Heaton and K. Jones, “Microbial contamination of fruit
compounds content is too low. The results demonstrate that and vegetables and the behaviour of enteropathogens in the
olive oil polar phenols can prevent the survival of the E. phyllosphere: a review,” Journal of Applied Microbiology, vol.
coli present in the product after the extraction process, only 104, no. 3, pp. 613–626, 2008.
in the presence of sufficient concentrations, which in our [4] D. J. Brenner, G. R. Fanning, J. K. Leete knutson, A. G.
study was higher than 110 mg of caffeic acid equivalent per Steigerwalt, and M. I. Krichevsky, “Attempts to classify herbicola
kg. This finding needs further studies since in an era of group-Enterobacter agglomerans strains by deoxyribonucleic
antibiotic resistance, the development of new strategies to acid hybridization and phenotypic tests,” International Journal
fight unwanted food bacteria is promising way for the future. of Systematic Bacteriological, vol. 34, no. 1, pp. 45–55, 1984.
In fact, the novelty of these interesting findings lies in the fact [5] G. Ciafardini and B. A. Zullo, “Antimicrobial activity of oil-mill
that, for extra virgin olive oil, which, according to current waste water polyphenols on the phytopathogen Xanthomonas
campestris spp.,” Annals of Microbiology, vol. 53, no. 3, pp. 283– [22] L. Di Giovacchino, S. Sestili, and D. Di Vincenzo, “Influence of
290, 2003. olive processing on virgin olive oil quality,” European Journal
[6] G. Ciafardini, G. Cioccia, and B. A. Zullo, “Survival of Candida of Lipid Science and Technology, vol. 104, no. 9-10, pp. 587–601,
parapsilosis yeast in olive oil,” Annals of Microbiology, vol. 63, 2002.
no. 4, pp. 1645–1648, 2013. [23] M. Patumi, R. d’Andria, V. Marsilio, G. Fontanazza, G. Morelli,
[7] E. Medina, A. De Castro, C. Romero, and M. Brenes, “Compar- and B. Lanza, “Olive and olive oil quality after intensive
ison of the concentrations of phenolic compounds in olive oils monocone olive growing (Olea europaea L., cv. Kalamata) in
and other plant oils: Correlation with antimicrobial activity,” different irrigation regimes,” Food Chemistry, vol. 77, no. 1, pp.
Journal of Agricultural and Food Chemistry, vol. 54, no. 14, pp. 27–34, 2002.
4954–4961, 2006. [24] T. Gallina-Toschi, L. Cerretani, A. Bendini, M. Bonoli-
[8] H. Karaosmanoglu, F. Soyer, B. Ozen, and F. Tokatli, “Antimi- Carbognin, and G. Lercker, “Oxidative stability and phenolic
crobial and antioxidant activities of Turkish extra virgin olive content of virgin olive oil: An analytical approach by traditional
oils,” Journal of Agricultural and Food Chemistry, vol. 58, no. 14, and high resolution techniques,” Journal of Separation Science,
pp. 8238–8245, 2010. vol. 28, no. 9-10, pp. 859–870, 2005.
[9] M. Palumbo and L. J. Harris, “Microbiological food safety of [25] H. P. Fleming, W. M. Walter Jr., and J. L. Etchells, “Antimicrobial
olive oil: A review of the literature,” US Davis Olive Center properties of oleuropein and products of its hydrolysis from
Report, December 2011. green olives,” Journal of Applied Microbiology, vol. 26, no. 5, pp.
[10] G. Ciafardini and B. A. Zullo, “Improvement of Commercial 777–782, 1973.
Olive Oil Quality through an Evaluation of the Polyphenol [26] Y. Sakihama, M. F. Cohen, S. C. Grace, and H. Yamasaki, “Plant
Content of the Oily Fraction of the Olive Fruit during its Period phenolic antioxidant and prooxidant activities: Phenolics-
of Maturation,” Journal of Food Processing and Technology, vol. induced oxidative damage mediated by metals in plants,”
5, no. 12, pp. 2–8, 2014. Toxicology, vol. 177, no. 1, pp. 67–80, 2002.
[11] B. A. Zullo, M. G. Di Stefano, G. Cioccia, and G. Ciafardini, [27] E. G. Yordi, E. M. Pérez, E. U. Villares, and M. J. Matos, “Antiox-
“Evaluation of polyphenol decay in the oily fraction of olive fruit idant and pro-oxidant effects of polyphenolic compounds and
during storage using a mild sample handling method,” European structure-acitivty relationship evidence,” Nutrition, Well-Being
Journal of Lipid Science and Technology, vol. 116, no. 2, pp. 160– and Health, 2012.
168, 2014. [28] D. Zanichelli, T. A. Baker, M. N. Clifford, and M. R. Adams,
[12] G. Ciafardini, G. Cioccia, and B. A. Zullo, “Taggiasca extra “Inhibition of Staphylococcus aureus by oleuropein is mediated
virgin olive oil colonization by yeasts during the extraction by hydrogen peroxide,” Journal of Food Protection, vol. 68, no. 7,
process,” Food Microbiology, vol. 62, pp. 58–61, 2017. pp. 1492–1496, 2005.
[13] EC, “European Commission Regulation No. 640/2008 of 4 [29] H. Taleb, S. E. Maddocks, R. K. Morris, and A. D. Kanekanian,
July 2008 amending Regulation (EEC) No.2568/91 on the “The antibacterial activity of date syrup polyphenols against S.
characteristics of olive oil and olive residue oil and on the aureus and E. coli,” Frontiers in Microbiology, vol. 7, article no.
relevant method of analysis”. 198, 2016.
[14] C. P. Kurtzman and J. W. Fell, The Yeasts, A Taxonomic Study,
Elsevier, Amsterdam, 4th edition, 1998.
[15] APHA, Standard Methods for the Examination of Water and
Wastewater, American Public Health Association, Washington,
Wash, USA, 19th edition, 1995.
[16] EC, European Commission Regulation UNI EN ISO 9308-1,
2002.
[17] K. B. Omar and T. G. Barnard, “Detection of diarrhoeagenic
Escherichia coli in clinical and environmental water sources in
South Africa using single-step 11-gene m-PCR,” World Journal of
Microbiology and Biotechnology, vol. 30, no. 10, pp. 2663–2671,
2014.
[18] U. K. Laemmli, “Cleavage of structural proteins during the
assembly of the head of bacteriophage T4,” Nature, vol. 227, no.
5259, pp. 680–685, 1970.
[19] J. M. Olı́as, A. G. Pérez, J. J. Rı́os, and L. C. Sanz, “Aroma of
Virgin Olive Oil: Biogenesis of the “Green” Odor Notes,” Journal
of Agricultural and Food Chemistry, vol. 41, no. 12, pp. 2368–
2373, 1993.
[20] F. Angerosa, N. D’Alessandro, C. Basti, and R. Vito, “Biogenera-
tion of Volatile Compounds in Virgin Olive Oil: Their Evolution
in Relation to Malaxation Time,” Journal of Agricultural and
Food Chemistry, vol. 46, no. 8, pp. 2940–2944, 1998.
[21] A. Garcı́a, M. V. Ruiz-Méndez, C. Romero, and M. Brenes,
“Effect of refining on the phenolic composition of crude olive
oils,” Journal of the American Oil Chemists’ Society, vol. 83, no.
2, pp. 159–164, 2006.
Hindawi
https://doi.org/10.1155/2018/8714975
Research Article
Extra-Intestinal Fluoroquinolone-Resistant Escherichia coli
Strains Isolated from Meat
Giorgia Caruso,1 Anna Giammanco,1 Cinzia Cardamone,2 Giuseppa Oliveri,2

Chiara Mascarella,1 Giuseppina Capra,1 and Teresa Fasciana 1
1
Department of Sciences for Health Promotion and Mother & Child Care, University of Palermo, Italy
2
Institute for Experimental Veterinary Medicine of Sicily, Palermo, Italy
Correspondence should be addressed to Teresa Fasciana; teresa.fasciana@virgilio.it
Received 26 June 2018; Revised 17 September 2018; Accepted 28 October 2018; Published 18 November 2018
Copyright © 2018 Giorgia Caruso et al. This is an open access article distributed under the Creative Commons Attribution License,
Extra-intestinal E. coli are emerging as a global threat due to their diffusion as opportunistic pathogens and, above all, to their wide
set of antibiotic resistance determinants. There are still many gaps in our knowledge of their origin and spread pathways, although
food animals have been adjudicated vehicles for passing mult-drug resistant bacteria to humans. This study analyzed 46 samples
of meat purchased from retail stores in Palermo in order to obtain quinolone-resistant E. coli isolates. Strains were screened for
their phylogenetic groups, ST131-associated single nucleotide polymorphisms (SNPs), and then typed by ERIC-PCR. Their set of
virulence factors, namely, kpsMII, papA, sfaS, focG, iutA, papC, hlyD, and afa genes, were investigated and their fluoroquinolone-
resistance determinants evaluated. The data obtained show a dramatically high prevalence of multidrug resistance patterns in the
Palermo area, with 28% of the isolates having virulence factor genes typical of ExPEC strains. No B2 group or ST131 strains were
detected. Moreover, 20% of our isolates showed positivity to all the plasmid-mediated quinolone resistance (PMQR) determinants,
showing a potential to transfer these genes among other bacteria. Therefore, these data underline the possibility that food animals
and, specifically, poultry in particular may be a significant source of resistant bacterial strains, posing a potential zoonotic risk.
1. Introduction plasmid-mediated quinolone resistance (PMQR) gene in 1998

[5], many other resistance mechanisms have been added [6].
The outburst of the antibiotic resistance phenomenon at Nontarget, commensal enteric bacteria are also exposed
global level has occurred due to the excessive and inap- to this wide variety of antimicrobial substances, leading to an
propriate use of antimicrobials in various fields, both in increase in resistance genes and, potentially, their horizontal
human medicine and in veterinary and zootechnical settings, transfer. Hence these bacteria may function as a reservoir of
strongly accelerating the development and diffusion of resis- resistance though largely ignored [7].
tant strains. For instance, intensive livestock farming prac- According to the EFSA and ECDC report [8], E. coli is an
tices that compel farmers to rely more heavily on antibiotics excellent indicator of resistance level among Enterobacteria
have determined a dramatic increase in the prevalence of in breeding animals, as it is widespread in farm environments.
antibiotic-resistant bacteria in farm animals and food [1, 2]. Furthermore, there is increasing evidence that E. coli
Quinolones in particular have long been the main strains may be conveyed through food and, directly or more
choice of antimicrobial agent for the treatment of various likely indirectly, they find their way to humans, account-
Gram-negative infections, both in human and in veterinary ing for a subset of resistant Extra-intestinal Pathogenic E.
medicine, ostensibly increasing the rate of resistant isolates coli (ExPEC) [9–11]. Indeed, ExPEC increasingly represent
all over the world [3]. Furthermore, the World Health an emerging category of pathogens that cause illness in
Organization (WHO) has signalled quinolones to be critically immunocompetent subjects both in nosocomial and in com-
important antibiotics, thus recommending a more prudent munity settings. ExPEC are in fact implicated in a wide range
use of them [4]. In fact, since the discovery of the first of host diseases and are associated with the vast majority of
urinary tract infections (UTIs), as well as neonatal meningitis one searched for hlyD (haemolysin D), afa (afimbrial adhe-
and bacteremia and animal infective syndromes [12]. sine), iutA (aerobactin siderophore ferric receptor protein),
E. coli ST131 is currently the predominant isolate among and papC (pilus-associated protein C) genes. Positive results
ExPEC lineages at global level [13] and is considered to for at least two of these VFs are a distinctive sign of ExPEC
be one of the most virulent bacterial clones, particularly [18]. Three strains were employed as positive controls: E. coli
linked to fluoroquinolone-resistance (e.g., qnrA, qnrB, qnrS, RS218 (kpsMT II, papA, papC, sfaS, and hlyD), E. coli V27
and aac (6’)-Ib-cr genes) and to extended-spectrum 𝛽- (kpsMT II, papA, papC, iutA, and focG), and E. coli 2H16
lactamases, such as CTX-M-15 [14]. Moreover, ST131 iso- (papC, iutA, afa, and hlyD) [17].
lates are commonly reported to harbour a wide variety
of virulence-associated genes, including a greater ability to
2.4. Genotypic Detection of Plasmid Resistance Genes. Strain
produce biofilms compared to non-ST131 isolates [15]. Due
genotypes were investigated with relation to the most com-
to these features, ST131 strains are considered to be truly
mon plasmid-mediated quinolone resistance genes: qnrA,
pathogenic [13]. The aim of this study, therefore, was to assess
qnrB, qnrS, and aac(6’)-Ib-cr [19, 20].
the prevalence of multidrug resistant E. coli with ExPEC-
associated traits in food that could pose a risk for consumers.
2.5. Typing. All the strains were typed in order to screen
for ST131-associated single nucleotide polymorphisms (SNPs)
2. Materials and Methods in mdh and gyrB, according to Johnson et al. [21]. Hence
a multiplex PCR was carried out, and the presence of the
2.1. Strain Selection. Between January and March 2017, 46 two amplicons relating to the two abovementioned genes
samples were analyzed at the Experimental Zooprophylactic qualified the strain as ST131.
Institute of Sicily “A. Mirri.” All the samples, in individually They were then subjected to Enterobacterial Repetitive
sealed packages, were purchased from different supermarkets Intergenic Consensus sequence PCR (ERIC-PCR), according
in Palermo. They consisted of 23 poultry, 13 beef and 10 pork to Versalovic et al. [22].
samples. According to the labels, all the samples came from The fingerprints were photographed by the GelDoc
intensive farms based in Sicily. (BIO-RAD) system and finally analyzed using the BIO-
The samples were immediately sent to the laboratory on NUMERICS software (Applied Maths, Kortrijk, Belgium).
ice and subsequently processed in asepsis. Comparisons between band patterns were performed with
10 g of each sample was added to 90 ml of saline the Dice similarity coefficient. The obtained matrices were
peptone solution (SSP). After homogenization by Stomacher combined using the UPGMA algorithm to produce a dendro-
and incubation for one hour at room temperature, sam- gram, with a cut-off of 80% similarity.
ples were plated into Tryptone Bile X-Glucuronide (TBX)
Agar. Colonies developed 18 to 24 hours after incubation
at 44∘ C. They were tested by disk diffusion for resistance 2.6. Antibiotic Testing. Besides fluoroquinolones, all the
to fluoroquinolones, in particular to ciprofloxacin (CIP, 5 strains were tested by disk diffusion for susceptibility to
𝜇g), norfloxacin (NOR, 10 𝜇g), and levofloxacin (LVX, 5 𝜇g) other antimicrobials, including amoxicillin–clavulanic acid
(Oxoid). A resistant colony was selected from each sample (AUG, 20–10 𝜇g), cefotaxime (CTX, 30 𝜇g), ceftazidime
and then identified by the API E (BioMérieux) system. (CAZ, 30 𝜇g), cefepime (PEP, 30 𝜇g), gentamicin (CN, 10
A single colony was suspended in 200 𝜇l sterile bidistilled 𝜇g), imipenem (IMI, 10 𝜇g), sulfamethoxazole–trimethoprim
water. DNA extraction was then performed by High Pure (SXT, 25 𝜇g), and tetracycline (TE, 30 𝜇g) (Oxoid). Resis-
PCR Template Preparation Kit (Roche), according to the tance was determined according to European Committee
manufacturer’s instructions. on Antimicrobial Susceptibility Testing (EUCAST) guide-
lines (http://www.eucast.org/clinical breakpoints/). Isolates
simultaneously resistant to three or more different drug
2.2. Phylogenetic Grouping. DNA extracts were analysed with classes were defined as multidrug resistant (MDR) [23].
multiplex PCR to ascertain their phylogenetic groups, as
described by Clermont et al. [16]. This method is based on
the presence/absence of three genes: chuA, which encodes a 3. Results
protein transporting the eme group, yjaA, with an unknown
function, and the fragment TSPE4.C2, thought to be within This study analysed 46 samples. Almost all the strains isolated
a gene encoding a lipase esterase. Previously studied strains from poultry samples were resistant to fluoroquinolones
from our laboratory were used as positive controls [17]. (91.3%). A considerably lower percentage of the strains iso-
lated from pigs and cattle showed resistance, namely, 20% and
15.3%, respectively. In total, we obtained 25 fluoroquinolone-
2.3. Virulence Factors. Two multiplex PCRs were assayed to resistant strains, to be further characterized in the following
investigate the presence of eight virulence factors (VFs) in the analyses.
E. coli isolates, as described by Johnson et al. [18]. The first As regards phylogenetic groups, D1 was the most preva-
multiplex PCR screened for the presence of kpsMII (group II lent (44%), followed by group A1 (28%), A0 (20%), and
capsule), papA (pilus-associated protein A), sfaS (S-fimbrial lastly B1 (8%); notably, no B2 group strains were observed
adhesine), and focG (F1C fimbriae protein) genes; the second (Figure 1).
Table 1: Resistance patterns observed in all the strains.
Resistance Pattern N. isolates (%)

CIP, NOR, LVX (Fluoroquinolones only) 3 (12%)
CIP, NOR, LVX, AUG 3 (12%)
CIP, NOR, LVX, AUG, TE 1 (4%)
CIP, NOR, LVX, AUG, SXT 1 (4%)
CIP, NOR, LVX, AUG, SXT, TE 16 (64%)
CIP, NOR, LVX, AUG, SXT, TE, CN 1 (4%)
the majority with iutA gene. PapA was found in one strain,
20% belonging to group A1.
Therefore, 7 of the 25 isolates (28%) met the inclusion
44%
criteria for ExPEC; that is, they had at least two virulence
factors, according to Johnson et al. [18]. Eight isolates had one
virulence determinant (Figure 2).
28% The genes aac(6’)-Ib-cr, qnrA, qnrB, and qnrS encoding
quinolone resistance were observed in only 20% of our
8% isolates. In particular, both qnrA and aac(6')- Ib-cr genes
appeared in 2 strains, while qnrB and qnrS were present in
1 strain each. 4 of these resistance determinants were found
in group A and one in group D1; specifically, only one was
found in pork meat (i.e., qnrB), while the other determinants
A0 (%)
A1 (%) were found in strains originating from poultry.
B1 (%) Phenotypic resistance patterns are summarized in
D1 (%) Table 1. Among the 25 isolated E. coli strains, notably
Figure 1: Percentage of strains by phylogenetic group. 80% were found to be resistant to amoxicillin–clavulanic
acid. A high prevalence was found for tetracyclin and
sulfamethoxazole–trimethoprim also, both present in
72% of samples. Interestingly, none of the strains were
observed to be resistant to the cephalosporins and
40%
carbapenem tested. The most common pattern was
35% resistance to amoxicillin–clavulanic acid, tetracyclin,
30% and sulfamethoxazole–trimethoprim, which was detected
in 14 of the 25 strains (56%). Hence, 19 strains (76%) can be
25%
considered multidrug resistant, according to the criterion
20% utilized [24].
Finally, ERIC PCR showed quite a high level of hetero-
15%
geneity, except for two pairs of strains (2 pork strains and 2
10% poultry strains), which shared the same patterns of bands and
5% hence are displayed only once (Figure 3).
0%
4. Discussion
0 VF
The steady increase in the prevalence of quinolone-resistant
1 VF
> 2 VFs ExPEC isolates is particularly alarming due to their spread
as opportunistic pathogens and suggests the need to deepen
Figure 2: Percentages of strains possessing VFs. our knowledge of their source, reservoirs, and transmission
pathways.
Poultry meat was highly contaminated with E. coli resis-
tant to quinolones (91.3% of samples). The percentage of
In accordance with the absence of group B2 strains, ST131 contaminated pork and beef samples was lower, in agreement
was absent among our isolates, which all tested negative for with the literature, according to which not only does the
the SNPs in the two genes of interest. poultry show the highest quinolone resistance in comparison
A limited number of virulence factors were observed, and to other types of meat but also the highest prevalence
these were concentrated in phylogenetic group D1. In fact, of MDR [25–27]. Lower resistance levels for beef, whose
this group included all the strains with the kpsMII gene and resistant strains accounted for 15.3% in this study, have also
100
92
94
96
98
POULTRY 16 D1
POULTRY 17 A1
PORK 1 A0
POULTRY 7 A1
POULTRY 11 A0
POULTRY 14 B1
POULTRY 12 A1
POULTRY 10 D1
POULTRY 15 A0
POULTRY 8 D1
POULTRY 9 A1
POULTRY 1 B1
CATTLE 1 D1
POULTRY 3 D1
POULTRY 13 D1
POULTRY 2 D1
POULTRY 4 D1
POULTRY 5 A1
POULTRY 18 D1
POULTRY 19 A0
POULTRY 6 D1
CATTLE 2 A1
POULTRY 20 A1
Figure 3: Dendrogram obtained by ERIC-PCR of strains.
been observed in other investigations from different parts of al. [33] and Alvarez-Fernandez et al. [25] reported a very
Europe [28, 29]. low incidence of resistance to these antibiotics (0-3.8%), and
The most common antibiotic classes used in bred Pavlickova et al. [11] did not describe any strain as resistant to
chickens are penicillins, tetracyclines, sulfonamides and cefotaxime and cefuroxime. In contrast, another study from
quinolones [6]. Accordingly, in our study, the highest Sicily, but based on Italian meat, found a high prevalence of
resistance prevalence was found for amoxicillin-clavulanic cephalosporin resistance in its strains [17].
acid, sulfamethoxazole–trimethoprim, and tetracycline. Car- We found a higher prevalence of phylogenetic group D1
bapenems are restricted to human use, but they were inves- strains (44%), followed by A1 (28%), A0 (20%), and lastly B1
tigated in this study, as required by 2013/652/EU [30], since (8%); these latter groups (A and B1) are usually associated
small resistance spots are, albeit slowly, starting to emerge with environmental and commensal strains in humans [34],
[31], above all in poultry, where a small percentage of while the phylogenetic groups B2 and to a lesser extent D are
carbapenemase-producing E. coli were detected from broilers related to extra-intestinal pathogenic strains. Furthermore, in
and its meat in two European countries. this study we found no evidence in the analyzed foods of an
Although veterinary use of cephalosporins is permitted animal ST131 reservoir, in accordance with observations by
by law, notably our strains did not exhibit resistance to them. other authors who only sporadically detected ST131 in farm
While the poultry industry in Italy renounced the use of III animals [35, 36]. In fact, although other sources have been
and IV generation cephalosporins in 2009, the other farming identified as ST131 vehicles, a greater prevalence of human
industries continue to use these antimicrobials for a rather compared to animal colonization has been observed [37].
wide range of diseases. Their consumption of this antibiotic Our isolates did not show a wide variety of VFs, as mainly
class is one of the highest in Europe and has shown a slightly the iutA receptor, present in 15 strains out of 25 (60%), and,
increasing trend since 2010 [32]. Our findings relating to to a lesser extent, kpsMII, present in 6 strains (24%), were
cephalosporins reflect other data in the literature. Wasyl et found; papA gene was found in just 1 isolate. The presence
of virulence genes in these strains is worrisome because Given the considerable public health threat that ExPEC
it suggests a high probability of pathogenicity, according represents, further long-term investigations are needed to
to Johnson et al.’s [18] ExPEC definition. VFs, therefore, give us more insight into the epidemiologic relationship
greatly increase the health threat these strains already pose between human and food-origin E. coli, and to clarify
as carriers of antibiotic-resistance genes through the food capacity for interspecies transfer.
chain. Specifically, 28% of isolates possessed two virulence With regard to animal production systems, a review of
factors (i.e., ExPEC). Lyhs et al. [38] classified 22% of strains farm management is essential, especially as far as intensive
as ExPEC in a study focused on poultry meat sold at retail farming is concerned, combining good practices and apply-
stores, while Xia et al. [39] observed an even lower percentage ing good hygiene measures and animal welfare in order to
(20.2%) in the same sample type. reduce the use of antimicrobials (i.e., an efficient antimi-
However, Johnson et al.’s above-mentioned classification crobial stewardship), thus acting on reservoirs of antibiotic
for determining the pathogenicity of microorganisms may resistance. At present, intensive farming systems rely on a
not be exhaustive, as there may be other unexamined factors routine use of antibiotics, creating reservoirs of antimicrobial
conferring pathogenic potential. For instance, in a study by resistance genes that could spread in the environment or
Fasciana et al. [40], many UPEC strains, all isolated from to different hosts. In fact, antibiotics are often used as
pathological urine samples, did not exhibit any of the VFs prophylactic prevention measures, for mass treatment that
indicated by Johnson et al. [18]. Hence it is highly likely is not associated with a specific diagnosis or for preventable
that the number of ExPECs among farm animals has been diseases, in a way that is no longer sustainable. In order to
underestimated. deal with this antimicrobial resistance emergency, different
As regards antibiotic resistance, since all the isolates levels of safety measures must be considered, including “ter-
in question exhibited phenotypic resistance to quinolones, tiary prevention” (i.e., increasing the ability of the animals’
other resistance mechanisms may explain the rather low immune system to respond to infections) [48] and vaccines
prevalence of the PMQR genes investigated (20%). Indeed, formed on widely conserved antigens [49, 50].
as the most common mechanisms in animal isolates are In addition, according to the farm-to-fork concept, it
chromosomal mutations in type II topoisomerase (parC is important that also slaughterhouses and food handling
and/or gyrA genes) [41–43], or in regulatory proteins (e.g., practices are taken into account in the attempt to reduce
MarA, SoxRS, and Rob) associated with upregulation of foodborne transmission. Hence, an integrated implemen-
efflux pumps, such as AcrAB-TolC, and downregulation of tation of GMP (Good Manufacturing Practices) and GHP
porin, reducing quinolone influx [44], we assume that these (Good Hygienic Practices) should be applied throughout
mechanisms were responsible for resistance in our study the production, processing, and consumption stages, and
as well. In addition, other potentially involved resistance consumer awareness should be raised.
determinants, though less frequent, are due to plasmid-
encoded qepA and oqxAB membrane transporters [45,
46].
Data Availability
Genotyping by ERIC-PCR revealed 23 banding profiles; The data used to support the findings of this study are
these results support a high genetic heterogeneity, which is available from the corresponding author upon request.
an alarming fact, showing a multiple onset of MDR strains
despite the restricted area of sampling.
This study, although numerically limited, emphasizes Conflicts of Interest
the already clear need to improve strategies to prevent the
spread of antibiotic resistance and to reduce the amount of
antibiotics used.
The high prevalence of resistant strains in this study, References
despite not all of them being classified as ExPEC, poses a
[1] J. Campos, J. Mourão, N. Pestana, L. Peixe, C. Novais, and
direct risk, as these strains can subclinically colonize the
P. Antunes, “Microbiological quality of ready-to-eat salads:
consumer’s intestinal tract until advantageous circumstances an underestimated vehicle of bacteria and clinically relevant
favour an extraintestinal infection, or an indirect risk, poten- antibiotic resistance genes,” International Journal of Food Micro-
tially contributing resistance genes to human indigenous biology, vol. 166, no. 3, pp. 464–470, 2013.
microbiota [47]. [2] V. Perreten, “Resistance in the food chain and in bacteria
For instance, a subset of human ExPEC strains, isolated from animals: relevance to human infections,” in Frontiers in
by Fasciana et al. [40] from UTIs in Palermo, turned out to Antimicrobial Resistance: A Tribute to Stuart B. Levy, D. G.
be non-ST-131 (33%) and were not resistant to cephalosporins White, M. N. Alekshun, and P. F. McDermott, Eds., pp. 446–
(32.4%). Furthermore, the most prevalent VFs observed 464, ASM Press, Washington, DC, USA, 2005.
included KpsMII (32%) and iutA (83.8%), which were [3] V. T. Andriole, “The quinolones: past, present, and future,”
reported to be more common in non-ST131 strains. These data Clinical Infectious Diseases, vol. 41, supplement 2, pp. S113–S119,
are limited and do not allow epidemiological considerations, 2005.
but they do underline, albeit partially, that it is not possible to [4] World Health Organization, WHO Advisory Group on Inte-
exclude a zoonotic origin for at least a small subset of human grated Surveillance of Antimicrobial Resistance (AGISAR). Criti-
ExPEC infections. cally important antimicrobials for human medicine 3rd Revision
2011, WHO Document Production Services, Geneva, Switzer- [19] C. H. Park, A. Robicsek, G. A. Jacoby, D. Sahm, and D.
land, 2012. C. Hooper, “Prevalence in the United States of aac(6)-Ib-
[5] L. Martı́nez-Martı́nez, A. Pascual, and G. A. Jacoby, “Quinolone cr encoding a ciprofloxacin-modifying enzyme,” Antimicrobial
resistance from a transferable plasmid,” The Lancet, vol. 351, no. Agents and Chemotherapy, vol. 50, no. 11, pp. 3953–3955, 2006.
9105, pp. 797–799, 1998. [20] A. Robicsek, J. Strahilevitz, D. F. Sahm, G. A. Jacoby, and D. C.
Hooper, “qnr prevalence in ceftazidime-resistant Enterobacteri-
[6] G. A. Jacoby, J. Strahilevitz, and D. C. Hooper, “Plasmid-
aceae isolates from the United States,” Antimicrobial Agents and
mediated quinolone resistance,” Microbiology Spectrum, vol. 2,
Chemotherapy, vol. 50, no. 8, pp. 2872–2874, 2006.
no. 5, Article ID PLAS-0006-2013, 2014.
[21] J. R. Johnson, B. Johnston, C. Clabots, M. A. Kuskowski, and
[7] R. L. Finley, P. Collignon, D. G. J. Larsson et al., “The scourge M. Castanheira, “Escherichia coli sequence type ST131 as the
of antibiotic resistance: the important role of the environment,” major cause of serious multidrug-resistant E. coli infections in
Clinical Infectious Diseases, vol. 57, no. 5, pp. 704–710, 2013. the United States,” Clinical Infectious Diseases, vol. 51, no. 3, pp.
[8] European Food Safety Authority and European Centre for Dis- 286–294, 2010.
ease Prevention and Control, “The European Union summary [22] J. Versalovic, T. Koeuth, and J. R. Lupski, “Distribution of
report on antimicrobial resistance in zoonotic and indicator repetitive DNA sequences in eubacteria and application to
bacteria from humans, animals and food in 2014,” EFSA Journal, fingerprinting of bacterial genomes,” Nucleic Acids Research,
vol. 14, no. 2, p. 4380, 2016. vol. 19, no. 24, pp. 6823–6831, 1991.
[9] L. M. Cavaco, N. Frimodt-Møller, H. Hasman, L. Guardabassi, [23] A.-P. Magiorakos, A. Srinivasan, R. B. Carey et al., “Multidrug-
L. Nielsen, and F. M. Aarestrup, “Prevalence of quinolone resistant, extensively drug-resistant and pandrug-resistant bac-
resistance mechanisms and associations to minimum inhibitory teria: an international expert proposal for interim standard
concentrations in quinolone-resistant Escherichia coli isolated definitions for acquired resistance,” Clinical Microbiology and
from humans and swine in Denmark,” Microbial Drug Resis- Infection, vol. 18, no. 3, pp. 268–281, 2012.
tance, vol. 14, no. 2, pp. 163–169, 2008. [24] M. Exner, S. Bhattacharya, B. Christiansen, J. Gebel, P. Goroncy-
[10] J. R. Johnson, M. R. Sannes, C. Croy et al., “Antimicrobial drug- Bermes, and P. Hartemann, “Antibiotic resistance: What is
resistant Escherichia coli from humans and poultry products, so special about multidrug-resistant Gram-negative bacteria?”
Minnesota and Wisconsin, 2002–2004,” Emerging Infectious GMS Hygiene and Infection Control, p. 12, 2017.
Diseases, vol. 13, no. 6, pp. 838–846, 2007. [25] E. Álvarez-Fernández, A. Cancelo, C. Dı́az-Vega, R. Capita,
and C. Alonso-Calleja, “Antimicrobial resistance in E. coli
[11] S. Pavlickova, M. Dolezalova, and I. Holko, “Resistance and isolates from conventionally and organically reared poultry: A
virulence factors of Escherichia coli isolated from chicken,” comparison of agar disc diffusion and Sensi Test Gram-negative
Journal of Environmental Science and Health, Part B: Pesticides, methods,” Food Control, vol. 30, no. 1, pp. 227–234, 2013.
Food Contaminants, and Agricultural Wastes, vol. 50, no. 6, pp.
417–421, 2015. [26] A. Skočková, I. Koláčková, K. Bogdanovičová, and R.
Karpı́šková, “Characteristic and antimicrobial resistance
[12] J. R. Johnson and T. A. Russo, “Extraintestinal pathogenic in Escherichia coli from retail meats purchased in the Czech
Escherichia coli: ‘The other bad E coli’,” The Journal of Laboratory Republic,” Food Control, vol. 47, pp. 401–406, 2015.
and Clinical Medicine, vol. 139, no. 3, pp. 155–162, 2002. [27] T. R. Thorsteinsdottir, G. Haraldsson, V. Fridriksdottir, K.
[13] M.-H. Nicolas-Chanoine, X. Bertrand, and J.-Y. Madec, G. Kristinsson, and E. Gunnarsson, “Prevalence and genetic
“Escherichia coli ST131, an intriguing clonal group,” Clinical relatedness of antimicrobial-resistant escherichia coli isolated
Microbiology Reviews, vol. 27, no. 3, pp. 543–574, 2014. from animals, foods and humans in Iceland,” Zoonoses and
[14] R. Banerjee and J. R. Johnson, “A new clone sweeps clean: The Public Health, vol. 57, no. 3, pp. 189–196, 2010.
enigmatic emergence of Escherichia coli sequence type 131,” [28] “European Food Safety Authority. Scientific opinion on the
Antimicrobial Agents and Chemotherapy, vol. 58, no. 9, pp. 4997– public health risks of bacterial strains producing extended-
5004, 2014. spectrum beta-lactamases and/or AmpC beta-lactamases in
food producing animals,” EFSA Journals, vol. 9, p. 2322, 2011.
[15] T. Kudinha, J. R. Johnson, S. D. Andrew, F. Kong, P. Anderson,
and G. L. Gilbert, “Escherichia coli sequence type 131 as a promi- [29] A. Kaesbohrer, A. Schroeter, B.-A. Tenhagen, K. Alt, B. Guerra,
nent cause of antibiotic resistance among urinary Escherichia and B. Appel, “Emerging antimicrobial resistance in commensal
coli isolates from reproductive-age women,” Journal of Clinical escherichia coli with public health relevance,” Zoonoses and
Microbiology, vol. 51, no. 10, pp. 3270–3276, 2013. Public Health, vol. 59, no. 2, pp. 158–165, 2012.
[30] “Commission Implementing Decision of 12 November 2013 on
[16] O. Clermont, S. Bonacorsi, and E. Bingen, “Rapid and simple the monitoring and reporting of antimicrobial resistance in
determination of the Escherichia coli phylogenetic group,” zoonotic and commensal bacteria,” 652, EU, 2013.
Applied and Environmental Microbiology, vol. 66, no. 10, pp.
[31] “Scientific Report of EFSA and ECDC (2018) The European
4555–4558, 2000.
Union Summary Report on antimicrobial resistance in zoonotic
[17] A. Ghodousi, C. Bonura, A. M. D. Noto, and C. Mam- and indicator bacteria from humans, animals and food in 2016,”
mina, “Extended-spectrum 𝛽-lactamase, AmpC-producing, https://ecdc.europa.eu/en/publications-data/european-union-
and fluoroquinolone-resistant Escherichia coli in retail broiler summary-report-antimicrobial-resistance-
chicken meat, Italy,” Foodborne Pathogens and Disease, vol. 12, zoonotic-and-indicator-4.
no. 7, pp. 619–625, 2015. [32] European Medicines Agency, “European Surveillance
[18] J. R. Johnson, M. A. Kuskowski, K. Smith, T. T. O’Bryan, and S. of Veterinary Antimicrobial Consumption (2017) Sales
Tatini, “Antimicrobial-resistant and extraintestinal pathogenic of veterinary antimicrobial agents in 29 European
Escherichia coli in retail foods,” The Journal of Infectious Dis- countries in 2015,” http://www.ema.europa.eu/docs/en GB/
eases, vol. 191, no. 7, pp. 1040–1049, 2005. document library/Report/2017/10/WC500236750.pdf.
[33] D. Wasyl, A. Hoszowski, M. Zając, and K. Szulowski, “Antimi- isolates from community-dwelling humans and UTI patients,”
crobial resistance in commensal Escherichia coli isolated from International Journal of Food Microbiology, vol. 142, no. 1-2, pp.
animals at slaughter,” Frontiers in Microbiology, vol. 4, 2013. 264–272, 2010.
[34] J. R. Johnson, P. Delavari, M. Kuskowski, and A. L. Stell, “Phy- [48] N. C. Maldonado, C. S. de Ruiz, M. C. Otero, F. Sesma, and
logenetic distribution of extraintestinal virulence-associated M. E. Nader-Macı́as, “Lactic acid bacteria isolated from young
traits in Escherichia coli,” The Journal of Infectious Diseases, vol. calves - Characterization and potential as probiotics,” Research
183, no. 1, pp. 78–88, 2001. in Veterinary Science, vol. 92, no. 2, pp. 342–349, 2012.
[35] M. Giufrè, C. Graziani, M. Accogli, I. Luzzi, L. Busani, and [49] A. Wieser, E. Romann, G. Magistro et al., “A multiepitope
M. Cerquetti, “Escherichia coli of human and avian origin: subunit vaccine conveys protection against extraintestinal
Detection of clonal groups associated with fluoroquinolone pathogenic Escherichia coli in mice,” Infection and Immunity,
and multidrug resistance in Italy,” Journal of Antimicrobial vol. 78, no. 8, pp. 3432–3442, 2010.
Chemotherapy, vol. 67, no. 4, Article ID dkr565, pp. 860–867, [50] U. Dobrindt and J. Hacker, “Targeting virulence traits: potential
2012. strategies to combat extraintestinal pathogenic E. coli infec-
[36] C. Vincent, P. Boerlin, D. Daignault et al., “Food reservoir tions,” Current Opinion in Microbiology, vol. 11, no. 5, pp. 409–
for Escherichia coli causing urinary tract infections,” Emerging 413, 2008.
Infectious Diseases, vol. 16, no. 1, pp. 88–95, 2010.
[37] B. A. Rogers, H. E. Sidjabat, and D. L. Paterson, “Escherichia
coli O25b-ST131: A pandemic, multiresistant, community-
associated strain,” Journal of Antimicrobial Chemotherapy, vol.
66, no. 1, pp. 1–14, 2011.
[38] U. Lyhs, I. Ikonen, T. Pohjanvirta, K. Raninen, P. Perko-Mäkelä,
and S. Pelkonen, “Extraintestinal pathogenic Escherichia coli
in poultry meat products on the Finnish retail market.,” Acta
Veterinaria Scandinavica, vol. 54, p. 64, 2012.
[39] X. Xia, J. Meng, S. Zhao et al., “Identification and antimicrobial
resistance of extraintestinal pathogenic Escherichia coli from
retail meats,” Journal of Food Protection, vol. 74, no. 1, pp. 38–
44, 2011.
[40] T. Fasciana, G. Giordano, P. Di Carlo et al., “Virulence fac-
tors and antimicrobial resistance of escherichia coli ST131
in community-onset healthcare-associated infections in sicily,
Italy,” Pharmacologyonline, vol. 1, pp. 12–21, 2017.
[41] L.-N. Xia, L. Li, C.-M. Wu et al., “A survey of plasmid-
mediated fluoroquinolone resistance genes from escherichia
coli isolates and their dissemination in Shandong, China,”
Foodborne Pathogens and Disease, vol. 7, no. 2, pp. 207–215, 2010.
[42] M. Karczmarczyk, M. Martins, T. Quinn, N. Leonard, and
S. Fanning, “Mechanisms of fluoroquinolone resistance in
Escherichia coli Isolates from food-producing animals,” Applied
and Environmental Microbiology, vol. 77, no. 20, pp. 7113–7120,
2011.
[43] D. Jones-Dias, V. Manageiro, A. P. Francisco et al., “Assessing
the molecular basis of transferable quinolone resistance in
Escherichia coli and Salmonella spp. from food-producing
animals and food products,” Veterinary Microbiology, vol. 167,
no. 3-4, pp. 523–531, 2013.
[44] D. C. Hooper and G. A. Jacoby, “Mechanisms of drug resistance:
quinolone resistance,” Annals of the New York Academy of
Sciences, vol. 1354, no. 1, pp. 12–31, 2015.
[45] K. Yamane, J.-I. Wachino, S. Suzuki et al., “New plasmid-
mediated fluoroquinolone efflux pump, QepA, found in an
Escherichia coli clinical isolate,” Antimicrobial Agents and
[46] L. H. Hansen, E. Johannesen, M. Burmølle, A. H. Sørensen,
and S. J. Sørensen, “Plasmid-encoded multidrug efflux pump
conferring resistance to olaquindox in Escherichia coli,” Antimi-
crobial Agents and Chemotherapy, vol. 48, no. 9, pp. 3332–3337,
2004.
[47] L. Jakobsen, D. J. Spangholm, K. Pedersen et al., “Broiler
chickens, broiler chicken meat, pigs and pork as sources of
ExPEC related virulence genes and resistance in Escherichia coli
Hindawi
https://doi.org/10.1155/2018/9794869
Research Article
Prevalence and Antimicrobial Susceptibility Profile of
Salmonella Serovars Isolated from Slaughtered Cattle in
Addis Ababa, Ethiopia
Lidya Ketema,1 Zerihun Ketema,2 Bitsu Kiflu,3 Haile Alemayehu,4 Yitagele Terefe,5
Mohammed Ibrahim,6 and Tadesse Eguale 4
1
Beshir Husein Veterinary Drugs and Equipment Wholesale, P.O. Box 181979, Addis Ababa, Ethiopia
2
Sebeta Municipal Abattoir, Sebeta, Ethiopia
3
Ministry of Agriculture, P.O. Box 170042, Addis Ababa, Ethiopia
4
Aklilu Lemma Institute of Pathobiology, Addis Ababa University, P.O. Box 1176, Addis Ababa, Ethiopia
5
College of Veterinary Medicine, Haramaya University, P.O. Box 138, Dire Dawa, Ethiopia
6
Jigjiga University, P.O.Box 1020, Jigjiga, Ethiopia
Correspondence should be addressed to Tadesse Eguale; tadesse.eguale@aau.edu.et
Received 4 July 2018; Accepted 22 October 2018; Published 4 November 2018
Copyright © 2018 Lidya Ketema et al. This is an open access article distributed under the Creative Commons Attribution License,
Salmonella is one of the top causes of foodborne bacterial illnesses in humans. The primary sources of human Salmonella infection
are food producing animals such as cattle, poultry, and swine. A cross-sectional study was undertaken to estimate the prevalence
and to determine the serovar distribution and antimicrobial susceptibility profiles of Salmonella spp. isolated from fecal (n=567)
and carcass swab (n=159) samples of slaughtered cattle at Addis Ababa Abattoir Enterprise and Kara’alo PLC, Abattoirs, in
Addis Ababa, Ethiopia between January 2014 and April 2015. Salmonella isolation was conducted according to Global Foodborne
Infections Network Laboratory Protocol and isolates were confirmed by genus specific PCR and serotyped by slide agglutination
test. Susceptibility of the isolates to 17 antimicrobials was testedusing the Kirby-Bauer disk diffusion method according to the
guidelines of the Clinical and Laboratory Standards Institute. Out of the total 726 samples examined, 27 (3.7%) were positive for
Salmonella. Salmonella was detected in 4.1% (23/567) fecal and 2.5% (4/159) carcass swab samples. Twelve different serovars were
identified and the most predominant serovars were S. Dublin (n=10, 35.7%) and S. Virchow (n=5, 17.9%), followed by S. Braendrerup,
S. Haifa, and S. Saintpaul which were isolated from 2 samples each (7.1%). All of the Salmonella isolates investigated were resistant
or intermediately resistant to four or more of the 17 drugs tested. High resistance rate was recorded to streptomycin 25 (89.3%),
cephalothin 20 (71.4%), ampicillin 19 (67.9%), and amoxicillin+clavulanic acid 19 (67.9%). Resistance to five or more antimicrobials
was detected in 20 (71.5%) of the isolates. Multidrug resistance to more than 7 antimicrobials was detected in 5 (17.9%) of the
isolates. Isolation of such multidrug resistant strains of Salmonella from slaughtered cattle poses a major public health concern.
These findings imply the need for a strict biosecurity and regulation of antimicrobial use across the country.
1. Introduction as humans. There are 2 species of Salmonella: Salmonella

enterica and Salmonella bongori. Salmonella enterica is clas-
Salmonella is one of the most important foodborne bacteria in sified into 6 subspecies of which Salmonella enterica sub-
the world and infection with Salmonella spp. is a major cause species enterica is the dominant subspecies affecting humans
of diarrhea in children and adults [1]. Salmonella belongs to and domestic animals [3]. There are currently over 2,700
the Enterobacteriaceae family which also includes pathogens Salmonella serovars [4], which are serologically identified
such as Escherichia coli, Shigella, and Klebsiella [2]. Members by antigenic variation in the O (Lipopolysaccharide), H
of the genus Salmonella are ubiquitous pathogens that infect (Flagella), and Vi (Capsular) antigens in accordance with the
a wide variety of mammals, birds, fish, and reptiles, as well Kauffmann–White scheme [4, 5].
Salmonellosis represents an important public health N = (1.96)2 x Pexp (1- Pexp)/d2 , where N is required
problem among the common bacterial foodborne pathogens sample size, p is expected prevalence, and d is desired absolute
worldwide. Estimated global burden of 93.8 million gas- precision of 0.05. Therefore, the calculated sample size was
troenteritis cases and 155,000 deaths are due to Salmonella 146, but, to increase the precision of the study and to increase
species annually, of which 85.6% is foodborne [6]. Human the number of Salmonella isolates, a total of 720 samples (567
salmonellosis has been associated with contaminated food fecal and 159 Swab samples) were collected from the two
products, mainly those of animal origin such as poultry, abattoirs.
beef, pork, and dairy products, as well as direct contact with
infected animals [7–9]. 2.2. Sample Collection. Fresh fecal sample was collected
The presence of Salmonella in food animals and the directly from the rectum of each animal during antemortem
consequent cross-contamination of edible carcass present inspection before slaughter using disposable gloves. Fecal
a significant food-safety hazard [10]. Food animals such samples were collected into sterile zippered plastic bags
as cattle may carry Salmonella at slaughter and can serve directly from rectum using disposable gloves and trans-
as sources of contamination and provide an opportunity ported to Microbiology Laboratory, Aklilu Lemma Institute
for entry of the pathogen into the food products. This of Pathobiology, Addis Ababa University, in ice box. Similarly,
implies that the presence of Salmonella in slaughter cattle carcass swab was sampled by rubbing the entire surface of
and slaughter house environment and the potential cross- each carcass (both sides) once from the hind quarter to the
contamination of carcasses and edible organs can pose a forequarter, uniformly using sterile cotton swab. Each swab
significant food-safety hazards [3]. There is little available sample was then placed into screw caped test tubes containing
data on Salmonella presence in cattle feces and carcass swab 10 ml of sterilized buffered peptone water (BPW) (Becton
and such information is important to understand the impact Dickinson, Sparks, MD), placed in an ice box with an ice pack
of the bacteria on food producing animals and the subsequent and transported to Microbiology Laboratory, Aklilu Lemma
risk to humans which consume cattle products. The aim of the Institute of Pathobiology, within 3–4 h of collection.
current study was therefore to estimate Salmonella prevalence
in feces and carcass swab of cattle slaughtered at Addis Ababa 2.3. Bacterial Isolation and Identification. Isolation and iden-
Abattoir Enterprise and Kara’alo PLC abattoir. Furthermore, tification of Salmonella were conducted using conventional
the isolates were serotyped and tested for antimicrobial methods [13]. Briefly, 10 g of feces was preenriched in 90 ml
susceptibility. of sterile buffered peptone water (BPW) (Becton Dickinson,
Sparks, MD) and incubated overnight at 37∘ C. Similarly,
2. Materials and Methods the carcass swab sample in BPW was placed in incubator
overnight at 37∘ C. A 100𝜇l of each preenriched suspension
2.1. Study Area and Study Design. The study was conducted was added into 9.9 ml of Rappaport-Vassiliadis enrichment
in Addis Ababa between January 2014 and April 2015. Addis Broth (RVB) (Oxoid, USA) and incubated at 42∘ C for 24 h.
Ababa is the capital city and administration center for the At the same time, 1 ml of the suspension was also transferred
Federal Democratic Republic of Ethiopia. There are four big to 10 ml of Tetrathionate broth (TTB) (Oxoid, USA) and
abattoirs in Addis Ababa town, of which three of them are incubated for 24 h at 37∘ C. It was then streaked from both
government owned and the other one is a private limited RVB and TTB to Xylose Lysine Tergitol 4 (XLT-4) (Oxoid,
company (PLC). Of these four abattoirs, we selected two USA) selective media and the plates were incubated at 37∘ C
abattoirs, namely, Addis Ababa Abattoir Enterprise and for 24 to 48 h. Presumptive Salmonella colonies were further
Kara’alo PLC Abattoir. investigated biochemically using Triple Sugar Iron agar, Urea,
Addis Ababa Abattoir is the largest government owned Citrate, and Lysine Iron Agar slants. Those colonies with
abattoir in Addis Ababa, established with the objective of typical Salmonella biochemical properties were then further
providing wholesome and hygienically slaughtered meat to confirmed by genus specific PCR [14]. A reference strain
the public. The enterprise gives slaughtering service for of S. Typhimurium (ATCC 14028) was used as a positive
average of 1200 cattle, 1000 sheep, and goats and 10 camels per control during biochemical analysis and PCR. One confirmed
day. Kara’alo PLC abattoir is the only private abattoir found in Salmonella isolate from each positive sample was stored at
Addis Ababa which is located in Kara’alo area, Addis Ababa. −80∘ C in 20 % glycerol until further testing. When Salmonella
The abattoir gives slaughtering services for the average of was recovered from samples enriched with both RV and
350 cattle per day. The animals slaughtered in these abattoirs TTB, they were considered as different strains until we con-
originate from different parts of the country. duct antimicrobial susceptibility test. Isolates with different
antimicrobial susceptibility profile were considered different
Study Design and Sample Size Determination. A cross- strains and both of them were submitted for serotyping.
sectional study was conducted on apparently healthy cattle However, when isolates exhibited identical antimicrobial
that were slaughtered at both abattoirs. The required sample susceptibility profile, they were considered as the same strain
size of the study was determined by the formula given by and only one isolate was randomly selected for further
Thrusfield [11] with 95% confidence interval and 5% desired investigation.
precision. Based on the mean prevalence report of 10.6%
from previous work [12], we calculated the samples size as 2.4. Salmonella Serotyping and Phage Typing. Salmonella
follows. isolates were serotyped and phage-typed at the Public
Table 1: Summary of the prevalence of Salmonella and sample types.
Abattoir Name Sample type Numbers examined No. positive (%)

Addis Ababa Fecal 282 11 (3.9%)
Swab 60 2 (3.3%)
Subtotal 342 13
Kara'alo Fecal 285 12 (4.2%)
Swab 99 2 (2.0%)
Subtotal 384 14
Total 726 27 (3.7%)
Table 2: Salmonella serovars isolated from fecal and swab samples of cattle slaughtered at Addis Ababa, Ethiopia.
No. isolated from each Abattoirs

Serovars Antigenic formula Total (%)
Addis Ababa Kara’alo
Dublin 9,12:g,p:- 0 10 10 (35.7)
Virchow 6,7:r:1,2 2 3 5 (17.9)
Braendrerup 6,7:e,h:e,n,z15 2 0 2 (7.1)
Saintpaul 4:e,h:1,2 2 0 2 (7.1)
Haifa 4:z10:1,2 2 0 2 (7.1)
Kottbus 6,8:e,h:1,5 1 0 1 (3.6)
Kentucky 8,20:i:z6 1 0 1 (3.6)
Mikawasima 6,7:y:e,n,z15 1 0 1 (3.6)
Typhimurium phage type 3 4,5:i:1,2 1 0 1 (3.6)
I:ROUGH-O:g,p:- -:g,p:- 0 1 1 (3.6)
Total 28 (100)
Health Agency of Canada, World Organization for Ani- percentage of Salmonella culture-positive samples among the
mal Health (OIÉ) Reference Laboratory for Salmonellosis, total number of samples examined.
Guelph, Ontario, Canada, as described previously [15].
3. Results
2.5. Antimicrobial Susceptibility Testing. Susceptibility of 3.1. Prevalence of Salmonella. Salmonella was isolated from
the isolates to 17 antimicrobials was determined using 27 of the 726 samples examined resulting in an overall
the disk diffusion method according to the guidelines of Salmonella prevalence of 3.7%. From the total of 567 fecal
the Clinical and Laboratory Standards Institute [16]. The samples, 23 (4.1%) and from 159 carcass swab samples 4
following antimicrobials (Sensi-Discs, Becton, Dickinson (2.5%) were found positive for Salmonella. Summary of the
and Company, USA) and disc potencies (𝜇g) were used: prevalence of Salmonella from fecal samples and carcass swab
amikacin (30𝜇g), ampicillin (10 𝜇g), amoxicillin-clavulanic samples in the two abattoirs is presented in Table 1.
acid 20/10 (30 𝜇g), chloramphenicol (30𝜇g), ceftriaxone
(30𝜇g), cephalothin (30 𝜇g), ciprofloxacin (5𝜇g), cefoxitin 3.2. Salmonella Serovar Distribution. A total of 12 different
(30 𝜇g), gentamycin (10𝜇g), kanamycin (30𝜇g), sulfamethox- Salmonella serovars were identified and the most predom-
azole+trimethoprim (23.75 𝜇g/1.25 𝜇g), trimethoprim (5 𝜇g), inant serovars identified were S. Dublin 10 (35.7%) and S.
tetracycline (30𝜇g), sulfisoxazole (1000 𝜇g), streptomycin (10 Virchow 5 (17.86%). Other serovars like S. Braendrerup,
𝜇g), nitrofurantoin (30𝜇g), and nalidixic acid (30𝜇g), and the S. Haifa, and S. Saintpaul were also isolated from 2 sam-
interpretation of the categories of susceptible, intermediate, ples each (7.14%). Two serovars were isolated from single
or resistant was done based on the CLSI guidelines [16]. sample, namely, S. Haifa and S. Kottbus: one from fecal
Reference strain of Escherichia coli ATCC 25922 was used as sample obtained from a cattle slaughtered in Addis Ababa
a quality control. Abattoir enriched with RV and the other from the same
sample enriched with TTB. Table 2 shows the distribution of
2.6. Data Analysis. Data was generated from combination Salmonella serovars and their antigenic formula.
of records from data collection and laboratory results. All
the data and corresponding laboratory results were entered 3.3. Antimicrobial Susceptibility of Salmonella Isolates. The
into Microsoft Excel, edited, coded, and analyzed using SPSS antimicrobial susceptibility profile of Salmonella isolates is
version 15.0. Prevalence of Salmonella was calculated as a shown in Table 3. High resistance rate was recorded among
4
Table 3: Salmonella serovar distribution and frequency of resistance to various antimicrobials.

Salmonella serovars and No. (%) of isolates ∗resistant to various antimicrobials (n=28)
Antimicrobials tested
Dublin Virchow Typhimurium Saintpaul Braenderup Haifa Kottbus Kentucky Mikawasima I:ROUGH-O:g,p:- No. (%) resistant
n=10 n=5 n=3 n=2 n=2 n=2 n=1 n=1 n=1 n=1
Amp 10 (100) 3 (60) 2 (66.7) 2 (100) - - - 1 (100) - 1 (100) 19 (67.9)
Amc 10 (100) 3 (60) 2 (66.7) 2 (100) - - - 1 (100) - 1 (100) 19 (67.9)
Cf 10 (100) 3 (60) 2 (66.7) 2 (100) - - 1 (100) 1 (100) - 1 (100) 20 (71.4)
Cro - - - - - - - - 0
Fox 1 (10) - - - - - - 1 (100) 2 (7.1)
An - 1 (20) - - 1 (50) 1 (50) - - 1 (100) - 4 (14.3)
Gm 1 (10) - - - - - 1 (100) - - 2 (7.1)
K 3 (30) 5 (100) 2 (66.7) 1 (50) 1 (50) 2 (100) 1 (100) 1 (100) - - 16 (57.1)
S 10 (100) 5 (100) 2 (66.7) 2 (100) 2 (100) 1 (50) 1 (100) 1 (100) 1 (100) - 25 (89.3)
Sxt - - 1 (33.3) - - - - - - - 1 (3.6)
Cip - 1 (20) 2 (66.7) 2 (100) 2 (100) 1 (50) - 1 (100) 1 (100) - 10 (35.7)
Na 1 (10) - - - - - - 1 (100) - 2 (7.1)
Te - 2 (40) 1 (33.3) 2 (100) 2 (100) 1 (50) 1 (100) 1 (100) 1 (100) - 11 (39.3)
C - - - - - - - - - - 0
Tmp 1 (10) - 1 (33.3) - - - - - - - 2 (7.1)
Su 1 (10) 2 (40) - 2 (100) 2 (100) 2 (100) 1 (100) 1 (100) 1 (100) - 12 (42.9)
Nitro - 2 (40) 2 (66.7) - 1 (50) 2 (100) 1 (100) 1 (100) 1 (100) - 10 (35.7)
An: amikacin, Amp: ampicillin, Amc: amoxicillin+clavulanic acid, C: chloramphenicol, Cro: ceftrioxone, Cf: cephalothin, Cip: ciprofloxacin, Fox: cefoxitin, Gm: gentamicin, K: kanamycin, Sxt: sulfamethoxa-
zole+trimethoprim, Tmp: trimethoprim, Te: tetracycline, Suv: sulfisoxazole, S: streptomycin, Nitro: nitrofurantoin, and Na: nalidixic acid. ∗Isolates intermediately resistant were also considered resistant.
Table 4: Antimicrobial resistance pattern of Salmonella serovars isolated from slaughtered cattle.
Resistance Pattern
Serovar No.
Intermediate Resistant
Braendrerup 1 Cip,Te,Su,S -
Braendrerup 1 An,Cip,K,Te,Su,S Nitro
Dublin 2 K Amp,Amc,Cf,S
Dublin 2 S Amp,Amc,Cf
Dublin 1 S Amp,Amc,Cf,Gm
Dublin 1 S,Su,Tmp Amp,Amc,Cf
Dublin 1 S Amp,Amc,Cf
Dublin 1 - Amp,Amc,Cf,S
Dublin 1 Fox,K Amp,Amc,Cf,S
Dublin 1 Na,S Amp,Amc,Cf
Haifa 1 K,Nitro Te,Su
Haifa 1 An,Cip,K,Su,S,Nitro -
Kottbus 1 Cf,K,S Te,Su,Nitro
Kentucky 1 K,Nitro Amp,Amc,Cf,Cip,Gm,Te,Su,S,Na
Mikawasima 1 An,Cip,Te Su,S,Nitro
Saintpaul 1 Amc,Cip,K,Su,S Amp,Cf, Te
Saintpaul 1 Amp,Amc,Cf,Cip,Su,S Amp,Cf,Te
Typhimurium phage type 3 1 Cip,K,Nitro,S Amp,Amc,Cf
Typhimurium phage type 93 1 - Sxt,Tmp,Te,S
Typhimurium phage type 4 1 Cip,K,Nitro Amp,Amc,Cf
Virchow 1 K,Te,Su,S Nitro
Virchow 1 Cip,K,Te,Su,S,Nitro -
Virchow 1 An, K Amp,Amc,Cf,S
Virchow 2 K,S Amp,Amc,Cf
I:ROUGH-O:g,p:- 1 Fox Amp,Amc,Cf
An, amikacin; Amp, ampicillin; Amc, amoxicillin and clavulanic acid; Cf, cephalothin; C, chloramphenicol; Cro, ceftriaxone; Cip, ciprofloxacin; Fox,
cefoxitin; Gm, gentamicin; K, kanamycin; Tmp, trimethoprim; Sxt, sulfamethoxazole + trimethoprim; Te, tetracycline; Su, sulfisoxazole; S, streptomycin; Nitro,
nitrofurantoin; Na, nalidixic acid, N, neomycin.
isolates to streptomycin 25 (89.3%), cephalothin 20 (71.4%), In the current study, overall prevalence of Salmonella was
ampicillin 19 (67.9%), and amoicillin+clavulanic acid 19 3.7% (fecal= 4.1% and carcass swab 2.5%), which is a little
(67.9%). All isolates were susceptible to ceftriaxone and chlo- bit lower than that reported from Addis Ababa Abattoir [18]
ramphenicol. All S. Dublin isolates were resistant to ampi- and Debrezeit slaughter house [19] which reported pooled
cillin, amoxicillin+clavulanic acid, cephalothin, and strepto- prevalence to be 10.6% and 7.1%, respectively. A much higher
mycin. All of the Salmonella isolates investigated were resis- prevalence of 14% was also reported from beef cattle in
tant or intermediately resistant to 4 or more of the 17 drugs Ethiopia [20]. The prevalence from carcass swab (2.5%) in
tested. Resistance or intermediate resistance to five or more the current study is in line with the 2% prevalence reported
drugs was detected in 20 (71.5%) of the isolates and resistance earlier [20]. However, higher rate of recovery of Salmonella
to more than 7 antimicrobials was detected in 5 (17.9%) of (4.8%) was reported from carcass swab [21] in slaughtered
the isolates. A single S. Kentucky isolated from Addis Ababa cattle at Bahir Dar town, North Ethiopia. The probable
Abattoir was resistant to 11 of the 17 antimicrobials tested reason for the fecal and carcass swab prevalence disparity
(Table 4). from other studies could be due to seasonal variation in
Salmonella shedding among animals, difference in infection
4. Discussion prevention practices by animal owners, and other factors such
as variation in hygiene status of the slaughter houses and
Foodborne gastroenteritis caused by non-typhoidal Salmo- difference in the Salmonella isolation protocol employed in
nella represents a major public health problem worldwide. each study.
As Salmonella is transmitted through contaminated food or In our study, we found S. Dublin to be the predominant
water, its presence in food animals and food animal products serovar followed by S. Virchow. Similarly, previous studies
has relevant public health implications. Thus, monitoring [12, 18, 19] reported S. Dublin as the most predominate
food safety is a key point in preventing and controlling the serovar in slaughtered cattle and beef in Ethiopia. A single
spread of Salmonella, as well as in providing healthier food I:ROUGH-O:g,p:-isolate obtained from fecal sample of cattle
product [17]. is also likely atypical strain of S. Dublin as its antimicrobial
susceptibility profile is closely related to most of the S. Dublin Acknowledgments

strains in this study. Unlike our study, S. Virchow was not
the common serovar isolated from cattle and carcass sample The authors would like to thank abattoir workers for collabo-
in the previous studies. However, recent study reported S. ration during sample collection. The authors are also grateful
Virchow to be one of the dominant serovars circulating in to Dr. Roger P. Johnson from the Public Health Agency of
dairy cattle in Addis Ababa [15]. Canada, National Microbiology Laboratory at Guelph, and
In the current study, resistance to 4 or more antimi- his team, for serotyping and phage typing of the Salmonella
crobials was observed in the isolates which is much higher isolates. This work was supported by WHO/AGISAR.
than the reports by previous studies [20, 22] in Salmonella
serovars isolated from beef and other food of animal origin. References
Other studies in Ethiopia also reported a much lower rate
of resistance to common antimicrobials used in both animal [1] S. S. Al-Abri, N. J. Beeching, and F. J. Nye, “Traveller’s diar-
rhoea,” The Lancet Infectious Diseases, vol. 5, no. 6, pp. 349–360,
and human health [19, 21]. This difference may be due to the
2005.
increasing rate of inappropriate utilization of antimicrobials
[2] C. D. Ellermeier and J. M. Slauch, “The Genus Salmonella,”
in cattle farms which favored selection for resistant bacterial
in he Prokaryotes: Volume 6: Proteobacteria: Gamma Subclass,
strains. M. Dworkin, S. Falkow, E. Rosenberg, K. Schleifer, and E.
Higher resistance rate observed to streptomycin could be Stackebrandt, Eds., Springer New York, New York, NY, USA,
due to the fact that it is among the most commonly used 2006.
antimicrobials for treatment of various infectious diseases of [3] S. Uzzau, D. J. Brown, T. Wallis et al., “Host adapted serotypes
livestock. Similarly, the occurrence of high rate of resistance of Salmonella enterica,” Epidemiology and Infection, vol. 125, no.
to ampicillin and amoxicillin+clavulanic acid among isolates 2, pp. 229–255, 2000.
in this study could partly be due to coselection of resistance [4] M. Guibourdenche, P. Roggentin, M. Mikoleit et al., “Supple-
phenomenon with penicillin, a drug frequently prescribed ment 2003–2007 (No. 47) to the White-Kauffmann-Le Minor
alone or in combination with streptomycin in veterinary scheme,” Research in Microbiology, vol. 161, no. 1, pp. 26–29,
practice in Ethiopia [23]. All isolates in the current study 2010.
showed multidrug resistance to more than four drugs which [5] P. A. D. Grimont and F. X. Weill, Antigenic formulae of the
is alarming for both human and animal health sector. This Salmonella Serovars, WHO Collaborating Center for Reference
observation indicates the potential importance of cattle as and Research on Salmonella, Institut Pasteur, Paris, France,
a source of antimicrobial resistant Salmonella serovars to 2007.
commonly used antimicrobials including ampicillin, amox- [6] S. E. Majowicz, J. Musto, E. Scallan et al., “The global burden
icillin+clavulanic acid, streptomycin, and tetracycline. The of nontyphoidal Salmonella gastroenteritis,” Clinical Infectious
fact that all isolates in the current study were suscepti- Diseases, vol. 50, no. 6, pp. 882–889, 2010.
ble to ceftriaxone and chloramphenicol might be due to [7] B. Bouchrif, S. Le Hello, M. Pardos et al., “Ceftazidime-resistant
low use of these two drugs in veterinary medicine in the Salmonella enterica, Morocco,” Emerging Infectious Diseases,
vol. 15, no. 10, pp. 1693–1695, 2009.
country.
[8] P. D. Fey, T. J. Safranek, M. E. Rupp et al., “Ceftriaxone-resistant
Salmonella infection acquired by a child from cattle,” The New
5. Conclusion England Journal of Medicine, vol. 342, no. 17, pp. 1242–1249,
2000.
Antimicrobial resistant bacteria of animal origin are consid- [9] M. L. Bartholomew, R. T. Heffernan, J. G. Wright et al.,
ered an important contributor to the overall phenomenon of “Multistate outbreak of salmonella enterica serotype enteritidis
increased antimicrobial resistance in bacterial pathogen of infection associated with pet guinea pigs,” Vector-Borne and
public health importance. Use of antimicrobials in one or the Zoonotic Diseases, vol. 14, no. 6, pp. 414–421, 2014.
other way contributes to the emergence and spread of antimi- [10] G. M. Kikuvi, J. N. Ombui, and E. S. Mitema, “Serotypes and
crobial resistance. Therefore, judicious use of antimicrobials antimicrobial resistance profiles of Salmonella isolates from pigs
at slaughter in Kenya,” The Journal of Infection in Developing
in beef cattle and other food animals is recommended to delay
Countries, vol. 4, no. 4, pp. 243–248, 2010.
the emergence and spread of antimicrobial resistant bacteria
[11] M. Thrusfield, Veterinary Epidemiology, Blackwell Science,
and resistance genetic markers.
2007.
[12] C. Nyeleti, G. Hildebrandt, J. Kleer, and B. Molla, “Prevalence
Data Availability of Salmonella in Ethiopian cattle and minced beef,” Berlin und
Münchener Tierärztliche Wochenschrift, vol. 113, no. 11-12, pp.
The data used to support the findings of this study are 431–434, 2000.
included within the article. [13] WHO, “WHO Global Foodborne Infections Network Labora-
tory Protocol,” in Isolation of Salmonella spp. From Food and
Animal Feace, vol. 5th, 2010.
Conflicts of Interest [14] N. D. Cohen, H. L. Neibergs, E. D. McGruder et al., “Genus-
specific detection of salmonellae using the polymerase chain
The authors declare that there are no conflicts of interest reaction (PCR),” Journal of Veterinary Diagnostic Investigation,
regarding publication of this paper. vol. 5, no. 3, pp. 368–371, 1993.
[15] T. Eguale, E. Engidawork, W. A. Gebreyes et al., “Fecal preva-

lence, serotype distribution and antimicrobial resistance of
Salmonellae in dairy cattle in central Ethiopia,” BMC Microbi-
ology, vol. 16, no. 1, article 20, 2016.
[16] CLSI, Performance standards for antimicrobial susceptibility
testing; twenty-third informational SupplementM100-S23, vol.
33, 2013.
[17] B. Bouchrif, B. Paglietti, M. Murgia et al., “Prevalence and
antibiotic-resistance of Salmonella isolated from food in
Morocco,” The Journal of Infection in Developing Countries, vol.
3, no. 1, pp. 35–40, 2009.
[18] C. Nyeleti, B. Molla, G. Hildebrandt, and J. Kleer, “The prev-
alence and distribution of Salmonellae in slaughter cattle,
slaughterhouse personnel and minced beef in,” Bulletin of
Animal Health and Production in Africa, vol. 48, no. 1, pp. 19–24,
2000.
[19] D. Alemayehu, B. Molla, and A. Muckle, “Prevalence and
antimicrobial resistance pattern of Salmonella isolates from
apparently healthy slaughtered cattle in Ethiopia,” Tropical
Animal Health and Production, vol. 35, no. 4, pp. 309–319, 2003.
[20] B. Sibhat, B. Molla Zewde, A. Zerihun et al., “Salmonella
Serovars and Antimicrobial Resistance Profiles in Beef Cattle,
Slaughterhouse Personnel and Slaughterhouse Environment in
Ethiopia,” Zoonoses and Public Health, vol. 58, no. 2, pp. 102–109,
2011.
[21] S. Alemu and B. M. Zewde, “Prevalence and antimicrobial
resistance profiles of Salmonella enterica serovars isolated from
slaughtered cattle in Bahir Dar, Ethiopia,” Tropical Animal
Health and Production, vol. 44, no. 3, pp. 595–600, 2012.
[22] E. Zewdu and P. Cornelius, “Antimicrobial resistance pattern of
Salmonella serotypes isolated from food items and personnel in
Addis Ababa, Ethiopia,” Tropical Animal Health and Production,
vol. 41, no. 2, pp. 241–249, 2009.
[23] G. Tadesse, “A meta-analysis of the proportion of animal
Salmonella isolates resistant to drugs used against human
salmonellosis in Ethiopia,” BMC Infectious Diseases, vol. 15,
article 84, 2015.
Hindawi
https://doi.org/10.1155/2018/9608756
Research Article
Genetic Heterogeneity of Alicyclobacillus Strains Revealed by
RFLP Analysis of vdc Region and rpoB Gene
Agnieszka Dekowska , Jolanta Niezgoda, and Barbara SokoBowska

Prof. Waclaw Dabrowski Institute of Agricultural and Food Biotechnology, 36 Rakowiecka Street, 02-532 Warsaw, Poland
Correspondence should be addressed to Agnieszka Dekowska; agnieszka.dekowska@ibprs.pl
Received 3 August 2018; Accepted 27 September 2018; Published 1 November 2018
Copyright © 2018 Agnieszka Dekowska et al. This is an open access article distributed under the Creative Commons Attribution
cited.
PCR-RFLP targeting of the 16S rDNA and rpoB genes, as well as the vdc region, was applied to identify and differentiate between
the spoilage and non-spoilage Alicyclobacillus species. Eight reference strains and 75 strains isolated from spoiled juices, juice
concentrates, drinks, its intermediates, and fresh apples were subject to study. Hin6I restriction patterns of the 16S rDNA gene
enabled distinguishing between all the species analyzed, while the rpoB gene and vdc gene cluster analysis also revealed that there
were two major types among the A. acidoterrestris isolates, one similar to the reference strain A. acidoterrestris DSM 2498, and the
other similar to the reference strain A. acidoterrestris ATCC 49025. Heterogeneity was also observed among the A. acidocaldarius
isolates. RFLP analysis of the 16S rDNA and rpoB genes, as well as vdc region, can be used successfully in the identification and
research of intraspecies heterogeneity of the Alicyclobacillus species.
1. Introduction and in drinks, for example ice tea, and isotonic drinks [17,
26]. The spoilage mainly manifests itself as the formation
The contamination of fruit juices by Alicyclobacillus has of a medical, antiseptic off-odour, from compounds pro-
recently become one of the most important issues in the duced by the bacteria. The main compound associated with
juice and beverage industry. These acidophilic, thermophilic, spoilage is guaiacol, produced from vanillin and vanillic
and spore-forming bacteria are very hard to eliminate from
acid [27–29], but halophenols, 2,6-dibromophenol and 2,6-
contaminated drinks.
dichlorophenol, have also been reported as spoilage agents.
Alicyclobacillus are Gram positive, aerobic, soil borne
bacteria that are able to grow within a range from pH 2.0 Among the 22 currently known Alicyclobacillus species, five
to 6.0 and at temperatures from 20 to 70∘ C [1–8]. The two have been proven to produce an off-odour: A. acidoterrestris,
main factors which prevent fruit products from spoilage with A. acidiphilus, A. pomorum, A. cycloheptanicus, and A.
most other bacteria, which are thermal treatment and low herbarius. [1, 9, 14, 30–37].
pH values, are insufficient to eliminate Alicyclobacillus. The The classic method for isolating and characterizing Alicy-
spores survive under typical pasteurization conditions and clobacillus, devised by IFU (Internationale Fruchtsaft Union),
are able to germinate and grow in an acidic environment which is commonly used in the juice and beverage industry,
[9, 10]. Thermal treatment may even impel germination of the takes about 15 days. If present in the tested sample, guaiacol
spores [11–13]. can be detected using the peroxidase method [27, 38], by
Despite being nonpathogenic [14], some Alicyclobacillus sensory tests ([9, 10, 39]; Siegmund and Pöllinger-Zierler,
species may cause the spoilage of juices and juice-containing 2006) or instrumental methods, for example, HPLC or gas
products such as nectars and beverages. Alicyclobacillus chromatography [28, 35, 40, 41].
species have been found all across the world, and their The identification of the Alicyclobacillus species based
presence has been detected on fruit surfaces [15], in juices on their ability to assimilate erythritol with acid production
produced from several fruits: citrus, apple, banana, berry, [19, 42] mainly allows differentiating between two species: A.
and stone fruits [1, 8, 10, 16–24], in canned tomatoes [25], acidoterrestris and A. acidocaldarius.
Since the classic microbiological Alicyclobacillus detect- utilization was tested by plating the cultures on agar con-
ing methods are time consuming, alternative approaches have taining 1% erythritol and bromophenol blue as an indicator
been adopted, like flow cytometry ([30], Pieper et al. 2006), [42]. The ability to produce guaiacol was tested using the
Fourier transform infrared spectroscopy [43–45], and genetic peroxidase method [27].
methods. Except for RAPD-PCR, (Yamazaki et al., 1997; [46–
49]), most of the genetic methods used in the studies on
2.3. DNA Isolation. Selected Alicyclobacillus strains were
Alicyclobacillus target the rDNA operon. These include 16S
cultured in BAT medium (pH 4.0±0.2) at 45∘ C for 2–3 days.
rDNA and ITS region sequencing, 16S rDNA RFLP, Real-
Bacillus subtilis was cultured in TSB medium (pH 7.1±0.2)
Time PCR, and LAMP-PCR of the 16S rDNA fragment ([1,
at 30∘ C for 2 days, and Geobacillus stearothermophilus was
50]; Durak et al., 2002; [6, 7, 51–54]).
cultured in TSB medium at 45∘ C for 2 days.
Guaiacol, the main spoilage agent, is produced by nonox-
Bacterial chromosomal DNA was purified using a
idative decarboxylation of vanillic acid. The ability to produce
Genomic Mini Kit (A&A Biotechnology), following the
guaiacol is associated with presence of vdc gene cluster,
manufacturer’s instructions.
consisting of three genes, vdcB, vdcC, and vdcD. Chow et al.
[55] described vdc gene cluster in Streptomyces sp. Detection
of the vdc genes of A. acidoterrestris using RT-PCR was 2.4. Primer Designing and Amplification. All PCR reactions
described by Niwa and Kawamoto [38]. The vdc region were performed using a Pequstar 2x Gradient thermocycler
sequence was published by Matsubara [56]. To date, there are (Pequlab).
no applications of vdc region analysis for any microorganism.
RpoB gene, encoding the 𝛽 subunit of bacterial RNA poly- 2.4.1. 16S rDNA Amplification. A fragment of the 16S rDNA
merase, is one of the single-copy housekeeping genes and is gene was amplified using universal primers, similar to that
widely used in studies on bacterial taxonomy. These studies used by Wang et al., 2010 [57]. The primer sequences were 8F
include PCR-RFLP analyses of rpoB gene fragments; however, (5󸀠 – AGAGTTTGATCCTGGCTCAG), E. coli positions 8-27
so far, there are no reports on using rpoB gene analysis in and 1512R, shortened by 1 nucleotide at 3󸀠 end (5󸀠 – ACGGC-
research on of Alicyclobacillus. TACCTTGTTACGACT), E. coli positions 1512–1493. The size
Our study focuses on the use of rpoB gene, vdc region, and of the amplification product was 1495 bp.
16SrDNA gene as molecular markers for the identification PCR reactions were performed in a total volume of 50 𝜇l,
and differentiation of Alicyclobacillus. containing 5 ng of the template DNA, 50 pM of each of the
primers, and 25 𝜇l of the DreamTaq Green PCR Master Mix
(Thermo Scientific). PCR was performed under the following
2. Materials and Methods conditions: initial denaturation at 94∘ C for 2 min, 40 cycles of
2.1. Sample Acquisition and Bacterial Strains. Seventy-five denaturation at 94∘ C for 30 sec, annealing at 51∘ C for 35 sec,
strains analyzed in this study were isolated from concentrated elongation 72∘ C for 1 min 40 sec, and the final elongation at
apple juice (47), concentrated cherry juice (4), fresh apples 72∘ C for 2 min.
(3), concentrated strawberry juice (2), concentrated black
currant juice (2), tomato juice (2), orange juice (3), cloudy 2.4.2. vdc Region Amplification. The vdc gene cluster was
(1) and clear (1) apple juice, apple beverage (1), concentrated amplified using primers vdc fr (5󸀠 – CTGTTGGCTCAA-
beetroot juice (1), concentrated raspberry juice (1), concen- TGGCGGCTGAGCGAT), vdc rev (5󸀠 – TTATCAGCG-
trated orange juice (1), orange beverage (1), banana nectar GTTTATCCGCGGTGGAACAGTC), vdc1 fr (5󸀠 – AAC-
(1), cherry puree (1), and intermediates used in beverage GACGCAGGTGTGGAAAC), vdc1 rev (5󸀠 – AGCGTG-
production (3). All the strains were isolated according to the GGCAAGTTGTCATGTG), vdc K (5󸀠 – TTGGCAACG-
method described in IFU no. 12 September 2004/March 2007. GAGAAGTGGGAG) and vdc S (5󸀠 – AATCACGCG-
Reference strains were obtained from the Leibniz Insti- CTGATGATGGG). The 1586 fragment of vdc region, con-
tute DSMZ – German Collection of Microorganisms and taining fragments of vdcB and vdcC genes, was used as
Cell Cultures (Alicyclobacillus acidiphilus DSM 14558; Ali- a template for PCR-RFLP and was amplified using the
cyclobacillus acidocaldarius DSM 446; Alicyclobacillus aci- primers Bur 5 (5󸀠 GCCGACGTGATGCTCAARGAG-
doterrestris DSM 2498; Alicyclobacillus herbarius DSM 13609; CGCA) and Bur 6 (5󸀠 GTSGCRTCGAGAATCATCTTG-
Alicyclobacillus hesperidum DSM 12489), and from the TG). The primers were designed based on a comparison
American Type Culture Collection (ATCC) (Alicyclobacillus of the raw genome sequences derived from Alicyclobacil-
acidoterrestris ATCC 49025; Geobacillus stearothermophilus lus acidoterrestris ATCC 49025 ([58]; GenBank number
ATCC 7953; Bacillus subtilis ATCC 6655). Also, Alicyclobacil- AURB01000113.1), and Alicyclobacillus herbarius DSM 13609
lus acidocaldarius A1 from our own library collection was (GenBank number AUMH01000032.1), the sequence pub-
used as a reference strain, after biochemical and 16S rDNA lished by Matsubara (GenBank number BD187778.1), and
sequencing confirmation. sequences obtained from several Alicyclobacillus acidoter-
restris strains analyzed in this study. Sequence alignments
were performed using the Serial Cloner program. The posi-
2.2. Biochemical Tests. The strains were checked for erythritol tions and directions of the vdc primers are described in Table 1
utilization and guaiacol production. The ability of erythritol and shown in Figure 1.
vdcK (2202 - 2222) vdc1 rev (2287 - 2308)
vdc fr (1 - 27) vdc1 fr bur5 vdcS (1044 - 1063) bur6 (2124 - 2146) vdc rev (2493 - 2523)
(314 - 333) (560 - 584)
vdc B (245 - 838) vdc C (831 - 2252) vdc D (2290 - 2517)

vdc region (1 - 2523)
Figure 1: Vdc region, positions of genetic elements and primers.
Table 1: The positions and directions of vdc primers. for 35 sec, elongation 72∘ C for 1 min 45 sec, and the final
elongation at 72∘ C for 5 min.
Primer name Primer position (bp) Primer direction
vdc fr 1-27 forward
2.5. PCR-RFLP. 5-15 𝜇l of the PCR products were digested
vdc rev 2493-2523 reverse
with BsuRI, Hin6I, and HphI (Thermo Scientific) in 20 𝜇l
vdc1 fr 314-333 forward volumes. The samples were incubated at 37∘ C for 1-2 hours,
vdc1 rev 2287-2308 reverse and the enzymes were then inactivated with ten-minute
vdc K 2202-2222 forward incubation at 80∘ C. The digests were analyzed on 2.5–3%
vdc S 1044-1063 forward agarose gel.
Bur5 560-584 forward
Bur6 2124-2146 reverse 2.6. DNA Sequencing. DNA samples were sequenced
using 8F and shortened 1512R primers for the 16S
rDNA gene; vdc fr, vdc rev, vdc1 fr, vdc1 rev, Bur5,
The 2523 bp vdc fr – vdc rev amplification product Bur6, and two additional primers to fill the gaps, vdcS
contained the whole vdc region. The size of the Bur5- (5󸀠 – AATCACGCGCTGATGATGGG) and vdcK (5󸀠 –
Bur6 amplification product was 1586 bp. PCR reactions were TTGGCAACGGAGAAGTGGGAG) for the vdc region; and
performed in a total volume of 50 𝜇l, containing 2.5 ng of the Gru3 – Gru6 for the rpoB gene.
template DNA, 5 pM of each of the primers, and 25 𝜇l of The contig assemblies, sequence alignments, and phylo-
the DreamTaq Green PCR Master Mix (Thermo Scientific). genetic analysis were performed using Serial Cloner software
PCR was performed under the following conditions: initial (SerialBasic) and Clustal Omega. The sequences were com-
denaturation at 94∘ C for 2 min, 30 cycles of denaturation at pared to the GenBank sequences database using BLAST tools.
94∘ C for 30 sec, annealing at 59∘ C for 50 sec, elongation 72∘ C
for 1 min 40 sec, and the final elongation at 72∘ C for 5 min. 3. Results
2.4.3. rpoB Gene Amplification. A fragment of rpoB gene 3.1. RFLP Analysis of 16S rDNA Fragment. The 1495 bp
was amplified using Gru3–Gru6 primers. The primers fragment of the 16S rDNA gene, amplified using 8F and
were designed based on a comparison of the rpoB gene shortened 1512R primers, was digested by BsuRI, Hin6I, and
sequences of Alicyclobacillus acidocaldarius, Bacillus subtilis, HphI.
and Geobacillus stearothermophilus, as well as sequences While BsuRI and HphI digestions did not allow to
derived from A. acidoterrestris 49025, A. hesperidum URH17- distinguish between all the species analyzed, the patterns
3-68, and A. herbarius DSM 13609 raw genomic sequences. obtained by Hin6I digestion were species specific (Figure 2).
Gru5 and Gru6 primers are nondegenerate versions of the All analyzed isolates with their features and RFLP profiles
Gru3 and Gru4 primers, respectively. The primer sequences are described in Table 2.
were Gru3 (CGYGACGTDCACTAYTCBCACTA), Gru4 (5󸀠
– GCCCANACYTCCATCTCRCCRAA) Gru5 (5󸀠 – CGC- 3.2. RFLP Analysis of the vdc Region Fragment. The fragment
GACGTACACTATTCGCACTA), and Gru6 (5󸀠 – GCC- of vdc region was amplified using Bur5 and Bur6 primers.
CAAACCTCCATCTCACCAAA). The size of the amplifi- The product was a single band of 1586 bp and was observed
cation product was 1735 bp. PCR reactions were performed only for guaiacol producing strains: A. acidoterrestris, A.
in a total volume of 50 𝜇l, containing 30 ng of the template acidophilus, and A. herbarius. The PCR product was digested
DNA, 40 pM of each of the primers, and 25 𝜇l of the by BsuRI (Figure 3), Hin6I (Figure 4), and HphI (Figure 5).
DreamTaq Green PCR Master Mix (Thermo Scientific). BsuRI and Hin6I RFLP patterns enabled distinguishing
PCR was performed under the following conditions: initial between all the species analyzed, and divided the A. acidoter-
denaturation at 94∘ C for 2 min, 35 cycles of denaturation at restris group into two clusters. Type I pattern was identical to
94∘ C for 30 sec, annealing at 57∘ C (for the Bur5 and Bur6 the pattern given by A. acidoterrestris DSM 2498, and type II
primer pairs) or at 59∘ C (for the Bur3 and Bur4 primers) pattern was identical to A. acidoterrestris ATCC 49025. The
4
Table 2: List of isolates and their RFLP profiles. AAT, A. acidoterrestris; AAC, A. acidocaldarius; BA, Brevibacillus agri; BG, bacillus ginsengihumi.
RFLP analysis
Isolate Source Guaiacol production Erythritol utilization
16S/ vdc/ vdc/ vdc/ rpoB/ rpoB/ rpoB/
Hin61 BsuRI Hin61 HphI BsuRI Hin61 HphI
1 concentrated apple juice yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
3 intermediate for beverage production yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
4 intermediate for beverage production no no AAC - - - AAC(I) AAC(I) AAC(I)
6 concentrated apple juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
9 orange beverage yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
16 concentrated apple juice yes non typical AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
17 banana nectar yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
18 orange juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
19 concentrated orange juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
25 fresh apples yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
31 concentrated black currant juice yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
33 concentrated apple juice yes non typical AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
34 fresh apples yes yes AAT AAT(I) AAT(I) AAT(IA) AAT(I) AAT(I) AAT(I)
Table 2: Continued.
RFLP analysis
Isolate Source Guaiacol production Erythritol utilization
16S/ vdc/ vdc/ vdc/ rpoB/ rpoB/ rpoB/
Hin61 BsuRI Hin61 HphI BsuRI Hin61 HphI
35 fresh apples yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
38 intermediate for beverage production no no AAC - - - AAC(I) AAC(I) AAC(IA)
39 concentrated apple juice yes - BG - - - BG BG BG
40 concentrated apple juice yes - BG - - - BG BG BG
42 concentrated apple juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(IIA)
44 spoiled apple beverage yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
46 spoiled apple juice yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
48 concentrated strawberry juice no no AAC - - - AAC(II) AAC(II) AAC(II)
49 concentrated cherry juice no no AAC - - - AAC(IA) AAC(I) AAC(IA)
50 tomato juice from fresh tomatoes no no AAC - - - AAC(II) AAC(II) AAC(II)
51 concentrated beetroot juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
52 concentrated cherry juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
54 concentrated apple juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(IIA) AAT(II) AAT(II)
56 concentrated raspberry juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
57 concentrated apple juice yes non typical AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
59 concentrated apple juice no non typical AAC - - - AAC(IA) AAC(I) AAC(I)
62 tomato juice yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
63 concentrated apple juice yes - BA - - - BA BA BA
64 concentrated apple juice no no AAC - - - AAC(II) AAC(II) AAC(II)
65 cherry puree yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
66 concentrated black currant juice yes yes AAT AAT(I) AAT(I) AAT(I) AAT(I) AAT(I) AAT(I)
67 concentrated strawberry juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
68 cloudy apple juice yes yes AAT AAT(II) AAT(II) AAT(II) AAT(II) AAT(II) AAT(II)
70 concentrated apple juice no no AAC - - - AAC(IA) AAC(I) AAC(I)
71 concentrated apple juice no no AAC - - - AAC(IA) AAC(I) AAC(I)
5
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
bp
1000
500
200
Figure 2: Restriction patterns of a 1495 bp fragment of the 16S rDNA gene, digested with Hin6I. Lanes 6, 7, 9, 14, and 18, A. acidoterrestris; 2,
3, 4, 8, 10, 11, 12, 13, 15, 16, and 17, A. acidocaldarius; 5, Brevibacillus agri; 19 A. acidoterrestris DSM 2498; 20, A. acidoterrestris ATCC49025; 21,
A. acidiphilus; 22, A. hesperidum; 23, A. herbarius; 24, A. acidocaldarius; 25, B. subtilis; 26, G. stearothermophilus; lane 1, molecular marker.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
bp
1000
500
200
Figure 3: Restriction patterns of a 1586 bp fragment of the vdc region, digested with BsuRI. Lanes 1–3, 5, 7–11, 13, and 14, A. acidoterrestris
type I; 4, 6, 12, and 15, A. acidoterrestris type II; 16 A. acidoterrestris DSM 2498; 17, A. acidoterrestris ATCC49025; 18, A. acidiphilus; 19, A.
herbarius; 20, molecular marker.
HphI patterns confirm this rule with the exception of one The patterns obtained by all of the nucleases used (Figures
strain, which represented the type I pattern in the BsuRI and 6–8) enabled distinguishing between the species analyzed.
Hin6I analysis. With exception of two strains, the BsuRI patterns divided
the A. acidoterrestris group into two clusters, analogical
3.3. RFLP Analysis of the rpoB Gene Fragment. The 1735 bp to the clusters revealed by the vdc region analysis. The
fragment of the rpoB gene was amplified using Gru3 and pattern (IIA) is shown by two exceptional strains, most
Gru4, or Gru5 and Gru6 primers. Gru3 and Gru4 primers resembling the type II pattern of A. acidoterrestris, and
were degenerated versions of Gru5 and Gru6 (respectively) those strains were classified as type II in other analyses. The
and were used for amplification of isolates other than reference strain ATCC 49025 shows this type of pattern.
A. acidoterrestris. A acidoterrestris isolates were amplified The A. acidocaldarius group was represented by three types
either with Gru3–Gru4, or Gru5–Gru6 primers, and the of patterns, two of them resembling each other. A acido-
Gru5–Gru6 primer pair was chosen due to the better effi- caldarius DSM 446 belongs to the cluster II of A. acido-
ciency of the reaction. Considering the individual isolates, the caldarius group, while A. acidocaldarius A1 was assigned to
RFLP patterns were identical for both pairs of primers. cluster I.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
bp
1000
500
200
Figure 4: Restriction patterns of a 1586 bp fragment of the vdc region, digested with Hin6I. Lanes 1–3, 5, 7–11, 13, and 14, A. acidoterrestris
type I; 4, 6, 12, and 15, A. acidoterrestris type II; 16 A. acidoterrestris DSM 2498; 17, A. acidoterrestris ATCC49025; 18, A. acidiphilus DSM 14558;
19, A. herbarius DSM 13609; lane 20, molecular marker.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
bp
1000
500
200
Figure 5: Restriction patterns of a 1586 bp fragment of the vdc region, digested with HphI. Lanes 2–4, 6, 8–12, 14, and 15, A. acidoterrestris
type I; 5, 7, 13, and 16, A. acidoterrestris type II; 17 A. acidoterrestris DSM 2498; 18, A. acidoterrestris ATCC49025; 19, A. acidiphilus; 20, A.
herbarius; lane 1, molecular marker.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 bp 20 21 22 23 24 25 26 27 28
1000
500
200
Figure 6: Restriction patterns of a 1735 bp fragment of the rpoB gene, digested with BsuRI. Lanes 1–4, 6, and 8–10, A. acidoterrestris type I; 5,
7, 21, 22, and 24-26, A. acidoterrestris type II; 23, A. acidoterrestris type IIA; 27, A. acidocaldarius type II, 28, A. acidocaldarius type IA; 11, A.
acidoterrestris DSM 2498; 12, A. acidoterrestris ATCC49025; 13, A. acidiphilus; 14, A. hesperidum; 15, A. herbarius; 16, A. acidocaldarius A1; 17,
B. subtilis; 18, G. stearothermophilus; lane 19, molecular marker.
Figure 7: Restriction patterns of a 1735 bp fragment of rpoB gene, digested with Hin6I. Lanes 3 and 5, A. acidoterrestris type I; 1, 2, 4, and 6, A.
acidoterrestris type II; 17, A. acidocaldarius type I; 18, A. acidocaldarius type II; 8, A. acidoterrestris DSM 2498; 9, A. acidoterrestris ATCC49025;
10, A. acidiphilus; 11, A. hesperidum; 12, A. herbarius; 13, A. acidocaldarius A1; 14, B. subtilis; 15, G. stearothermophilus; lanes 7 and 16, molecular
marker.
Figure 8: Restriction patterns of a 1735 bp fragment of rpoB gene, digested with HphI. Lanes 1-4, 6, 8-11, 13, 25, and 27, A. acidoterrestris I;
5, 7, 12, 26, and 28, A. acidoterrestris II; 24, A. acidoterrestris IIA; 29, A. acidocaldarius IA; 30, A. acidocaldarius type II; 15, A. acidoterrestris
DSM 2498; 16, A. acidoterrestris ATCC49025; 17, A. acidiphilus; 18, A. hesperidum; 19, A. herbarius; 20, A. acidocaldarius A1; 21, B. subtilis; 22,
G. stearothermophilus; lanes 14 and 23, molecular marker.
DSM_2498 0.00032 classified as type II in other analyses. Two of the three

31 -0.00032 patterns of A. acidocaldarius differ with only one band.
34 -0.00256
41 0 A. acidocaldarius DSM 446 represents cluster II of the A.
ATCC_49025 0.00224 acidocaldarius group, while A. acidocaldarius A1 represents
55 0.00056
56 -0.00092 cluster I.
52 -0.00018
33 0
51 0
53 -0.00013 3.4. DNA Sequencing. DNA sequencing was performed for
selected strains. Sequencing of the 16S rDNA gene was
Figure 9: Phylogenetic tree of partial 16S rRNA sequence of 11 A. performed to confirm the proper identification of the isolates
acidoterrestris isolates. The tree was constructed by neighbor joining and to identify the non-Alicyclobacillus isolates. The 16S
method using Clustal Omega software. rDNA sequence of strains 31 and 34, classified as type I,
showed the greatest similarity to A. acidoterrestris DSM 2498,
also classified as type I. The sequences of strains 33, 51, 52, 53,
For Hin6I there were two types of patterns for the A. 55, and 56, classified as type II, showed the greatest similarity
acidoterrestris and A. acidocaldarius. A. acidoterrestris DSM to A. acidoterrestris ATCC 49025, also classified as type II. The
2498 belongs to the cluster I, while A. acidoterrestris ATCC sequence of strain 41, classified as type II, showed the greatest
49025 belongs to the cluster II. A. acidocaldarius DSM 446 similarity to A. acidoterrestris DSM 3922.
represents cluster II of the A. acidocaldarius group, while A. Figure 9 shows the phylogenetic tree constructed from the
acidocaldarius A1 represents cluster I. 16S rDNA sequences of analyzed strains of A. acidoterrestris.
HphI endonuclease produces two types of patterns for The sequence analysis indicates that A. acidoterrestris DSM
A. acidoterrestris, analogically as before, and three types of 2498 and two other type I strains are closely related and it
patterns for A. acidocaldarius. One sample of A. acidoter- shows greater variation within class II strains. The isolates
restris cluster II has a slightly different pattern and has been selected for sequencing represent both groups and different
sources which they were isolated from: concentrated apple by genetic methods as A. acidoterrestris or A. acidocaldarius.
juice (isolates 33 and 41), fresh apples (isolate 34), concen- A. acidoterrestris isolates were grouped in two major clusters.
trated blackcurrant juice (isolate 31), concentrated raspberry 27 of the isolates belonged to the cluster I, and 33 to the
juice (isolate 56), concentrated beetroot juice (isolate 51), cluster II. Also, A. acidocaldarius isolates were grouped into
and concentrated cherry juice (isolates 52, 53, and 55). The two clusters, but showed more intracluster diversity.
sequence analysis shows no apparent correlation between These results support the observations made by Osopale
diversity of the 16S rDNA sequence and the sources of the at al. [60] and Durak et al. [23] who also reported two genetic
isolates. clusters among analyzed A. acidoterrestris samples, by RAPD
Five whole vdc gene clusters were sequenced. Two of them analysis,and by 16S rDNA sequencing, respectively.
were isolated from the reference strains, A. acidoterrestris Most of the strains analyzed in this study were isolated
DSM 2498, and A. acidoterrestris ATCC 49025. 2416 bp from concentrated apple juice, as this is the main subject of
fragments of the vdc regions were aligned. The vdc region the Alicyclobacillus focused screening made or outsourced by
sequence of strains 15 and 34, classified as type I, showed polish fruit industry; however, it is one of the main subjects
99.9% identity with the vdc sequence of A. acidoterrestris of similar screenings performed by fruit industry worldwide.
DSM 2498; the sequence of strain 41, classified as type A. acidoterrestris representing both clusters have been found
II, showed 99.3% identity with the vdc sequence A. aci- in concentrated apple juice. For other sources, three A.
doterrestris ATCC 49025. Vdc sequences of A. acidoterrestris acidoterrestris cluster II isolates have been found in orange
DSM 2498 and A. acidoterrestris DSM 49025 showed 94.5% juices, two cluster I in concentrated black currant juice, and
identity. For the last pair, protein sequences of the gene three cluster II in concentrated cherry juice; however, these
products showed 98.5% positives and 96.5% identities for are only single observations and further research is needed to
VdcB, 99.4% and 98.9% for VdcC, and 100% and 97.4% for establish if A. acidoterrestris strains representing both clusters
VdcD. are found in other juices.
RpoB gene sequencing was performed to confirm that Genetic methods are broadly used in the detection,
both primer pairs, Gru3–Gru4 and Gru5–Gru6, enabled characterization, and differentiation of microorganisms. The
to amplify the correct DNA fragment and that degenera- application of PCR-RFLP in the characterization of Ali-
tion of the primers did not affect the sequence specificity, cyclobacillus and other thermoacidophilic bacteria isolated
although the degenerated primers produced significantly from the apple juice processing environment has been
lower amount of PCR product. All of the sequences obtained described by Chen et al. [52], although only the 16S rDNA
showed greatest similarity to the appropriate rpoB genes. gene was the subject of this study and the Hin6I enzyme
The GenBank accession numbers are KX371237- was not used. RpoB gene has never been subjected to PCR-
KX371249 for 16S rDNA sequences; KX453673-KX453677 RFLP or any other genetic analysis of Alicyclobacillus so
for full vdc region sequences; KX453678 and KX453679 for far, although the value of this gene in taxonomy has been
partial vdc sequences of A. herbarius and A. acidiphilus, confirmed by many studies on other microorganisms. To
respectively; and KX453680- KX453682 for partial rpoB date, there are no reports on the use of the vdc gene cluster in
sequences. taxonomic studies of microorganisms, although its sequence
may be proven valuable for research both on the vectors and
diversity and evolution of the element itself. Hin6I restriction
4. Discussion patterns for 16S rDNA were sufficient to differentiate between
all the species analyzed, but provided no closer data on
Among more than one thousand samples of concentrated intraspecies diversity. The diversity was revealed both by the
apple juice tested in our laboratory between 2004 and 2012, rpoB gene and vdc region RFLP analyses.
67% was contaminated with Alicyclobacillus sp., and 31% of Vdc gene cluster of Streptomyces sp., described by Chow
the isolates were identified as A. acidoterrestris [59]. The et al. [55], consists of three genes: vdcB (0.6kb), vdcC (1.4 kb),
statistics show that Alicyclobacillus spoilage is still a major and vdcD (0.2 kb), transcribed as single, policistronic mRNA
concern in the fruit processing industry. molecule. All three genes were essential to produce guaiacol
In this study, 75 guaiacol producing and non-guaiacol from vanillic acid. Niwa and Kawamoto [38] described
producing strains were isolated from various fruit juices, analogical gene cluster in A. acidoterrestris, consisting of
concentrated fruit juices, and fresh apples. Additionally, ORF1 (597 bp), ORF2 (1425 bp), and ORF3 (321 bp). Three
8 reference strains were used. The isolates and reference respective open reading frames were found in all five analyzed
strains were examined using classic methods, and PCR- vdc sequences.
RFLP focusing on 16S rDNA and rpoB gene fragments as Alicyclobacillus acidoterrestris RFLP patterns of both
well as the vdc region fragment. For selected strains, DNA the rpoB gene and vdc region showed consistently that
sequencing of the 16S rDNA gene was performed. Sixty of there were two major types among the isolates, one similar
the isolates analyzed were identified as A. acidoterrestris, to the reference strain A. acidoterrestris DSM 2498, and
12 as A. acidocaldarius, one as Brevibacillus agri, and two the other similar to the reference strain A. acidoterrestris
as Bacillus ginsengihumi. Four of the isolates, which gave ATCC 49025. Obtaining such consistent data concerning
ambiguous results during classic identification (nontypical two genetic elements of distant function reveals that there is
colour on an erythritol medium or lack of growth at 65∘ C deeper intraspecies genetic diversity in the A. acidoterrestris
connected with lack of guaiacol production), were identified species. This division may be considered when examining
other features of Alicyclobacillus such as susceptibility to fatty acids, isolated from herbal tea,” International Journal of
temperature or high hydrostatic pressure, in order to establish Systematic and Evolutionary Microbiology, vol. 52, no. 1, pp. 109–
if there are any differences between the groups. 113, 2002.
Both the rpoB gene and vdc region seem to be single- [7] K. Goto, Y. Tanimoto, T. Tamura et al., “Identification
copy genetic elements and showed no signs of intragenomic of thermoacidophilic bacteria and a new Alicyclobacillus
heterogeneity, which often makes the RFLP comparison of genomic species isolated from acidic environments in Japan,”
rDNA genes harder to perform. Extremophiles, vol. 6, no. 4, pp. 333–340, 2002.
The sequence analysis of the 16S rDNA fragment of [8] H. Matsubara, K. Goto, T. Matsumura et al., “Alicyclobacillus
selected isolates shows no apparent correlation between acidiphilus sp. nov., a novel thermo-acidophilic, 𝜔-alicyclic
fatty acid-containing bacterium isolated from acidic beverages,”
diversity of the 16S rDNA sequence and the sources which
International Journal of Systematic and Evolutionary Microbiol-
the strains were isolated from. ogy, vol. 52, no. 5, pp. 1681–1685, 2002.
In conclusion, the application of PCR-RFLP has been
[9] R. V. Orr, R. L. Shewfelt, C. J. Huang, S. Tefera, and L. R.
proven to be a fast and reliable method for Alicyclobacillus Beuchat, “Detection of guaiacol produced by Alicyclobacillus
identification and differentiation. The method is also techni- acidoterrestris in apple juice by sensory and chromatographic
cally less difficult than most of other molecular techniques. analyses, and comparison with spore and vegetative cell popu-
Two major groups of A. acidoterrestris have been identified. lations,” Journal of Food Protection, vol. 63, no. 11, pp. 1517–1522,
The primers designed for this study could be useful in further 2000.
research on Alicyclobacillus. [10] G. L. Pettipher, M. E. Osmundson, and J. M. Murphy, “Methods
for the detection and enumeration of Alicyclobacillus acidoter-
restris and investigation of growth and production of taint in
Data Availability fruit juice and fruit juice-containing drinks,” Letters in Applied
The DNA sequences obtained during this study have been Microbiology, vol. 24, no. 3, pp. 185–189, 1997.
deposited in GenBank, and the accession numbers are [11] A. C. N. F. Spinelli, A. S. Sant󸀠Ana, S. Rodrigues Jr., and
included within the article. P. R. Massaguer, “Influence of different filling, cooling, and
storage conditions on the growth of Alicyclobacillus acidoter-
restris CRA7152 in orange juice,” Applied and Environmental
Conflicts of Interest Microbiology, vol. 75, no. 23, pp. 7409–7416, 2009.
[12] M. C. Maldonado, C. Belfiore, and A. R. Navarro, “Temperature,
The authors declare that they have no conflicts of interest. soluble solids and pH effect on Alicyclobacillus acidoterrestris
viability in lemon juice concentrate,” Journal of Industrial
Acknowledgments Microbiology and Biotechnology, vol. 35, no. 2, pp. 141–144, 2008.
[13] M. N. U. Eiroa, V. C. A. Junqueira, and F. L. Schmidt, “Alicy-
Our research project was fully sponsored by Polish Ministry clobacillus in orange juice: Occurrence and heat resistance of
of Science and Higher Education, with funds for statutory spores,” Journal of Food Protection, vol. 62, no. 8, pp. 883–886,
activity. 1999.
[14] I. Walls and R. Chuyate, “Isolation of Alicyclobacillus acidoter-
restris from fruit juices,” Journal of AOAC International, vol. 83,
References no. 5, pp. 1115–1120, 2000.
[1] K. Yamazaki, H. Teouka, and H. Shinano, “Isolation and identi- [15] M. E. Parish and R. M. Goodrich, “Recovery of presumptive
fication of alicyclobacillus acidoterrestris from acidic beverages,” Alicyclobacillus strains from orange fruit surfaces,” Journal of
Bioscience, Biotechnology, and Biochemistry, vol. 60, no. 3, pp. Food Protection, vol. 68, no. 10, pp. 2196–2200, 2005.
543–545, 1996. [16] D. F. Splittstoesser, J. J. Churey, and C. Y. Lee, “Growth
[2] G. DARLAND and T. D. BROCK, “Bacillus acidocaldar- characteristics of aciduric sporeforming bacilli isolated from
ius sp.nov., an Acidophilic Thermophilic Spore-forming Bac- fruit juices,” Journal of Food Protection, vol. 57, no. 12, pp. 1080–
terium,” Journal of General Microbiology, vol. 67, no. 1, pp. 9–15, 1083, 1994.
1971. [17] J. Baumgart, M. Husemann, and C. Schmidt, “Alicyclobacil-
[3] G. Deinhard, P. Blanz, K. Poralla, and E. Altan, “Bacillus lus acidoterrestris: vorkommen, bedeutung und nachweis in
acidoterrestris sp. nov., a new thermotolerant acidophile isolated getränken und getränkegrundstoffen,” Flussiges Obst, vol. 64,
from different soils,” Systematic and Applied Microbiology, vol. pp. 178–180, 1997.
10, no. 1, pp. 47–53, 1987. [18] C. A. Wisse and M. E. Parish, “Isolation and enumeration of
[4] G. Deinhard, J. Saar, W. Krischke, and K. Poralla, “Bacillus spore-forming, thermoacidophilic, rod-shaped bacteria from
cycloheptanicus sp. nov., a new thermoacidophile containing 𝜔- citrus processing environments,” Dairy Food Environmental
cycloheptane fatty acids,” Systematic and Applied Microbiology, Sanitation, vol. 18, pp. 504–509, 1998.
vol. 10, no. 1, pp. 68–73, 1987. [19] J. Baumgart and S. Menje, “The impact of Alicyclobacillus
[5] L. Albuquerque, F. A. Rainey, A. P. Chung et al., “Alicyclobacillus acidoterestris on the quality of juices and soft drinks,” Fruit
hesperidum sp. nov. and a related genomic species from solfa- Process, vol. 10, pp. 251–254, 2000.
taric soils of Sao Miguel in the Azores,” International Journal [20] S. Y. Eguchi, G. P. Manfio, M. E. Pinhatti, E. Azuma, and S.
of Systematic and Evolutionary Microbiology, vol. 50, no. 2, pp. F. Variane, “Acidotermofilic sporeforming bacteria (ATSB) in
451–457, 2000. orange juices: ecology, and involvement in the deterioration of
[6] K. Goto, H. Matsubara, K. Mochida et al., “Alicyclobacillus fruit juices Report of the Research Project, Part II,” Fruit Process,
herbarius sp. nov., a novel bacterium containing 𝜔-cycloheptane vol. 11, pp. 55–62, 2001.
[21] P. A. Gouws, L. Gie, A. Pretorius, and N. Dhansay, “Isolation and Agricultural and Food Chemistry, vol. 55, no. 16, pp. 6692–6699,
identification of Alicyclobacillus acidocaldarius by 16S rDNA 2007.
from mango juice and concentrate,” International Journal of [38] M. Niwa and A. Kawamoto, “Development of a rapid detection
Food Science & Technology, vol. 40, no. 7, pp. 789–792, 2005. method of A. acidoterrestris, hazardous bacteria to acidic
[22] K. Goto, K. Mochida, Y. Kato et al., “Proposal of six species beverage,” Fruit Process, vol. 13, pp. 102–107, 2003.
of moderately thermophilic, acidophilic, endospore-forming [39] T. A. Eisele and M. J. Semon, “Best estimated aroma and
bacteria: Alicyclobacillus contaminans sp. nov., Alicyclobacillus taste detection threshold for guaiacol in water and apple juice,”
fastidiosus sp. nov., Alicyclobacillus kakegawensis sp. nov., Alicy- Journal of Food Science, vol. 70, no. 4, pp. S267–S269, 2005.
clobacillus macrosporangiidus sp. nov., Alicyclobacillus sacchari
[40] B. Zierler, B. Siegmund, and W. Pfannhauser, “Determination
sp. nov. and Alicyclobacillus shizuokensis sp. nov,” International
of off-flavour compounds in apple juice caused by microor-
Journal of Systematic and Evolutionary Microbiology, vol. 57, no.
ganisms using headspace solid phase microextraction-gas
6, pp. 1276–1285, 2007.
chromatography-mass spectrometry,” Analytica Chimica Acta,
[23] M. Z. Durak, J. J. Churey, M. D. Danyluk, and R. W. Worobo, vol. 520, no. 1-2, pp. 3–11, 2004.
“Identification and haplotype distribution of Alicyclobacillus
[41] K. S. Bahçeci and J. Acar, “Modeling the combined effects
spp. from different juices and beverages,” International Journal
of pH, temperature and ascorbic acid concentration on the
heat resistance of Alicyclobacillus acidoterrestis,” International
[24] B. Sokolowska, J. Niezgoda, A. Dekowska et al., “Incidence of Journal of Food Microbiology, vol. 120, no. 3, pp. 266–273, 2007.
Alicyclobacillus spp. in Polish apple and dark berry juice con-
[42] J. Baumgart, “Chapter 11 Media for the detection and enu-
centrates and the ability of isolated A. acidoterrestris strains to
meration of Alicyclobacillus acidoterrestris and Alicyclobacillus
spoilage of these juices,” Postępy Nauki i Technologii Przemysłu
acidocaldarius in foods,” in Progress in Industrial Microbiology,
Rolno-Spożywczego, vol. 71, no. 1, pp. 5–20, 2016.
vol. 37, pp. 161–166, Elsevier, 2003.
[25] I. Walls and R. Chuyate, “Alicyclobacillus historical perspective
[43] M. Lin, M. Al-Holy, S.-S. Chang et al., “Rapid discrimination
and preliminary characterization study,” Dairy Food Environ
of Alicyclobacillus strains in apple juice by Fourier transform
Sanitation18, pp. 499–503, 1998.
infrared spectroscopy,” International Journal of Food Microbiol-
[26] H.-A. Duong and N. Jensen, “Spoilage of iced tea by Alicy- ogy, vol. 105, no. 3, pp. 369–376, 2005.
clobacillus,” Food Australia, vol. 52, no. 7, p. 292, 2000.
[44] J. Wang, T. Yue, Y. Yuan, X. Lu, J.-H. Shin, and B. Rasco,
[27] M. Niwa and A. Kuriyama, “A. acidoterrestris rapid detection “Discrimination of alicyclobacillus strains using nitrocellulose
kit,” Fruit Process, vol. 13, pp. 328–331, 2003. membrane filter and attenuated total reflectance fourier trans-
[28] K. S. Bahçeci, V. Gökmen, and J. Acar, “Formation of guaiacol form infrared spectroscopy,” Journal of Food Science, vol. 76, no.
from vanillin by Alicyclobacillus acidoterrestris in apple juice: A 2, pp. 137–142, 2011.
model study,” European Food Research and Technology, vol. 220, [45] M. A. Al-Holy, M. Lin, O. A. Alhaj, and M. H. Abu-Goush,
no. 2, pp. 196–199, 2005. “Discrimination between Bacillus and Alicyclobacillus Isolates
[29] R. C. Witthuhn, E. van der Merwe, P. Venter, and M. Cameron, in Apple Juice by Fourier Transform Infrared Spectroscopy and
“Guaiacol production from ferulic acid, vanillin and vanillic Multivariate Analysis,” Journal of Food Science, vol. 80, no. 2, pp.
acid by Alicyclobacillus acidoterrestris,” International Journal of M399–M404, 2015.
Food Microbiology, vol. 157, no. 1, pp. 113–117, 2012.
[46] W. H. Groenewald, P. A. Gouws, and R. C. Witthuhn, “Isolation,
[30] A. Borlinghaus and R. Engel, “Alicyclobacillus incidence in com- identification and typification of Alicyclobacillus acidoterrestris
mercial apple juice concentrate (AJC) supplies and validation,” and Alicyclobacillus acidocaldarius strains from orchard soil
Fruit Process, vol. 7, pp. 262–266, 1997. and the fruit processing environment in South Africa,” Food
[31] D. F. Splittstoesser, C. Y. Lee, and J. J. Churey, “Control of Microbiology, vol. 26, no. 1, pp. 71–76, 2009.
Alicyclobacillus in the juice industry,” Dairy Food Environ [47] J. Zhang, T. Yue, and Y. Yuan, “Alicyclobacillus contamination
Sanitation, vol. 18, pp. 585–587, 1998. in the production line of Kiwi products in China,” PLoS ONE,
[32] N. Jensen, “Alicyclobacillus in Australia,” Food Australia, vol. 52, vol. 8, no. 7, p. e67704, 2013.
no. 7, pp. 282–285, 2000. [48] I. C. McKnight, M. N. U. Eiroa, A. S. Sant’Ana, and P. R.
[33] I. Walls and R. Chuyate, “Spoilage of fruit juices by Alicyclobacil- Massaguer, “Alicyclobacillus acidoterrestris in pasteurized exotic
lus acidoterrestris,” Food Australia, vol. 52, no. 7, pp. 293–295, Brazilian fruit juices: Isolation, genotypic characterization and
2000. heat resistance,” Food Microbiology, vol. 27, no. 8, pp. 1016–1022,
[34] N. Jensen and F. B. Whitfield, “Role of Alicyclobacillus acidoter- 2010.
restris in the development of a disinfectant taint in shelf-stable [49] L. Félix-Valenzuela, I. Guardiola-Avila, A. Burgara-Estrella, M.
fruit juice,” Letters in Applied Microbiology, vol. 361, pp. 9–14, Ibarra-Zavala, and V. Mata-Haro, “Genotypic and phenotypic
2003. diversity of Alicyclobacillus acidocaldarius isolates,” Letters in
[35] D. Gocmen, A. Elston, T. Williams, M. Parish, and R. L. Applied Microbiology, vol. 61, no. 4, pp. 367–373, 2015.
Rouseff, “Identification of medicinal off-flavours generated by [50] J. D. Wisotzkey, P. Jurtshuk Jr., G. E. Fox, G. Deinhard, and
Alicyclobacillus species in orange juice using GC-olfactometry K. Poralla, “Comparative sequence analyses on the 16S rRNA
and GC-MS,” Letters in Applied Microbiology, vol. 40, no. 3, pp. (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and
172–177, 2005. Bacillus cycloheptanicus and proposal for creation of a new
[36] M. Niwa, “Control of hazardous bacteria in acidic beverages genus, Alicyclobacillus gen. nov,” International Journal of Sys-
by using a guaiacol detection kit (peroxidase method,” Fruit tematic Bacteriology, vol. 42, no. 2, pp. 263–269, 1992.
Process, vol. 15, pp. 388–392, 2005. [51] C. J. Connor, H. Luo, B. B. McSpadden Gardener, and H.
[37] B. Siegmund and B. Pöllinger-Zierler, “Growth behavior of H. Wang, “Development of a real-time PCR-based system
off-flavor-forming microorganisms in apple juice,” Journal of targeting the 16S rRNA gene sequence for rapid detection of
Alicyclobacillus spp. in juice products,” International Journal of

Food Microbiology, vol. 99, no. 3, pp. 229–235, 2005.
[52] S. Chen, Q. Tang, X. Zhang et al., “Isolation and characterization
of thermo-acidophilic endospore-forming bacteria from the
concentrated apple juice-processing environment,” Food Micro-
biology, vol. 23, no. 5, pp. 439–445, 2006.
[53] K. Goto, A. Nishibori, Y. Wasada, K. Furuhata, M. Fukuyama,
and M. Hara, “Identification of thermo-acidophilic bacteria
isolated from the soil of several Japanese fruit orchards,” Letters
in Applied Microbiology, vol. 46, no. 3, pp. 289–294, 2008.
[54] J. Chen, X. Ma, Y. Yuan, and W. Zhang, “Sensitive and rapid
detection of Alicyclobacillus acidoterrestris using loop-mediated
isothermal amplification,” Journal of the Science of Food and
Agriculture, vol. 91, no. 6, pp. 1070–1074, 2011.
[55] K. T. Chow, M. K. Pope, and J. Davies, “Characterization of a
vanillic acid non-oxidative decarboxylation gene cluster from
Streptomyces sp. D7,” Microbiology, vol. 145, no. 9, pp. 2393–
2403, 1999.
[56] K. Matsubara, “A method for detecting and/or identifying gua-
iacol producing micro organism,” Patent no. JP2003000259A,
2003.
[57] Y. Wang, T. Yue, Y. Yuan, and Z. Gao, “Isolation and identifi-
cation of thermo-acidophilic bacteria from orchards in china,”
Journal of Food Protection, vol. 73, pp. 390–394, 2010.
[58] M. Shemesh, R. Pasvolsky, N. Sela, S. J. Green, and V. andZakin,
“Draft Genome Sequence of Alicyclobacillus acidoterrestris
Strain ATCC 49025,” Genome Announcement, vol. 1, no. 5,
Article ID e00638–13, 2013.
[59] B. Sokołowska, S. Skapska, M. Fonberg-Broczek et al., “Factors
influencing the inactivation of Alicyclobacillus acidoterrestris
spores exposed to high hydrostatic pressure in apple juice,” High
Pressure Research, vol. 33, no. 1, pp. 73–82, 2013.
[60] B. A. Osopale, C. R. Witthuhn, J. Albertyn, and F. A. Oguntoy-
inbo, “Culture dependent and independent genomic identifica-
tion of Alicyclobacillus species in contaminated commercial fruit
juices,” Food Microbiology, vol. 56, pp. 21–28, 2016.
Hindawi
https://doi.org/10.1155/2018/4301628
Research Article
Characteristics of Escherichia coli Isolated from Bovine Mastitis
Exposed to Subminimum Inhibitory Concentrations of Cefalotin
or Ceftazidime
Gang Liu,1 Laidi Ding,1 Bo Han ,1 Sofie Piepers,2 S. Ali Naqvi ,3 Herman W. Barkema,2,3
Tariq Ali ,1 Sarne De Vliegher ,2 Siyu Xu,1 and Jian Gao 1
1
Department of Clinical Veterinary Medicine, College of Veterinary Medicine, China Agricultural University, Beijing, China
2
M-team and Mastitis and Milk Quality Research Unit, Department of Reproduction, Obstetrics, and Herd Health,
Faculty of Veterinary Medicine, Ghent University, Ghent, Belgium
3
Department of Production Animal Health, Faculty of Veterinary Medicine, University of Calgary, Calgary, Canada
Correspondence should be addressed to Jian Gao; gaojian2016@cau.edu.cn
Received 2 August 2018; Accepted 9 October 2018; Published 1 November 2018
Copyright © 2018 Gang Liu et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Escherichia coli is a major udder pathogen causing clinical mastitis in dairy cattle and its heat stable endotoxin in powdered infant
formula milk is a potential risk factor in neonatal infections. Cephalosporins are frequently used for treatment of mastitis caused
by mastitis; however, use of these antimicrobials may induce antimicrobial resistance in E. coli. The objective of this study was to
explore the in vitro effect of subminimum inhibitory concentrations (sub-MIC) of cefalotin (CF) and ceftazidime (CAZ) on the
morphology, antimicrobial resistance, and endotoxin releasing characteristics of 3 E. coli isolates recovered from bovine clinical
mastitis. The parent E. coli isolates, which were susceptible to CF and CAZ, were exposed to CF or CAZ separately at sub-MIC
levels to produce 9 generations of induced isolates. Colonies of the CAZ-induced isolates from all 3 parent E. coli were smaller on
blood agar and the bacteria became filamentous, whereas the CF-induced isolates did not demonstrate prominent morphological
changes. After induction by CF or CAZ, many induced isolates showed resistance to cefoxitin, CAZ, CF, kanamycin, ampicillin,
and amoxicillin/clavulanic acid while their parent isolates were susceptible to these antimicrobials. Notably, 5 CAZ-induced isolates
from the same parent isolate were found to produce extended-spectrum beta-lactamase (ESBL) though none of the tested ESBL
related genes could be detected. All CAZ-induced isolates released more endotoxin with a higher release rate, whereas endotoxin
release of CF-induced E. coli isolates was not different from parent isolates. The exposure of cephalosporins at sub-MIC levels
induced resistant Escherichia coli. We inferred that cephalosporins, especially CAZ, should be used prudently for treatment of
clinical E. coli mastitis.
1. Introduction can remain biologically active in powdered infant formula

milk because it is heat stable at 100∘ C and, therefore, may pose
Mastitis is one of the most common and costly diseases for a potential risk to formula fed neonates [8].
the dairy industry worldwide. Mastitis also affects animal The efficacy and necessity of antimicrobial therapy for
welfare and is a frequent reason that cows are culled [1]. Treat- treatment of E. coli mastitis are still a topic of debate [9].
ment of mastitis accounts for the majority of antimicrobials However, fluoroquinolones and cephalosporins, particularly
administered to dairy cows [2, 3]. Gram-negative bacteria, 3rd and 4th generation products, are the only antimicrobials
mostly coliforms, including Escherichia coli, Klebsiella spp., for which there is supporting evidence of beneficial effects in
and Enterobacter spp., cause a high proportion of all clinical treatment of E. coli mastitis [10, 11]. It is noteworthy that these
mastitis (CM) cases [4–6]. Escherichia coli is the most 2 classes of antimicrobial agents are also important drugs
common Gram-negative species causing CM in dairy cattle for human health. The prevalence of resistance against these
[4, 6, 7]. The endotoxin of E. coli, lipopolysaccharide (LPS), important antibiotics, particularly in E. coli, is increasing
worldwide in veterinary and human medicine [12–14]. The and 1/2 of the MIC of CF was again dissolved in Mueller-
2 main factors involved in development of antimicrobial Hinton broth (Luqiao, Beijing, China) containing 1.5 x 106
resistance in bacteria are the presence of resistance genes CFU/mL of CF-1 groups. After 24 h of incubation at 37∘ C, the
and selective pressure of antimicrobial agents, especially 2nd generation induced mutant was obtained and identified
if suboptimal doses are administered [15]. Currently, very as CF-2 group. The same steps were repeated another 7
limited studies have been conducted to elucidate the influ- times. Induced E. coli isolates recovered after subsequent
ence of cephalosporin dosage on induction of antimicrobial induction were designated CF-3, CF-4, CF-5, CF-6, CF-7,
resistance in E. coli isolated from CM. First-generation CF-8, and CF-9. Escherichia coli isolates were recovered after
cephalosporins are less critical for human health, although induction with CAZ, using procedures identical to those
they primarily have a Gram-positive spectrum, with limited mentioned above for CF. Isolates recovered after induction
activity against Gram-negative bacteria [16, 17]. were identified as CAZ-1, CAZ-2, CAZ-3, CAZ-4, CAZ-5,
Induction of antimicrobial resistance in E. coli has been CAZ-6, CAZ-7, CAZ-8, and CAZ-9 (E4-CAZ, E11-CAZ, and
characterized by changes in morphology, including filamen- E21-CAZ). Parent isolates and all induced isolates recovered
tation, which is likely to protect the bacteria from deleterious after induction were stored in 30% glycerol at -80∘ C pending
effects of antimicrobials [18, 19]. There is also strong evidence further processing. When MICs of the parent E. coli and
that antimicrobials may enhance endotoxin release from E. induced isolates were determined, E. coli ATCC 25922 was
coli, which could exacerbate symptoms of CM [18]. used as a control strain. The CLSI breakpoints for CF were
The main objective of this study was, therefore, to deter- ≤ 8 휇g/mL (susceptible), 16 휇g/mL (intermediate), and ≥ 32
mine in vitro effects of sub-MIC exposure of cefalotin (CF) 휇g/mL (resistant). In case of CAZ, breakpoints for ceftiofur
or ceftazidime (CAZ) on 3 E. coli isolates recovered from (≤ 2 휇g/mL = susceptible, 4 휇g/mL = intermediate, and ≥ 8
bovine CM cases. Characteristics such as colony morphology, 휇g/mL = resistant) were used [20].
antimicrobial susceptibility profile, and release of endotoxin
from E. coli isolates recovered after induction were investi- 2.3. Morphological Observations. Stored isolates were recov-
gated. ered by streaking 100 휇L of suspension on tryptone soya agar
(TSA; Luqiao, Beijing, China) supplemented with 5% sheep
2. Materials and Methods blood and incubated for 24 h at 37∘ C. A pure growth was
picked and streaked on a new TSA plate. Shape, size, and color
2.1. Escherichia coli Isolates. Quarter milk samples (n=1252) of colonies were recorded. A single colony from agar was
were collected from July 2015 to May 2016 from dairy cows stained using the Gram-staining method and morphology
with CM from various dairy herds located in 16 Chinese examined with an optical microscope (Olympus, Tokyo,
provinces [7]. In total, 153 E. coli isolates were recovered, Japan).
of which 36 produced extended-spectrum beta-lactamase
(ESBL). More details on the origin and characteristics of the 2.4. Antimicrobial Susceptibility Testing. Antimicrobial sus-
E. coli isolates are described [12]. All isolates were tested ceptibility of the parent E. coli and isolates recovered after
for resistance to CF (30 휇g) and CAZ (30 휇g) using the induction was determined using Mueller-Hinton agar (BD,
Kirby-Bauer disk diffusion method, with clinical breakpoints Franklin Lakes, NJ) against 9 antimicrobial agents using the
following recommendations of the Clinical and Laboratory standard Kirby-Bauer disk diffusion method according to
Standards Institute [20]. Three E. coli isolates, subsequently CLSI recommendations [20]. Inhibition zone diameter (mm)
referred to as E4, E11, and E21, were selected from 3 provinces was measured using a ruler. The panel of antimicrobial agents
(Beijing, Shanghai, and Gansu) and used as parent E. coli consisted of ampicillin (10 휇g), amoxicillin/clavulanic acid
isolates in this study. The 3 isolates were susceptible to CF (20/10 휇g), CAZ (30 휇g), CF (30 휇g), cefepime (30 휇g),
and CAZ, did not produce ESBL, and did not carry any of cefoxitin (30 휇g), gentamicin (10 휇g), kanamycin (30 휇g), and
the tested ESBL encoding genes (data not shown). amikacin (30 휇g). For these antimicrobial agents, breakpoints
for cefepime and cefoxitin referred to E. coli isolates from
2.2. Experimental Design. All steps of the experiment were humans. Escherichia coli ATCC 25922 and Enterobacter cloa-
carried out in triplicate. A single colony was inoculated cae CMCC45301 were used as quality control strains.
into 20 mL trypticase soy broth (TSB; BD, Franklin Lake,
NJ) and incubated for 12 h at 37∘ C. Then, 200 휇L of the 2.5. Detection of ESBL Production. Parent isolates and all iso-
bacterial suspension (0.5 McFarland) was inoculated into lates recovered after induction were screened on MacConkey
20 mL Mueller-Hinton broth (Luqiao, Beijing, China) to agar containing cefotaxime (1 mg/L) for ESBL-production.
which 1/2 of the MIC was added for CF and CAZ separately Presumptive ESBL-producing isolates, if any, were further
and incubated for 24 h at 37∘ C. Subsequently, the bacterial confirmed by the double-disc synergy test, following recom-
suspension was centrifuged (6000 × g, 25∘ C, 5 min) (Anting, mendations of the CLSI [20], using antimicrobial discs of
Shanghai, China) and the pellet resuspended in a solution cefotaxime (30 휇g), cefotaxime plus clavulanic acid (30/10
containing 1.4 mL TSB and 0.6 mL glycerol (Luqiao, Beijing, 휇g), CAZ (30 휇g), and CAZ plus clavulanic acid (30/10
China) and stored pending further processing. These induced 휇g). Production of ESBL was considered positive if the
isolates (i.e., first generation of growth) are further referred inhibition zone of cefotaxime plus clavulanic acid or CAZ
to as CF-1 groups (E4-CF-1, E11-CF-1, and E21-CF-1). The plus clavulanic acid was ≥ 5 mm larger than their respective
MIC values for CF versus CF-1 groups were determined, single discs [20]. Escherichia coli ATCC 25922 (ESBL-negative
Table 1: Primers used to detect extended spectrum beta-lactamase encoding genes.
Genes Primer sequence (5耠 to 3耠 ) Amplicon size (bp)

푏푙푎CTX-M CGC TTT GCG ATG TGC AG 550
ACC GCG ATA TCG TTG GT
푏푙푎CTX-M-1 GTT ACA ATG TGT GAG AAG CAG 1041
CCG TTT CCG CTA TTA CAA AC
푏푙푎CTX-M-2 ATG ATG ACT CAG AGC ATT CGC CGC 876
TCA GAA ACC GTG GGT TAC GAT TTT
푏푙푎CTX-M-9 GTG ACA AAG AGA GTG CAA CGG 857
ATG ATT CTC GCC GCT GAA GCC
푏푙푎CTX-M-15 CAC ACG TGG AAT TTA GGG ACT 995
GCC GTC TAA GGC GAT AAA CA
푏푙푎TEM TTC TTG AAG ACG AAA GGG C 1150
ACG CTC AGT GGA ACG AAA AC
푏푙푎SHV CAC TCA AGG ATG TAT TGT G 885
TTA GCG TTG CCA GTG CTC G
푏푙푎OXA ACA CAA TAC ATA TCA ACT TCG C 813
AGT GTG TTT AGA ATG GTG ATC
strain) and Klebsiella pneumoniae ATCC 700603 (ESBL- Subsequently, bacterial solutions were diluted to 106 CFU/mL
positive strain) were used as reference strains. using TSB and bacteria were cultured aerobically at 37∘ C. At
various time points (0, 2, 4, 6, 8, and 10 h), aliquots were
2.6. Detection of ESBL-Related Genes. Bacterial DNA from collected and endotoxin release capability quantified. Briefly,
E. coli was isolated using the Bacterial DNA Extraction aliquots were collected and centrifuged at 6,000 × g for 15
Kit (Transgen, Beijing, China) according to the manufac- min. The supernatant of each aliquot was collected and stored
turer’s instructions. A PCR assay was conducted to detect at -20∘ C until further processing. Endotoxin concentration
the presence of 푏푙푎CTX-M , 푏푙푎CTX-M-1 , 푏푙푎CTX-M-2 , 푏푙푎CTX-M-9 , was measured using an enzyme-linked immunosorbent assay
푏푙푎CTX-M-15 , 푏푙푎SHV , 푏푙푎TEM , and 푏푙푎OXA genes, as described (ELISA) commercial kit (Sigma, St. Louis, MO). Each step
[21, 22] with minor modifications. The reaction mixture was performed following the manufacturer’s instructions. All
(20 휇L) consisted of 10 휇L of TaqMix (Transgen, Beijing, experiments were performed in triplicate.
China), 1 휇L of template DNA, 0.5 휇L of each primer (10 휇M;
Sunbiotech, Beijing, China), and 8 휇L of ultra-pure distilled 2.8. Statistical Analyses. Associations between endotoxin re-
water. Initial denaturation at 94∘ C for 5 min was followed by lease and exposure to sub-MICs of CF and CAZ were
35 cycles of amplification at 94∘ C for 45 s, annealing at 55∘ C determined by fitting a mixed effects linear regression model
for 30 s, and extension at 72∘ C for 60 s, and a final step with using replicate (n = 3) as the random effect with the lme4
extension at 72∘ C for 10 min. The PCR products were sepa- package (Bates et al., 2017) in R version 3.3.0 (R Core Team).
rated on a 2% agarose gel. Subsequently, PCR products were A P-value < 0.05 was considered statistically significant.
purified by TIANquick Midi Purification Kit (TIANGEN, Data were first visually examined to understand associations
Beijing, China) and then bidirectionally sequenced using the between time and endotoxin release. Due to the sigmoidal
nature of the association, data were normalized by taking
same primers by ABI 3730 sequencer (Applied Biosystems,
the natural logarithm of endotoxin release, which resulted
Foster City, CA). Gene sequences were aligned with BLASTN
in a more clearly parabolic association between incubation
software (http://www.ncbi.nlm.nih.gov/BLAST/) and com-
time and endotoxin release. Higher degree terms for time
pared to sequences available in GenBank. Klebsiella pneu-
were included to more accurately adjust for this parabolic
moniae ATCC 700603 (ESBL-positive strain) and ddH2 O,
relationship and isolate effects of treatment and generation
without template DNA, were used as positive and negative
of isolate on endotoxin release. The final model included
controls, respectively, in all PCR assays. Primers used in this treatment (CF, CAZ, or control) and an interaction with
study are presented in Table 1. generation (ranging from 1 to 9) as independent variables,
with an adjustment for incubation time modelled with cubic
2.7. Detection of Endotoxin Release. Isolates recovered after
and quadratic terms, as higher degree polynomial terms did
induction with CF or CAZ, as well as parent isolates, were not increase model fit as determined by P-value and change
used for this part of the study. Frozen bacteria were thawed at in restricted maximum likelihood criterion.
37∘ C for 60 min. Ten 휇L of suspension was streaked onto TSA
supplemented with 5% sheep blood and incubated for 24 h at
37∘ C. A single colony was picked from the agar, inoculated
3. Results
into 10 mL of TSB, and incubated for 18 h at 37∘ C. Bacterial 3.1. MICs of Cefalotin and Ceftazidime. The MICs of CF and
counts were measured using the 10-fold dilution method. CAZ for the parent E. coli isolates were 0.5-4 휇g/mL and
Table 2: Minimal inhibitory concentrations of cefalotin and ceftazidime against Escherichia coli isolates.
MIC of E. coli isolates (휇g/mL)

Isolate Antimicrobial Parent type -1∗ -2 -3 -4 -5 -6 -7 -8 -9
E4 Cefalotin† 4 8 32# 80 #
240 #
240 #
320# 320# 320# 320#
# #
Ceftazidime‡ 0.125 0.25 2 4 16 16 32# 32# 64# 128#
#
E11 Cefalotin 0.5 2 16 32 # # # # # #
Ceftazidime 1 4 8# 8# 16# 32# 32# 64 128# 128#
E21 Cefalotin 2 8 16 16 # # # # # #
Ceftazidime 0.5 1 4 4 8# 16# 16# 32# 32# 64#
No mark: susceptible or intermediate to cefalotin or ceftazidime; #: resistant to cefalotin or ceftazidime. Breakpoints for cefalotin were as follows: susceptible
⩽ 8 휇g/mL, intermediate 16 휇g/mL, and resistant ⩾ 32 휇g/mL. Breakpoints for ceftazidime were as follows: susceptible ⩽ 2 휇g/mL, intermediate 4 휇g/mL, and
resistant ⩾ 8 휇g/mL.
∗
Escherichia coli isolates at various generations that were induced by cefalotin or ceftazidime.
†MIC values of cefalotin were determined for E. coli isolates induced by cefalotin.
‡MIC values of ceftazidime were determined for E. coli isolates induced by ceftazidime.
Table 3: Antimicrobial susceptibility profiles of the Escherichia coli isolates recovered after induction with cefalotin.
Resistant E. coli isolates

Antimicrobial Derived from E4 Derived from E11 Derived from E21
Cefoxitin CF-3/-4/-5/-6/-7/-8/-9 CF-5/-6/-7/-8/-9 CF-5/-6/-7/-8/-9
Ceftazidime CF-5/-6/-7/-8/-9 CF-5/-6/-7/-8/-9 CF-7/-8/-9
Ampicillin CF-4/-5/-6/-7/-8/-9 CF-3/-4/-5/-6/-7/-8/-9 CF-6/-7/-8/-9
Amoxicillin/clavulanic acid CF-4/-5/-6/-7/-8/-9 CF-4/-5/-6/-7/-8/-9 CF-6/-7/-8/-9
Kanamycin∗ CF-4/-5/-6/-7/-8/-9 CF-7/-8/-9 CF-6/-7/-8/-9
∗
All E. coli isolates had intermediate resistance to cefoxitin, ceftazidime, and kanamycin.
0.125-1 휇g/mL, respectively; therefore, parent isolates were 6 and 4 isolates derived from E4 and E21 were resistant
susceptible to these 2 antimicrobial agents. The MIC values to ampicillin and amoxicillin/clavulanic acid, respectively,
of CF and CAZ against induced isolates are shown (Table 2). whereas 7 and 6 isolates derived from E11 became resis-
After exposure to sub-MIC of CF, 8, 7, and 6 isolates that were tant to ampicillin and amoxicillin/clavulanic acid. All CF-
derived from E4, E11, and E21, respectively, were resistant to induced isolates were susceptible to cefepime, gentamicin,
CF. After exposure to sub-MIC of CAZ, 6, 8, and 6 isolates and amikacin. Parent isolates remained susceptible to all
derived from E4, E11, and E21, respectively, were resistant to tested antimicrobial agents.
CAZ. Among CAZ-induced isolates, all were resistant to CF.
Nineteen isolates became resistant to cefoxitin, of which 6,
3.2. Morphological Characteristics. Morphological character- 7, and 6 were derived from E4, E11, and E21, respectively.
istics of E. coli isolates recovered after induction with CF Only 1 CAZ-induced isolate (CAZ-1 derived from E4) was
were similar to those of their parent isolates (Figures 1 and susceptible to ampicillin and amoxicillin/clavulanic acid. All
2). However, morphological changes on blood agar were isolates derived from E4 and E21 became intermediate to
observed in 17 isolates recovered after induction with CAZ kanamycin, whereas CAZ-1 from E11 remained susceptible
compared to their parent isolates. Of those isolates, 6, 5, (Table 4). All CAZ-induced isolates were susceptible to
and 6 were derived from E4, E11, and E 21, respectively. cefepime, gentamicin, and amikacin. Parent isolates were
Colonies of those isolates were smaller after 24 h incubation susceptible to all tested antimicrobial agents.
at 37∘ C and became sticky and were therefore difficult to
retrieve (Figure 1). Also, cells of all isolates recovered after 3.4. ESBL Production and ESBL-Related Genes. The differ-
induction with CAZ were elongated, with a filamentous shape ence in diameters between the inhibition zone of cefotaxime
(Figure 2). and cefotaxime plus clavulanic acid was < 5 mm for all
induced isolates, except 5 derived from E4 (CAZ-5 to CAZ-
3.3. Antimicrobial Susceptibility Profiles. Among CF-induced 9). The difference of the zone diameters for those 5 CAZ-
isolates, 17, 13, and 13 developed intermediate resistance to induced isolates was ≥ 5 mm (Figure 3), which was an
cefoxitin, ceftazidime, and kanamycin, respectively, whereas indication for ESBL production by those isolates. However,
no isolate was resistant to these 3 antimicrobial agents none of the tested ESBL-encoding genes were detected in
(Table 3). Of isolates with intermediate resistance to cefoxitin, ESBL-producing isolates.
7, 5, and 5 were derived from E4, E11, and E21, respectively. Of
isolates with intermediate resistance to kanamycin, 6, 3, and 4 3.5. Endotoxin Release. Endotoxin release increased with
were derived from E4, E11, and E21, respectively. In addition, time (2, 4, 6, 8, and 10 h) for 2 treatment types and control
(a) (b) (c)
(d) (e) (f)
(g) (h) (i)
Figure 1: Colony morphology of parent Escherichia coli and antibiotic-induced isolates recovered after induction (24 h). (a), (d), and (g) were
parent strains; (b), (e), and (h) were cefalotin-induced isolates; and (c), (f), and (i) were ceftazidime-induced isolates.
(P < 0.0001). The amount of endotoxin released by CAZ- of endotoxin released at the same time point for CF-induced
induced mutants differed from the parent E. coli isolates (P mutants compared to parent E. coli isolates (P = 0.70), nor
< 0.001). Therefore, CAZ at sub-MIC increased release of did endotoxin release by CF-mutants vary by generation (P =
endotoxin from induced E. coli mutants when compared to 0.79). Therefore, CF at sub-MIC did not increase endotoxin
parent strains (Figure 4). However, the amount of endotoxin release, compared to parent isolates, at any time point.
released by CAZ mutants was not associated with generation Both antibiotic type and incubation time were associated
of the isolate (P = 0.94). There was no difference in amount with endotoxin release (Table 5; Figure 4). All treatments
(a) (b) (c)
10m 10m 10m
(d) (e) (f)
10m 10m
10m
(g) (h) (i)
Figure 2: Cell morphology of parent Escherichia coli and isolates recovered after induction with antibiotics. Cells were subjected to Gram-
staining and examined with an optical microscope (1000×). (a), (d), and (g) were parent strains; (b), (e), and (h) were cefalotin-induced
isolates; and (c), (f), and (i) were ceftazidime-induced isolates.
followed similar release patterns over time, starting with a releasing of E. coli isolated from bovine CM under persistent
high rate of endotoxin release that plateaued after 6 h. exposure to CF and CAZ at sub-MIC. In this study, sub-MIC
in vitro exposure of CF and CAZ resulted not only in failure of
4. Discussion killing E. coli, but also in increased antimicrobial resistance.
In addition, exposure to CAZ led to generation of more
This was apparently the first study to characterize changes virulent strains of E. coli. Choice of antibiotic, administration
in morphology, antimicrobial resistance, and endotoxin route, and treatment duration are determined by many
Table 4: Antimicrobial susceptibility profiles of the Escherichia coli isolates recovered after induction with ceftazidime.
Resistant E. coli isolates

Antimicrobial Derived from E4 Derived from E11 Derived from E21
Cefalotin CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9 CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9 CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9
Cefoxitin CAZ-4/-5/-6/-7/-8/-9 CAZ-3/-4/-5/-6/-7/-8/-9 CAZ-4/-5/-6/-7/-8/-9
Ampicillin CAZ-2/-3/-4/-5/-6/-7/-8/-9 CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9 CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9
Amoxicillin/clavulanic acid CAZ-2/-3/-4/-5/-6/-7/-8/-9 CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9 CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9
Kanamycin∗ CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9 CAZ-2/-3/-4/-5/-6/-7/-8/-9 CAZ-1/-2/-3/-4/-5/-6/-7/-8/-9
∗
All E. coli isolates had intermediate resistance to kanamycin.
 
 
 
 
Difference in mm
Difference in mm
 
 
 
 
 
 
− −
− −
                   
Escherichia coli isolates Escherichia coli isolates
E4 E4
E11 E11
E21 E21
(a) (b)
Figure 3: Extended spectrum beta-lactamase (ESBL) production of isolates recovered after induction by cefalotin (a) or ceftazidime (b).
Isolates at various generations are listed on the X-axis. Differences were calculated as diameter of the inhibition zone of ceftazidime plus
clavulanic acid subtracted from their respective single discs. An isolate was designated an ESBL producer if the difference was > 5 mm.
factors [23], which makes the choice of treatment strategy Colonies of E. coli isolates recovered after induction
relatively subjective or arbitrary. Based on our findings, we with CAZ were smaller and stickier than the parent iso-
inferred that prudent usage of antibiotics should be proposed late. This was in accordance with a previous study that
when treating CM, particularly if caused by E. coli. growth of Bacteroides thetaiotaomicron isolates was slower
After continuous sub-MIC exposure to CF or CAZ, iso- after exposure to cefoxitin [28]. In our study, bacterial
lates became increasingly resistant to CF or CAZ, respectively. cells became extensively elongated (filamentation), consis-
Bacteria can quickly develop resistant phenotypes under tent with several E. coli strains that become filamentous
persistent cephalosporin stress [24]. In addition, several after exposure to various antimicrobial agents [18, 19, 29].
isolates became resistant to 훽-lactams (CF, cefoxitin, CAZ, Escherichia coli readily became filamentous in shape when
ampicillin, and amoxicillin/clavulanic acid) after exposure to exposed to cephalosporins [29]. Effects of antibiotics on
either CF or CAZ. Similarly, bovine E. coli strains isolated bacterial morphology or survival depend on both type and
from cows treated with ceftiofur became resistant to cefa- dosage [19, 30]. Antibiotics can kill bacteria by acting on
zoline, whereas strains not previously exposed to ceftiofur penicillin-binding proteins (PBPs) [31]. There are 3 kinds of
remained susceptible [25]. Resistance of E. coli strains to PBPs: PBP1, PBP2, and PBP3. Various types and dosages of
multiple antimicrobials could result in failure of mastitis antibiotics could bind to different PBPs, which may result in a
therapy and is a serious threat to human and animal health. morphology change of bacteria [30]. A high concentration of
Mutants of Pseudomonas aeruginosa isolated from humans CAZ can destroy bacteria quickly by inhibiting PBP1, whereas
became resistant to various antimicrobials after induction the same antibiotic administered at lower concentrations can
with ceftazidime [26]. Resistance to vancomycin increased lead to filamentation of bacteria [32]. In the present study,
in Staphylococcus aureus isolates, accompanied with mor- filamentation of isolates at 6th and later generations of growth
phologic alteration, after continuous exposure to ceftazidime was weaker than during earlier generations; perhaps induced
[27]. Results of these 2 studies were in accordance with our isolates were already adapted to antimicrobial exposure. It has
findings. been reported that the filamentous bacteria return to a typical
Endotoxin release (EU/ml)

150000 120000 150000
120000 120000
90000
90000 90000
60000
60000 60000
30000 30000 30000
0 0 0
0 2 4 6 8 10 0 2 4 6 8 10 0 2 4 6 8 10
Time (h) Time (h) Time (h)
E4 CAZ-1 CAZ-2 CAZ-3 CAZ-4 E4 CF-1 CF-2 CF-3 CF-4 E11 CAZ-1 CAZ-2 CAZ-3 CAZ-4
CAZ-5 CAZ-6 CAZ-7 CAZ-8 CAZ-9 CF-5 CF-6 CF-7 CF-8 CF-9 CAZ-5 CAZ-6 CAZ-7 CAZ-8 CAZ-9
(a) (b) (c)


120000 160000 120000
90000 120000 90000
60000 80000 60000
30000 40000 30000
0 0 0
0 2 4 6 8 10 0 2 4 6 8 10 0 2 4 6 8 10
Time (h) Time (h) Time (h)
E11 CF-1 CF-2 CF-3 CF-4 E21 CAZ-1 CAZ-2 CAZ-3 CAZ-4 E21 CF-1 CF-2 CF-3 CF-4
CF-5 CF-6 CF-7 CF-8 CF-9 CAZ-5 CAZ-6 CAZ-7 CAZ-8 CAZ-9 CF-5 CF-6 CF-7 CF-8 CF-9
(d) (e) (f)

Figure 4: Endotoxin release of Escherichia coli isolates included in the study at various time points (0, 2, 4, 6, 8, and 10 h).
Table 5: Results of a linear mixed regression model for log endotoxin release (log of EU/mL) by Escherichia coli after exposure to cefalotin
(CF) or ceftazidime (CAZ).
Parameter Estimate SEM P-value

Parent isolates (Ref.)∗ 6.07 0.11 <0.001
CAZ 0.50 5.01 x 10−3 <0.001
CF 0.02 5.01 x 10−3 0.699
Interactions†
CAZ x generation 3.78 x 10−4 5.23 x 10−3 0.942
CF x generation 1.39 x 10−3 5.23 x 10−3 0.791
Time (h) 1.60 0.02 <0.001
Time2 (h2 ) -0.16 5.39 x 10−3 <0.001
Time3 (h3 ) 0.01 3.54 x 10−4 <0.001
Between-replicate variance 0.03 0.16
Endotoxin release was measured at various time points (2, 4, 6, 8, and 10 h) and resistance was induced over varying numbers of generations.
∗
Baseline to which other samples were compared was a parent isolate (generation 0)
†Interactions were not created with the parent isolate as there was only 1 generation
bacillus shape after antibiotic removal, so filamentation was ESBL-encoding genes, as described [21, 22]. Nevertheless,
temporary [33]. Interestingly, isolates recovered after induc- other ESBL-encoding genes not targetted in this study may
tion with CF did not undergo obvious changes in colonial have been responsible for production of ESBL [34]. Moreover,
and bacterial morphology. Presumably, CF bound to different there might be a misinterpretation of data, since the differ-
PBPs, which did not make the cell filamentous. ence of 4 of 5 isolates was just at the threshold (5 mm) to
In this study, 5 isolates recovered after induction with detect ESBL phenotypes.
CAZ produced ESBL phenotype, while no ESBL-associated Release of endotoxins from the disrupted E. coli cell
genes were detected in these isolates. One potential rea- walls could cause a serious inflammatory reaction in an
son for this discrepancy might be that we were unable to infected udder [35]. Besides, high endotoxin in ingested
detect the genes that were responsible for ESBL production. infant formula milk might cause neonatal bacteraemia and
In the present study, we only tried to detect common endotoxemia, especially in neonates with immature innate
immune systems [8]. In our study, all parent and induced Recruitment Program (no. GDT20141100043 and no.
isolates released more endotoxin when incubation was pro- GDT20171100013), and the National Natural Science
longed, which was in accordance with reports that bacteria Foundation of China (no. 31572587 and no. 31550110200).
released more endotoxin in induction period by antibiotics The authors thank Dr. John Kastelic, Faculty of Veterinary
due to overexpression or shedding at higher speed from cell Medicine, University of Calgary, for editing the manuscript.
wall [36, 37]. Increased release of endotoxin from isolates
recovered after induction with CAZ may have been associated References
with filamentation of E. coli after exposure to CAZ [19,
30]. Filamentation of cells could increase the surface of the [1] A. J. Bradley, “Bovine mastitis: an evolving disease,” The Veteri-
cell wall with a higher endotoxin release from cell wall nary Journal, vol. 164, no. 2, pp. 116–128, 2002.
and, therefore, a higher releasing speed. In contrast, isolates [2] A. Kuipers, W. J. Koops, and H. Wemmenhove, “Antibiotic use
recovered after induction with CF did not produce more in dairy herds in the Netherlands from 2005 to 2012,” Journal of
endotoxin than parent isolates, which may be associated with Dairy Science, vol. 99, no. 2, pp. 1632–1648, 2016.
less morphological changes in these isolates. [3] M. Stevens, S. Piepers, and S. De Vliegher, “Mastitis prevention
Although a series of phenotypic changes (morphology, and control practices and mastitis treatment strategies associ-
antimicrobial resistance, and endotoxin releasing capability) ated with the consumption of (critically important) antimicro-
were observed in the current study, mechanism of bacteria’s bials on dairy herds in Flanders, Belgium,” Journal of Dairy
Science, vol. 99, no. 4, pp. 2896–2903, 2016.
acquired resistance after exposure to the antibiotics should
be further clarified. Therefore, a study including whole- [4] H. W. Barkema, Y. H. Schukken, T. J. G. M. Lam et al., “Incidence
of clinical mastitis in dairy herds grouped in three categories by
genome sequencing and analysis of acquired mutations
bulk milk somatic cell count,” Journal of Dairy Science, vol. 81,
should be conducted, to provide insights regarding the origin no. 2, pp. 411–419, 1998.
of observed resistance.
[5] J. E. Breen, M. J. Green, and A. J. Bradley, “Quarter and cow
risk factors associated with the occurrence of clinical mastitis
5. Conclusions in dairy cows in the United Kingdom,” Journal of Dairy Science,
vol. 92, no. 6, pp. 2551–2561, 2009.
After exposure to subminimum concentrations of CF or CAZ, [6] J. Verbeke, S. Piepers, K. Supré, and S. De Vliegher, “Pathogen-
parent E. coli CM isolates underwent a series of changes specific incidence rate of clinical mastitis in Flemish dairy
related to morphology, antimicrobial resistance pattern, and herds, severity, and association with herd hygiene,” Journal of
endotoxin release. Several isolates recovered after induction Dairy Science, vol. 97, no. 11, pp. 6926–6934, 2014.
had higher resistance to CF, CAZ, and some other commonly [7] J. Gao, H. W. Barkema, L. Zhang et al., “Incidence of clinical
used antimicrobials. Moreover, several isolates recovered mastitis and distribution of pathogens on large Chinese dairy
after induction with CAZ had slower growth on blood farms,” Journal of Dairy Science, vol. 100, no. 6, pp. 4797–4806,
agar, became filamentous, and released more endotoxin. 2017.
Therefore, we inferred that there shoud be prudent use [8] S. Townsend, J. Caubilla Barron, C. Loc-Carrillo, and S.
of cephalosporins, especially those that belong to the 3rd Forsythe, “The presence of endotoxin in powdered infant
generation, for treatment of bovine mastitis caused by E. formula milk and the influence of endotoxin and Enterobacter
sakazakii on bacterial translocation in the infant rat,” Food
coli. Such treatment would increase potential risk to formula
fed neonates if the milk with endotoxin was processed into
[9] L. Suojala, T. Pohjanvirta, H. Simojoki et al., “Phylogeny, viru-
powdered infant formula milk.
lence factors and antimicrobial susceptibility of Escherichia coli
isolated in clinical bovine mastitis,” Veterinary Microbiology,
Data Availability vol. 147, no. 3-4, pp. 383–388, 2011.
[10] B. Poutrel, M. R. Stegemann, O. Roy, F. Pothier, N. Tilt, and
The data used to support the findings of this study are M. Payne-Johnson, “Evaluation of the efficacy of systemic
available from the corresponding author upon request. danofloxacin in the treatment of induced acute Escherichia coli
bovine mastitis,” Journal of Dairy Research, vol. 75, no. 3, pp.
310–318, 2008.
[11] Y. H. Schukken, G. J. Bennett, M. J. Zurakowski et al., “Ran-
The authors declare that they have no conflicts of interest. domized clinical trial to evaluate the efficacy of a 5-day ceftiofur
hydrochloride intramammary treatment on nonsevere gram-
negative clinical mastitis,” Journal of Dairy Science, vol. 94, no.
Authors’ Contributions 12, pp. 6203–6215, 2011.
[12] T. Ali, S. Ur Rahman, L. Zhang et al., “ESBL-producing
Gang Liu and Laidi Ding contributed equally to this work. Escherichia coli from cows suffering mastitis in China contain
clinical class 1 integrons with CTX-M linked to ISCR1,” Frontiers
Acknowledgments in Microbiology, vol. 7, article no. 1931, 2016.
[13] J. Oteo, M. Pérez-Vázquez, and J. Campos, “Extended-spectrum
This research was financially supported by the Chinese 훽-lactamase producing Escherichia coli: changing epidemiology
13 “Five-year” National Science and Technology Support and clinical impact,” Current Opinion in Infectious Diseases, vol.
Project (no. 2016YFD0501203), High-end Foreign Experts 23, no. 4, pp. 320–326, 2010.
[14] T. Ali, S. U. Rahman, L. Zhang et al., “Characteristics and genetic [28] H. Fang, C. Edlund, K. Hultenby, and M. Hedberg, “Effects
diversity of multi-drug resistant extended-spectrum beta- of cefoxitin on the growth and morphology of Bacteroides
lactamase (ESBL)-producing Escherichia coli isolated from thetaiotaomicron strains with different cefoxitin susceptibility,”
bovine mastitis,” Oncotarget , vol. 8, no. 52, pp. 90144–90163, Anaerobe, vol. 8, no. 2, pp. 55–61, 2002.
2017. [29] G. Goscinski, E. Tano, E. Löwdin, and J. Sjölin, “Propensity to
[15] E. K. Silbergeld, J. Graham, and L. B. Price, “Industrial food ani- release endotoxin after two repeated doses of cefuroxime in an
mal production, antimicrobial resistance, and human health,” in vitro kinetic model: Higher release after the second dose,”
Annual Review of Public Health, vol. 29, pp. 151–169, 2008. Journal of Antimicrobial Chemotherapy, vol. 60, no. 2, pp. 328–
[16] V. Guérin-Faublée, G. Carret, and P. Houffschmitt, “In vitro 333, 2007.
activity of 10 antimicrobial agents against bacteria isolated from [30] A. S. M. Dofferhoff and J. Buys, “The influence of antibiotic-
cows with clinical mastitis,” Veterinary Record, vol. 152, no. 15, induced filament formation on the release of endotoxin from
pp. 466–471, 2003. Gram-negative bacteria,” Journal of Endotoxin Research, vol. 3,
[17] Y. Pfeifer, A. Cullik, and W. Witte, “Resistance to cephalosporins no. 3, pp. 187–194, 1996.
and carbapenems in Gram-negative bacterial pathogens,” Inter- [31] G. Sakoulas, M. Kumaraswamy, P. Nonejuie et al., “Differential
national Journal of Medical Microbiology, vol. 300, no. 6, pp. 371– effects of penicillin binding protein deletion on the suscepti-
379, 2010. bility of Enterococcus faecium to cationic peptide antibiotics,”
[18] J. Buijs, A. S. Dofferhoff, J. W. Mouton, and J. W. van der Meer, Antimicrobial Agents and Chemotherapy, vol. 59, no. 10, pp.
“Continuous administration of PBP-2- and PBP-3-specific 훽- 6132–6139, 2015.
lactams causes higher cytokine responses in murine Pseu- [32] J. Buijs, A. S. M. Dofferhoff, J. W. Mouton, J. H. Wagenvoort, and
domonas aeruginosa and Escherichia coli sepsis,” Journal of J. van der Meer, “A quantitative assessment of dose-dependent
Antimicrobial Chemotherapy, vol. 59, no. 5, pp. 926–933, 2007. 훽-lactam-induced filament-formation in Gram-negative bacte-
[19] J. J. Jackson, H. Kropp, and J. C. Hurley, “Influence of antibi- ria,” Clinical Microbiology and Infection, vol. 9, no. 4, pp. 88–91,
otic class and concentration on the percentage of release 2003.
of lipopolysaccharide from escherichia coli,” The Journal of [33] K. Chen, G. W. Sun, K. L. Chua, and Y.-H. Gan, “Modified
Infectious Diseases, vol. 169, no. 2, pp. 471-472, 1994. virulence of antibiotic-induced Burkholderia pseudomallei fil-
aments,” Antimicrobial Agents and Chemotherapy, vol. 49, no. 3,
[20] CLSI, Clinical and Laboratory Standards Institute, Performance
pp. 1002–1009, 2005.
standards for antimicrobial disk and dilution susceptibility tests
for bacteria isolated from animals—Third Edition: Approved [34] M. J. Day, I. Rodrı́guez, A. van Essen-Zandbergen et al., “Diver-
Standard Vet01S, 2015 Wayne, PA, USA. 2015. sity of STs, plasmids and ESBL genes among Escherichia coli
from humans, animals and food in Germany, the Netherlands
[21] A. Jouini, L. Vinue, K. B. Slama et al., “Characterization of CTX-
and the UK,” Journal of Antimicrobial Chemotherapy, vol. 71, no.
M and SHV extended-spectrum beta-lactamases and associated
5, pp. 1178–1182, 2016.
resistance genes in Escherichia colistrains of food samples in
Tunisia,” Journal of Antimicrobial Chemotherapy, vol. 60, no. 5, [35] Y. H. Schukken, J. Günther, J. Fitzpatrick et al., “Host-response
pp. 1137–1141, 2007. patterns of intramammary infections in dairy cows,” Veterinary
Immunology and Immunopathology, vol. 144, no. 3-4, pp. 270–
[22] H. Kanamori, R. B. Navarro, H. Yano et al., “Molecular charac-
289, 2011.
teristics of extended-spectrum 훽-lactamases in clinical isolates
of Enterobacteriaceae from the Philippines,” Acta Tropica, vol. [36] R. G. Holzheimer, “Antibiotic induced endotoxin release and
120, no. 1-2, pp. 140–145, 2011. clinical sepsis: a review,” Journal of Chemotherapy, vol. 13, suppl
2, no. 1, pp. 159–172, 2001.
[23] J. M. Swinkels, A. Hilkens, V. Zoche-Golob et al., “Social
influences on the duration of antibiotic treatment of clinical [37] P. M. Flynn, J. L. Shenep, F. Gigliotti, D. S. Davis, and W. K.
mastitis in dairy cows,” Journal of Dairy Science, vol. 98, no. 4, Hildner, “Immunolabeling of lipopolysaccharide liberated from
pp. 2369–2380, 2015. antibiotic-treated Escherichia coli,” Infection and Immunity, vol.
56, no. 10, pp. 2760–2762, 1988.
[24] S. Suzuki, N. Shibata, K. Yamane, J. Wachino, K. Ito, and Y.
Arakawa, “Change in the prevalence of extended-spectrum-
beta-lactamase-producing Escherichia coli in Japan by clonal
spread,” Journal of Antimicrobial Chemotherapy, vol. 63, no. 1,
pp. 72–79, 2008.
[25] T. Sato, T. Okubo, M. Usui et al., “Association of Veteri-
nary Third-Generation Cephalosporin Use with the Risk of
Emergence of Extended-Spectrum-Cephalosporin Resistance
in Escherichia coli from Dairy Cattle in Japan,” PLoS ONE, vol.
9, no. 4, Article ID e96101, 2014.
[26] G. Cabot, L. Zamorano, B. Moyà et al., “Evolution of Pseu-
domonas aeruginosa antimicrobial resistance and fitness under
low and high mutation rates,” Antimicrobial Agents and
[27] M. Roch, P. Clair, A. Renzoni et al., “Exposure of Staphylo-
coccus aureus to Subinhibitory Concentrations of 훽-Lactam
Antibiotics Induces Heterogeneous Vancomycin-Intermediate
Staphylococcus aureus,” Antimicrobial Agents and Chemother-
apy, vol. 58, no. 9, pp. 5306–5314, 2014.
Hindawi
https://doi.org/10.1155/2018/7309346
Review Article
Reviewing Interventions against Enterobacteriaceae in
Broiler Processing: Using Old Techniques for Meeting the New
Challenges of ESBL E. coli?
Michaela Projahn , Ewa Pacholewicz, Evelyne Becker, Guido Correia-Carreira,

Niels Bandick, and Annemarie Kaesbohrer
German Federal Institute for Risk Assessment, Diedersdorfer Weg 1, 12277 Berlin, Germany
Correspondence should be addressed to Michaela Projahn; michaela.projahn@bfr.bund.de
Received 2 August 2018; Revised 17 September 2018; Accepted 25 September 2018; Published 23 October 2018
Copyright © 2018 Michaela Projahn et al. This is an open access article distributed under the Creative Commons Attribution
cited.
Extended-spectrum beta-lactamase- (ESBL-) producing Enterobacteriaceae are frequently detected in poultry and fresh chicken
meat. Due to the high prevalence, an impact on human colonization and the spread of antibiotic resistance into the environment
is assumed. ESBL-producing Enterobacteriaceae can be transmitted along the broiler production chain but also their persistence
is reported because of insufficient cleaning and disinfection. Processing of broiler chickens leads to a reduction of microbiological
counts on the carcasses. However, processing steps like scalding, defeathering, and evisceration are critical concerning fecal
contamination and, therefore, cross-contamination with bacterial strains. Respective intervention measures along the slaughter
processing line aim at reducing the microbiological load on broiler carcasses as well as preventing cross-contamination. Published
data on the impact of possible intervention measures against ESBL-producing Enterobacteriaceae are missing and, therefore, we
focused on processing measures concerning Enterobacteriaceae, in particular E. coli or coliform counts, during processing of
broiler chickens to identify possible hints for effective strategies to reduce these resistant bacteria. In total, 73 publications were
analyzed and data on the quantitative reductions were extracted. Most investigations concentrated on scalding, postdefeathering
washes, and improvements in the chilling process and were already published in and before 2008 (n=42, 58%). Therefore, certain
measures may be already installed in slaughterhouse facilities today. The effect on eliminating ESBL-producing Enterobacteriaceae
is questionable as there are still positive chicken meat samples found. A huge number of studies dealt with different applications
of chlorine substances which are not approved in the European Union and the reduction level did not exceed 3 log10 values.
None of the measures was able to totally eradicate Enterobacteriaceae from the broiler carcasses indicating the need to develop
intervention measures to prevent contamination with ESBL-producing Enterobacteriaceae and, therefore, the exposure of humans
and the further release of antibiotic resistances into the environment.
1. Introduction waters [1–3]. As also farm animals, especially broiler chickens,

are affected by ESBL-producing E. coli (EEC), transmission
Enterobacteriaceae that produce extended-spectrum beta- via the food production chain from animals to humans is
lactamases (ESBLs) are a challenging problem in human and speculated [4, 5]. Therefore, many studies were conducted to
veterinary medicine due to the limitations of the treatment
investigate the dissemination of these resistant bacteria in the
options against infections caused by these resistant bacteria.
In the beginning, ESBL-producing Enterobacteriaceae were broiler production. EEC were found in broiler breeder chick-
only linked to human infections in hospitals. Nowadays, they ens and also in samples from broiler fattening farms even
are found to be widespread as intestinal gut colonizers in though there was no antibiotic treatment [6–11]. Moreover,
healthy humans as well as in animals and were also isolated in some studies broiler chickens were found to be already
from environmental samples like wastewater or fresh surface colonized with resistant bacteria in their first days of life
[9]. Transmission investigations identified potential (pseudo- Table 1: Overview of treatments/intervention measures prior to
)vertical transmission routes from (grand-)parent flocks to processing.
their offspring where the hatcheries played an important
Measures prior to processing
role in further spreading the resistant E. coli strains into the
fattening flocks [12–15]. In addition, insufficient cleaning and Age of broilers before slaughter 42 d, 49 d, 56 d
disinfection procedures support the circulation of EEC on the Feed withdrawal 4 h to 16 h
farms and between subsequently fattened flocks [16, 17]. Replacement finisher
Further investigations focused on the occurrence of EEC Feed additives Glucose
in chicken retail meat and chicken food products. Propor- Chlorine, MgSO4 , allostatic
tions of up to 90% of EEC-positive samples were reported Water additives
modulator
in some European studies [18–20]. Therefore, chicken meat
is considered as a potential source of the transmission to
humans. Insufficient kitchen hygiene in private households
or hospitals might contribute to cross-contamination or of broiler chickens to the slaughterhouse to prevent fecal
transmission to humans [21, 22] even though the amount of material from the fattening farms entering into the processing
detectable EEC on chicken filet or neck skin samples seemed line as well as those measures which refer to slaughterhouse
to be low (range of 1 to 3.18 log10 CFU/g) [23, 24]. equipment or cleaning and disinfection procedures.
Processing of broiler carcasses in slaughterhouses is very
likely a critical point in the contamination of raw chicken 2. Intervention Measures
meat. On one hand, EEC frequently occur as intestinal colo-
nizers in broiler chickens and, therefore, fecal contamination 2.1. Prior to Processing. Despite general biosafety and biose-
during evisceration of carcasses might be possible [25, 26]. curity measures as well as cleaning and disinfection strategies
On the other hand, broiler chickens are obviously visibly in the fattening period of broiler chickens, further prepro-
contaminated on the skin and feathers with a mixture of cessing factors like chicken age, feed withdrawal, or water and
feces and litter before entering the slaughterhouse [27, 28]. feed additives might lead to a reduced introduction of Enter-
Unfortunately, there are only limited data on the occurrence obacteriaceae, in particular E. coli and coliforms, into the
of EEC during the processing of broiler chickens in the slaughterhouses and therefore reduced cross-contamination
slaughterhouse. In the study of Pacholewicz et al., they found during carcass processing (Table 1).
an overall reduction of EEC on broiler carcasses during It was found that increased age (56 days vs. 42 days) of
processing [29]. However, in some of the investigated batches broiler chicken led to higher contamination of the broiler
more than 2 log EEC per carcass could be still detected carcasses with E. coli strains or coliforms after chilling in
after chilling. Therefore, intervention measures against these chlorinated water [33]. However, detailed data earlier in
resistant bacteria in slaughterhouse facilities are needed to the processing line were not available and, therefore, data
further reduce or even eliminate EEC from broiler processing might be biased. Further studies investigated the influence
plants and, therefore, also from chicken retail meat. of duration of feed withdrawal. In general, feed withdrawal
A lot of research was conducted to investigate interven- of 8 to 10 hours is used to reduce the fecal amount in
tion measures against Salmonella sp. or Campylobacter sp. in the gastrointestinal tract of broiler chickens and therefore a
slaughterhouses [30] but to the best of our knowledge none of reduced probability of fecal contamination during automated
the studies examined the respective interventions concerning evisceration is assumed [34, 35]. However, in four different
the usefulness to eradicate EEC. However, some studies con- studies from three different countries, various outcomes were
cerning Salmonella sp. or Campylobacter sp. also determined observed [33, 36–38]. Results showed both a reduction and
the counts of E. coli, coliforms, or total Enterobacteriaceae an increment of the E. coli amount on the carcasses in the
in their samples. These data might give an indication of the different samplings suggesting insufficient effectiveness of the
effectiveness of a respective intervention against EEC in the feed withdrawal concerning the reduction of E. coli. Further-
processing plants as Enterobacteriaceae, in particular E. coli more, the effect of the feed withdrawal time varied between
or coliforms, might function as indicator bacteria for EEC in samples at different stations in the slaughter processing line
the broiler processing line [31, 32]. [37]. This led to the assumption that the processing or certain
In this review, we therefore provide an overview on data steps of processing, e.g., evisceration, have a higher impact
concerning intervention measures to quantitatively reduce on the contamination rate of broiler carcasses with E. coli
E. coli, coliforms, or Enterobacteriaceae during processing than the duration time of the feed withdrawal. In addition to
of broiler chickens. We evaluated data from 73 original feed withdrawal times, certain feed and water additives were
research papers and summarized the quantitative effects of investigated to enhance a possible positive effect of the feed
the investigated interventions to reduce these bacteria at withdrawal concerning the reduction of particular pathogens
the different stages of the slaughter processing line (supple- (Table 1). Substances like specialized replacement finisher
mentary table (available here)). The studies comprise inter- [37], the supplementation of feed with a glucose cocktail
ventions to reduce/prevent the contamination of carcasses [39], chlorine additives [36], or magnesium sulfate [40] in
during processing as well as to remove the contamination drinking water, or the supplementation of tap water with an
that already occurred. There are also some data available allostatic modulator [38] were investigated. These substances
concerning certain measures directly prior to the transport were applied to broiler chickens prior to feed withdrawal.
Again, various outcomes concerning a reduction of E. coli, impact of a forced cloacal fecal expulsion prior to scalding
Enterobacteriaceae, or coliforms concentrations on broiler to prevent these leakages during further carcass processing
carcasses were observed. Glucose feed additives and chlorine [47]. They found no differences in the bacterial load between
compounds in drinking water showed reductions of Enter- prescald washed, prescald squeezed, and prescald washed and
obacteriaceae or E. coli in chicken crops [36, 39]. However, squeezed carcasses but a comparison to untreated carcasses
an impact on the reduction of E. coli on the broiler carcasses was not done. Musgrove et al. investigated the contribution
during processing and concerning the prevention on cross- of a cloacal plugging prior to electrocution of broilers to
contamination seemed to be ambiguous and needs further reduce numbers of Enterobacteriaceae on broiler carcasses
investigations. The supplementation of drinking water with [48]. The closure of the cloacae seemed to prevent further
magnesium sulfate at different levels led to a reduction of fecal contamination during processing as they determined
up to 2 log10 values of the microbial cecum contents and reductions of 0.53 log10 CFU/ml per carcass rinse. In experi-
coliform bacteria [40]. However, in these experiments neither mental inoculation trials, Buhr et al. also used manual cloacal
the effect on E. coli counts nor EEC counts were investigated plugging and vent suturing to prevent fecal leakage [49]. They
and therefore the application of magnesium sulfate needs found a reduction of 1.2 log10 CFU/ml breast skin rinse E. coli
to be further evaluated. Overall, the investigated measures compared to broiler carcasses with open vents. Nevertheless,
do not provide a distinct strategy for the reduction of the cloacal plugging is labor-consuming and is not yet established
introduction of E. coli into slaughterhouse facilities. However, as an online procedure. However, it points to the fact that
positive effects of these measures on the reduction of EEC fecal leakage is a major problem in contamination of broiler
numbers on broiler carcasses were not yet published. carcasses.
Even though there are only limited studies on prepro-
2.2. During Processing. The processing of broiler chick- cessing measures, there might be a great potential in new
ens consists of the following major steps: arrival at the strategies for the quantitative reduction of the bacterial load
slaughterhouse, stunning, bleeding, scalding, defeathering, on broiler chickens before their processing.
evisceration, washing, chilling, and cutting/packaging. The
summarized study data include intervention measures during
2.2.2. Scalding. Scalding of carcasses is used to preliminary
general online slaughter procedures as well as experimental loose the feathers of broiler carcasses prior to the actual
trials in pilot processing plants or under laboratory condi- defeathering process. Two different systems of carcass scald-
tions for all processing steps except stunning and bleeding
ing are established: immersion scalding in water bathes and
(Table 2). For both these steps, no data or studies could be
stream/spray scalding. During immersion scalding, bacteria
identified.
are removed by the effect of high temperature and a washing
effect of the water bath. However, cross-contamination was
2.2.1. After Arrival. Visible contamination of broiler chickens shown during immersion scalding [50, 51]. During steam
(on feathers and skin) is of great importance concerning the scalding, bacteria are only reduced via a temperature effect
introduction of the bacteria into the slaughter facilities [27, but cross-contamination is expected to be less likely [52]. In
28]; however, there are only few studies which investigated the course of the development of the slaughter processing,
measures before the scalding of the broiler chickens (Table 2). different immersion scalding conditions have been estab-
In two independent studies, experimental prescald equip- lished. Hard scalding with water temperatures from 60 to
ment was developed to brush broiler chickens before scalding 66∘ C and immersion time of 45 to 90 s were typically used
to reduce the visible contamination and to lower the amount in the US poultry industry whereas in Europe soft scalding
of fecal material and bacteria which were further introduced at 51 to 54∘ C with immersion times for 120 to 210 s is
into the scalding water [41, 42]. The entering of fecal material preferred [53]. The scalding conditions are also linked to the
into the scalding water has an effect on the pH of the scalding preferences of consumers with regard to certain attributes
water. It decreases due to dissociation of the ammonium of fresh chicken meat like color of meat and skin [54]
urate, present in chicken feces, into uric acid and ammo- and the form of offer, chilled or frozen. Early data from
nium hydroxide [43] and thus influences heat resistance of artificial contamination trials of chicken skin with an E. coli
Campylobacter and Salmonella [44, 45]. However, for E. coli K12 strain indicate that scalding temperatures above 60∘ C
the pH of the scalding water seems to be less important (scalding time of 150 s) led to an increased reduction of this
[46]. Both prescald brushing studies used slightly different strain from the contaminated chicken skin [55]. They also
techniques (whole surface vs. breast, vent, and neck areas) concluded from their results that it seems to be difficult to
and reductions of up to 0.3 log10 CFU of E. coli, coliforms, totally remove the E. coli strain from the chicken skin as it
and Enterobacteriaceae on carcasses, respectively, might be is protected by polymers on the surface of the chicken skin.
achievable. The partial brushing of the breast, vent, and neck Mulder et al. found in their artificial contamination study that
was not tested as an online treatment and, therefore, the effect cross-contamination during scalding is very likely and that
after scalding could not be examined [42]. external contamination might be of greater importance than
A second important contamination source is internal internal contamination [56]. Due to the need for enhanced
fecal material, which could contaminate carcasses due to hygiene measures to reduce microbiological contamination
leakage from the cloacae or gastrointestinal disruptions. and consequently foodborne illnesses via poultry food prod-
Therefore, Northcutt et al. investigated in their study the ucts, further investigations were carried out to improve the
4
Table 2: Overview of treatments/intervention measures during processing.

After arrival Scalding Defeathering Evisceration Postevisceration treatment Chilling
Nu-Tech
Prescald
Temperature of scalding water Defeathering time Evisceration Spray washes Air chilling
brushing
System
Skin removal
Forced cloacal Postdefeathering
Steam scalding prior to Inside-outside (I/O) washes Steam treatment (hot water)
fecal expulsion scald
evisceration
New York dressed
Cloacal Countercurrent/counterflow Rapid cooling/freeze chilling of
(NYD) carcass spray Post-I/O brush wash
plugging scalding carcasses/crust freezing
washes
Chilling with water sprays/chlorinated
pH of scalding water Trimming of visible fecal contamination
water sprays
Triple/multiple immersion
Trimming/high pressure sprays Chilling in tap water
scalding tanks
Postscald cold water treatment Water washes (potable water) Immersion chilling in chlorinated water
Water washes/spray washes using
Chilling in water with sodium
electrolyzed water/acidified electrolyzed
Water additives (commercial hypochloride (SH)/monochloramine
water supplemented with sodium
sanitizer, Timsen) (MON)/chlorine (Cl2 )/acidified chlorine
hypochloride (SH)/chlorine dioxide
(ClO2 -Cl2 )
(ClO2 )/acidified sodium chlorite (ASC)
Water additives like trisodium phosphate
(TSP), tripotassium phosphate (TTP),
Chilling water with 2% Protecta II (herbal
lauric acid (LA), myristic acid (MA),
extract on an NaCl carrier)
potassium hydroxide (KOH), acetic acid
(AA), oleic acid
Kosher salt application Postchill dips/washes
Postchill spray wash with electrolyzed
water (EO)
Kosher salt application
effectiveness of the scalding process without leading to a Only few studies were conducted to investigate the impact of
reduced meat quality and meat appearance. the defeathering process on microbiological contamination.
Later on, countercurrent immersion scalding and addi- Cason et al. found no significant difference in the numbers
tional postscald hot water sprays have been introduced [57]. of E. coli of carcasses after mechanical defeathering for 30
However, the use of a three-tank counterflow scalder does not s and 60 s, respectively, in a laboratory processing facility
lead to a microbiological improvement of the contamination [72]. Allen et al. reported that the majority of feathers with
level of broiler carcasses compared to a single-tank scalder attached bacteria were already removed in the first 10 sec of
[58] although there was a reduction of aerobic bacteria in the defeathering process [70]. To possibly reduce the microbi-
the last scalding tank. Berrang et al. found that the scalding ological load on the carcasses directly after defeathering, hot
in a counterflow triple-tank scalder decreased the E. coli water immersion scald and spray washer were investigated
counts from 4.6 log10 CFU to 2.0 log10 CFU, but controls [41, 73, 74]. The studies found reductions between 0.2 log10
to other scalding techniques were not provided [59]. Further and 0.7 log10 of the E. coli load in the whole carcass rinses.
studies showed that variations in the pH of the scalding water However, limitations were alterations in meat quality and
[46] as well as technical developments of immersion scalders meat appearance due to high water temperatures and the
like triple-tank scalders [60], counterflow triple tanks [61], use of chlorinated water which is not approved in the EU
or an additional cold water scald [62] also had no distinct [65]. The effects of an application of acetic acid and hydrogen
effect on the amount of E. coli or coliforms detected on the peroxide during defeathering on the microbiological quality
broiler carcasses. In contrast, the addition of copper sulfate- were only tested for total aerobic plate counts but not for E.
based sanitizers [63] or ammonium chloride substances [64] coli [75].
to the scalding water seemed to be of great advantage in Overall, there are only few studies available/published,
reducing the amount of E. coli or coliforms on broiler which dealt with microbiological investigations during
carcasses. However, these substances are not approved for defeathering of carcasses. Respective studies might not be
use in European slaughterhouses as there are no chemicals conducted or the investigations are just not available to the
approved for use in the European Union (EU) [65]. Further public. It also seems that further development of defeathering
variations in the scalding temperatures for immersion and technology has a greater focus on processing parameters like
spray scalders were not tested concerning their influence defeathering efficacy than on microbiological aspects.
on the microbiological status of the carcasses. It also seems
to be challenging to achieve an equal distributed scalding 2.2.4. Evisceration. The aim of this processing step is to
temperature at the different sites of the carcasses and to remove the total intestinal package. The whole evisceration
avoid a “cooked” skin appearance when using higher scalding process is highly automated and most challenging is the
temperatures [52]. proper evisceration of highly variable sizes of broiler carcasses
Further scalding techniques like spray or vapor scalding without leading to fecal leakage and gastrointestinal disrup-
have been tested as it was assumed that these methods would tions. There is limited information about the effectiveness and
reduce water consumption and the amount of waste water possible microbiological contamination due to the technolo-
[66] and might also reduce possible cross-contamination gies used for every single evisceration step. Russel et al. did
[52]. A prototype of a steam-hot-water-spray scalder was early comparisons between the Nu-Tech Evisceration System
tested and showed a reduction of coliforms of approximately and a conventional Streamlined Inspection System (SIS).
0.5 log10 CFU/cm2 on carcass surface compared to a con- Evisceration with the Nu-Tech system leads to the separation
ventional scalder [67]. However, there were apparently no of the visceral package from the carcass for inspection
further data determined on the efficiency of these techniques whereas with the SIS the package remains attached to the
to reduce the microbiological load on broiler carcasses. carcass. The Nu-Tech system showed better performance
As the scalding process of broiler carcasses was identi- concerning the visible fecal contamination of the carcasses
fied as a critical point for cross-contamination events with but no difference in the amount of E. coli in the investigated
pathogenic foodborne bacteria [50, 51] as well as ESBL- carcass rinses between both systems was observed [76].
producing Enterobacteriaceae [24, 68], it is necessary to Compliance with procedures to set and control equip-
improve the processing in the context of microbiological ment may be also associated with presence of fecal contami-
hygiene measures. nation [77]. This contamination occurs as a result of damage
of the intestines due to heterogeneity of carcasses within and
2.2.3. Defeathering. The defeathering process aims at the between flocks. Conventional equipment cannot be adjusted
complete removal of the feathers from the broiler carcasses per carcass; however, evisceration employees can adjust it
while keeping the skin and carcass appearance according to for a particular flock to minimize the fecal leakage. The
consumer preference. The defeathering machine consists of observed association between compliance with procedures
banks with sets of motor driven discs with rubber plucking and occurrence of fecal contamination needs to be validated
fingers. This process also turned out to be critical concern- in intervention studies.
ing microbiological contamination of broiler carcasses as The structure of the skin of broiler chickens is assumed to
during defeathering the pressure may be released to the play an important role in level of observable microbiological
carcasses which frequently leads to fecal leakage [51, 69– contamination due to the properties of the skin surface and
71]. It was recently shown that also cross-contamination the associated polymers which can protect bacteria from
with ESBL-producing Enterobacteriaceae can occur [24, 68]. removal [55, 78]. Therefore, whether the removal of the skin
prior to evisceration can lead to reduced contamination of as an intervention against E. coli contamination on broiler
the chicken meat was investigated. After manual evisceration, carcasses [88, 89]. They conducted lab work experiments and
they found a reduction of 0.5 log10 CFU/carcass of E. coli combined online treatments and found reductions between
and coliforms, respectively [79]. However, the possible reduc- 0.77 and 2.28 log10 CFU.
tion of contamination with Enterobacteriaceae by removing Further substances like trisodium phosphate (TSP), lauric
broiler chicken skin before evisceration was not tested as an acid (LA), myristic acid (MA), or potassium hydroxide
online operation. (KOH) were also tested in further studies as candidates to
potentially reduce E. coli, coliforms, or Enterobacteriaceae
2.2.5. Postevisceration Treatment. Leakage of fecal material counts on broiler carcasses after the evisceration step. Out-
and contamination with bacteria occur due to improper comes vary between 0.33 and 2.07 log10 CFU reduction
efficiency of the evisceration. Therefore, a high number of [74, 85, 90, 91]. Acetic acid (1.4 g/l and 2.8 g/l AA) and
investigations were conducted to improve the removal of (vis- oleic acid as a 10% washing solution were also tested in lab
ible) fecal contamination on broiler carcasses by improving experiments. They showed reductions of up to 0.93 log10
CFU of E. coli and 2.43 log10 CFU of Enterobacteriaceae,
the washing technologies as well as adding various substances
respectively, on poultry skin samples [92, 93]. For kosher
to the washing water.
chicken meat production, the usage of salt was evaluated
Early examinations on spray washing and inside-outside after the evisceration step of the carcasses [94]. During their
(I/O) washers revealed slight reductions of Enterobacte- investigation, they found that kosher salt application can
riaceae on broiler carcasses due to this application [80]. reduce the E. coli and coliform counts by 2.81 and 2.31 log10
Further investigations of I/O washers also found only slight CFU, respectively.
reductions of the E. coli and coliform count, respectively,
Most of the studies dealt with washing substances which
even though chlorinated water was used for the washing
are not approved in Europe [65] (Table 2). It turned out
process which is not approved in the EU [41, 65, 74, 80, 81].
that the addition of chlorine compounds does not lead to
Furthermore, it was shown that an I/O wash with a showering
a total removal of Enterobacteriaceae on broiler carcasses
time of 5s to 6s does not completely remove visible fecal
and also more natural substances might have a potential to
contamination and, therefore, is less effective in reducing
reduce these bacteria on broiler carcasses during processing.
E. coli, Enterobacteriaceae, or coliforms from contaminated
However, most investigations were done as lab work or in
broiler carcasses [25]. Berrang and Baily examined a post-I/O
pilot processing plants and the results need to be further
brush wash step and found an additional reduction of about
evaluated.
0.5 log10 CFU of E. coli and coliforms, respectively [41]. The
trimming of visible fecal contamination with different water
pressure resulted in a lower reduction of these bacteria [82] 2.2.6. Chilling. The chilling process in general can lead to a
and the usage of high pressure spray with chlorinated water reduction of the E. coli amount on broiler carcasses of up to
showed varying outcomes in the ability to reduce Enterobac- 3.5 log10 values [95, 96]. However, broiler carcasses are still
teriaceae from broiler carcasses [83]. Studies also investigated contaminated with E. coli, coliforms, or Enterobacteriaceae
the efficiency of water washes to reduce the numbers of after chilling. This was also to be found for multidrug resistant
E. coli or coliforms on broiler carcasses. Experiments were E. coli like EEC [97–99].
carried out in the lab or in experimental pilot processing Chilling of broiler carcasses is done via immersion
plants and it turned out that using water with less than chilling in a water tank, chilling in air, or air-spray chilling
2 ppm chlorine or potable water for the washing steps led to where carcasses are sprayed with water at several points in
reductions between 0.3 and 1.3 log10 CFU of E. coli, coliforms, the chilling room. Furthermore, some slaughterhouses use a
or Enterobacteriaceae [82, 84, 85]. combination of immersion and air chilling having a water
Most of the interventions against E. coli, coliforms, or bath with cold water only in the beginning of the chilling
Enterobacteriaceae on broiler carcasses by different washing room. The chilling method applied depends on the scalding
steps or technologies after the evisceration include the usage temperature regime. If the scalding temperatures are very
of chlorinated water (produced, e.g., by adding sodium high, the epidermis is removed and the carcasses need to
hypochloride (SH), or by electrolyzing water containing be kept wet through the process; otherwise, the appearance
dissolved sodium chloride) which is not approved in the EU of the chicken skin/meat is affected. Therefore, chilling in a
[65]. Here, investigations in the lab or in processing plants water bath is applied in combination with high temperature
showed better results concerning the reduction of E. coli, scalding.
coliforms, and Enterobacteriaceae, respectively, than online The use of a water bath during chilling—like the scalding
investigations in the slaughterhouse [84–87]. Furthermore, a water bath—might also contribute to cross-contamination
study concerning online postevisceration washes with chlori- between carcasses but experimental studies on air chilling
nated water resulted in higher bacterial contamination than with or without chlorinated water sprays did not result in
without chlorinated water [74]. The same was found in a study reductions of the amount of E. coli or coliforms on the
concerning prechill washes [41] whereas chlorine dioxide broiler carcasses [100–105]. The use of steam or hot water in
(ClO2 ) spray wash seems to reduce E. coli and coliform counts combination with rapid cooling, chilling, or freezing seems
about 0.4 log10 CFU, respectively [74]. Kemp et al. investi- to reduce up to 2.83 log10 CFU of E. coli depending on
gated the possible usage of acidified sodium chlorite (ASC) the treatment time [106]. However, there are disadvantages
in the skin appearance and skin color [106]. Freeze chilling Table 3: Overview of packaging treatments/intervention.
of chicken meat for longer transportation was investigated
with no negative effect on the meat appearance and found to Packaging Substances
possibly reduce up to 1 log10 CFU of Enterobacteriaceae on Modified atmosphere Various combinations of O2 , CO2 , and
the chicken meat [107]. In contrast, an experimental trial on packaging (MAP) N2
the survival of E. coli K12 during crust freezing resulted only Water extract of sumac, lauric acid
Decontamination
in reductions 0.3 log10 CFU [108]. Allen et al. investigated (LA), high-intensity pulsed light
(chlorinated) water sprays for carcass chilling but the effect in Active packaging Carvacrol, cinnamaldehyde,
reducing coliforms from breast skin was not more than 0.62 ovotransferrin, potassium sorbate
log10 CFU even when using 250 ppm of chlorine [100].
Immersion chilling in tap water showed reductions of
up to 1.1 log10 CFU of E. coli under laboratory conditions of the gases O2 , CO2 , and N2 . Depending on the storage
compared to unchilled carcasses [109]. Chilling in water time investigated in the studies, most of the tested MAP
with less than 2 ppm free chlorine residues reduced E. coli gases showed reduced growth of E. coli or Enterobacteriaceae
counts by 1.34 log10 CFU [110]. In the same study, after compared to the storage under air conditions [107, 115–117].
renewal of the chilling water after 8 h (instead of 16 h) the High portions of CO2 in the gaseous mixtures seemed to
reduction was determined as 1.25 log10 CFU of E. coli. better reduce the growth of E. coli on chicken meat [116, 117].
In most of the studies, the use of chlorine substances or However, none of the tested MAP processes led to a total
solutions like acidified chlorine, sodium hypochlorite (SH), reduction of E. coli counts on chicken meat. The shelf life
monochloramine (MON), or chlorine dioxide (ClO2 ) for the of chicken meat is not only dependent on the amount of
reduction of bacterial contamination on broiler carcasses E. coli on the respective filets or chicken wings. Therefore,
was investigated [25, 33, 60, 74, 111–113]. On the one hand, most of the investigations on MAP also concentrate on other
reductions of up to 1.4 log10 CFU of E. coli were detected. bacteria like pseudomonads and other potential pathogenic
On the other hand, also increments of the amount of E. Enterobacteriaceae as well as meat appearance and consumer
coli (up to 0.2 log10 CFU) were found. This might be due preferences [54, 114, 118]. As alternatives to MAP, active
to the sampling of different slaughterhouses and different packaging has been developed which leads to an interaction
sampling conditions/methods and laboratory work. In the of the packaging material and the respective meat [119].
study by Kameyada et al., they found that also the chilling Furthermore, the packaging material can be incorporated
temperature might have an influence on the reduction of E. with different (reactive) substances to increase the shelf life
coli counts on broiler carcasses [112]. To further reduce the due to the interaction of material, substances, and meat.
bacterial contamination from the carcasses and additionally The substances allowed for use for active packaging are also
prevent cross-contamination, Dickens et al. investigated an strictly regulated in the EU [119]. The incorporation of 3%
herbal extract as additive in the chilling water [109]. In carvacrol or 3% cinnamaldehyde into wrapping films reduced
their laboratory, they determined reductions of 2 log10 CFU the amount of E. coli O157:H7 on chicken breast samples of
and 2.64 log10 CFU for E. coli and coliforms, respectively. up to 6.8 and 5.2 log10 CFU, respectively, after storage time of
Postchill washing or dipping steps in chlorinated water can 72 h at 23∘ C [120]. Using ovotransferrin or potassium sorbate
lead to additional reductions between 0.2 and 1.74 log10 CFU showed reductions of more than 2 log10 CFU of E. coli only
of E. coli or coliforms on the broiler carcasses [74, 81, 87]. A in combination with 5 mM EDTA whereas the reduction due
prechill or postchill application of kosher salt to the carcasses to EDTA alone was higher than for both separate substances
was found to reduce E. coli counts by 1.39 log10 CFU and 1.77 [121]. Besides the packaging technology, the decontamination
log10 CFU, respectively [94]. of chicken meat with a water extract of sumac (WES) and 2%
The analysis of various published papers concerning lactic acid (LA) was investigated in a broiler wing model [122].
the microbiologic profile of broiler carcasses after chilling Reductions up to 2 log10 CFU of coliforms were detected
highlights the need for harmonized methods and sampling compared to a distilled water reference. Haughton et al.
procedures. It also shows that, in concordance to the poste- determined the decontamination of chicken meat using high-
visceration wash, the adding of chlorine compounds to the intensity pulsed light (HIPL) and found a reduction of up
chilling water does not completely remove Enterobacteri- to 1.51 log10 CFU of E. coli on uncovered chicken skin [123].
aceae from the broiler carcasses assuming that methods for However, the use of HIPL on packaged chicken meat/skin led
preventing contamination of broiler carcasses might be of to a lower reduction of the E. coli amount.
greater importance. None of the investigated interventions was tested for their
efficacy against EEC. However, it seems that the reduction or
2.3. Packaging. There are different technologies established eradication of EEC needs to be done in previous steps in the
to protect raw meat from recontamination and to prevent processing of broiler chickens.
the growth of potential pathogenic bacteria [114]. For the
preservation of chicken meat, investigations were conducted 2.4. Equipment/Others. Despite direct intervention measures
to improve the shelf life and to reduce bacterial contamina- to reduce E. coli, coliforms, or Enterobacteriaceae on broiler
tion (Table 3). Various combinations of gaseous substances carcasses also few investigations on the reduction of bacte-
and concentrations were tested in modified atmosphere rial contaminants in the slaughterhouse environment were
packaging (MAP) processes. Most common are combinations conducted (Table 4). These investigations include the general
Table 4: Overview of treatments of equipment/slaughterhouse that reduced exposure to humans also led to a reduction
environment. in the prevalence in humans [132]. The transmission along
Equipment
the broiler production chain and certain cross-contamination
events have been described by various authors [12–15].
Conveyor treatment Furthermore, it has been reported that wastewater from
Disinfectants (peracetic acid and quaternary ammonium, sodium processing facilities contributes to the spread of multidrug
hypochloride (SH), peracetic acid) resistant bacteria into the environment [133–136]. Therefore,
Transport crate treatment interventions are needed to reduce or even eradicate these
LEDs/UV light ESBL-producing Enterobacteriaceae from the broiler pro-
duction.
Until now certain interventions were investigated against
sanitary treatment in slaughterhouses and the disinfection of Campylobacter sp. and/or Salmonella sp. but specific inter-
conveyor belts and transport crates. In the study of Kašková ventions against EEC were not evaluated. We, therefore,
et al., no coliforms were detected on the sampled sites, except summarized data from various studies which also investi-
for the shackling hooks, after disinfection with quaternary gated Enterobacteriaceae counts with E. coli and coliforms
ammonium compounds [124]. For the sanitizing of stainless in particular as they might function as indicator bacteria for
steel sodium hypochloride (SH) and peracetic acid were EEC in the broiler processing line [31, 32].
tested under laboratory conditions [125]. From the results, Overall, we found 73 studies providing data on the quan-
the authors did not recommend peracetic acid as a sanitizing titative reduction of E. coli, coliforms, or Enterobacteriaceae
agent for slaughterhouse equipment. Cleaning and disinfec- along the different steps of the broiler processing line (supple-
tion of conveyor belts and transport crates are critical con- mentary table). Reductions were measured up to 3 log10 CFU
cerning cross-contamination. Hot water treatment does not on chicken skin or broiler carcasses; however, none of the
result in significant reduction of Enterobacteriaceae whereas methods led to total eradication of those bacteria. A variety
washing, soaking, and the additional use of disinfectants or of investigated measures provided only reductions below
detergents are more effective [126–128]. Ultrasonic treatment 1 log10 CFU or even caused an increase in the respective
of conveyor belts was more effective in combination with bacterial counts indicating an insufficient effect against E. coli,
water temperatures around 60∘ C [127]. These studies show coliforms, or Enterobacteriaceae contamination of broiler
that the disinfection of the slaughterhouse equipment or carcasses and, therefore, an effect on EEC is questionable.
transport crates is a critical process and needs to be done In addition, it seems that experimental intervention trials
accurately to avoid cross-contamination and further spread provide better results than measures implemented as online
of the bacteria. treatment. Also, the effect of measures dependent on the con-
For the decontamination of chilling wash water Rowan tamination level of broiler carcasses is not well investigated.
et al. tested a pulsed-plasma gas discharge system [129]. They The application of simultaneous or parallel interventions
found a reduction of approx. 8 log10 CFU of E. coli NCTC9001 might have an additive effect; however, respective studies for
after a treatment time of 18 sec. UV irradiation and LED most of the interventions are missing.
light were further methods tested for the decontamination We found studies comprising interventions to prevent
of stainless steel and chicken skin [130, 131]. UV irradiation fecal material from the fattening farms entering into the
showed better results concerning the reduction of E. coli on processing line of the slaughterhouse (measures prior to
stainless steel (up to 5.34 log10 CFU) than on chicken skin processing and after arrival), to reduce/prevent the contami-
(up to 1.28 log10 CFU) [130]. This is assumed to be due to nation of carcasses during processing (scalding, evisceration)
the rough surface of the chicken skin and the feather follicles as well as to remove contamination that already occurred
which protect bacteria from the UV light. The LED array (postevisceration treatment, chilling, packaging, and equip-
treatment did not exceed 1 log10 CFU reduction on stainless ment/others). It was already reported that the structure of the
steel and chicken skin, respectively [131]. Furthermore, the chicken skin plays an important role in attachment of bacteria
treatment period ranged between 10 and 20 min which might and that firmly attached bacteria during plucking are more
be problematic for an installation as online treatment. difficult to remove [51, 55, 137]. This might suggest that there
There is a high diversity in methods tested for the inac- is a need for more measures that prevent contamination from
tivation or reduction of Enterobacteriaceae or E. coli counts occurring.
in slaughterhouses or slaughterhouse equipment. However, Twenty-one measures dealt with the application of var-
most of the methods were not tested for their potential to also ious chlorine substances which are not approved in the EU
reduce contamination on chicken carcasses or as an online [65]. The overall reduction of E. coli, coliforms, or Enterobac-
intervention in a slaughterhouse. teriaceae by these substances was less than 2.3 log10 CFU,
indicating that chlorine does not remove E. coli, coliforms,
3. Summary and Conclusion or Enterobacteriaceae from broiler carcasses to a preferable
amount. Again, taking into account the important issue of
ESBL-producing Enterobacteriaceae are frequently detected skin structure and the bacterial attachment, it could be con-
in broiler chickens and chicken meat. Due to high prevalence cluded that there are general limitations to the effectiveness
of these usually multidrug resistant bacteria, an impact on of decontaminating chicken carcasses. It could be of interest
human health is assumed [4, 5]. It was recently reported to develop more interventions preventing the introduction
or the recontamination with Enterobacteriaceae especially spectrum beta-lactamase-producing Escherichia coli in Dutch
under the current EU regulations where decontamination is surface water and wastewater,” PLoS ONE, vol. 10, no. 6, Article
not approved. From our collection, 42 studies were already ID e0127752, 2015.
published before 2008 and, therefore, it is very likely that [2] A. Kaesbohrer, A. Schroeter, B.-A. Tenhagen, K. Alt, B. Guerra,
some of these measures are already installed in slaugh- and B. Appel, “Emerging antimicrobial resistance in commensal
terhouses. Furthermore, 58% of the studies (n=42) were escherichia coli with public health relevance,” Zoonoses and
conducted in the USA and only 21% in European countries Public Health, vol. 59, no. 2, pp. 158–165, 2012.
(n=15) which highlights the need for further investigations [3] A. F. C. Leonard, L. Zhang, A. J. Balfour et al., “Exposure to
in the EU due to differences in the respective guidelines and and colonisation by antibiotic-resistant E. coli in UK coastal
European decrees. water users: Environmental surveillance, exposure assessment,
In the study of Pacholewicz et al., they found an overall and epidemiological study (Beach Bum Survey),” Environment
International, vol. 114, pp. 326–333, 2018.
reduction of EEC on broiler carcasses during processing
[29]. However, they also detected differences in the reduc- [4] B. Lazarus, D. L. Paterson, J. L. Mollinger, and B. A. Rogers,
tion during processing of E. coli and EEC populations “Do human extraintestinal escherichia coli infections resistant
to expanded-spectrum cephalosporins originate from food-
in one slaughterhouse. Here, EEC were less reduced than
producing animals? A systematic review,” Clinical Infectious
the numbers of total E. coli after defeathering and after Diseases, vol. 60, no. 3, pp. 439–452, 2015.
evisceration, respectively. Furthermore, the effect of a respec-
[5] A. I. Vitas, D. Naik, L. Pérez-Etayo, and D. González,
tive processing step on the reduction of EEC additionally “Increased exposure to extended-spectrum 𝛽-lactamase-
illustrated differences between two slaughterhouses [29]. producing multidrug-resistant Enterobacteriaceae through the
This indicates that also slaughterhouses specific intervention consumption of chicken and sushi products,” International
measures might be needed against the dissemination of EEC. Journal of Food Microbiology, vol. 269, pp. 80–86, 2018.
In addition, effective measures might depend on the current [6] V. Bortolaia, L. Guardabassi, M. Trevisani, M. Bisgaard, L.
equipment, procedures, and technologies used in every single Venturi, and A. M. Bojesen, “High diversity of extended-
slaughterhouse, which need to be further evaluated. spectrum 𝛽-lactamases in Escherichia coli isolates from Italian
Nevertheless, there is a need to eliminate as much as broiler flocks,” Antimicrobial Agents and Chemotherapy, vol. 54,
possible at various stages of processing (through preventing no. 4, pp. 1623–1626, 2010.
fecal contamination from entering a particular step) and [7] D. Costa, L. Vinué, P. Poeta et al., “Prevalence of extended-
maintaining and/or further reducing the amount of bacteria spectrum beta-lactamase-producing Escherichia coli isolates in
achieved at a respective processing step. EEC do not only faecal samples of broilers,” Veterinary Microbiology, vol. 138, no.
spread in the broiler production line but can also be spread 3-4, pp. 339–344, 2009.
into the environment via wastewater and, therefore, con- [8] A. Dame-Korevaar, E. A. J. Fischer, A. Stegeman et al., “Dynam-
tribute to the transmission of antibiotic resistance factors. ics of CMY-2 producing E. coli in a broiler parent flock,”
Intervention measures are needed to prevent the spread Veterinary Microbiology, vol. 203, pp. 211–214, 2017.
and cross-contamination of these resistant bacteria during [9] C. M. Dierikx, J. A. Van Der Goot, H. E. Smith, A. Kant, and D. J.
slaughter and finally the transmission into the environment Mevius, “Presence of ESBL/AmpC -producing Escherichia coli
and the households via contaminated chicken meat. in the broiler production pyramid: A descriptive study,” PLoS
ONE, vol. 8, no. 11, 2013.
[10] C. A. Ginns, G. F. Browning, M. L. Benham, G. A. Anderson,
Conflicts of Interest and K. G. Whithear, “Antimicrobial resistance and epidemi-
ology of Escherichia coli in broiler breeder chickens,” Avian
The authors declare that they have no conflicts of interest. Pathology, vol. 25, no. 3, pp. 591–605, 1996.
[11] S. S. Mo, M. Norström, J. S. Slettemeas, A. Lovland, A.
Acknowledgments M. Urdahl, and M. Sunde, “Emergence of AmpC-producing
Escherichia coli in the broiler production chain in a country
This work was funded by the Federal Office for Agriculture with a low antimicrobial usage profile,” Veterinary Microbiology,
and Food (BLE) EsRAM Consortium (grant no.: 2817701614). vol. 171, no. 3-4, pp. 315–320, 2014.
[12] Y. Agerso, J. D. Jensen, H. Hasman, and K. Pedersen, “Spread
of extended spectrum cephalosporinase-producing escherichia
Supplementary Materials coli clones and plasmids from parent animals to broilers and
to broiler meat in a production without use of cephalosporins,”
Supplementary table: published study data on quantitative Foodborne Pathogens and Disease, vol. 11, no. 9, pp. 740–746,
reductions of E. coli, coliforms, or Enterobacteriaceae in 2014.
the broiler processing line (negative reductions meaning
[13] S. Börjesson, T. Guillard, A. Landén, B. Bengtsson, and O.
an increase in the bacterial load are marked in red). Nilsson, “Introduction of quinolone resistant Escherichia coli
(Supplementary Materials) to Swedish broiler population by imported breeding animals,”
Veterinary Microbiology, vol. 194, pp. 74–78, 2016.
References [14] M. Projahn, K. Daehre, U. Roesler, and A. Friese, “ESBL-
/pAmpC-producing enterobacteria in the broiler hatchery – a
[1] H. Blaak, G. Lynch, R. Italiaander, R. A. Hamidjaja, F. M. Schets, mode of pseudo-vertical transmission?” Applied and Environ-
and A. M. de Roda Husman, “Multidrug-resistant and extended mental Microbiology, vol. 83, 2017.
[15] M. Projahn, K. Daehre, T. Semmler, S. Guenther, U. Roesler, [29] E. Pacholewicz, A. Liakopoulos, A. Swart et al., “Reduction
and A. Friese, “Environmental adaptation and vertical dis- of extended-spectrum-𝛽-lactamase- and AmpC-𝛽-lactamase-
semination of ESBL-/pAmpC-producing Escherichia coli in producing Escherichia coli through processing in two broiler
an integrated broiler production chain in the absence of an chicken slaughterhouses,” International Journal of Food Micro-
antibiotic treatment,” Microbial Biotechnology, 2018. biology, vol. 215, pp. 57–63, 2015.
[16] K. Daehre, M. Projahn, T. Semmler, U. Roesler, and A. Friese, [30] J. M. Cox and A. Pavic, “Advances in enteropathogen control in
“Extended-spectrum beta-lactamase-/AmpC beta-lactamase- poultry production,” Journal of Applied Microbiology, vol. 108,
producing enterobacteriaceae in broiler farms: transmission no. 3, pp. 745–755, 2010.
dynamics at farm level,” Microbial Drug Resistance, vol. 24, no. [31] B. G. Matias, P. S. D. A. Pinto, M. V. C. Cossi, and L. A.
4, pp. 511–518, 2018. Nero, “Salmonella spp. and hygiene indicator microorganisms
[17] K. Y. Luyckx, S. Van Weyenberg, J. Dewulf et al., “On-farm in chicken carcasses obtained at different processing stages in
comparisons of different cleaning protocols in broiler houses,” two slaughterhouses,” Foodborne Pathogens and Disease, vol. 7,
Poultry Science, vol. 94, no. 8, pp. 1986–1993, 2015. no. 3, pp. 313–318, 2010.
[18] T. Casella, M. C. L. Nogueira, E. Saras, M. Haenni, and J.- [32] P. K. Saini, H. M. Marks, M. S. Dreyfuss, P. Evans, L. Victor Cook
Y. Madec, “High prevalence of ESBLs in retail chicken meat Jr., and U. Dessai, “Indicator organisms in meat and poultry
despite reduced use of antimicrobials in chicken production, slaughter operations: Their potential use in process control and
France,” International Journal of Food Microbiology, vol. 257, pp. the role of emerging technologies,” Journal of Food Protection,
271–275, 2017. vol. 74, no. 8, pp. 1387–1394, 2011.
[19] P. Egea, L. López-Cerero, E. Torres et al., “Increased raw poul- [33] J. K. Northcutt, M. E. Berrang, J. A. Dickens, D. L. Fletcher, and
try meat colonization by extended spectrum beta-lactamase- N. A. Cox, “Effect of broiler age, feed withdrawal, and trans-
producing Escherichia coli in the south of Spain,” International portation on levels of coliforms, Campylobacter, Escherichia
Journal of Food Microbiology, vol. 159, no. 2, pp. 69–73, 2012. coli and Salmonella on carcasses before and after immersion
chilling,” Poultry Science, vol. 82, no. 1, pp. 169–173, 2003.
[20] L. P. Randall, M. P. Lodge, N. C. Elviss et al., “Evaluation of
[34] S. F. Bilgili, “Effect of feed and water withdrawal on shear
meat, fruit and vegetables from retail stores in five United King-
strength of broiler gastrointestinal tract.,” Poultry Science, vol.
dom regions as sources of extended-spectrum beta-lactamase
67, no. 5, pp. 845–847, 1988.
(ESBL)-producing and carbapenem-resistant Escherichia coli,”
International Journal of Food Microbiology, vol. 241, pp. 283– [35] C. J. Wabeck, “Feed and water withdrawal time relationship to
290, 2017. processing yield and potential fecal contamination of broilers,”
Poultry Science, vol. 51, no. 4, pp. 1119–1121, 1972.
[21] A. J. Stewardson, G. Renzi, N. Maury et al., “Extended-spectrum
𝛽-lactamase-producing enterobacteriaceae in hospital food: A [36] F. R. Barreiro, S. M. Baraldi-Artoni, F. R. Pinto, M. M. C.
risk assessment,” Infection Control and Hospital Epidemiology, Barbosa, J. C. Barbosa, and L. A. Amaral, “Influence of chlo-
vol. 35, no. 4, pp. 375–383, 2014. rine added to drinking water during the preslaughter feed
withdrawal on microbiology and morphology of the broiler
[22] G. A. Younis, R. M. Elkenany, M. A. Fouda, and N. F. Mostafa, gastrointestinal tract,” Poultry Science, vol. 91, no. 11, pp. 2778–
“Virulence and extended-spectrum 𝛽-lactamase encoding 2784, 2012.
genes in Escherichia coli recovered from chicken meat intended
[37] J. K. Northcutt, R. J. Buhr, M. E. Berrang, and D. L. Fletcher,
for hospitalized human consumption,” Veterinary World, vol. 10,
“Effects of replacement finisher feed and length of feed with-
no. 10, pp. 1281–1285, 2017.
drawal on broiler carcass yield and bacteria recovery,” Poultry
[23] F. Reich, F. Schill, V. Atanassova, and G. Klein, “Quantification Science, vol. 82, no. 11, pp. 1820–1824, 2003.
of ESBL-Escherichia coli on broiler carcasses after slaughtering
[38] M. E. Rubio-Garcı́a, M. S. Rubio-Lozano, E. Ponce-Alquicira,
in Germany,” Food Microbiology, vol. 54, pp. 1–5, 2016.
C. Rosario-Cortes, G. M. Nava, and M. P. Castañeda-Serrano,
[24] P. von Tippelskirch, G. Gölz, M. Projahn et al., “Prevalence and “Improving appearance and microbiologic quality of broiler
quantitative analysis of ESBL and AmpC beta-lactamase pro- carcasses with an allostatic modulator,” Poultry Science, vol. 94,
ducing Enterobacteriaceae in broiler chicken during slaughter no. 8, pp. 1957–1963, 2015.
in Germany,” International Journal of Food Microbiology, vol. [39] A. Hinton Jr., R. J. Buhr, and K. D. Ingram, “Reduction of
281, pp. 82–89, 2018. Salmonella in the crop of broiler chickens subjected to feed
[25] S. M. Jiménez, M. C. Tiburzi, M. S. Salsi, M. E. Pirovani, and M. withdrawal,” Poultry Science, vol. 79, no. 11, pp. 1566–1570, 2000.
A. Moguilevsky, “The role of visible faecal material as a vehicle [40] V. G. Stanley, D. M. Hutchinson, A. H. Reine, D. Corrier,
for generic Escherichia coli, coliform, and other enterobacteria and A. A. Hinton Jr., “Magnesium sulfate effects on coliform
contaminating poultry carcasses during slaughtering,” Journal bacteria reduction in the intestines, ceca, and carcasses of
of Applied Microbiology, vol. 95, no. 3, pp. 451–456, 2003. broiler chickens,” Poultry Science, vol. 71, no. 1, pp. 76–80, 1992.
[26] D. P. Smith, J. K. Northcutt, J. A. Cason, A. Hinton Jr., R. J. [41] M. E. Berrang and J. S. Bailey, “On-line brush and spray washers
Buhr, and K. D. Ingram, “Effect of external or internal fecal to lower numbers of Campylobacter and Escherichia coli and
contamination on numbers of bacteria on prechilled broiler presence of Salmonella on broiler carcasses during processing,”
carcasses,” Poultry Science, vol. 86, no. 6, pp. 1241–1244, 2007. Journal of Applied Poultry Research, vol. 18, no. 1, pp. 74–78,
[27] J. A. Cason, A. Hinton Jr., J. K. Northcutt et al., “Partitioning of 2009.
external and internal bacteria carried by broiler chickens before [42] E. Pacholewicz, L. J. A. Lipman, A. Swart, A. H. Havelaar, and
processing,” Journal of Food Protection, vol. 70, no. 9, pp. 2056– W. J. C. Heemskerk, “Pre-scald brushing for removal of solids
2062, 2007. and associated broiler carcass bacterial contamination,” Poultry
[28] K. L. Kotula and Y. Pandya, “Bacterial contamination of broiler Science, vol. 95, no. 12, pp. 2979–2985, 2016.
chickens before scalding,” Journal of Food Protection, vol. 58, no. [43] T. J. Humphrey, D. G. Lanning, and D. Beresford, “The effect
12, pp. 1326–1329, 1995. of pH adjustment on the microbiology of chicken scald-tank
water with particular reference to the death rate of salmonellas,” [59] M. E. Berrang, R. J. Meinersmann, R. J. Buhr, N. A. Reimer, R.
Journal of Applied Bacteriology, vol. 51, no. 3, pp. 517–527, 1981. W. Philips, and M. A. Harrison, “Presence of Campylobacter
[44] T. J. Humphrey and D. G. Lanning, “Salmonella and campy- in the respiratory tract of broiler carcasses before and after
lobacter contamination of broiler chicken carcasses and scald commercial scalding,” Poultry Science, vol. 82, no. 12, pp. 1995–
tank water: the influence of water pH,” Journal of Applied 1999, 2003.
Bacteriology, vol. 63, no. 1, pp. 21–25, 1987. [60] R. J. Buhr, D. V. Bourassa, J. K. Northcutt, A. Hinton Jr., K. D.
[45] A. J. Okrend, R. W. Johnston, and A. B. Moran, “Effect of Ingram, and J. A. Cason, “Bacteria recovery from genetically
acetic acid on the death rates at 52∘C of salmonella newport, feathered and featherless broiler carcasses after immersion
salmonella typhimurium and campylobacter jejuni in poultry chilling,” Poultry Science, vol. 84, no. 9, pp. 1499–1504, 2005.
scald water,” Journal of Food Protection, vol. 49, no. 7, pp. 500– [61] J. A. Cason, A. Hinton Jr., and K. D. Ingram, “Coliform,
503, 1986. Escherichia coli, and Salmonellae concentrations in a multiple-
[46] M. E. Berrang, W. R. Windham, and R. J. Meinersmann, tank, counterflow poultry scalder,” Journal of Food Protection,
“Campylobacter, Salmonella, and Escherichia coli on broiler vol. 63, no. 9, pp. 1184–1188, 2000.
carcasses subjected to a high pH scald and low pH postpick [62] J. A. Cason, R. J. Buhr, and A. Hinton Jr., “Unheated water in the
chlorine dip,” Poultry Science, vol. 90, no. 4, pp. 896–900, 2011. first tank of a three-tank broiler scalder,” Poultry Science, vol. 80,
[47] J. K. Northcutt, W. D. McNeal, K. D. Ingram, R. J. Buhr, and no. 11, pp. 1643–1646, 2001.
D. L. Fletcher, “Microbial recovery from genetically featherless [63] S. M. Russell, “The effect of an acidic, copper sulfate-based
broiler carcasses after forced cloacal fecal expulsion,” Poultry commercial sanitizer on indicator, pathogenic, and spoilage
Science, vol. 87, no. 11, pp. 2377–2381, 2008. bacteria associated with broiler chicken carcasses when applied
at various intervention points during poultry processing,”
[48] M. T. Musgrove, J. A. Cason, D. L. Fletcher, N. J. Stern, N. A.
Poultry Science, vol. 87, no. 7, pp. 1435–1440, 2008.
Cox, and J. S. Bailey, “Effect of cloacal plugging on microbial
recovery from partially processed broilers,” Poultry Science, vol. [64] V. Lansini, D. S. V. Maia, D. da Fontoura Prates, A. S. de Lima,
76, no. 3, pp. 530–533, 1997. and W. P. da Silva, “Antibacterial activity of Timsen (n-alkyl
dimethyl benzyl ammonium chloride-40%) in scalding and
[49] R. J. Buhr, M. E. Berrang, and J. A. Cason, “Bacterial recovery
precooling water in poultry slaughterhouses,” Journal of Food
from breast skin of genetically feathered and featherless broiler
Science and Technology, vol. 54, no. 8, pp. 2607–2612, 2017.
carcasses immediately following scalding and picking,” Poultry
Science, vol. 82, no. 10, pp. 1641–1647, 2003. [65] EFSA, “Panel on Biological Hazards (BIOHAZ): Scientific
Opinion on Campylobacter in broiler meat production: control
[50] T. Seliwiorstow, J. Baré, I. Van Damme, I. G. Algaba, M.
options and performance objectives and/or targets at different
Uyttendaele, and L. De Zutter, “Transfer of Campylobacter
stages of the food chain,” EFSA Journal, vol. 9, no. 4, 2011.
from a positive batch to broiler carcasses of a subsequently
slaughtered negative batch: A quantitative approach,” Journal of [66] V. F. Kaufman, A. A. Klose, H. G. Bayne, M. F. Pool, and
Food Protection, vol. 79, no. 6, pp. 896–901, 2016. H. Lineweaver, “Plant Processing of Sub-atmospheric Steam
Scalded Poultry,” Poultry Science, vol. 51, no. 4, pp. 1188–1194,
[51] C. J. Thomas and T. A. McMeekin, “Contamination of broiler 1972.
carcass skin during commercial processing procedures: An
[67] T. E. Patrick, T. L. Goodwin, J. A. Collins, R. C. Wyche, and B.
electron microscopic study,” Applied and Environmental Micro-
E. Love, “Steam versus hot-water scalding in reducing bacterial
biology, vol. 40, no. 1, pp. 133–144, 1980.
loads on the skin of commercially processed poultry.,” Journal
[52] J. A. Dickens, R. J. Buhr, and J. A. Cason, “Subcutaneous of Applied Microbiology, vol. 23, no. 4, pp. 796–798, 1972.
temperature profile, skin appearance, and picking efficiency of
[68] M. Projahn, P. von Tippelskirch, T. Semmler, S. Guenther,
immersion and spray scalded broiler carcasses,” Poultry Science,
T. Alter, and U. Roesler, “Contamination of chicken meat
vol. 78, no. 4, pp. 595–599, 1999.
with extended-spectrum beta-lactamase producing- Klebsiella
[53] R. J. Buhr, J. M. Walker, D. V. Bourassa, A. B. Caudill, B. H. pneumoniae and Escherichia coli during scalding and defeath-
Kiepper, and H. Zhuang, “Impact of broiler processing scalding ering of broiler carcasses,” Food Microbiology, vol. 77, pp. 185–
and chilling profiles on carcass and breast meat yield,” Poultry 191, 2019.
Science, vol. 93, no. 6, pp. 1534–1541, 2014.
[69] V. M. Allen, M. H. Hinton, D. B. Tinker, C. Gibson, G.
[54] N. A. Mir, A. Rafiq, F. Kumar, V. Singh, and V. Shukla, “Determi- C. Mead, and C. M. Wathes, “Microbial cross-contamination
nants of broiler chicken meat quality and factors affecting them: by airborne dispersion and contagion during defeathering of
a review,” Journal of Food Science and Technology, vol. 54, no. 10, poultry,” British Poultry Science, vol. 44, no. 4, pp. 567–576, 2003.
pp. 2997–3009, 2017. [70] V. M. Allen, D. B. Tinker, M. H. Hinton, and C. M. Wathes,
[55] S. Notermans and E. H. Kampelmacher, “Heat destruction of “Dispersal of micro-organisms in commercial defeathering
some bacterial strains attached to broiler skin,” British Poultry systems,” British Poultry Science, vol. 44, no. 1, pp. 53–59, 2003.
Science, vol. 16, no. 4, pp. 351–361, 2007. [71] J. W. Arnold, “Bacterial contamination on rubber picker fingers
[56] R. W. A. W. Mulder, L. W. J. Dorresteijn, and J. V. Van Der before, during, and after processing,” Poultry Science, vol. 86, no.
Broek, “Cross-contamination during the scalding and plucking 12, pp. 2671–2675, 2007.
of broilers,” British Poultry Science, vol. 19, no. 1, pp. 61–70, 1978. [72] J. A. Cason, A. Hinton Jr., and R. J. Buhr, “Impact of feathers and
[57] W. O. James, J. C. Prucha, R. L. Brewer et al., “Effects of counter- feather follicles on broiler carcass bacteria,” Poultry Science, vol.
current scalding and postscald spray on the bacteriologic profile 83, no. 8, pp. 1452–1455, 2004.
of raw chicken carcasses,” Journal of the American Veterinary [73] M. E. Berrang, J. A. Dickens, and M. T. Musgrove, “Effects
Medical Association, vol. 201, no. 5, pp. 705–708, 1992. of hot water application after defeathering on the levels of
[58] J. A. Cason, A. D. Whittemore, and A. D. Shackelford, “Aerobic Campylobacter, coliform bacteria, and Escherichia coli on
bacteria and solids in a three-tank, two-pass, counterflow broiler carcasses,” Poultry Science, vol. 79, no. 11, pp. 1689–1693,
scalder,” Poultry Science, vol. 78, no. 1, pp. 144–147, 1999. 2000.
[74] J. D. Stopforth, R. O’Connor, M. Lopes, B. Kottapalli, W. E. to reduce microorganisms on chicken carcasses,” Food Control,
Hill, and M. Samadpour, “Validation of individual and multiple- vol. 86, pp. 200–206, 2018.
sequential interventions for reduction of microbial populations [88] G. Kere Kemp, M. L. Aldrich, M. L. Guerra, and K. R. Schneider,
during processing of poultry carcasses and parts,” Journal of “Continuous online processing of fecal- and ingesta contam-
Food Protection, vol. 70, no. 6, pp. 1393–1401, 2007. inated poultry carcasses using an acidified sodium chlorite
[75] J. A. Dickens and A. D. Whittemore, “Effects of acetic acid antimicrobial intervention,” Journal of Food Protection, vol. 64,
and hydrogen peroxide application during defeathering on the no. 6, pp. 807–812, 2001.
microbiological quality of broiler carcasses prior to eviscera- [89] G. K. Kemp, M. L. Aldrich, and A. L. Waldroup, “Acidified
tion,” Poultry Science, vol. 76, no. 4, pp. 657–660, 1997. sodium chlorite antimicrobial treatment of broiler carcasses,”
[76] S. M. Russell and J. M. Walker, “The effect of evisceration on Journal of Food Protection, vol. 63, no. 8, pp. 1087–1092, 2000.
visible contamination and the microbiological profile of fresh [90] A. Hinton Jr. and K. D. Ingram, “Microbicidal activity of
broiler chicken carcasses using the nu-tech evisceration system tripotassium phosphate and fatty acids toward spoilage and
or the conventional streamlined inspection system,” Poultry pathogenic bacteria associated with poultry,” Journal of Food
Science, vol. 76, no. 5, pp. 780–784, 1997. Protection, vol. 68, no. 7, pp. 1462–1466, 2005.
[77] E. Pacholewicz, S. A. Sura Barus, A. Swart, A. H. Havelaar, L. J. [91] A. Hinton Jr., J. K. Northcutt, J. A. Cason, D. P. Smith, and K.
A. Lipman, and P. A. Luning, “Influence of food handlers’ com- D. Ingram, “Bacterial populations of broiler carcasses washed
pliance with procedures of poultry carcasses contamination: A in mixtures of potassium hydroxide and lauric acid,” Journal of
case study concerning evisceration in broiler slaughterhouses,” Applied Poultry Research, vol. 16, no. 3, pp. 387–391, 2007.
Food Control, vol. 68, pp. 367–378, 2016. [92] A. Hinton Jr. and K. D. Ingram, “Use of oleic acid to reduce the
[78] P. Singh, H. C. Lee, K. B. Chin, S. D. Ha, and I. Kang, population of the bacterial flora of poultry skin,” Journal of Food
“Quantification of loosely associated and tightly associated Protection, vol. 63, no. 9, pp. 1282–1286, 2000.
bacteria on broiler carcass skin using swabbing, stomaching, [93] S. M. Jiménez, P. Destefanis, M. S. Salsi, M. C. Tiburzi, and M.
and grinding methods,” Poultry Science, vol. 94, no. 12, pp. 3034– E. Pirovani, “Predictive model for reduction of Escherichia coli
3039, 2015. during acetic acid decontamination of chicken skin,” Journal of
[79] M. E. Berrang, R. J. Buhr, J. A. Cason, and J. A. Dickens, “Micro- Applied Microbiology, vol. 99, no. 4, pp. 829–835, 2005.
biological consequences of skin removal prior to evisceration [94] D. Shin, G. Kakani, V. A. Molina, J. M. Regenstein, H. S. Choe,
of broiler carcasses,” Poultry Science, vol. 81, no. 1, pp. 134–138, and M. X. Sánchez-Plata, “Effect of kosher salt application on
2002. microbial profiles of poultry carcasses,” Poultry Science, vol. 91,
[80] R. W. Mulder and N. M. Bolder, “The effect of different bird no. 12, pp. 3247–3252, 2012.
washers on the microbiological quality of broiler carcasses,” The [95] L. L. Duffy, P. J. Blackall, R. N. Cobbold, and N. Fegan,
Veterinary Quarterly, vol. 106, no. 14, pp. 124–130, 1981. “Quantitative effects of in-line operations on Campylobacter
and Escherichia coli through two Australian broiler processing
[81] O. A. Oyarzabal, C. Hawk, S. F. Bilgili, C. C. Warf, and G.
plants,” International Journal of Food Microbiology, vol. 188, pp.
K. Kemp, “Effects of postchill application of acidified sodium
128–134, 2014.
chlorite to control Campylobacter spp. and Escherichia coli on
commercial broiler carcasses,” Journal of Food Protection, vol. [96] E. Pacholewicz, A. Swart, M. Schipper et al., “A comparison
67, no. 10, pp. 2288–2291, 2004. of fluctuations of Campylobacter and Escherichia coli concen-
trations on broiler chicken carcasses during processing in two
[82] A. Giombelli and M. B. A. Gloria, “Prevalence of Salmonella and
slaughterhouses,” International Journal of Food Microbiology,
Campylobacter on broiler chickens from farm to slaughter and
vol. 205, pp. 119–127, 2015.
efficiency of methods to remove visible fecal contamination,”
Journal of Food Protection, vol. 77, no. 11, pp. 1851–1859, 2014. [97] Y. Agerso, F. M. Aarestrup, K. Pedersen, A. M. Seyfarth, T.
Struve, and H. Hasman, “Prevalence of extended-spectrum
[83] A. Giombelli, D. Hammerschmitt, M. F. Cerutti et al., “High cephalosporinase (ESC)-producing Escherichia coli in Danish
pressure spray with water shows similar efficiency to trimming slaughter pigs and retail meat identified by selective enrichment
in controlling microorganisms on poultry carcasses,” Poultry and association with cephalosporin usage,” Journal of Antimi-
Science, vol. 94, no. 10, pp. 2589–2595, 2015. crobial Chemotherapy, vol. 67, no. 3, Article ID dkr507, pp. 582–
[84] L. N. Bartenfeld, D. L. Fletcher, J. K. Northcutt, D. V. Bourassa, 588, 2012.
N. A. Cox, and R. J. Buhr, “The effect of high-level chlorine [98] C. Belmar Campos, I. Fenner, N. Wiese et al., “Prevalence and
carcass drench on the recovery of Salmonella and enumeration genotypes of extended spectrum beta-lactamases in Enterobac-
of bacteria from broiler carcasses,” Poultry Science, vol. 93, no. teriaceae isolated from human stool and chicken meat in Ham-
11, pp. 2893–2899, 2014. burg, Germany,” International Journal of Medical Microbiology,
[85] P. Whyte, J. D. Collins, K. McGill, C. Monahan, and H. vol. 304, no. 5-6, pp. 678–684, 2014.
O’Mahony, “Quantitative investigation of the effects of chemical [99] A. Kola, C. Kohler, Y. Pfeifer et al., “High prevalence
decontamination procedures on the microbiological status of of extended-spectrum-𝛽-lactamase-producing Enterobacteri-
broiler carcasses during processing,” Journal of Food Protection, aceae in organic and conventional retail chicken meat, Ger-
vol. 64, no. 2, pp. 179–183, 2001. many,” Journal of Antimicrobial Chemotherapy, vol. 67, no. 11,
[86] J. Northcutt, D. Smith, K. D. Ingram, A. Hinton Jr., and M. Article ID dks295, pp. 2631–2634, 2012.
Musgrove, “Recovery of bacteria from broiler carcasses after [100] V. M. Allen, C. H. Burton, J. E. L. Corry, G. C. Mead, and D. E.
spray washing with acidified electrolyzed water or sodium Tinker, “Investigation of hygiene aspects during air chilling of
hypochlorite solutions,” Poultry Science, vol. 86, no. 10, pp. poultry carcases using a model rig,” British Poultry Science, vol.
2239–2244, 2007. 41, no. 5, pp. 575–583, 2000.
[87] H. Wang, J. Qi, D. Duan, Y. Dong, X. Xu, and G. Zhou, “Combi- [101] V. M. Allen, J. E. L. Corry, C. H. Burton, R. T. Whyte, and
nation of a novel designed spray cabinet and electrolyzed water G. C. Mead, “Hygiene aspects of modern poultry chilling,”
International Journal of Food Microbiology, vol. 58, no. 1-2, pp. [115] A. Al-Nehlawi, J. Saldo, L. F. Vega, and S. Guri, “Effect of
39–48, 2000. high carbon dioxide atmosphere packaging and soluble gas
[102] S. Barbut, L. F. Moza, F. Nattress, B. Dilts, and C. O. Gill, “The stabilization pre-treatment on the shelf-life and quality of
microbiological conditions of air- or water-chilled carcasses chicken drumsticks,” Meat Science, vol. 94, no. 1, pp. 1–8, 2013.
produced at the same poultry packing plant,” Journal of Applied [116] J. A. Byrd, A. R. Sams, B. M. Hargis, and D. J. Caldwell, “Effect
Poultry Research, vol. 18, no. 3, pp. 501–507, 2009. of selected modified atmosphere packaging on Campylobacter
[103] M. E. Berrang, R. J. Meinersmann, D. P. Smith, and H. survival in raw poultry,” Poultry Science, vol. 90, no. 6, pp. 1324–
Zhuang, “The effect of chilling in cold air or ice water on the 1328, 2011.
microbiological quality of broiler carcasses and the population [117] H. Meredith, V. Valdramidis, B. T. Rotabakk, M. Sivertsvik,
of Campylobacter,” Poultry Science, vol. 87, no. 5, pp. 992–998, D. McDowell, and D. J. Bolton, “Effect of different modi-
2008. fied atmospheric packaging (MAP) gaseous combinations on
[104] M. X. Sánchez, W. M. Fluckey, M. M. Brashears, and S. Campylobacter and the shelf-life of chilled poultry fillets,” Food
R. McKee, “Microbial profile and antibiotic susceptibility of Microbiology, vol. 44, pp. 196–203, 2014.
Campylobacter spp. and Salmonella spp. in broilers processed [118] A. Rouger, O. Tresse, and M. Zagorec, “Bacterial contaminants
in air-chilled and immersion-chilled environments,” Journal of of poultry meat: sources, species, and dynamics,” Microorgan-
Food Protection, vol. 65, no. 6, pp. 948–956, 2002. isms, vol. 5, no. 3, p. 50, 2017.
[105] L. Zhang, J. Y. Jeong, K. K. Janardhanan, E. T. Ryser, and I. Kang, [119] K. W. McMillin, “Advancements in meat packaging,” Meat
“Microbiological quality of water immersion - Chilled and air- Science, vol. 132, pp. 153–162, 2017.
chilled broilers,” Journal of Food Protection, vol. 74, no. 9, pp. [120] S. Ravishankar, L. Zhu, C. W. Olsen, T. H. McHugh, and M.
1531–1535, 2011. Friedman, “Edible apple film wraps containing plant antimi-
crobials inactivate foodborne pathogens on meat and poultry
[106] C. James, S. J. James, N. Hannay et al., “Decontamination of
products,” Journal of Food Science, vol. 74, no. 8, pp. M440–
poultry carcasses using steam or hot water in combination
M445, 2009.
with rapid cooling, chilling or freezing of carcass surfaces,”
International Journal of Food Microbiology, vol. 114, no. 2, pp. [121] K. H. Seol, D. G. Lim, A. Jang, C. Jo, and M. Lee, “Antimicrobial
195–203, 2007. effect of 𝜅-carrageenan-based edible film containing ovotrans-
ferrin in fresh chicken breast stored at 5∘ C,” Meat Science, vol.
[107] A. Patsias, A. V. Badeka, I. N. Savvaidis, and M. G. Kontominas,
83, no. 3, pp. 479–483, 2009.
“Combined effect of freeze chilling and MAP on quality
parameters of raw chicken fillets,” Food Microbiology, vol. 25, [122] M. Gulmez, N. Oral, and L. Vatansever, “The effect of water
no. 4, pp. 575–581, 2008. extract of sumac (Rhus coriaria L.) and lactic acid on decon-
tamination and shelf life of raw broiler wings,” Poultry Science,
[108] B. D. Chaves, I. Y. Han, P. L. Dawson, and K. Northcutt, “Sur- vol. 85, no. 8, pp. 1466–1471, 2006.
vival of artificially inoculated Escherichia coli and Salmonella
[123] P. N. Haughton, J. G. Lyng, D. J. Morgan, D. A. Cronin, S.
Typhimurium on the surface of raw poultry products subjected
Fanning, and P. Whyte, “Efficacy of high-intensity pulsed light
to crust freezing,” Poultry Science, vol. 90, no. 12, pp. 2874–2878,
for the microbiological decontamination of chicken, associated
2011.
packaging, and contact surfaces,” Foodborne Pathogens and
[109] J. A. Dickens, M. E. Berrang, and N. A. Cox, “Efficacy of an Disease, vol. 8, no. 1, pp. 109–117, 2011.
herbal extract on the microbiological quality of broiler carcasses
[124] A. Kašková, O. Ondrašovičová, M. Vargová, M. Ondrašovič,
during a simulated chill,” Poultry Science, vol. 79, no. 8, pp. 1200–
and J. Venglovský, “Application of peracetic acid and quar-
1203, 2000.
ternary ammonium disinfectants as a part of sanitary treatment
[110] L. C. T. Souza Jr., J. G. Pereira, T. L. B. Spina, T. B. Izidoro, A. in a poultry house and poultry processing plant,” Zoonoses and
C. Oliveira, and J. P. A. N. Pinto, “Microbiological evaluation of Public Health, vol. 54, no. 3-4, pp. 125–130, 2007.
chicken carcasses in an immersion chilling system with water [125] E. M. M. Rossoni and C. C. Gaylarde, “Comparison of
renewal at 8 and 16 hours,” Journal of Food Protection, vol. 75, sodium hypochlorite and peracetic acid as sanitising agents for
no. 5, pp. 973–975, 2012. stainless steel food processing surfaces using epifluorescence
[111] J. A. Cason, M. E. Berrang, R. J. Buhr, and N. A. Cox, “Effect of microscopy,” International Journal of Food Microbiology, vol. 61,
prechill fecal contamination on numbers of bacteria recovered no. 1, pp. 81–85, 2000.
from broiler chicken carcasses before and after immersion [126] V. M. Allen, C. H. Burton, D. J. Wilkinson et al., “Evaluation
chilling,” Journal of Food Protection, vol. 67, no. 9, pp. 1829–1833, of the performance of different cleaning treatments in reducing
2004. microbial contamination of poultry transport crates,” British
[112] M. Kameyama, T. Chuma, T. Nishimoto et al., “Effect of cooled Poultry Science, vol. 49, no. 3, pp. 233–240, 2008.
and chlorinated chiller water on campylobacter and coliform [127] V. M. Allen, R. T. Whyte, C. H. Burton et al., “Effect of ultrasonic
counts on broiler carcasses during chilling at a middle-size treatment during cleaning on the microbiological condition of
poultry processing plant,” Journal of Veterinary Medical Science, poultry transport crates,” British Poultry Science, vol. 49, no. 4,
vol. 74, no. 1, pp. 129–133, 2012. pp. 423–428, 2008.
[113] S. M. Russell and S. P. Axtell, “Monochloramine versus sodium [128] V. M. Soares, J. G. Pereira, C. M. Zanette et al., “Cleaning con-
hypochlorite as antimicrobial agents for reducing populations veyor belts in the chicken-cutting area of a poultry processing
of bacteria on broiler chicken carcasses,” Journal of Food plant with 45∘ C water,” Journal of Food Protection, vol. 77, no. 3,
Protection, vol. 68, no. 4, pp. 758–763, 2005. pp. 496–498, 2014.
[114] J. H. Chen, Y. Ren, J. Seow, T. Liu, W. S. Bang, and H. G. Yuk, [129] N. J. Rowan, S. Espie, J. Harrower, J. G. Anderson, L. Marsili,
“Intervention technologies for ensuring microbiological safety and S. J. MacGregor, “Pulsed-plasma gas-discharge inactivation
of meat: current and future trends,” Comprehensive Reviews in of microbial pathogens in chilled poultry wash water,” Journal
Food Science and Food Safety, vol. 11, no. 2, pp. 119–132, 2012. of Food Protection, vol. 70, no. 12, pp. 2805–2810, 2007.
[130] T. Kim, J. L. Silva, and T. C. Chen, “Effects of UV irradiation

on selected pathogens in peptone water and on stainless steel
and chicken meat,” Journal of Food Protection, vol. 65, no. 7, pp.
1142–1145, 2002.
[131] C. Sommers, N. W. Gunther, and S. Sheen, “Inactivation of
Salmonella spp., pathogenic Escherichia coli, Staphylococcus
spp., or Listeria monocytogenes in chicken purge or skin using
a 405-nm LED array,” Food Microbiology, vol. 64, pp. 135–138,
2017.
[132] P. F. M. Teunis, E. G. Evers, P. D. Hengeveld, C. M. Dierikx, C.
C. C. H. Wielders, and E. Van Duijkeren, “Time to acquire and
lose carriership of ESBL/ pAmpC producing E. coli in humans
in the Netherlands,” PLoS ONE, vol. 13, no. 3, 2018.
[133] M. Caltagirone, E. Nucleo, M. Spalla et al., “Occurrence of
extended spectrum 𝛽-lactamases, KPC-Type, and MCR-1.2-
producing enterobacteriaceae from wells, river water, and
wastewater treatment plants in Oltrepò Pavese area, Northern
Italy,” Frontiers in Microbiology, vol. 8, 2017.
[134] A. A. Diallo, H. Brugère, M. Kérourédan et al., “Persistence
and prevalence of pathogenic and extended-spectrum beta-
lactamase-producing Escherichia coli in municipal wastewater
treatment plant receiving slaughterhouse wastewater,” Water
Research, vol. 47, no. 13, pp. 4719–4729, 2013.
[135] V. Dupouy, B. Doublet, N. Arpaillange et al., “Dominant
plasmids carrying extended-spectrum 𝛽-lactamases blaCTX-
M genes in genetically diverse Escherichia coli from slaugh-
terhouse and urban wastewaters,” Environmental Microbiology
Reports, 2016.
[136] L. Gao, J. Hu, X. Zhang et al., “Dissemination of ESBL-
producing Escherichia coli of chicken origin to the nearby river
water,” Journal of Molecular Microbiology and Biotechnology, vol.
24, no. 4, pp. 279–285, 2014.
[137] S. Notermans and E. H. Kampelmacher, “Further studies on the
attachment of bacteria to skin,” British Poultry Science, vol. 16,
no. 5, pp. 487–496, 1975.
Hindawi
https://doi.org/10.1155/2018/6536919
Research Article
Chemical Composition and Enzymatic Screening of
Micromeria fruticosa serpyllifolia Volatile Oils Collected from
Three Different Regions of West Bank, Palestine
Nihaya Salameh, Naser Shraim , and Nidal Jaradat

Department of Pharmacy, Faculty of Medicine and Health Sciences, An-Najah National University, Nablus,
P.O. Box 7, Nablus, State of Palestine
Correspondence should be addressed to Naser Shraim; shraim.n@gmail.com
Received 26 July 2018; Revised 9 September 2018; Accepted 27 September 2018; Published 16 October 2018
Copyright © 2018 Nihaya Salameh et al. This is an open access article distributed under the Creative Commons Attribution License,
Introduction. Volatile oils (VOs) have been commonly used in cosmetics and food as fragrances, flavoring, and preservative agents
or in alternative medicine for their therapeutic effects. This necessitates investigating those plants and their VOs. This study was
conducted to investigate the chemical compositions of the VOs of Micromeria fruticosa serpyllifolia growing widely in three regions
in Palestine (i.e., Hebron, Ramallah, and Nablus districts representing south, middle, and north of West Bank). Afterwards, VOs
were subjected to in vitro screening and their enzymatic properties were compared. Methods. The analysis of chemical components
of VOs was performed by gas chromatography coupled with mass spectrometry (GC-MS). The antilipase activity was evaluated
using porcine pancreatic lipase and p-nitrophenyl butyrate. The antiamylase activity was assessed using porcine pancreatic 𝛼-
amylase, starch, and 3,5-dinitrosalicylic. Results. Plant extracts yield range was 0.67 to 0.99 w/w%. GC-MS analysis showed the
high percentages of oxygenated components in the range of 86.1-89.88% and nonoxygenated components in the range of 4.38-
4.71%. Seven components were observed, pulegone was the most abundant component in the three samples in the range of 74.43-
86.04%, and isomenthone was the second most abundant component with the range of 3.16-14.41%. The sample collected from
Nablus showed the most potent antilipase and antiamylase activity with IC50 values of 39.81 𝜇g/mL and 3.31 𝜇g/mL, respectively.
Conclusions. The study showed that Micromeria fruticosa serpyllifolia volatile oils samples from different regions in Palestine
contained different proportions of phytochemicals which provided different potential biological activities such as antiobesity and
antidiabetes activities that were in line with traditional uses of the plant extracts. The plant extracts showed higher antilipase and
antiamylase potency than that of the relative references and there were significant differences in these activities compared to each
other.
1. Introduction anthelmintic, antimalarial, antiviral, antibacterial, cholesterol

inhibition, and insecticide effects [3, 4]. Volatile oil also
Dissimilar to conventional single drug, plant extracts or called “ethereal oil” or “essential oil” is extracted from
raw plants have a range of phytochemicals and bioactive different parts of plant (roots, bark, leaves, flowers, fruits,
constituents that provide synergistic effects which allow for etc.) [5]. The chemical compounds of VOs can be classi-
multitarget effect in curing of diseases [1]. The medicinal fied into oxygenated (ketones, alcohols, phenols, etc.) and
plants and their claimed traditional use are considered one of hydrocarbons (limonene, pinene, etc.) [6, 7]. The chemical
the major approaches in developing new drug from natural structures of VOs determine their therapeutic activities [6].
products [2]. Secondary metabolites, including alkaloids, The chemical composition and the aroma of VOs may be
glycosides, flavonoids, phenols, steroids, saponins, tannins, different due to growing condition (climate, type of soil
terpenoids, and volatile oils (VOs), are important for healing and composition, altitude), plant age, geo-climatic location,
diseases and are responsible for the therapeutic effect of and environmental conditions of collection time and site
plants; for example, VOs have anti-inflammatory, anticancer, [8].
Dangerous health problems causing big load to global They can also be used as a natural substance for replace-
health sector such as obesity are a global health danger, ment of synthetic herbicides due to the presence of pulegone
which negatively affect personal professional quality of life, which consisted of 70% of oils chemicals [30]. Therefore,
morbidity, and mortality [9]. The greatest cost expended for the aim of the current study was to identify the chemical
obesity is due to coronary heart disease, diabetes type 2, and composition and the potential enzymatic activities of M
hypertension [10]. Orlistat is among the most common drugs fruticosa serpyllifolia growing wildly in three regions in West
used for obesity treatment, but there is still deficiency of safe Bank area in Palestine and to perform a comparative study of
medicine for treating obesity [9]. Diabetes has caused a major the results among three regions in Palestine.
load to the global health sector [11]. Diabetes is a dangerous
disease and has serious complications; WHO reported that 2. Materials and Methods
8.5% of adults around the world have diabetes, and 1.6 million
2.1. Chemical Reagents. Porcine pancreatic lipase, Tris-HCl,
deaths occurred in 2015 [12]. Therefore, the investigation
PNPB (𝑝-nitrophenyl butyrate), Amylase type VI -B, ≥ 10
for antidiabetic agents from plant extract has increased, as unit/mg, Acarbose, and Calcium Chloride were purchased
discovering new effective drugs is important for controlling from Sigma-Aldrich, USA. Orlistat was purchased from
the disease [11]. Sigma-Aldrich, China, Acetonitrile and dimethyl sulfoxide
Micromeria fruticosa subspecies serpyllifolia (M. Bieb.) (DMSO) were purchased from CARLO ERBA, France. 3,5-
(Lamiaceae), known as White Micromeria, is an aromatic Dinitrosalysylic acid (DNSA) was purchased from Sigma-
herb [13], dominated in the eastern Mediterranean regions Aldrich, India, sodium potassium tartrate tetrahydrate
including Palestine, has pleasant minty fragrance, and in hot was purchased from Merck, Germany, sodium hydroxide
summer provides sensation of coolness [14, 15]. In Palestinian (NaOH) was purchased from Sun Pharm.drug stars, Nablus,
society known as Duqat ‘Adas, ‘Ishbit esh-shai, Qurnya [16, Palestine, Disodium hydrophosphate/dihydrosodium phos-
17], and as Thyme-leave savory in English, the aerial parts phate (Na2 HPO4 /NaH2 PO4 ) was purchased from Alfa Aesar,
of plant (flower, leaves, and stalk) are used in folk medicine USA, Sodium chloride (NaCl) was self-backing (Alshela
[16]. M fruticosa serpyllifolia is a perennial Mediterranean company, Palestine) as well as Starch (Alzahra company,
plant habitant in rocky areas that has a height of 20-80 cm. Nablus, Palestine).
It is short-shrub plant grown in the period of end winter
and spring and starts flowering in summer until autumn 2.2. Instrumentation. Grinder (Moulinex model, Uno.
with white color [15, 18–20]. Stems are straight, whitish, China) was used to fracture the dried herbs. Balance max
covered with short, dense, and soft hair, thick, and solid. 220 g (Radway, Poland) was used to weigh the plant material,
Leaves are greyish-white, thyme-leaved, and covered with microwave-ultrasonic cooperative extractor/reactor (CW-
very finely hair. Inflorescence is a cluster of cymes with many 2000, China) was utilized for extraction volatile oil, and Gas
branching flowers. Corolla is yellow or white, scarcely female, Chromatography Mass Spectrometry (QP-5000 Shimadzu
and self-pollinated in unopened flowers [21–23]. M fruti- GC-MS, Japan) was utilized for chemical screening of
cosa serpyllifolia has different uses in traditional medicine VO. Balance was 4500 g (BOECO, Germany), Ultraviolet-
such as treatment of hypertension, heart disorders, diarrhea, Visible (UV-Vis) Spectrophotometer (Jen WAY 7315, UK)
abdominal pains, colds, headache, wounds, infections such was utilized for assessment the enzymatic activities of
as skin and eye infections and has anti-inflammatory effects VOs, water bath was from Memert, Germany, water bath
[15, 24–28]. In Palestinian society M fruticosa serpyllifolia is sonicator was from MRC, Haifa, and heater was from
considered one of the most wild edible plants in Palestine Lab-Tech, Korea. pH meter was used to adjust pH of
[14]. The leaves are prepared as tea for colds and relieve disodium hydrophosphate/dihydrosodium phosphate
intestine and stomach pain in addition to exhaustion and (Na2 HPO4 /NaH2 PO4 ). Micropipettes were from Microliter,
weariness [15]. The extracts of leaves have been used for BRAND, Germany.
relief chest, respiratory system, asthma, fever, skin infections,
wounds, and eye inflammation [18, 20]; in addition to that, 2.3. Plant Material Collection and Treatment. The aerial parts
the infusion of M fruticosa serpyllifolia stalks and leaves in of M fruticosa serpyllifolia were collected in April of 2017
Palestinian society is used in treatment of diabetes, cough, from three cities in the West Bank (WB) in Palestine: Nablus,
headaches, and urinary diseases [16, 20]. The major con- Ramallah, and Hebron which represented north, middle, and
stituents of M fruticosa serpyllifolia VOs were monoterpenes south regions of the WB in Palestine, respectively (three
(pulegone, menthol, isomenthol, isomenthone, limonene, 𝛼- samples were collected from each city). The samples were
pinene, 𝛽-pinene, piperitone, and piperitenone oxide), and botanically identified and coded by Dr. Nidal Jaradat the
sesquiterpenes (b-caryophyllene and germacrene) [15, 19, 24]. Pharmacognosist at An-Najah National University (ANNU)
Studies conducted on the aqueous extract of M fruticosa under the voucher specimen code: Pharm-PCT-1575. The
serpyllifolia showed anti-inflammatory effect and protection extraction of VOs followed the procedure in [31]. The fresh
against gastric ulcer activities so it can be used as supplement aerial parts of M fruticosa serpyllifolia were separated care-
or alternative herbal therapy for NSAIDs which can cause fully, washed two times with distilled water, and dried for two
gastric ulcers [18, 25]. M fruticosa serpyllifolia VOs also weeks in the shade at room temperature. The dried specimens
exhibit antibacterial, antifungal, antioxidants, insecticide, were fractured and stored in well closed plastic bags for
analgesic, anticonvulsants, hepatoprotective, and Central future use in the Laboratory of Pharmacognosy at An-Najah
Nervous System (CNS) depressant effects [13, 15, 26, 29]. National University Faculty of Medicine and Health Sciences.
2.4. Extraction of Volatile Oils. The VOs of the three samples manufacturer’s instructions (20.9 mg of PNPB in 2 mL of
of M fruticosa serpyllifolia plant were extracted by microwave- acetonitrile). From each working solution of plant extract,
ultrasonic method which was examined by Jaradat et al, 2016 200 𝜇L was mixed with 100 𝜇L of porcine pancreatic lipase
by which the suspension of plant fractures was exposed to (1 mg/mL), and then the volume was brought to 1000 𝜇L
ultrasonic waves to improve the extraction process [31]. The with Tris-HCl solution and incubated at 37∘ C in water bath
apparatus consisted of a microwave oven combined with an for 15 min. After the incubation time, 100 𝜇L of PNPB
ultrasonic extractor. Approximately 100 g of the fractioned solution was added. The mixture was again incubated in water
dried aerial parts of each plant sample was placed in a one bath for 30 min at 37∘ C. A negative control solution was
litter round-bottom flask, about 300 mL deionized water was prepared without plant extract, by mixing 100 𝜇L of porcine
added, and the flask was placed in the apparatus connected pancreatic lipase (1 mg/mL) solution with Tris-HCl solution
up to 1mL. The same procedure was followed for Orlistat used
with Clevenger apparatus placed in the same apparatus. The
as positive control. Tris-HCl buffer was used to zero UV-Vis
power of the microwave-ultrasonic extractor apparatus was
spectrophotometer at 405 nm. Pancreatic lipase activity was
fixed at 1000 W. The ultrasonic power of the apparatus was determined by measuring the hydrolysis of p-nitrophenolate
fixed at 50 W and the frequency of 40 kHz at its maximum to p-nitrophenol at 405 nm using UV-Vis spectrophotometer.
power. The extraction process was prolonged for 10 min at The lipase inhibition activity of M fruticosa serpyllifolia VOs
100∘ C. This was repeated three times for each plant sample. or Orlistat as a reference was identified by measuring the
The resulting VOs were collected into a separate clean, well effect on the enzyme reaction rate after adding extracts,
closed small glass bottle, chemically dried over calcium compared with the control. I% was calculated by the using
chloride, and stored in the refrigerator at 2-8∘ C until use the following equation [37].
[31, 32].
[AbsorbanceControl − AbsorbanceTest ]
𝐼% = ∗ 100% (1)
2.5. GC-MS Analysis. The chemical composition of the three 𝐴𝑏𝑠𝑜𝑟𝑏𝑎𝑛𝑐𝑒𝐶𝑜𝑛𝑡𝑟𝑜𝑙
samples of M fruticosa serpyllifolia VOs was separated and where I% is the percentage inhibition of pancreatic lipase.
quantified using Shimadzu QP-5000 GC-MS. The method
used was described by Mohammad Al-Hamwi et al. [13] and 2.8. 𝛼-Amylase Inhibition. The 𝛼-amylase inhibition assay
Jaradat et al [32] with some modifications. GC was equipped was done according to procedure conducted by N. Nirmali
with column Rtx-5ms (0.25 mm inner diameter, 0.25𝜇m et al. [11] with some modifications. The assay was performed
thickness, and 30 m length). A carrier gas was helium at a using the 3,5-dinitrosalicylic acid (DNSA) method. M fru-
flow rate of 1 mL/min. The temperature of the injector was ticosa serpyllifolia VOs stock solution (S.S) of 1 mg/mL was
220∘ C. The temperature of the oven was programmed from prepared in a minimum amount of DMSO 10% and was
50∘ C (1min hold) at 5∘ C/min to 130∘ C and then at 10∘ C/min to further dissolved in buffer (Na2 HPO4 /NaH2 PO4 (0.02 M),
250∘ C and kept constant for 15 min. The temperature transfer NaCl (0.006 M) at pH 6.9). Working solution of concen-
line was 290∘ C. For GC-MS detection, an electron ionization trations 10, 50, 100, 500, and 1000 𝜇g/mL was prepared
method, with detector volts of 1.7 KV, was utilized. A scan using buffer (Na2 HPO4 /NaH2 PO4 (0.02 M)), NaCl (0.006
speed 1000 amu/sec and scan rate of 0.5 s were used, covering M) at pH 6.9). Acarbose was used as a reference. The stock
a mass range from 38 to 450 M/Z [13, 32]. and working solutions of Acarbose were prepared using the
same procedure of M fruticosa serpyllifolia VOs. 𝛼-Amylase
2.6. Components Identification. The mass spectrometry data solution (2 unit/mL) was prepared by dissolving 12.5 mg of
center of the national institute of standards and technology amylase enzyme in buffer [(Na2 HPO4 /NaH2 PO4 (0.02 M)),
(NIST) was used as a reference to identify the chemical NaCl (0.006 M) at pH 6.9]. A volume of 200 𝜇L of 𝛼-amylase
components of the VOs by comparing their MS spectra solution (2 unit/mL) was mixed with 200 𝜇L of each VOs
with data of NIST in addition to using Kovats index in the working solution and incubated for 10 min at 37∘ C. Then 200
literature to compare their retention times. The quantitative 𝜇L of the starch solution was added and incubated for 3 min.
data were obtained electronically from integrated peaks, area The reaction was stopped by the addition of 200 𝜇L DNSA
percentages without the use of correction factor [32, 33]. reagent and boiled for 10 min in a water bath at 85–90∘ C. The
mixture was cooled to ambient temperature and diluted with
2.7. Pancreatic Lipase (PL) Inhibition. The porcine pancre- 5 mL of distilled water, and the absorbance was measured
atic lipase (PPL) inhibitory assay was conducted using the at 540 nm using a UV-Vis. spectrophotometer. The blank
methods from Jaradat et al. [34], Bustanji et al. [35], and with 100% enzyme activity was prepared by replacing the
Siew-Ling et al. [36] with some modifications. VOs stock plant extract with 200 𝜇L of buffer. Acarbose was used as
solution of 1mg/mL was prepared in 10% Dimethyl sulfoxide a positive control sample. The 𝛼-amylase inhibitory activity
(DMSO) and diluted with DMSO 10% to produce different was expressed as percent inhibition and was calculated using
concentrations (10, 50, 100, 150, 200, 400, 600, and 800 (2). The % 𝛼-amylase inhibition was plotted against the
𝜇g/mL). Orlistat was used as a reference for pancreatic lipase extract concentration and the IC50 values were obtained from
inhibition assay and was prepared by the same procedure the graph [11].
of plant extract. Pancreatic lipase enzyme stock solution
% 𝛼 − 𝑎𝑚𝑦𝑙𝑎𝑠𝑒 𝑖𝑛ℎ𝑖𝑏𝑖𝑡𝑖𝑜𝑛
was prepared immediately before use by suspending in
DMSO10% at concentration of 1 mg/mL. The stock solution [𝐴𝑏𝑠𝐶𝑜𝑛𝑡𝑟𝑜𝑙 − 𝐴𝑏𝑠𝑇𝑒𝑠𝑡 ] (2)
= ∗ 100%
of p-nitrophenyl butyrate (PNPB) was prepared according to 𝐴𝑏𝑠𝐶𝑜𝑛𝑡𝑟𝑜𝑙
Table 1: The total % of yields, chemical compounds, total identified compounds, and chemical groups of the three samples of M fruticosa
serpyllifolia VOs.
% total VO % total VO % total VO

Nablus Ramallah Hebron
(w/w) % yield 0.67% ± 0.29 0.99% ± 0.55 0.70% ± 0.17
𝛼-Pinene 0.91 0.71 0.83
𝛽-Pinene 1.48 0.94 1.08
𝛽-Myrcene < 0.04 0.26 0.35
D- Limonene 1.73 1.65 1.26
Isocaryophyllene 0.26 1 1.19
Isomenthone 3.16 3.84 14.41
Pulegone 82.94 86.04 74.43
Total non-oxygenated constituents 4.38 4.56 4.71
Total oxygenated constituents 86.1 89.88 88.84
Total identified components % 90.48 94.44 93.55
where % 𝛼-amylase inhibition is the percentage inhibition of 120

amylase.
100
2.9. Statistical Analysis. Statistical analysis was conducted
Lipase Inhibition (%)
using one-way ANOVA with post hoc Tukey-Kramer HSD 80

multiple comparison calculation; 𝑝 values less than 0.05 or
0.01 were considered statistically significant [38]. 60
3. Results 40
3.1. Chemical Composition. Volatile oils of the three samples 20

of M fruticosa serpyllifolia were extracted using Microwave-
Ultrasonic Apparatus, and the produced oils were viscous, 0
colorless, and with a nice peppermint smell. The average 1 10 100 1000
percentage of VOs yield (w/w%) of the three samples was Concentration (g/ml)
Nablus (0.67% ± 0.29), Ramallah (0.99% ± 0.55), and Hebron
Orlistat Ramallah
(0.70% ± 0.17) (Table 1). The data were expressed as mean ±
Nablus Hebron
STDV (n=3).
The chemical analysis conducted using GC-MS char- Figure 1: Lipase inhibition assay of the three samples of M fruticosa
acterized the VOs with seven components classified into serpyllifolia VOs and Orlistat.
oxygenated ingredients mainly ketones and nonoxygenated
ingredients mainly hydrocarbons in all three samples with
different proportions (Table 1). The most abundant compo-
nents in all three samples were pulegone and isomenthone. 39.81 𝜇g/mL but with a maximum inhibition % of 65.40%.
The total identified components in the three samples were However, Orlistat owned potency at IC50 value of 43.64
almost consistent in which 90.48, 94.44, and 93.55% of the 𝜇g/mL with antilipase inhibition of 99.13%. The results of
constituents were identified in Nablus, Ramallah, and Hebron IC50 values and the antilipase activity of the three samples
districts, respectively. Detailed results are represented in and Orlistat are shown in Table 2 and Figure 1. Comparative
Table 1. Other five common compounds identified in all statistical analysis of the findings of the three samples of VOs
three samples with total percentage less than 2% were D- showed that there were significant differences in antilipase
Limonene, 𝛽-Pinene, Isocaryophyllene, 𝛼-Pinene, and 𝛽- potency and efficacy of VOs compared to Orlistat (p < 0.01).
Myrcene (Table 1). In addition, there were significant differences in antilipase
potency and efficacy of VOs compared to each other (p <
3.2. Lipase Inhibition Activity. The hydrolysis of p-nitro- 0.01).
phenyl butyrate to p-nitrophenol was used to measure the
influence of M fruticosa serpyllifolia VOs of three samples 3.3. 𝛼-Amylase Inhibition Assay. In vitro assay of alpha
on pancreatic lipase enzyme. The assay was detected by amylase inhibitory activities by using starch as a substrate
comparing to Orlistat lipase inhibitory agent; the three and Acarbose as a positive control was conducted on M
VOs samples showed varied antilipase activity while Nablus fruticosa serpyllifolia VOs of the three samples. Our findings
VO sample showed the highest potency with IC50 value of revealed that the three samples of VOs showed different
Table 2: Lipase inhibition assay of the three samples of M fruticosa serpyllifolia VOs and Orlistat.
Orlistat Nablus Ramallah Hebron

IC50 𝜇g/mL 43.64 39.81a 43.73ab 51.21abc
Antilipase activity 99.13% 65.41%a 54.94%ab 36.92%abc
a𝑝
< 0.01 compared to Orlistat, b 𝑝 < 0.01 compared to Nablus sample, and c 𝑝 < 0.01 compared to Ramallah.
Table 3: 𝛼-Amylase inhibition assay of the three samples of M fruticosa serpyllifolia VOs and Acarbose.
Acarbose Nablus Ramallah Hebron

IC50 𝜇g/mL 21.38 3.31a 3.40ab 3.35abc
antiamylase activity 91.39% 64.34%a 23.77%ab 25.00%abc
a𝑝
< 0.01 compared to Acarbose, b 𝑝 < 0.01 compared to Nablus, and c 𝑝 < 0.01 compared to Ramallah.
100 plants, harvest season, nature of the soil, age of the plant
90 parts (young or adult), and time of collection. In addition,
80 the effect of the environment on the secondary metabolic
profile of Micromeria fruticosa is a model for environmental
Amylase inhibition%
70
metabolomics of plants. The north region represented by
60 Nablus city showed the highest percent in 𝛼-Pinene, 𝛽-
50 Pinene, and D-Limonene. The middle region represented by
40 Ramallah city owned the highest percent in Pulegone, and the
30
south region represented by Hebron city showed the highest
percent in 𝛽-Myrcene, Isocaryophyllene, and Isomenthone
20 and in total nonoxygenated constituents. These cities are
10 calcified into different biogeographical zones in West Bank
0 in Palestine, such as the central highlands, and the eastern
1 10 100 1000 slope which has influence on climate, elevation, the average
Concentration (g/ml) rainfall, and temperature that affect the rate of biochemical
reaction and the weathering process of soil.
Acarbose Ramallah
The yields of M fruticosa serpyllifolia VOs in the current
Nablus Hebron
study were lower than that the findings of a study conducted
Figure 2: 𝛼-Amylase inhibition assay of M fruticosa serpyllifolia VOs in Palestine studied by Shehab et al., [24] which reported a
from different regions of Palestine. yield of VOs of 2.2%. Also our data were lower in yield than
that of M fruticosa serpyllifolia growing in Turkey examined
by Gulluce et al., [28] who reported a yield of 1.85% of VOs of
the plant collected in the flowering period.
degree of inhibition. The highest potency and efficacy of the The GC-MS analysis identified seven compounds listed
antiamylase activity of the VOs were reported in the sample in Table 1. Studies were conducted previously on M fruti-
collected from Nablus (north), where an IC50 value of 3.31 cosa serpyllifolia VOs. Table 4 summarizes different relevant
𝜇g/mL was estimated with antiamylase inhibition of 64.34%. literature with the most important finding. In Palestine
The VOs samples from Ramallah and Hebron showed little Shehab et al. (2012) reported that pulegone, neo-Menthol,
amylase inhibition activity, while Acarbose showed potency and Isomenthone were the dominant compounds [24], while
at IC50 value of 21.38 𝜇g/mL and I% effect of 91.39%. The in Lebanon Pulegone and D-limonene were the prevalent
results of IC50 values and the antiamylase activity of the components (Al-Hamawi et al., 2011) [13] and for that grow-
three samples and Acarbose are illustrated in Table 3 and ing in Turkey piperitenone, pulegone, and Isomenthone were
Figure 2. The three VOs samples showed higher potency the most abundant components (Gulluce et al., 2004) [28].
in 𝛼-amylase inhibition compared to Acarbose. There were Isa Telci1 and Mustafa Ceylan (2007) [26] reported that the
significant differences in antiamylase potency and efficacy of VOs of subspecies of Micromeria fruticosa belong to different
VOs compared to Acarbose and compared to each other (p < chemotypes, (a) pulegone, linalool, and p-menthone and (b)
0.01). piperitenone and linalool type, and revealed that pulegone
was the most prominent compound in Micromeria species
4. Discussion mainly in M fruticosa. In the current study Isocaryophyllene
was lower than that identified in VO sample of Palestine
The qualitative and quantitative differences in the chemical (Table 4) [24]. The rest of the components in recent study
composition of VOs might be attributed to several factors such as D-limonene, 𝛽-pinene, and 𝛼-pinene were presented
such as geographical factors (location), climatic effects of the in higher levels than that of the samples of the Palestinian
Table 4: Main components and their structures of M fruticosa serpyllifolia VOs from different origin.
Compound and
Origin Sample period Extraction method Reference
concentration
pulegone 58.5%
before flowering stage neoiso-Menthol 8.7% Shehab et al., (2012)
Palestine hydrodistillation
(March) Isomenthone 3.9% [24]
Isocaryophyllene 3.9%
piperitenone 50.61%
Gulluce et al., (2004)
Turkey flowering stage hydrodistillation pulegone 29.19% [28]
Isomenthone 3.92%
Pulegone 30.41%
full flowering stage in Al-Hamawi et
Lebanon hydrodistillation D-limonene 15.64%
July al.,(2011) [13]
Menthalactone10.28%
sample and of the Turkey sample. 𝛽-Myrcene was not iden- samples from different regions in Palestine were investigated
tified in the Turkey sample [24, 28]. Pulegone, limonene, 𝛼- by the inhibition of 𝛼-amylase activity. According to our
pinene, 𝛽-pinene, and 𝛽-myrcene were also being identified knowledge, there were no previous studies conducted for the
in M. barbata growing in Lebanon but in different propor- purpose of assessing the activity of M fruticosa serpyllifolia
tions [39, 40]. The differences in the total percentages of VOs against 𝛼-amylase enzyme. The inhibition of 𝛼-amylase
yields, identified components, and chemical compounds may activity of Sideritis galactica Bornm VOs sample growing
be explained by the variations in environmental conditions in Turkey studied by Zengin et al. (2016) [45] was related
including location, climate, and seasonal and geographical to abundance of monoterpene hydrocarbons ingredients
factors [24]: the part of the plant studied and the growing mainly 𝛼-pinene and 𝛽-pinene. In screening the 𝛼-amylase
period of leaves; the younger leaves were investigated to be inhibitory activity of J. phoenicea volatile oil growing in
rich mainly in pulegone accounting for 70% of the VOs [19]; Tunisia, the results showed powerful 𝛼-amylase inhibition
it accounted for 29.19% of VOs in the flowering stage [28] and
properties due to presence of terpenes like 𝛼-pinene [37]. The
58.5% before flowering period.
M fruticosa serpyllifolia VOs sample from Nablus owned the
The p-nitrophenyl butyrate (PNPB) assay was used as
highest amount of 𝛼-pinene and 𝛽-pinene components (0.91
in vitro approach to investigate the inhibition of pancreatic
lipase (PL) and to screen the antilipase properties of M and 1.48%, respectively) compared with samples of Ramallah
fruticosa serpyllifolia VOs samples from different regions and Hebron which may explain its highest potency against
of Palestine. To the best of our knowledge, there were no 𝛼-amylase enzyme.
previous studies conducted to explore the activity of M Since the volatile oils of Micromeria fruticosa serpyllifolia
fruticosa serpyllifolia VOs against PL enzyme. The results have a potential inhibitory activity against pancreatic lipase
of the current study showed that VO sample from Nablus and 𝛼-amylase enzymes, it is of high importance to take into
owned the highest potency with IC50 value of 39.81 𝜇g/mL consideration pulegone toxicity. The European Medicines
(Table 2, Figure 2). However, through an in vitro screening of Agency (EMA), committee on herbal medicinal products
the phytochemical properties of 30 plants growing in Mexico, (HMPC), concluded that pulegone is considered a hepato-
Villa-Ruano et al. (2013) [41] concluded that plants rich toxin; depending on that, the recommended daily dose of
with terpenes and other phytochemicals (steroids, tannins, pulegone for 60 kg person by EMA would correspond to 2.3
and glycoside) showed very strong antilipase activity. Other mg/kg body weight (bw) [46] taking into account the density
studies reported that plant extracts rich in terpenes showed of pulegone (0.9346 g/mL) [47], and the daily recommended
antilipase activity [42, 43]. Investigating Pinus massoniana dose as mentioned above could be recommended by special-
L. volatile oil growing in China by Wang M et al. (2017) ists as the safe volume of volatile oil ingestion [48].
[44] indicated that the dominant components were related
to monoterpene and sesquiterpene (𝛼-pinene, 𝛽-pinene, 5. Conclusions
D-limonene, and caryophyllene) and were responsible for
antilipase activity of the oil at IC50 25.10 ±0.49 𝜇M. The M fruticosa serpyllifolia VOs from different regions in Pales-
phytochemical screening of the three samples of M fruticosa tine represented by three cities showed variable antilipase
serpyllifolia VOs supports the existence of monoterpenes and antiamylase activities depending on the phytochemical
and sesquiterpenes in all of three samples of VOs. Samples constituents of the volatile oils. M fruticosa serpyllifolia VOs
collected from Nablus owned the highest percentages of of three regions owned the same chemical components but
(𝛼-pinene, 𝛽-pinene, and D-limonene) which support the in difference proportions. The sample from north Palestine
highest antilipase potency and efficacy of Nablus samples. (Nablus) exhibited highest antilipase and antiamylase activity
The antidiabetic properties of M fruticosa serpyllifolia VOs due to higher amount of 𝛼-pinene and 𝛽-pinene. Further in
vivo studies are needed to evaluate the potential pharma- [10] U.S. Department of Health and Human Services, The Surgeon
cological activities and to assess the safety and toxicity of General’s Call to Action to Prevent and Decrease Overweight
plant extract. Also further studies are required to isolate the and Obesity, Rockville MUSDoHaHS, Public Health Service,
basic components responsible for potential pharmacological Office of the Surgeon General, 2001, Available from: U.S. GPO,
activities. Washington.
[11] M. N. Wickramaratne, J. C. Punchihewa, and D. B. M. Wickra-
maratne, “In-vitro alpha amylase inhibitory activity of the leaf
Data Availability extracts of adenanthera pavonina,” BMC Complementary and
The data used to support the findings of this study are Alternative Medicine, vol. 16, no. 1, Article ID 466, 2016.
available from the corresponding author upon request. [12] WHO, Diabetes Fact sheet No. 312, 2017.
[13] Y. B. Mohammad Al-Hamwi, M. Abou-Ela, A. ElLakany, M.
Conflicts of Interest Tabcheh, and F. El-Omar, “Chemical composition and seasonal
variation of the essential oil of Micromeria fruticosa,” Journal of
The authors declare that they have no conflicts of interest. Natural Products, vol. 4, pp. 147–149, 2011.
[14] M. S. Ali-Shtayeh, R. M. Jamous, J. H. Al-Shafie’ et al., “Tradi-
Acknowledgments tional knowledge of wild edible plants used in Palestine (North-
ern West Bank): A comparative study,” Journal of Ethnobiology
The authors would like to thank Dr. Lina Adwan and Mr. and Ethnomedicine, vol. 4, p. 13, 2008.
Shadi K’aibni for their help in performing GC-MS analysis. [15] Z. Yaniv and N. Dudai, Medicinal and Aromatic Plants of the
Also the authors thank the members of Faculty of Graduate Middle-East, vol. 2, 1st edition, 2014.
Studies at An-Najah National University for their support. [16] A. Abu-Rabia, “Ethno-Botanic Treatments for Paralysis (Falij)
in the Middle East,” Chinese Medicine, vol. 3, no. 4, pp. 157–166,
Supplementary Materials 2012.
[17] H. El. Shaer, K. Omer, K. A. Harhash, I. M. Albaradeiya, and
Chemical structure of the main components of M fruti- M. Mahassneh, State of Palestine Fifth National Report to The
cosa serpyllifolia VOs. GC-MS chromatograms and analysis. Convention on Biological Diversity, 2015.
(Supplementary Materials) [18] M. S. Ali-Shtayeh, M. A. Al-Nuri, R. M.-R. Yaghmour, and Y. R.
Faidi, “Antimicrobial activity of Micromeria nervosa from the
References Palestinian area,” Journal of Ethnopharmacology, vol. 58, no. 3,
pp. 143–147, 1997.
[1] S.-Y. Pan, G. Litscher, S.-H. Gao et al., “Historical perspective [19] N. Dudai, O. Larkov, U. Ravid, E. Putievsky, and E. Lewinsohn,
of traditional indigenous medical practices: the current renais- “Developmental control of monoterpene content and composi-
sance and conservation of herbal resources,” Evidence-Based tion in Micromeria fruticosa (L.) Druce,” Annals of Botany, vol.
Complementary and Alternative Medicine, vol. 2014, Article ID 88, no. 3, pp. 349–354, 2001.
525340, 20 pages, 2014.
[20] A. Azab, “MIcromeria: chemistry and medicinal activies,” Euro-
[2] N. R. Farnsworth, O. Akerele, A. S. Bingel, D. D. Soejarto, and Z. pean Chemical Bulletin, vol. 5, no. 7, pp. 300–307, 2016.
Guo, “Medicinal plants in therapy,” Bulletin of the World Health
Organization, vol. 63, no. 6, pp. 965–981, 1985. [21] C. Bräuchler, O. Ryding, and G. Heubl, “The genus Micromeria
(Lamiaceae), a synoptical update,” Willdenowia, vol. 38, no. 2,
[3] A. K. Shakya, “Medicinal plants: Future source of new drug,”
pp. 363–410, 2008.
International Journal of Herbal Medicine, vol. 4, no. 4, pp. 59–
64, 2016. [22] C. Tristram, “Flora of Syria, Palestine, and Sinai,” Palestine
Exploration Quarterly, vol. 29, no. 2, pp. 151–153, 2013.
[4] R. Jalpa, P. Moteriya, and S. Chanda, “Phytochemical screening
and reported biological activities of some medicinal plants of [23] A. A. Fedorov, “Genus Micromeria,” in Flora of Russia The
Gujarat region,” Journal of Pharmacognosy and Phytochemistry, European Part and Bordering Regions, vol. 3, 2000.
vol. 4, no. 2, pp. 192–198, 2015. [24] N. G. Shehab and E. Abu-Gharbieh, “Constituents and bio-
[5] A. J. Haagen-Smit, “The Chemistry, Origin and Function of logical activity of the essential oil and the aqueous extract of
Essential Oils in Plant Life,” in The Essential Oils, E. Guenther, Micromeria fruticosa (L.) Druce subsp. serpyllifolia,” Pakistan
Ed., vol. 1, 1948. Journal of Pharmaceutical Sciences, vol. 25, no. 3, pp. 687–692,
[6] D. Abdelouaheb and A. Dicko, The Therapeutic Benefits of 2012.
Essential Oils, Nutrition, Well-Being and Health, J. Bouayed, Ed., [25] E. Abu-Gharbieh, N. G. Shehab, and S. A. Khan, “Anti-
2012. inflammatory and gastroprotective activities of the aqueous
[7] D. P. De Sousa, “Analgesic-like activity of essential oils con- extract of Micromeria fruticosa (L.) Druce ssp Serpyllifolia in
stituents,” Molecules, vol. 16, no. 3, pp. 2233–2252, 2011. mice,” Pakistan Journal of Pharmaceutical Sciences, vol. 26, no.
[8] E. H. A. Andrade, C. N. Alves, E. F. Guimarães, L. M. M. 4, pp. 799–803, 2013.
Carreira, and J. G. S. Maia, “Variability in essential oil composi- [26] I. Telci and M. Ceylan, “Essential oil composition of Micromeria
tion of Piper dilatatum L.C. Rich,” Biochemical Systematics and fruticosa Druce from Turkey,” Chemistry of Natural Com-
Ecology, vol. 39, no. 4-6, pp. 669–675, 2011. pounds, vol. 43, no. 5, pp. 629–631, 2007.
[9] M. Castro, M. Preto, V. Vasconcelos, and R. Urbatzka, “Obesity: [27] E. Abu-Gharbieh, M. Mohammad, and Y. Bustanji, “In vitro
The metabolic disease, advances on drug discovery and natural effects of Micromeria fruticosa on human leukocyte myeloper-
product research,” Current Topics in Medicinal Chemistry, vol. oxidase activity,” Journal of Pharmacy Research, vol. 3, no. 10, pp.
16, no. 23, pp. 2577–2604, 2016. 2492-2493, 2010.
[28] M. Güllüce, M. Sökmen, F. Şahin, A. Sökmen, A. Adigüzel, and [41] N. Villa-Ruano, G. G. Zurita-Vásquez, Y. Pacheco-Hernández,
H. Özer, “Biological activities of the essential oil and methanolic M. G. Betancourt-Jiménez, R. Cruz-Durán, and H. Duque-
extract of Micromeria fruticosa (L) Druce ssp serpyllifolia Bautista, “Anti-lipase and antioxidant properties of 30 medici-
(Bieb) PH Davis plants from the eastern Anatolia region of nal plants used in Oaxaca, México,” Biological Research, vol. 46,
Turkey,” Journal of the Science of Food and Agriculture, vol. 84, no. 2, pp. 153–160, 2013.
no. 7, pp. 735–741, 2004. [42] S. J. Sarkar, D. Dioundi, and M. Gupta, “Endophytic pestalo-
[29] E. Abu-Gharbieh and N. G. Ahmed, “Bioactive content, hepato- tiopsis species from Andaman Islands: A potential pancreatic
protective and antioxidant activities of whole plant extract of lipase inhibitor,” Asian Journal of Pharmaceutical and Clinical
Micromeria fruticosa (L) Druce ssp Serpyllifolia F Lamiaceae Research, vol. 10, no. 10, pp. 82-83, 2017.
against Carbon tetrachloride-induced hepatotoxicity in mice,” [43] G. Singh, S. Suresh, V. Krishna Bayineni, and R. K. Kadeppagari,
Tropical Journal of Pharmaceutical Research, vol. 15, no. 10, pp. “Lipase inhibitors from plants and their medical applications,”
2099–2106, 2016. International Journal of Pharmacy and Pharmaceutical Sciences,
vol. 7, no. 1, pp. 1–5, 2015.
[30] N. Dudai, A. Poljakoff-Mayber, H. R. Lerner, E. Putievsky, U.
Ravid, and I. Katzir, “Inhibition of germination and growth by [44] M. Wang, D. Gu, H. Li et al., “Rapid prediction and identifica-
volatiles of micromeria fruticosa,” Acta Horticulturae, pp. 123– tion of lipase inhibitors in volatile oil from Pinus massoniana L.
130, 1993. needles,” Phytochemistry, vol. 141, pp. 114–120, 2017.
[45] G. Zengin, C. Sarıkürkçü, A. Aktümsek, and R. Ceylan,
[31] N. A. Jaradat, A. N. Zaid, A. Abuzant, and R. Shawahna,
“Antioxidant potential and inhibition of key enzymes linked
“Investigation the efficiency of various methods of volatile
to Alzheimer’s diseases and diabetes mellitus by monoterpene-
oil extraction from Trichodesma africanum and their impact
rich essential oil from Sideritis galatica Bornm. Endemic to
on the antioxidant and antimicrobial activities,” Journal of
Turkey,” Records of Natural Products, vol. 10, no. 2, pp. 195–206,
Intercultural Ethnopharmacology, vol. 5, no. 3, pp. 1–7, 2016.
2015.
[32] N. Jaradat, L. Adwan, S. K’aibni et al., “Variability of chemi- [46] HMPC, Public Statement on the Use of Herbal Medicinal Prod-
cal compositions and antimicrobial and antioxidant activities ucts Containing Pulegone and Menthofuran, EMA, Ed., 2005.
of ruta chalepensis leaf essential oils from three palestinian
[47] “Monographs-108: Pulegone,” in Some Drugs and Herbal Prod-
regions,” BioMed Research International, vol. 2017, Article ID
ucts, vol. 108, 2016.
2672689, 9 pages, 2017.
[48] “Pulegone and Menthofuran in flavourings - Opinion of the
[33] M. Al-Hamwi, Y. Bakkour, M. Abou-Ela, A. ElLakany et al., Scientific Panel on Food Additives, Flavourings, Processing
“Chemical composition and seasonal variation of the essential Aids and Materials in contact with Food (AFC),” EFSA Journal,
oil of Micromeria fruticosa,” Journal of Natural Products, vol. 4, vol. 6, no. 3, p. 298, 2008.
pp. 147–149, 2011.
[34] N. A. Jaradat, A. N. Zaid, and F. Hussein, “Investigation of
the antiobesity and antioxidant properties of wild Plumbago
europaea and Plumbago auriculata from North Palestine,”
Chemical and Biological Technologies in Agriculture, vol. 3, p. 31,
2016.
[35] Y. Bustanji, I. M. Al-Masri, M. Mohammad et al., “Pancreatic
lipase inhibition activity of trilactone terpenes of Ginkgo
biloba,” Journal of Enzyme Inhibition and Medicinal Chemistry,
vol. 26, no. 4, pp. 453–459, 2011.
[36] H. Y. Lai, S. L. Ong, and N. K. Rao, “In vitro lipase inhibitory
effect of thirty two selected plants in Malaysia,” Asian Journal
of Pharmaceutical and Clinical Research, vol. 7, no. 2, pp. 19–24,
2014.
[37] H. Keskes, K. Mnafgui, K. Hamden, M. Damak, A. El Feki,
and N. Allouche, “In vitro anti-diabetic, anti-obesity and
antioxidant proprieties of Juniperus phoenicea L. leaves from
Tunisia,” Asian Pacific Journal of Tropical Biomedicine, vol. 4, no.
2, pp. S649–S655, 2014.
[38] “One-way ANOVA with post-hoc Tukey HSD Test Calculator,”
http://astatsa.com/OneWay Anova with TukeyHSD/.
[39] S. A. Youssef Bakkour, H. Soufi, N. El-Ashi, M. Tabcheh, and F.
El Omar, “Chemical composition of essential oil extracted from
Micromeria Barbata growing in Lebanon and their antimicro-
bial and antioxidant properties,” Journal of Natural Products,
vol. 5, pp. 116–120, 2012.
[40] S. Alwan, K. El Omari, H. Soufi et al., “Evaluation of the
Antibacterial Activity of Micromeria barbata in Lebanon,”
Journal of Essential Oil Bearing Plants, vol. 19, no. 2, pp. 321–327,
2016.
Hindawi
https://doi.org/10.1155/2018/1457480
Research Article
Duration of Heat Stress Effect on Invasiveness of
L. monocytogenes Strains
Ewa WaBecka-Zacharska ,1 Renata Gmyrek,1 Krzysztof Skowron ,2

Katarzyna Kosek-Paszkowska ,1 and Jacek Bania1
1
Department of Food Hygiene and Consumer Health Protection, Wrocław University of Environmental and Life Sciences,
Wrocław, Poland
2
Department of Microbiology, Nicolaus Copernicus University in Toruń, Collegium Medicum of L. Rydygier in Bydgoszcz,
Bydgoszcz, Poland
Correspondence should be addressed to Ewa Wałecka-Zacharska; ewa.walecka@upwr.edu.pl
Received 15 May 2018; Revised 25 July 2018; Accepted 13 September 2018; Published 9 October 2018
Copyright © 2018 Ewa Wałecka-Zacharska et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
During food production and food conservation, as well as the passage through the human gastrointestinal (GI) tract, L.
monocytogenes is exposed to many adverse conditions which may elicit a stress response. As a result the pathogen may become
more resistant to other unpropitious factors and may change its virulence. It has been shown that low and high temperature, salt,
low pH, and high pressure affect the invasion capacity of L. monocytogenes. However, there is a scarcity of data on the duration
of the stress effect on bacterial biology, including invasiveness. The aim of this work was to determine the period during which L.
monocytogenes invasiveness remains altered under optimal conditions following exposure of bacteria to mild heat shock stress. Ten
L. monocytogenes strains were exposed to heat shock at 54∘ C for 20 minutes. Then both heat-treated and nontreated control bacteria
were incubated under optimal growth conditions, 37∘ C, for up to 72 hours and the invasion capacity was tested. Additionally, the
expression of virulence and stress response genes was investigated in 2 strains. We found that heat stress exposure significantly
decreases the invasiveness of all tested strains. However, during incubation at 37∘ C the invasion capacity of heat-treated strains
recovered to the level of nontreated controls. The observed effect was strain-dependent and lasted from less than 24 hours to 72
hours. The invasiveness of 6 out of the 10 nontreated strains decreased during incubation at 37∘ C. The expression of inlAB correlated
with the increase of invasiveness but the decrease of invasiveness did not correlate with changes of the level of these transcripts.
Conclusions. The effect of heat stress on L. monocytogenes invasiveness is strain-dependent and was transient, lasting up to 72 hours.
1. Introduction low pH [3]. Such a deleterious environment triggers in the

pathogen a stress response. Consequently, alternative sigma
Listeria monocytogenes is a Gram-positive rod-shaped bac- factors are activated and a specific set of genes, responsible for
terium widespread in the environment. As a pathogen, survival under stress, is expressed [4]. One of the best-studied
L.monocytogenes is capable of invading naturally nonphago- sigma factors is 𝜎B . In L. monocytogenes this factor was shown
cytic cells and crossing host barriers [1]. In humans, L. mono- to play a role under osmotic, oxidative, acid, and cold stress
cytogenes may cause mild infections such as gastroenteritis conditions [5]. Additionally, 𝜎B controls the expression of
in immunocompetent individuals but also may contribute virulence genes, e.g., inlAB, affecting the invasion capacity
to serious, disseminated forms of infections, i.e., meningitis, of L. monocytogenes [6]. Thereby, stress conditions may
abortion, and septicemia, mostly in immunocompromised influence bacterial virulence. To date it has been found that
individuals. Over 90% of human listeriosis is related to food L. monocytogenes invasiveness may change in response to
contaminated with the bacteria [2]. The food production osmotic, heat and cold shock, low pH, or high pressure [7–
environment is a challenge for L. monocytogenes in which it 11]. Additionally it has been shown that the exposure time and
has to deal with low and high temperatures, salt additives, and growth phase of bacteria can affect the stress response [9, 12];
however, there is no data describing how long the effect of Table 1: L. monocytogenes strains used in the study.
stress lasts on L. monocytogenes invasiveness. The objective
of this study was to investigate the duration of the heat stress Strain Source Lineage Serotype
effect on the invasiveness of 10 L. monocytogenes strains. L28 Human I 4b
L84 Human I 4b
L41 Human I 1/2b
2. Materials and Methods
L45 Food I 1/2b
2.1. Growth of L. monocytogenes Strains. The study was L56 Food II 1/2a
conducted on 10 L. monocytogenes strains, representing L71 Food II 1/2a
3 major lineages, 4 serogroups, and 2 sources of isola- L83 Food II 1/2a
tion (Table 1). Three human sporadic clinical isolates were L1057 Food II 1/2c
obtained from patients hospitalized during 2000-2002 in L2061 Food III 4c
Warsaw and Gdańsk and were kindly provided by Dr. J.
L4 Food III 4c
Paciorek (National Institute of Hygiene, Warsaw, Poland). In
brief, single colonies of L. monocytogenes were grown in 5
ml of Brain Heart Infusion (BHI) broth (Biocorp, Poland) at (Invitrogen) with random hexamer primers according to the
37∘ C with shaking at 180 rpm for 8 hours. Then 5 𝜇L aliquots manufacturer’s instructions. No-RT controls, used thereafter
were transferred into 5 mL of fresh BHI and grown for 18 to check for DNA contamination, were prepared from 1
hours. To study the duration of the heat stress effect on L. 𝜇g of RNA with the Superscript III First Strand Synthesis
monocytogenes invasiveness, one milliliter of bacterial culture System in which no reverse transcriptase was added. A
was incubated at 54∘ C for 20 minutes. Then, heat-treated and relative amount of inlA, inlB, prfA, and sigB transcripts was
nontreated bacteria (control) were incubated at 37∘ C for up to measured using the CFX Optical System (BioRad, Warsaw,
72 hours and were used to infect the HT-29 human cell line Poland). Primers for inlA and inlB were from Werbrouck
and plated in duplicate onto BHI agar. et al. [13], for prfA from Freitag et al. [14], and for sigB
from Kazmierczak et al. [6]. For normalization of cDNA
2.2. Cell Line and Culture Conditions. The human adeno- amount, the housekeeping gene gap was used [12, 15, 16].
carcinoma cell line HT-29 (CLS, Germany) was cultured Real time PCR was performed from 3 independent RNA
in DMEM (Dulbecco’s modified Eagle’s medium; Sigma- preparations and PCRs were run in duplicate. PCRs were
Aldrich, Poznań, Poland) supplemented with 10 % heat- run in a total volume of 20 𝜇L containing 1𝜇L of appropriate
inactivated fetal calf serum (Invitrogen, Warsaw, Poland), 2 cDNA, 450 nM primers for gap or 900 nM primers for
mM glutamine, 10 IU/mL penicillin, and 10 𝜇g/mL strepto- inlA, inlB, prfA, and sigB, and 18 𝜇L of iQ SYBR Green
mycin (Sigma-Aldrich) at 37∘ C in 5 % CO2 . Supermix (BioRad) using the protocol: initial denaturation
at 95∘ C for 3 minutes, followed by 40 cycles of 95∘ C for 30s,
2.3. Plaque-Forming Assay (PFA). HT-29 cells were grown to 60∘ C for 30s, and 72∘ C for 45s. The specificity of PCR was
obtain 90% confluence in 6-well plates. Twenty-four hours evaluated by a melt curve analysis in a temperature range
before infection the medium was replaced by DMEM without from 90∘ C to 50∘ C performed for each reaction. Residual
antibiotics. HT-29 cells were infected with 3 to 7 log CFU DNA contamination was checked in each RNA sample by
of treated and nontreated bacteria for 2 hours; then the running no-RT controls. PCR efficiencies for each primer
medium was replaced by DMEM containing 100 𝜇g/mL pair were determined on genomic L. monocytogenes DNA by
gentamicin (Sigma-Aldrich) and incubated for another 1.5 running serial 5-fold dilutions of the template. Determined
hours. Each well was then overlaid with DMEM containing efficiencies were taken into account when calculating relative
10 𝜇g/mL gentamicin and 1.2 % low-melting-point agarose transcript levels according to Pfaffl [17].
(Prona, Gdańsk, Poland). After 2 days of culture the number
of plaques was determined. Each assay was performed in 2.6. Statistical Analysis. Each experiment of survival at 54∘ C,
duplicate and repeated at least three times. Invasiveness was invasion, and relative expression was repeated at least three
expressed as a percentage of the number of plaques per times. A two-way analysis of variance (ANOVA) was per-
number of log CFU deposited per well [9]. formed and the Bonferroni test was used with Statistica
software (StatSoft, Poland) to determine whether statistical
2.4. RNA Isolation. Bacterial pellets from 3-mililiter cultures differences existing between different experimental groups.
were suspended in 90𝜇L of 0.1M Tris-HCl pH 7.4 containing Significance was set at p level of <0.05.
1mg/mL of lysozyme (Sigma-Aldrich) and incubated for 20
minutes at 37∘ C. One mL of TRI-reagent (Sigma-Aldrich) was
3. Results
added, and RNA was extracted according to the producer’s
protocol. RNA was treated with RNAse free DNAse I (Sigma- 3.1. Survival of L. monocytogenes Strains at 54∘ C. Bacteria
Aldrich) for 1 hour at 37∘ C to remove the DNA. were incubated at 54∘ C for 20 minutes and the number of
treated and nontreated bacteria was examined immediately
2.5. RT-PCR. cDNA synthesis was performed on 1 𝜇g of after heat exposure and after 24-hour and 48-hour incubation
RNA using the Superscript III First Strand Synthesis System at 37∘ C. The bacterial count was significantly reduced upon
Table 2: L. monocytogenes strains counts (log cfu/unit) after heating at 54∘ C for 20 minutes and incubation at 37∘ C for 0 hours, 24 hours and
48 hours.
Bacterial counts reduction [log cfu/unit]
Strain 0 hours after heating 24 hours after heating 48 hours after heating
L28 0,27±0,08 0,62±0,2 ∗ 0,66±0,02 ∗
L84 0,31±0,06 0,46±0,12 0,71±0,23
L41 0,29±0,09 0,93±0,17∗ 1,02±0,16 ∗
L45 0,33±0,07 0,36±0,08 0,92±0,05∗
L56 0,29±0,10 0,32±0,09 0,69±0,14
L71 0,12±0,01 0,91±0,24 ∗ 0,74±0,11 ∗
L83 0,18±0,09 0,56±0,06 1,05±0,15 ∗
L1057 0,21±0,05 0,66±0,21 0,84±0,15 ∗
L2061 0,65±0,14 0,99±0,22 ∗ 0,99±0,12 ∗
L4 1,26±0,05 ∗ 0,84±0,08 ∗ 0,58±0,11
heating at 0 hours in 1 L. monocytogenes strain only (L4). longest time after heat treatment, since it required 72 hours of
Following 24-hour incubation at 37∘ C a significant reduction incubation at 37∘ C, to reach an invasiveness value of that of
of bacterial count was observed in 5 strains (L28, L41, L71, the control strain. The invasiveness of the L4 strain reached
L2061, and L4). The highest differences in bacterial counts the level of nontreated control in the shortest time, i.e., 24
between treated and nontreated strains were noted after 48- hours. No significant differences in inlA expression upon
hour incubation at 37∘ C. Here, a significant reduction of incubation at 37∘ C were observed for strain L71 (Figure 2).
bacterial count was found in 7 L. monocytogenes strains (L28, After 24 hours an incubation increase of inlB, prfA, and sigB
L41, L45, L71, L83, L1057, and L2061) (Table 2). was found in the nontreated L71 strain whereas in the heat-
treated strain elevated expression of inlB and prfA was noted.
3.2. Effect of Heat Stress Exposure on L. monocytogenes After 48 hours in the nontreated strain, expression of all
Invasiveness. Ten L. monocytogenes strains were exposed to genes did not change compared to expression after 24 hours,
heat stress at 54∘ C for 20 minutes and incubated at 37∘ C for whereas, in the treated L71 strain, expression of sigB and inlB
up to 72 hours. Then the invasion capacity was determined. was significantly higher. A comparison of heat-treated and
Invasiveness of 6 out of 10 nontreated bacteria was found to nontreated L71 strain indicated that expression of sigB was
decrease 2-25 times during incubation at 37∘ C. A significant significantly higher following heat treatment at 0 hours and
reduction of invasiveness of nontreated bacteria was noted in 48 hours of incubation at 37∘ C and expression of inlB was
5 strains (L28, L41, L45, L71, and L2061) after 24 hours and in higher at 48 hours at 37∘ C. No correlation between expression
1 strain (L56) after 48 hours of incubation. of studied genes and invasiveness was observed for strain L71.
In all strains tested a 2.4- to 25-fold reduction of invasive- In the nontreated L4 strain, expression of all tested genes
ness after heat exposure was observed at 0 hours (Figure 1). was significantly higher after 24-hour incubation at 37∘ C and
Invasiveness of all 10 heat-treated strains increased during subsequently decreased after the next 24 hours of incubation
incubation at 37∘ C reaching the value of the nontreated (Figure 3). In the treated L4 strain an increase of inlB
bacteria. The fastest increase of invasiveness after less than transcript was observed after 24 hours of incubation at 37∘ C
24 hours was noted in the L. monocytogenes strain L4. and prfA, inlA, and sigB RNA increased after 48 hours. No
Invasion capacity of two strains (L. monocytogenes L1057, significant differences in expression of all tested genes were
L2061) recovered to the level of the nontreated bacteria at 24 found between the treated and nontreated bacteria directly
hours of incubation at 37∘ C. In four strains the level of the after heating. After 24 hours incubation at 37∘ C expression of
invasiveness of the control bacteria was reached between 24 inlA, sigB, and prfA was statistically higher in the nontreated
and 48 hours (L28, L41, L45, and L56) whereas for 1 strain L4 strain, whereas after 48 hours expression for all tested
(L84) and 2 strains (L71, L83) this level was reached after genes was higher in the treated strain. In the heat-treated
48 and 72 hours, respectively. Moreover, 3 strains (L28, L56, L4 strain the increase of gene expression correlated with the
and L2061) after incubation at 37∘ C displayed a significantly increase of invasiveness.
higher invasion capacity than the nontreated controls. No
difference in stress effect duration on invasiveness between
strains of different lineage, serotype, and origin was found.
4. Discussion
During food processing, L. monocytogenes encounters many
3.3. Relative Expression of inlA, inlB, prfA, and sigB Genes in adverse conditions. In response to stress, bacteria change
Response to Heat Stress. The expression of selected virulence- their metabolism which may result in resistance to other
associated genes and stress response gene, i.e., sigB, was stress factors or enhanced resistance to the same kind of stress
assessed on two representative L. monocytogenes strains L71 [18, 19]. Moreover, under such conditions the pathogen may
and L4. The invasiveness of L71 strain remained altered for the modify its virulence [7, 13, 20, 21]. Little is known about
10
1 non-treated
L4 8
0.8 L28 heat-treated
Invasion [%]
Invasion [%]
0.6 6
0.4 4
0.2 2
0 0
0 12 24 36 48 0 12 24 36 48
time [h] time [h]
0.3 4
L1057 L83
3
Invasion [%]
Invasion [%]
0.2
2
0.1
1
0 0
0 12 24 36 48 0 12 24 36 48 60 72
time [h] time [h]
1 14
L2061 L45
0.8 12
10
Invasion [%]
Invasion [%]
0.6
8
0.4 6
4
0.2
2
0 0
0 12 24 36 48 60 72 0 12 24 36 48
time [h] time [h]
12 8
L84 L56
10 6
Invasion [%]
Invasion [%]
8
6 4
4 2
2
0 0
0 12 24 36 48 0 12 24 36 48
time [h] time [h]
10
L71 6
8 L41
Invasion [%]
Invasion [%]
6 4
4
2
2
0 0
0 12 24 36 48 60 72 0 12 24 36 48 60 72
time [h] time [h]
Figure 1: Invasiveness of 10 L. monocytogenes strains during incubation at 37∘ C. The data show mean invasiveness and error bars show the
standard deviations from at least three independent experiments. The data were analyzed by two-way ANOVA using the Bonferroni test.
12
sigB 12
prfA
10
relative gene expression
9
8

6
6
4
3
2
0 0
0h 24h 48h 0h 24h 48h
time [h] time [h]
4 8
inlB
3 inlA 6
2 4
1 2
0 0
0h 24h 48h 0h 24h 48h
time [h] time [h]
non-treated non-treated
heat-treated heat-treated
Figure 2: Relative change in the transcription level for inlA, inlB, sigB, and prfA genes for heat-treated and nontreated strain L71. Fold changes
and SD were calculated from 3 independent RNA preparations and PCRs performed in duplicate. The data were analyzed by two-way ANOVA
followed by a Bonferroni test.
stress effect duration on bacterial invasiveness. Recent work The heat stress effect duration on invasiveness was deter-
by Stollework et al. [11] has shown that the invasion capacity mined on 10 L. monocytogenes strains. After heat treatment
of bacteria exposed to HHP (high hydrostatic pressure) or the bacteria were incubated at 37∘ C which reflects the
heating does not change after 14-day storage at 8∘ C. In this temperature of the human GI tract. L. monocytogenes strains
study we attempted to assess the duration of heat stress effect were incubated under such conditions until the invasiveness
on L. monocytogenes invasiveness. The mild heat treatment of heat-treated bacteria amounted to the value of nontreated
at 54∘ C was applied as previously we had found that this controls. A significant reduction of bacterial counts after
type of stress greatly affects L. monocytogenes invasiveness heating was observed in 1 strain immediately after treatment,
[9]. A temperature of 54∘ C has been proposed as the mean in 5 strains after 24 hours, and in 7 strains after 48 hours. In
temperature of undercooked food and is encountered during nontreated bacteria a significant reduction during incubation
the manufacture of refrigerated, processed food and during at 37∘ C was shown in only 1 strain. It can be assumed that
food processing in microwave ovens [22]. The study was negative changes in bacterial cells exposed to heat shock may
conducted on the human adenocarcinoma cell line HT-29 appear later, after 48 hours. The invasion capacity of all strains
since these cells were found to have a constant proliferation was greatly reduced in response to heat treatment. However,
rate [23]. In turn, plaque forming assay applied here was the invasiveness of all treated strains during incubation at
shown to be the best alternative to in vivo tests to study L. 37∘ C reached the value of the nontreated bacteria. The effect
monocytogenes virulence [24]. of heat stress lasted less than 72 hours. Additionally, 3 treated
sigB prfA
3 6

2 4
1 2
0 0
0h 24h 48h 0h 24h 48h
time [h] time [h]
inlA inlB
90 2

60
30
0 0
0h 24h 48h 0h 24h 48h
time [h] time [h]
non-treated non-treated
heat-treated heat-treated
Figure 3: Relative change in the transcription level for inlA, inlB, sigB, and prfA genes for heat-treated and nontreated strain L4. Fold changes
and SD were calculated from 3 independent RNA preparations and PCRs performed in duplicate. The data were analyzed by two-way ANOVA
followed by a Bonferroni test.
strains at the end point of incubation at 37∘ C were more is determined by internalins, the expression of inlA and inlB
invasive than the nontreated ones. No correlation between genes was examined. Additionally, the expression of the key
stress effect duration on invasiveness and lineage, serotype, regulator of virulence genes prfA and stress response gene
or strain origin was found. sigB was investigated. The expression of inlAB correlated with
60% of nontreated strains was characterized by a decrease the increase of invasiveness. The decrease of invasiveness
of invasiveness during incubation at 37∘ C. In contrast, Bruno did not correlate with the transcript expression. To date,
and Freitag [25] have shown that virulence of 1-day-old L. studies have shown that internalin expression does not always
monocytogenes culture is not different from a 12-day-old correlate with invasion capacity, suggesting the involvement
culture. The discrepancy between studies can be explained of additional factors in this process [7, 12].
by culture conditions and the test used. Additionally, a study
by Bruno and Freitag was conducted in a mouse model on 1
strain only. In a few-day culture bacterial growth is limited 5. Conclusions
by the availability of nutrients and oxygen. This leads to
physiological changes in bacterial cells and the generation We found that the invasiveness of L. monocytogenes strains
of stress response [26]. Consequently, bacteria previously decreased when the bacteria were grown at 37∘ C. Mild
exposed to stress may become more virulent in response heating significantly decreased the invasion capacity of L.
to another unfavorable factor. This may explain differences monocytogenes strains at the beginning of the experiment.
in invasion capacity during incubation at 37∘ C between the Further incubation of these bacteria at a temperature corre-
heat-treated and nontreated groups. sponding to those of the human body resulted in an increase
L. monocytogenes in response to stress activates genes of invasiveness with strain-dependent dynamics. Hence, the
responsible for survival under adverse conditions as well as observed effect was transient, lasting for less than 72 hours.
virulence genes [27–29]. Since the invasion of eukaryotic cells It can be assumed that the effect of heat treatment of 54∘ C
for 20 minutes can alter the pathogen’s invasiveness in the [10] K. Neuhaus, P. Satorhelyi, K. Schauer, S. Scherer, and T. M.
following 24 to 72 hours. The increase of inlAB transcript level Fuchs, “Acid shock of Listeria monocytogenes at low environ-
correlated with the increase of invasiveness but the decrease mental temperatures induces prfA, epithelial cell invasion, and
of invasiveness did not correlate with the changes of the level lethality towards Caenorhabditis elegans,” BMC Genomics, vol.
of these transcripts. 14, no. 1, article no. 285, 2013.
[11] K. Stollewerk, C. D. Cruz, G. Fletcher, M. Garriga, and A. Jofré,
“The effect of mild preservation treatments on the invasiveness
Data Availability of different Listeria monocytogenes strains on Greenshell
mussels,” Food Control, vol. 71, pp. 322–328, 2017.
The data used to support the findings of this study are
[12] E. Walecka, J. Molenda, R. Karpı́šková, and J. Bania, “Effect of
available from the corresponding author upon request. osmotic stress and culture density on invasiveness of Listeria
monocytogenes strains,” International Journal of Food Microbi-
Conflicts of Interest ology, vol. 144, no. 3, pp. 440–445, 2011.
[13] H. Werbrouck, A. Vermeulen, E. Van Coillie et al., “Influence
The authors declare that they have no conflicts of interest. of acid stress on survival, expression of virulence genes and
invasion capacity into Caco-2 cells of Listeria monocytogenes
strains of different origins,” International Journal of Food Micro-
Acknowledgments biology, vol. 134, no. 1-2, pp. 140–146, 2009.
The writing of this study was supported by the Wrocław Cen- [14] N. E. Freitag, L. Rong, and D. A. Portnoy, “Regulation of
the prfA transcriptional activator of Listeria monocytogenes:
ter of Biotechnology, program Leading National Research
Multiple promoter elements contribute to intracellular growth
Center (KNOW) for the years 2014-2018.
and cell-to-cell spread,” Infection and Immunity, vol. 61, no. 6,
pp. 2537–2544, 1993.
References [15] M. J. Kazmierczak, M. Wiedmann, and K. J. Boor, “Contribu-
tions of Listeria monocytogenes 𝜎B and PrfA to expression of
[1] L. Radoshevich and P. Cossart, “Listeria monocytogenes: virulence and stress reponse genes during extra- and intracel-
towards a complete picture of its physiology and pathogenesis,” lular growth,” Microbiology, vol. 152, no. 6, pp. 1827–1838, 2006.
Nature Reviews Microbiology, vol. 16, no. 1, pp. 32–46, 2018. [16] P. McGann, R. Ivanek, M. Wiedmann, and K. J. Boor,
[2] K. J. Allen, E. Wałecka-Zacharska, J. C. Chen et al., “Listeria “Temperature-dependent expression of Listeria monocyto-
monocytogenes - An examination of food chain factors poten- genes internalin and internalin-like genes suggests functional
tially contributing to antimicrobial resistance,” Food Microbiol- diversity of these proteins among the listeriae,” Applied and
ogy, vol. 54, pp. 178–189, 2016. Environmental Microbiology, vol. 73, no. 9, pp. 2806–2814, 2007.
[3] A. C. Camargo, J. J. Woodward, D. R. Call, and L. A. Nero, [17] M. W. Pfaffl, “A new mathematical model for relative quantifica-
“Listeria monocytogenes in Food-Processing Facilities, Food tion in real-time RT-PCR.,” Nucleic Acids Research, vol. 29, no.
Contamination, and Human Listeriosis: The Brazilian Sce- 9, article e45, 2001.
nario,” Foodborne Pathogens and Disease, vol. 14, no. 11, pp. 623– [18] C.-I. A. Belessi, Y. Le Marc, S. I. Merkouri et al., “Adap-
636, 2017. tive growth responses of Listeria monocytogenes to acid and
[4] L. Tripathi, Y. Zhang, and Z. Lin, “Bacterial Sigma Factors as osmotic shifts above and across the growth boundaries,” Journal
Targets for Engineered or Synthetic Transcriptional Control,” of Food Protection, vol. 74, no. 1, pp. 78–85, 2011.
Frontiers in Bioengineering and Biotechnology, vol. 2, 2014. [19] S. V. Poimenidou, D.-N. Chatzithoma, G.-J. Nychas, and P. N.
[5] M. Boura, C. Keating, K. Royet et al., “Loss of SigB in Listeria Skandamis, “Adaptive response of listeria monocytogenes to
monocytogenes Strains EGD-e and 10403S Confers Hyperresis- heat, salinity and low pH, after habituation on cherry tomatoes
tance to Hydrogen Peroxide in Stationary Phase under Aerobic and lettuce leaves,” PLoS ONE, vol. 11, no. 10, 2016.
Conditions,” Applied and Environmental Microbiology, vol. 82, [20] M. R. Garner, B. L. Njaa, M. Wiedmann, and K. J. Boor, “Sigma
no. 15, pp. 4584–4591, 2016. B contributes to Listeria monocytogenes gastrointestinal infec-
[6] M. J. Kazmierczak, S. C. Mithoe, K. J. Boor, and M. Wiedmann, tion but not to systemic spread in the guinea pig infection
“Listeria monocytogenes 𝜎B regulates stress response and model,” Infection and Immunity, vol. 74, no. 2, pp. 876–886,
virulence functions,” Journal of Bacteriology, vol. 185, no. 19, pp. 2006.
5722–5734, 2003. [21] E. Walecka-Zacharska, K. Kosek-Paszkowska, J. Bania, R.
[7] I. Olesen, F. K. Vogensen, and L. Jespersen, “Gene transcription Karpı́šková, and T. Stefaniak, “Salt stress-induced invasiveness
and virulence potential of Listeria monocytogenes strains after of major Listeria monocytogenes serotypes,” Letters in Applied
exposure to acidic and NaCl stress,” Foodborne Pathogens and Microbiology, vol. 56, no. 3, pp. 216–221, 2013.
Disease, vol. 6, no. 6, pp. 669–680, 2009. [22] P. N. Skandamis, Y. Yoon, J. D. Stopforth, P. A. Kendall, and J.
[8] M. H. Larsen, A. G. Koch, and H. Ingmer, “Listeria monocy- N. Sofos, “Heat and acid tolerance of Listeria monocytogenes
togenes efficiently invades caco-2 cells after low-temperature after exposure to single and multiple sublethal stresses,” Food
storage in broth and on deli meat,” Foodborne Pathogens and Microbiology, vol. 25, no. 2, pp. 294–303, 2008.
Disease, vol. 7, no. 9, pp. 1013–1018, 2010. [23] P. Velge, E. Bottreau, N. Van-Langendonck, and B. Kaeffer, “Cell
[9] E. Wałecka, J. Molenda, R. Karpı́šková, and J. Bania, “Effect proliferation enhances entry of Listeria monocytogenes into
of heat exposure on invasiveness of listeria monocytogenes intestinal epithelial cells by two proliferation-dependent entry
strains,” Foodborne Pathogens and Disease, vol. 8, no. 7, pp. 839– pathways,” Journal of Medical Microbiology, vol. 46, no. 8, pp.
841, 2011. 681–692, 1997.
[24] S. M. Roche, P. Velge, E. Bottreau, C. Durier, N. Marquet-van

der Mee, and P. Pardon, “Assessment of the virulence of Listeria
monocytogenes: agreement between a plaque-forming assay
with HT-29 cells and infection of immunocompetent mice,”
International Journal of Food Microbiology, vol. 68, no. 1-2, pp.
33–44, 2001.
[25] J. C. Bruno and N. E. Freitag, “Listeria monocytogenes adapts
to long-term stationary phase survival without compromising
bacterial virulence,” FEMS Microbiology Letters, vol. 323, no. 2,
pp. 171–179, 2011.
[26] C. E. Ress, C. E. Dodd, and P. T. Gibson, “Significance of bacteria
in stationary phase to food microbiology,” International Journal
of Food Microbiology, vol. 28, p. 28, 1995.
[27] E. Harter, E. M. Wagner, A. Zaiser, S. Halecker, M. Wagner,
and K. Rychli, “Stress survival islet 2, predominantly present in
Listeria monocytogenes strains of sequence type 121, is involved
in the alkaline and oxidative stress responses,” Applied and
Environmental Microbiology, vol. 83, no. 16, Article ID e00827-
17, 2017.
[28] C. Guldimann, V. Guariglia-Oropeza, S. Harrand, D. Kent, K. J.
Boor, and M. Wiedmann, “Stochastic and differential activation
of 𝜎B and PrfA in Listeria monocytogenes at the single cell level
under different environmental stress conditions,” Frontiers in
Microbiology, vol. 8, 2017.
[29] J. H. Lee, C. Choi, T. Lee et al., “Transcription Factor 𝜎B Plays an
Important Role in the Production of Extracellular Membrane-
Derived Vesicles in Listeria monocytogenes,” PLoS ONE, vol. 8,
no. 8, p. e73196, 2013.
Hindawi
https://doi.org/10.1155/2018/5063185
Review Article
Food-Origin Lactic Acid Bacteria May Exhibit Probiotic
Properties: Review
Dorota ZieliNska and Danuta Kolohyn-Krajewska

Department of Food Gastronomy and Food Hygiene, Warsaw University of Life Sciences (SGGW),
Nowoursynowska 159, 02-776 Warsaw, Poland
Correspondence should be addressed to Dorota Zielińska; dorota zielinska@sggw.pl
Received 30 July 2018; Accepted 10 September 2018; Published 1 October 2018
Copyright © 2018 Dorota Zielińska and Danuta Kolożyn-Krajewska. This is an open access article distributed under the Creative
Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the
original work is properly cited.
One of the most promising areas of development in the human nutritional field over the last two decades has been the use of
probiotics and recognition of their role in human health and disease. Lactic acid-producing bacteria are the most commonly used
probiotics in foods. It is well known that probiotics have a number of beneficial health effects in humans and animals. They play
an important role in the protection of the host against harmful microorganisms and also strengthen the immune system. Some
probiotics have also been found to improve feed digestibility and reduce metabolic disorders. They must be safe, acid and bile
tolerant, and able to adhere and colonize the intestinal tract. The means by which probiotic bacteria elicit their health effects are not
understood fully, but may include competitive exclusion of enteric pathogens, neutralization of dietary carcinogens, production of
antimicrobial metabolites, and modulation of mucosal and systemic immune function. So far, lactic acid bacteria isolated only
from the human gastrointestinal tract are recommended by the Food and Agriculture Organization (FAO) and World Health
Organization (WHO) for use as probiotics by humans. However, more and more studies suggest that strains considered to be
probiotics could be isolated from fermented products of animal origin, as well as from non-dairy fermented products. Traditional
fermented products are a rich source of microorganisms, some of which may exhibit probiotic properties. They conform to the
FAO/WHO recommendation, with one exception; they have not been isolated from human gastrointestinal tract. In light of
extensive new scientific evidence, should the possibility of changing the current FAO/WHO requirements for the definition of
probiotic bacteria be considered?
1. Introduction many physiological systems, including immunity or mental

state. Due to the growing awareness of the role that the gut
The role of food in developing human health and wellbeing microflora has on people keeping their health, for over 20
has been known since the times of Hippocrates, whose years research work has been conducted worldwide, with
saying, “Let food be thy medicine and medicine be thy regard to the possibilities of modifying positively or enriching
food,” frequently repeated today, has become the slogan of human microbiome. This is because it has been noticed that
supporters of “treating” with food. This correlation is par- more and more both quantitative and qualitative composi-
ticularly apparent and documented as regards the beneficial tion of the gut microflora diverges from the norm. These
microflora found in the human body. changes are caused by many endogenous factors (connected
An efficiently working gut ecosystem, the so-called directly with the person, i.e., viral or bacterial infections)
microbiome (quantitative and qualitative composition of and exogenous (foodstuffs, steroids, laxatives, antibiotics
various microorganisms) has a great impact on the person’s and chemotherapeutics, contraceptives, etc.), which directly
ability to maintain their health. The microflora in human result in numerous disorders connected not just with the
intestines is the most varied ecosystem on earth in terms human digestive system. It is believed that the use of appro-
of species (100–1000 species). The microbiome influences priately selected strains of probiotic bacteria in nutrition may
result in beneficial modulation of the composition of the gut However, it is currently believed that it is the specific way
bacterial flora [1]. in which they work and not the source of isolation of the
Probiotics are an important concept for health care in the microorganism that is important. Most of probiotic strains
21st century. The global probiotics market size was valued used in humans have been isolated from people; however this
at USD 35.9 billion in 2016. In Asia and Europe, probiotics recommendation does not constitute a requirement. There
are widely used as health foods and medicines. In the global are some well-tested probiotic strains known that do not
probiotic market, the European market is the largest and the originate from human hosts (e.g., Bifidobacterium animalis
fastest growing with an average annual growth rate of around subsp. lactis and Saccharomyces cerevisiae var. boulardii).
20% [2]. Development of efficient strains of probiotics is a key David et al. [6] showed that several microbes found in
industry scenario. The health benefits of probiotics and rising consumed food products such as cheese and deli meats were
awareness among the consumers are expected to drive the reisolated from faecal samples of individuals who consumed
industry growth over the next few years. The global revenue them. Microorganisms of food-ingested bacteria made up
generated from probiotics market is estimated to be valued more than 1% of the faecal microbiome in some cases. In
at roughly US$ 6,762.2 million by the end of 2018 and is reality, it is very difficult to confirm the source of origin of
expected to increase in the near future [3]. a microorganism [4]. This is why it is believed that probiotics
The main purpose of the review was to discuss the current intended for people require proving that they work in human
definition of probiotic and summarize current understanding hosts. It is also recommended that strains isolated from a
of probiotic in the view of the use of nonhuman isolation population in which they are to be later applied are used in
sources. Additionally, we conduct a comparative review of the probiotic preparations [7]. Procedures which are to confirm
latest literature investigating candidates to probiotic strains health properties of the tested probiotic strains have been
isolated from different sources to identify their common developed by FAO/WHO [8].
features. In 2014, experts from ISAPP (International Scientific
Association for Probiotics and Prebiotics) organised a meet-
2. Definitions and Legal Regulations ing which resulted in a publication verifying the previous
Report of FAO/WHO [8]. A consensus was announced which
concerning Probiotics allowed for minor grammatical corrections to the definition,
The definition of probiotics changes together with the retaining its sense and meaning. The term “probiotic” may
development of knowledge about them. A definition of the be used to refer to many types of microorganisms which
probiotic was proposed in 2001 by Schrezenmeir and De demonstrate health benefits for the host, while remaining
Vrese: “a preparation of or a product containing viable, alive. In the document presented, this feature was empha-
defined microorganisms in sufficient numbers, which alter sised particularly, and metabolites as well as dead cells
the microflora by implantation or colonization, in a compart- of microorganisms were excluded from the definition of
ment of the host and by that, exert beneficial effects on host a “probiotic.” Additionally, it was agreed that “probiotics”
health” [1]. are not undefined consortia of microorganisms (such as
In 2002, FAO and WHO experts adopted a definition faecal microbiota transplants) or fermented foods containing
of probiotics deciding that these are “live microorganisms undefined microorganisms (Table 1) [9].
which when administered in adequate amounts confer a The reason for undertaking the discussion was the fact
health benefit on the host.” Microorganisms, in order to be that both scientific research and clinical evidence progress
classified as probiotic strains, should be defined precisely by fast, similar to the development of a number of probiotic
determining appropriate criteria concerning safety of their products. Unfortunately, the incorrect use of the term “pro-
use and functional and technological features. Microorgan- biotic” has become a serious problem because in the case of
isms, candidates for the name “probiotics,” must meet three many products this term is used while the required criteria
key requirements [4]: are not met. At the same time, probiotic products came to the
justified attention of regulatory bodies protecting consumers
(1) They must be living at the moment of administration from misleading health claims.
and must be microorganisms In recent years, a new concept appeared, suggesting that
(2) They must be administered in a dose which is key health benefits connected with probiotic mechanisms
sufficiently high to have a health promoting effect. may be assigned to the species and not just to specific strains
The recommended effective dose is strictly connected of microorganisms, in particular in the case of some species
with the clinical documentation on which it must be of lactic fermentation bacteria, the strains of which have
based been used as probiotics for a long time. It is believed that if
fermented food (e.g., sauerkraut) contains a large number of
(3) Microorganisms administered must have a beneficial
live cells belonging to the species for which health benefits
effect on the host
have been proven (e.g., Lb. plantarum), it may be reasonably
Probiotics must be identified at the strain level and safe for supposed that this food may be deemed showing similar
use in humans. They must have a beneficial effect on the host; health benefits to the benefits arising from the probiotic
this is why they should originate from the gastrointestinal bacteria of the same species [10].
tract of a healthy individual and be resistant to gastric Scientists and ISAPP experts have emphasised the impor-
enzymes, low pH, and high concentration of bile salts [5]. tance of a lot of evidence showing the connection between
Table 1: Overall framework for probiotic and nonprobiotic products.
Live cultures Not-live cultures

Probiotics Not-probiotics
(1) Probiotic drugs
(2) Probiotic medical foods
(3) Probiotic foods
(1) Fermented foods with undefined microbial content
(4) Non-oral probiotics (1) Postbiotics
(2) Undefined consortia including faecal microbiota
(5) Probiotic animal feed (2) Inactivated bacterial cells
transplant
(6) Defined microbial consortia
(7) Probiotic dietary supplement
(8) Probiotic infant formula
According to [1, 9].
eating fermented foods and human health, such as reduction A FAO/WHO taskforce [8] recommended specific health
of the risk of diabetes type 2 development in people eating fer- claims, permitted for food products with probiotics if suffi-
mented milk products. However, difficulties arise as regards cient scientific evidence is available. It is recommended that
unequivocal indication of the participation and role of live it is the producer who is responsible for the product, but an
microorganisms in those mechanisms. Health-promoting independent third party should check whether health claims
microorganisms found in fermented foods often constitute are true and are not misleading.
consortia undefined at the strain level. It is recommended In the EU, food containing probiotic bacteria is subject to
that this type of food is described only as “containing live and general community law regulations. In accordance with the
active microorganism cultures” [9]. suggestion of FAO/WHO [8], in 2006, the European Parlia-
The term “postbiotics” has also arisen. This term is ment and the Council published Regulation No. 1924/2006
used to determine nonviable bacterial products or metabolic on “Nutrition and Health Claims Made on Foods” [12]. The
byproducts produced by probiotic microorganisms which Regulation concerns all nutrition and health claims for all
show biological activity in the host. Generally, postbiotics types of foods intended for end consumers, including pro-
include bacterial metabolites, byproducts, such as bacteri- biotic products marketed with health claims. The purpose of
ocins, organic acids, ethanol, diacetyl, acetaldehydes, and the Regulation is to harmonise health claims on the European
hydrogen peroxide. It has been found, however, that also level in order to protect consumers better, including in retail
some heat inactivated probiotics may retain important cellu- communication (labelling, presentation, and promotional
lar structures and exert biological activity in the host’s body campaigns) as well as trademarks and brands which may be
[1]. interpreted as nutrition or health claims. The Regulation also
Some research has shown that dead cells of probiotic establishes authorisation procedures required to ensure that
bacteria may have beneficial effects, such as modulation of claims on labels, in presentations and food advertisements,
the immune system and binding carcinogens in the host’s are clear, concise, and based on scientific evidence. The Euro-
body; however their effect is weaker or restricted. It is pean Food Safety Authority (EFSA) developed a scientific and
suggested, moreover, that the application of inactivated cells technical guide for application in order to obtain consent for
is a solution better from the point of view of safety of the use of health claims.
use, particularly in the case of newborn babies or patients EFSA may express its consent to the placing of health
with immunosuppression [11]. It is therefore sufficient for claims on health product packaging on the basis of scientific
probiotic strains to increase their number accordingly at the evidence collected. However, so far EFSA has not expressed
initial stage of production, until the required number of its consent to placing claims concerning probiotics on any of
microorganisms is obtained in the product, whereas later, the products available on the EU market, thus blocking the
during the storage process, they do not have to display good development of probiotic foods [13]. The only EU country
viability [1]. Taking this into account, we propose extending which published a list of probiotics and a guide concerning
the framework for probiotic products to include the concept their use is Italy [14].
of postbiotics and inactivated bacterial cells (Table 1). The organisation ESPGHAN (the European Society for
The issue of defining what probiotics are and what they Paediatric Gastroenterology, Hepatology, and Nutrition)
are not is important for many groups, including consumers, operating under the EU aegis in 2014 published strong
scientists, health care professionals, industry representa- recommendations for the clinical use of two probiotics
tives, and legislators. Also the determination of which food (Lactobacillus rhamnosus GG and Saccharomyces boulardii),
products may be deemed probiotic, due to the potentially stating the dosage in the case of children treated for acute
important interventions to improve health and wellbeing, diarrhoea, acute gastroenteritis, and postantibiotic diarrhoea.
requires further classification. The approach to these issues, At the same time, the document emphasises the low quality
however, is not identical all over the world. of evidence for those recommendations, and the list of
In most countries only very general health claims are microorganisms which may not be used due to the very low
currently permitted to label foods containing probiotics. quality of evidence was provided, and a microorganism was
indicated (Enterococcus faecium SF68), the use of which is not human distal gut microbiota. Eukaryotes (yeasts and protists)
recommended for safety reasons [15]. and Viruses (phagi and animal viruses) are also present [20,
Nutritional recommendations vary depending on the 21].
country because the consumption of nutrients and the prior- Many of the probiotic strains have been isolated from
ity in selecting main nutrients may depend on the availability human intestine, such as Lb. salivarius subsp. salicinius and
of foods and nutritional preferences. In EU Member States, Lb. acidophilus [22], as well as from human faeces, such as B.
main food groups under national nutrition guidelines do not longum and Lb. acidophilus, and less frequently from human
vary significantly, but there are differences in types of foods stomach such as Lb. fermentum, Lb. gasseri, Lb. vaginalis, Lb.
in groups and quantities recommended for consumption. reuteri, and Lb. salivarius [23].
At the moment, there are no harmonised guidelines at the A common conception is that probiotics, upon con-
EU level due to the lack of representative data concerning sumption, must withstand gastrointestinal transit and always
consumption. In Europe, for example, most of the national colonize the intestines for benefits to be observed [24].
nutrition recommendations include yoghurt as part of a In fact, certain probiotics (e.g., B. longum and Bacteroides
healthy diet. Similar recommendations are also given in non- thetaiotaomicron) colonize the human intestinal microbiota,
European countries, e.g., New Zealand, USA, and Australia but others (e.g., Lb. casei and B. animalis) do not. For the
[16]. health benefits of probiotics, there is no proof of a need for
Health Canada decided that generally positive impact on colonization, and mostly probiotics reside only transiently
health may be expected, without evidence as to the strain following food intake [25]. It has been claimed that probiotics
for the following microorganisms stated in the quantity isolated from human and animal intestines have different
of 109 units/dose: Bifidobacterium (adolescentis, casei, fer- adhesion capacity than probiotics originating from food
meanimalis, bifidum, breve, and longum) and Lactobacillus and other unconventional sources. Intestinal isolates usually
(acidophilus, casei, fermentum, gasseri, johnsonii, paracasei, exhibit higher adhesion activity than the food-origin isolates
plantarum, rhamnosus, and salivarius). It was deemed that [26]. However, Monteagudo-Mera et al. [27] reported that
this is a group of well-investigated species, having general some Lactobacillus strains isolated from cheese were more
health benefits, particularly for the digestive system and adherent to CaCo-2 cells than Lactobacillus spp. isolated from
immune system; therefore in Canada a general claim is used: human faeces.
“promotes a healthy gut flora” [17, 18]. It is also worth noting that commensals in the gut can
The law is different in the USA where a lot of microor- be the source of probiotic strains, but until these strains are
ganisms listed in the document entitled Clinical Guide to isolated, and carefully characterized for their health effects,
Probiotic Products [19], with recommendations for use and they cannot be called “probiotics.” The distinction between
dosage, are permitted. commensal microorganisms and probiotics was highlighted
Many medical organisations have evaluated probiotics by an ISAPP panel [9].
and probiotic foods in terms of their proven health benefits. Several probiotic bacteria of human origin are used
Such evaluations resulted in clinical recommendations of commercially, like Lactobacillus rhamnosus GG, Lactobacillus
medical organisations concerning the use of selected well- casei Shirota, and Lactobacillus acidophilus LA-1. However,
tested probiotics in specific clinical conditions, such as the several commercially explored, well-studied probiotic strains
treatment and prevention of acute gastroenteritis, necrotising are species that are not native human colonizers (e.g.,
enterocolitis, and postantibiotic diarrhoea, as well as in the Bifidobacterium animalis subsp. lactis and Saccharomyces
supplementation of milk for initial newborn nutrition [16]. cerevisiae var. boulardii) [4, 28].
Markowiak and Śliżewska [7] in their review presented an Probiotic microorganisms, beside the conventional
extensive list of possible clinical uses of probiotics in the case source (a healthy person’s gastrointestinal tract), may
of various conditions. originate from unconventional sources, such as the
gastrointestinal tract of an animal, human breast milk,
food (fermented and unfermented), air, or soil. In Table 2
3. New Sources and Types of Probiotics there are examples of conventional and unconventional
sources of probiotics isolation only from the recent years.
The conventional source of probiotics for human use, recom- Looking for probiotic properties of food-origin lactic acid
mended by FAO/WHO, is the human gastrointestinal tract bacteria becomes a visible trend in food microbiology
(GIT). The number of microorganisms inhabiting the GIT researches. When the level of advancement of the researches
has been estimated to exceed 1014 , most of them belonging on probiotic candidates (in most cases only in vitro tests) is
to the domain Bacteria. Compiled data from the Human analysed, it becomes clear that the investigations are still at
Microbiome Project studies identified 2172 species isolated the beginning of a long way. Even more so, the correlation of
from human beings, classified into 12 different phyla. Around in vitro with in vivo results remains obscure [29]. However,
90% of all the bacterial taxa belong to just two divisions: abundance of the current findings seems to be extremely
Bacteroidetes and Firmicutes. The other divisions that have promising.
been consistently found in samples from the human distal It has been recommended that microorganisms used for
gut are Proteobacteria, Actinobacteria, Fusobacteria, and production of probiotic animal formulas should be isolated
Verrucomicrobia. Only very few species of Archaea (mostly from individuals belonging to the species for which they are
Methanobrevibacter smithii) seem to be represented in the intended, because part of health beneficial effects is probably
Table 2: Examples of conventional and unconventional sources of probiotic microorganisms.
Source of isolation Strains identify Activities References
Human Gastrointestinal tract

10 of Lb. gasseri, Lb. fermentum, Lb. vaginalis, Lb. reuteri In vitro gastrointestinal conditions resistance,
[23]
(i) stomach and Lb. salivarius strains antimicrobial activity
In vitro gastrointestinal conditions resistance,
2 of Lb. reuteri strains among 19 isolates antimicrobial activity, adhesion to epithelial gastric cell [30]
line, antioxidative activity antibiotic resistance
In vivo gastrointestinal conditions resistance, adhesion
to HT-29 cells, antimicrobial activities, antibiotic
Lb. rhamnosus IMC 501 and Lb. paracasei IMC 502, Lb.
susceptibility and plasmid profile. [31]
plantarum 319
In vivo survival through intestine in a 3 months human
(ii) intestine
feeding trial
In vivo improvement of intestinal microbiota with
Lb. rhamnosus IMC 501 and Lb. paracasei IMC 502 beneficial microbes and enhances bowel habits of [32]
healthy adults.
In vitro gastrointestinal conditions resistance, adhesion
Lb. helveticus BGRA43 [33]
to Caco-2 cells, antimicrobial and proteolytic activity
In vitro antimicrobial effect on C. difficile,
immunomodulatory activity, increase proliferation of
Lb. fermentum BGHI14 and Lb. helveticus BGRA43 [34]
GALT lymphocytes
In vivo reduction of C. perfringens in goats
In vitro adhesion to HT-29 cells, antimicrobial and
10 of Faecalibacterium prausnitzii strains antibiotic activity, immunomodulatory properties, [35]
(iii) feaces Short Chain Fatty Acid production
Lb. casei/paracasei CTC1677, Lb. casei/paracasei antimicrobial and antibiotic activity, auto-aggregation
[36, 37]
CTC1678 and Lb. rhamnosus CTC1679 In vivo survival, colonize and persist in the
gastrointestinal tract in a human intervention study
5
6
Table 2: Continued.
Lb. fermentum F53 and KC5b, E. gallinarum, and E. In vitro gastrointestinal conditions resistance,
[38]
faecalis strains assimilation of cholesterol
Breast milk, colostrums E. faecalis F1 and W. confuse F8 strains among 33 isolates [39]
antimicrobial and antibiotic activity,
antimicrobial and antibiotic activity, antiadhesion of
Lb. plantarum WLPL04 [40]
pathogens, protection from harmful effect of sodium
dodecyl sulfate, and anti-inflammatory properties
9 of Lb. gasseri, Bifidobacterium breve, and S. salivarius
antimicrobial and antibiotic activity, agglutination [41]
strains
properties
B. animalis subsp. lactis (B. lactis) INL1 in vivo anti-inflammatory capacities [42]
Animals Gastrointestinal tract
In vitro gastrointestinal conditions resistance, antibiotic
Lb. fermentum V3B-08, Weissella hellenica V1V-30, Lb.
(i) calves and antimicrobial susceptibility [43]
farciminis B4F-06
In vivo mice intestine colonization, immunomodulation
(ii) pigs 3 of Lb. salivarius strains In vitro antimicrobial activity [44]
3 of Pediococcus pentosaceus LJR1, LJR5, and LJR9
(iii) goats antibacterial activity, adhesion to the HCT-15 cells, [45]
strains
anti-inflammatory properties
15 of Candida sp., R. mucilaginosa, Y. lipolytica, M.
In vivo reduction of mortality associated to V.
(iv) fishes viticola, C. laurentii, D. hansenii, and S. cerevisiae yeast [46]
anguillarum challenge in zebrafish
strains
In vitro antibacterial activity, high auto-agregation
(v) bees Lb. johnsonii CRL1647 properties [47, 48]
In vivo stimulate of bee egg-laying and vitality
Table 2: Continued.
Fermented
Milk and dairy products
food
L. lactis KX881768, Lb.plantarum KX881772, L. lactis
(i) camel’s milk and antimicrobial susceptibility, auto- and [49]
KX881782 and Lb. plantarum KX881779
co-agregation properties, cholesterol removal

Lb. plantarum YD5S and YD9S, Lb. pentosus YD8S, Lb. In vitro: hypocholesteromic effect, acid tolerance, bile
(ii) yak milk paraplantarum YD11S, E. lactis YHC20 and E. faecium tolerance, bile salt hydrolase (BSH) activity, cell surface [50]
YY1 hydrophobicity
(iii) goat’s milk Lb. plantarum and Pediococcus acidilactici [51]
and antimicrobial susceptibility, adhesion properties
adherence to Caco-2 cells, antimicrobial and
(iv) cow’s milk Lb. helveticus KII13 and KHI1 strains [52]
cholesterol-lowering activity
In vivo cholesterol-lowering activity in mice model
(v) whey 16 of Lb. plantarum and Lb. fermentum strains In vitro antibacterial activity, safety assessment [53]
S. thermophilus ACA-DC 26
(vi) traditional Greek dairy 2 of Lb. plantarum ACA-DC 2640 and ACA-DC 4039 In vitro antibacterial activity, high adherence ability,
[54]
products strains, Lb. plantarum ACA-DC 2640 and S. anti-inflammatory properties
thermophilus ACA-DC 26 and ACA-DC 170
(vii) traditional Polish
29 of Lb. plantarum strains In vitro antibacterial activity [55]
cheeses
auto-aggregation properties
(viii) Tibetan kefir grain Lb. kefiranofaciens XL10 [56]
In vivo modulation of gut microbiota, adhere and
colonize to intestine tissue of mice
(ix) Iranian Spar Lb. brevis LSe to Caco-2 cells, antioxidant and high selenium-tolerant [57]
activity
Raw fermented meat
products
(i) Thai fermented pork
Lb. plantarum subsp. plantarum SKI19 to xylene and chloroform, antimicrobial activity, safety [58]
sausage
assessment
Pediococcus pentosaceus R1, Lb. brevis R4, Lb. curvatus
(ii) Harbin dry sausages auto-aggregation, adhesion to Caco-2 cells, antioxidant [59]
R5, and Lb. fermentum
activity
7
8
Table 2: Continued.
(iii) raw fermented Polish In vitro gastrointestinal conditions resistance,
21 of Lb. plantarum, Lb. brevis, Pd. pentosaceus strains [60]
meat products antimicrobial activity, safety assessment
In vitro gastrointestinal conditions resistance, auto- and
(iv) cooked meat products E. faecium UAM1 [61]
co- aggregation, adhesion to Caco-2 cells,
Fishes and seafood
(i) Hentak, a fermented fish In vitro gastrointestinal conditions resistance,
product of North-East Lb. brevis LAP2 auto-aggregation, hydrophobicity, antioxidant and [62]
India antimicrobial potential
In vivo inhibition of mesangial proliferative
(ii) Japanese fermented fish
heat-killed Lb. paracasei NFRI 7415 glomerulonephritis by alcohol intake with stress in [63]
(funa-sushi)
mice model
In vitro stimulation macrophages to produce IL-12
(iii) Korean salted In vivo immunostimulation, inhibition of atopic
Lb. plantarum JBCC105645 and JBCC105683 [64]
fermented seafood (Jeotgal) dermatitis -like skin lesions and reduction serum IgE
levels in mice model
In vitro antimicrobial activity, resistant to
(iv) marine oyster E. faecium HL7 [65]
environmental stressors, antibiotic sensitivity
Pickled vegetables
(i) kimchi Lactococcus lactis KC24 antimicrobial properties, adhesion to Caco-2 cells, [66]
antioxidant, anti-inflammatory, anticancer activity,
(ii) Polish fermented
14 of Lactobacillus spp. antimicrobial properties, adhesion to xylene, safety [67]
cabbage and cucumber
assessment
In vitro antimicrobial properties,
(iii) cocoa fermentation Lb. fermentum TcUESC01 and Lb. plantarum TcUESC02 In vivo anti-inflammatory and immunomodulation [68]
activity
(iv) Mexican alcoholic,
antimicrobial properties,
non-distilled, fermented Leuconostoc mesenteroides strain P45 [69]
In vivo anti-infective activity against S. enterica serovar
beverage (Pulque)
Typhimurium in challenged mice
In vitro gastrointestinal conditions resistance, auto- and
P. acidilactici SDL 1402, SDL 1405, SDL 1406, Weissella co- aggregation ability, adhesion to xylene, safety
(v) Korean fermented
cibaria SCCB 2306, S. thermophilus SCML 337, SCML assessment [70]
soybean paste
300 and E. faecium SC 54 In vivo colonization ability and strongly attachment to
Caenorhabditis elegans gut
Table 2: Continued.
Sourdough, cereal
products
(i) India fermented pearl In vitro gastrointestinal conditions resistance, bile salt
Lb. fermentum CFR5, CFR1, CFR4 and CFR2 and Lb.
millet porridge (Kambu hydrolase activity, auto-aggregation ability, [71]
delbrueckii CFR6
koozh) antimicrobial and antioxidant activity, safety assessment
(ii) Altamura dough S. cerevisiae 2 and S. cerevisiae 4 hydrophobic ability, antimicrobial activity, safety [72]
assessment
Non-
fermented Fruits and vegetables
food
(i) byproducts of fruit pulp Lb. brevis 59, Lb. pentosus 129, Lb. paracasei 108, Lb. In vitro gastrointestinal conditions resistance,
[73]
processing plantarum 49, and Lb. fermentum 111 antimicrobial activity, safety assessment
(ii) pineapple and 50 isolates of Candida lusitaniae and Meyerozyma In vitro gastrointestinal conditions resistance,
[74]
pineapple peels caribbica antimicrobial activity, safety assessment
(iii) raw fruits and
48 of Lactobacillus, Weissella and Pediococcus strains to Caco-2 cells, immunomodulatory properties, [75]
vegetables
antimicrobial activity
(iv) carrot Enterococcus durans QU 49 In vitro bacteriocin production [76]
Environment Food wastes
(i) poultry slaughterhouse Lb. plantarum LPL9, Lb. ramnosus LRH25, and Lb. In vitro gastrointestinal conditions resistance,
[77]
waste fermentum LFE26 antimicrobial activity, adhesion to hydrocarbons
In vitro Zearalenone removal ability, gastrointestinal
(ii) moldy corn Bacillus amyloliquefaciens [78]
conditions resistance, antimicrobial activity
Air in working and storage 16S rRNA gene sequencing and amplified fragment
Strains of Lb. plantarum and Lb. sanfranciscensis [79]
room of bakery length polymorphism analysis
Soils of North East to Caco-2 cells
Bacillus amyloliquefaciens JF836079 [80]
Himalayas In vivo beneficial effect on Inflammatory Bowel Disease
in mice
9
species specific [81]. Therefore the guts of several animal cheese from Armenia exhibited a high aggregation and
species are good sources of probiotics, mainly for animal use. adhesion activity in vitro and in vivo, so it has the potential
Billet et al. [82] have found that Bifidobacterium actinocoloni- as a good probiotic strain. Recently, also four Enterococcus
iforme R-53049, isolated from bumblebee gut, showed the strains isolated from a regional Argentinean cheese were
potential to colonize the bumblebees’ guts permanently after found to be safe, and authors promoted these strains for
administration. Recently, three candidate probiotic strains, further study and suggest their utilization as adjuvant in a
Bacillus subtilis (IPA-S.51) and Shewanella algae (IPA-S.252 starter culture for cheese production [100].
and IPA-S.111) isolated from shrimp found to be active in Microorganisms (bacteria and fungi) with probiotic
vivo against the pathogenic bacteria Vibrio sp., improved properties are also isolated from other fermented and unfer-
shrimp growth and could develop in shrimp hepatopancreas mented products of animal origin, such as meat and raw
and intestine [83]. Literature shows many other examples of cured cold meats [101, 102], fish and seafood [62, 103, 104],
probiotics isolated from animal intestinal tracts for animal or honey [105].
use, such as swine [84], poultry [85], marine, and freshwater Han et al. [59] evaluated in vitro probiotic properties of
fish [86]. four strains Pediococcus pentosaceus R1, Lactobacillus brevis
Among the lactic acid bacteria isolated from breast R4, Lactobacillus curvatus R5, and Lactobacillus fermentum
milk three species clearly predominated: Lb. gasseri, Lb. R6 isolated from Harbin dry sausages. They found that these
reuteri, and E. faecium. These species are considered among strains tolerated the human gastrointestinal (GI) tract well
the probiotic bacteria. Recently Rajoka et al. [87] isolated and possess antioxidant activity. Recently, also Hernández-
Lactobacillus sp. from mother’s milk and examined them Alcántara [2018] isolated six thermotolerant lactic acid bacte-
for resistance to acid and bile and antioxidant properties as ria from cooked meat products and showed that E. Faecium
well as antibiotic susceptibility. Moreover, they have found UAM1 has probiotic properties that predict its capability to
that tested Lactobacillus strains were efficient against cervix colonize in competition with pathogens in the intestinal tract.
cancer cells and hold promise to show probiotic features. Recently Yamada et al. [63] have found that heat-killed
Arroyo et al. [88] investigated the efficacy of Lb. fermentum Lb. paracasei NFRI 7415 isolated from traditional Japanese
CECT 5716 or Lb. salivarius CECT 5713 isolated from breast fermented fish (funa-sushi) possess in vitro probiotic char-
milk, to treat lactational mastitis. They found that probiotic acteristics and inhibited mesangial proliferative glomeru-
treatment led to a significant reduction in the milk bacterial lonephritis by alcohol intake with stress in mice model.
count and to a rapid improvement of woman condition. Hamdy et al. [106] investigated Bacillus subtilis HMNig-
Other authors also claimed that lactic acid bacteria that are 2 and Bacillus subtilis MENO2 isolated from honey and
originally isolated from human milk may have an endoge- bee gut and found that these strains and prebiotic levan
nous origin and may not be the result of contamination exhibited in vivo promising probiotic characteristics, such
from the surrounding breast skin and therefore would fulfil as immune system improvement and protection from
some of the main criteria generally recommended for human Salmonella typhimurium infection and their associated effects
probiotics [89, 90]. on liver such as inflammation and hepatic infiltration.
Milk of farm animals and milk products constitute It has been shown that fruit, vegetables, juices, and grain
a good source of the lactic acid fermentation bacteria. products are an equally valuable source of isolation [107–
Spontaneously fermented milk products are still produced 109].
until this day in many parts of the world and constitute an Recently, Lactobacillus fermentum TcUESC01 (LF) and
excellent source of probiotic microorganisms, particularly Lactobacillus plantarum TcUESC02 (LP) isolated from the
bacteria from the genera Lactobacillus, Lactococcus, or Strep- fermentation of cocoa (Theobroma cacao L.) were evaluated in
tococcus, as well as yeasts. The examples include drinks, kule vitro and in vivo as probiotics. The protective effect of admin-
naoto, Masai fermented milk [91] and Koumiss [92], from istration of the lactobacilli against Salmonella typhimurium
which microorganisms with immunomodulatory properties was proved [68].
have been isolated. Unconventional sources of isolation of Other authors isolated 150 yeasts from peel and sponta-
microorganisms with probiotic characteristics were also yak neously fermented pineapple pulp. Five of them survived the
milk [93] and camel milk [94] and goat milk [95] as well gastrointestinal conditions and showed antibiotic resistance
as other fermented milk drinks. For example, Lactobacil- and autoaggregation properties, which predisposes them for
lus kefiranofaciens XL10, with a high yield of extracellular further probiotic characteristics study [74].
polysaccharide (EPS), isolated from Tibetan kefir grain has Also other unconventional sources, such as soil [80], air
been considered to exhibit probiotic potential in vitro and in from rooms in which the leavening for the production of
vivo [56]. Recently Bengoa et al. [96] evaluated the adhesion sourdough bread has been prepared [79], or sewage, kitchen
ability in vitro of Lb. paracasei strains isolated from kefir leftovers, and postproduction waste [77, 110], have become
grains after acid and bile stress and observed that, after a source of isolation of bacteria with probiotic properties.
gastrointestinal passage, Lb. paracasei strains have increased Also in our laboratory, in the Department of Technology
their ability to adhere to mucin and epithelial cells. Catering and Food Hygiene at Warsaw University of Life
Many regional cheeses in Europe have also been used Sciences, the investigations were performed on isolation,
to isolate microorganisms with health promoting properties identification, and characterization of lactic acid bacteria,
[54, 97, 98]. Grigoryan et al. [99] demonstrated that Lacto- mainly Lactobacillus, and the characteristic of probiotic
bacillus helveticus INRA-2010-H11 isolated from the Chanakh and functional properties of these strains. Currently, the
collection possesses over 200 pure cultures of Lactobacillus apoptosis using a Capase-3 assay. The results of the research
sp. and other lactic acid bacteria isolated from spontaneously work carried out so far have been presented at conferences
fermented food products. and partially published.
Traditional and regional Polish fermented food products Based on our results, we can conclude that the properties
were found as an abundant source of potential probiotic investigated (antagonistic, enzymatic activity, susceptibility,
strains. For example, twenty-one strains of the genus Lac- or resistance to selected antibiotic) of tested lactic acid
tobacillus and the genus Pediococcus, isolated from raw bacteria strains were dependent on the source of isolation. For
fermented meat products, were found to be resistant to example, strains isolated from the Oscypek and Korycinski
gastric enzymes, low pH, intestinal enzymes, and bile salts. cheeses and fermented vegetables were more active against
Moreover few strains had the ability to produce bacteriocins Listeria than strains isolated form fermented meat and
or bacteriocin-like substances. Most strains were considered whey. The weakest activity of the strains tested occurred
as safe. In conclusion, strains Lb. brevis SCH6 and Pd. pen- against E. coli and Salmonella; however strains isolated from
tosaceus BAL6 and KL14 were selected as potential probiotic, the Korycinski cheese and strains isolated from fermented
as well as a viable bioprotective culture that can be inoculated cucumber were found to be moderately active against those
in raw fermented meat products as starter cultures [60]. pathogens. On the other hand, strains isolated from organic
In other investigations of the same authors, twenty- whey were more susceptible to selected antibiotics than
five strains were isolated from raw, organic whey samples, strains isolated from other sources.
and sixteen of them were identified as Lb. plantarum and
Lb. fermentum. The study showed that all of the strains
had 𝛽-galactosidase activity and average lipolytic, esterolytic, 4. Summary
and low proteolytic activity. Some of them reduced nitrate
content. Moreover most of the tested strains were susceptible Despite the widely conducted research and extensive scien-
to known antibiotics and few of Lb. plantarum and Lb. tific evidence, there are still no clear-cut legal requirements,
fermentum strains did not possess any transfer resistance which leads to inappropriate application, or even abuse of
genes. The study reveals that the Lactobacillus strains isolated the term “probiotic.” In accordance with the current state
from organic whey are safe and have high potential for of knowledge, probiotic organisms should show an effect
food application. Moreover these strains were highly active of improved health in the host’s body. The origin of the
against selected pathogens, such as E. coli, L. monocytogenes, microorganisms from the human gastrointestinal tract is not
Salmonella enteritidis, and Shigella sp. [53]. a criterion that is indicated as essential. The more so as more
In the study of Ołdak et al. [55] 29 of Lactobacillus and more scientific evidence indicates new unconventional
plantarum strains isolated from Oscypek and Korycinski, sources of isolation as correct ones.
the traditional and regional cheeses form Poland, were Isolation, identification, and assessment of safety and
investigated. It has been found that the highest antimicrobial probiotic properties of new, “wild” strains of microorgan-
activity was observed for L. monocytogenes; however, the isms from traditional foods constitute a necessary practice,
level of that activity was different depending on the Lb. particularly in order to develop the technology of pro-
plantarum strain. Moreover, the antagonistic activity shown duction of food-dedicated vaccines. New vaccines, besides
by Lb. plantarum strains was connected with the source protective properties (bacteriostatic and bactericidal), may
from which a given strain was isolated. Strains isolated from provide additional values connected with the consumer’s
the Oscypek cheese represented stronger activity against L. improved health. Microorganisms isolated from foods show
monocytogenes, whereas strains isolated from the Korycinski better viability in the food environment and guarantee
cheese were more active against E. coli. more attractive sensory characteristics in comparison with
Abundant sources of Lactobacillus strains were also found microorganisms originating from intestines [112]. The most
in Polish food product of plant origin, such as traditional fer- frequently encountered types of probiotics are Bifidobac-
mented cabbage and cucumber. Zielińska et al. [67] isolated terium (adolescentis, animalis, bifidum, breve, and longum)
38 strains from the pickled samples and 14 were identified and Lactobacillus (acidophilus, casei, fermentum, gasseri,
as Lactobacillus spp. The study showed that all tested strains johnsonii, paracasei, plantarum, rhamnosus, and salivarius).
were resistant to harmful gastrointestinal conditions (pH 2.5, Selected strains of yeasts are also believed to be probiotic:
0.2% bile salt solution, and 0.4% phenol addition); however Saccharomyces boulardii. The Escherichia coli or Bacillus
pH 1.5 caused death of Lactobacillus cells, except 4 strains, coagulans strains are used less frequently. Recently, interest
which could survive for 90 min at pH 1.5. The hydrophobic in newly identified human commensals has been growing:
nature of the cell surface of the tested strains suggested Akkermansia muciniphila, Faecalibacterium prausnitzii, Rose-
their adhesion capacity. On the basis of the results, 10 of buria spp., and Eubacterium hallii, which are referred to
the selected Lactobacillus strains are considered safe and as “probiotics of the future.” Thanks to new possibilities of
can survive under gastrointestinal conditions, which requires growing these bacteria, which due to their properties (strict
them to undergo future in vitro and in vivo studies. In anaerobes) were believed as noncultivated, the interest of
the next study [111], the selected strains were screened for researchers and possibilities for identifying their phenotype
adhesion capacity to Caco-2 cells, regulation of selected increased. In the future, there are plans to use the newly found
cytokine production by incubating bacterial suspensions with strains to design ecosystems which may be used to replace the
THP-1 macrophage like cells, and stimulation of Caco-2 cells microbiome in people with various conditions for therapeutic
purposes. The possibilities of using those microorganisms in [11] S. Sarkar, “Efficacy of dead probiotic cells,” International Journal
the production of food will depend on the progress in further of Food Sciences and Nutrition Diet, vol. 5, no. 1, 2016.
research and proving the safety of their application in human [12] “Nutrition and health claims made on foods,” Regulation (EC)
beings [9]. No. 1924/2006.
Evidence from well-conducted observation research and [13] G. Reid, “Probiotics: definition, scope and mechanisms of
a lot of randomised controlled research confirms the potential action,” Best Practice & Research Clinical Gastroenterology, vol.
influence of probiotics on human health. However, extend- 30, no. 1, pp. 17–25, 2016.
ing the term “probiotic” to include bacteria isolated from [14] Ministero della Salute, “Commissione unica per la nutrizione e
traditionally, spontaneously fermented foods seems justified. la dietetica,” in Guidelines on Probiotics and Prebiotics, 2013.
Microorganisms isolated from fermented products constitute [15] H. Szajewska, A. Guarino, I. Hojsak et al., “Use of probiotics
the microflora of an environment in which the products for management of acute gastroenteritis: a position paper by
were produced. If they are tested, particularly in terms of the ESPGHAN working group for probiotics and prebiotics,”
their probiotic properties and safety, they may constitute an Journal of Pediatric Gastroenterology and Nutrition, vol. 58, no.
interesting alternative to gut bacteria. 4, pp. 531–539, 2014.
[16] S. Ebner, L. N. Smug, W. Kneifel, S. J. Salminen, and M. E.
Sanders, “Probiotics in dietary guidelines and clinical recom-
Conflicts of Interest mendations outside the European Union,” World Journal of
Gastroenterology, vol. 20, no. 43, pp. 16095–16100, 2014.
[17] M. J. Scourboutakos, B. Franco-Arellano, S. A. Murphy, S.
regarding the publication of this paper.
Norsen, E. M. Comelli, and M. R. L’Abbé, “Mismatch between
probiotic benefits in trials versus food products,” Nutrients, vol.
Acknowledgments 9, no. 4, 2017.
[18] Health Canada, Accepted Claims about the Nature of Probiotic
This work was supported by National Science Centre, Microorganisms in Food, 2009.
Poland (Narodowe Centrum Nauki), under grant number [19] http://usprobioticguide.com/.
2017/01/X/NZ9/01627, Miniatura I. [20] P. Hugon, J.-C. Dufour, P. Colson, P.-E. Fournier, K. Sallah, and
D. Raoult, “A comprehensive repertoire of prokaryotic species
References identified in human beings,” The Lancet Infectious Diseases, vol.
15, no. 10, article no. 225, pp. 1211–1219, 2015.
[1] R. G. Kerry, J. K. Patra, S. Gouda, Y. Park, H. S. Shin, and G. Das, [21] V. Robles-Alonso and F. Guarner, “From basic to applied
“Benefaction of probiotics for human health: A review,” Journal research lessons from the human microbiome projects,” Journal
of Food and Drug Analysis, vol. 26, 3, pp. 927–939, 2018. of Clinical Gastroenterology, vol. 48, pp. S3–S4, 2014.
[2] https://www.grandviewresearch.com/industry-analysis/ [22] D. Ren, C. Li, Y. Qin et al., “In vitro evaluation of the probiotic
probiotics-market. and functional potential of Lactobacillus strains isolated from
[3] https://www.transparencymarketresearch.com/probiotics- fermented food and human intestine,” Anaerobe, vol. 30, pp. 1–
market.html. 10, 2014.
[4] M. E. Sanders, “Probiotics, the concept, w:wgo handbook on gut [23] K. A. Ryan, T. Jayaraman, P. Daly et al., “Isolation of lactobacilli
microbes, world digestive health day,” in The WGO Foundation, with probiotic properties from the human stomach,” Letters in
pp. 39–42, USA, Milwakee, 2014. Applied Microbiology, vol. 47, no. 4, pp. 269–274, 2008.
[5] F. Guarner, G. Perdigon, G. Corthier, S. Salminen, B. Koletzko, [24] M. E. Sanders, “Impact of probiotics on colonizing microbiota
and L. Morelli, “Should yoghurt cultures be considered probi- of the gut,” Journal of Clinical Gastroenterology, vol. 45, no. 3,
otic?” British Journal of Nutrition, vol. 93, no. 6, pp. 783–786, pp. S115–S119, 2011.
2005. [25] E. Isolauri, S. Salminen, and A. C. Ouwehand, “Probiotics,” Best
[6] L. A. David, C. F. Maurice, R. N. Carmody et al., “Diet rapidly Practice & Research Clinical Gastroenterology, vol. 18, no. 2, pp.
and reproducibly alters the human gut microbiome,” Nature, 299–313, 2004.
vol. 505, no. 7484, pp. 559–563, 2014. [26] V. Bunešová, E. Vlková, V. Rada et al., “Bifidobacterium ani-
[7] P. Markowiak and K. Ślizewska, “Effects of probiotics, prebi- malis subsp. lactis strains isolated from dog faeces,” Veterinary
otics, and synbiotics on human health,” Nutrients, vol. 9, no. 9, Microbiology, vol. 160, no. 3-4, pp. 501–505, 2012.
article no. 1021, 2017. [27] A. Monteagudo-Mera, L. Rodrı́guez-Aparicio, J. Rúa et al.,
[8] FAO/WHO, “Probiotics in food. Health and nutritional prop- “In vitro evaluation of physiological probiotic properties of
erties and guidelines for evaluation,” FAO. Food and Nutrition different lactic acid bacteria strains of dairy and human origin,”
Paper, vol. 85, pp. 1–56, 2002. Journal of Functional Foods, vol. 4, no. 2, pp. 531–541, 2012.
[9] C. Hill, F. Guarner, G. Reid et al., “Expert consensus document: [28] M. Derrien and J. E. T. van Hylckama Vlieg, “Fate, activity, and
the International Scientific Association for Probiotics and impact of ingested bacteria within the human gut microbiota,”
Prebiotics consensus statement on the scope and appropriate Trends in Microbiology, vol. 23, no. 6, pp. 354–366, 2015.
use of the term probiotic,” Nature Reviews Gastroenterology & [29] G. Vinderola, M. Gueimonde, C. Gomez-Gallego, L. Delfed-
Hepatology, vol. 11, no. 8, pp. 506–514, 2014. erico, and S. Salminen, “Correlation between in vitro and in
[10] M. L. Marco, D. Heeney, S. Binda et al., “Health benefits of vivo assays in selection of probiotics from traditional species
fermented foods: microbiota and beyond,” Current Opinion in of bacteria,” Trends in Food Science & Technology, vol. 68, pp.
Biotechnology, vol. 44, pp. 94–102, 2017. 83–90, 2017.
[30] S. Delgado, A. M. O. Leite, P. Ruas-Madiedo, and B. Mayo, [44] L. L. Verso, M. Lessard, G. Talbot, B. Fernandez, and I. Fliss,
“Probiotic and technological properties of Lactobacillus spp. “Isolation and selection of potential probiotic bacteria from the
Strains from the human stomach in the search for potential pig gastrointestinal tract,” Probiotics and Antimicrobial Proteins,
candidates against gastric microbial dysbiosis,” Frontiers in pp. 1–14, 2017.
Microbiology, vol. 5, 2014. [45] G. Ladha and K. Jeevaratnam, “Probiotic potential of pedio-
[31] M. C. Verdenelli, F. Ghelfi, S. Silvi, C. Orpianesi, C. Cecchini, coccus pentosaceus LJR1, a bacteriocinogenic strain isolated
and A. Cresci, “Probiotic properties of Lactobacillus rhamnosus from rumen liquor of goat (Capra aegagrus hircus),” Food
and Lactobacillus paracasei isolated from human faeces,” Euro- Biotechnology, vol. 32, no. 1, pp. 60–77, 2018.
pean Journal of Nutrition, vol. 48, no. 6, pp. 355–363, 2009. [46] M. Caruffo, N. Navarrete, O. Salgado et al., “Potential probiotic
[32] M. C. Verdenelli, S. Silvi, C. Cecchini, C. Orpianesi, and A. yeasts isolated from the fish gut protect zebrafish (Danio rerio)
Cresci, “Influence of a combination of two potential probiotic from a Vibrio anguillarum challenge,” Frontiers in Microbiology,
strains, Lactobacillus rhamnosus IMC 501 and Lactobacillus vol. 6, 2015.
paracasei IMC 502 on bowel habits of healthy adults,” Letters [47] M. Carina Audisio, M. J. Torres, D. C. Sabaté, C. Ibarguren, and
in Applied Microbiology, vol. 52, no. 6, pp. 596–602, 2011. M. C. Apella, “Properties of different lactic acid bacteria isolated
[33] I. Strahinic, J. Lozo, A. Terzic-Vidojevic et al., “Technological from Apis mellifera L. bee-gut,” Microbiological Research, vol.
and probiotic potential of BGRA43 a natural isolate of Lacto- 166, no. 1, pp. 1–13, 2011.
bacillus helveticus,” Frontiers in Microbiology, vol. 4, 2013. [48] M. C. Audisio and M. R. Benı́tez-Ahrendts, “Lactobacillus
[34] N. Golić, K. Veljović, N. Popović et al., “In vitro and in vivo johnsonii CRL1647, isolated from Apis mellifera L. bee-gut,
antagonistic activity of new probiotic culture against Clostrid- exhibited a beneficial effect on honeybee colonies,” Beneficial
ium difficile and Clostridium perfringens,” BMC Microbiology, Microbes, vol. 2, no. 1, pp. 29–34, 2011.
vol. 17, no. 1, article no. 108, 2017. [49] A. Abushelaibi, S. Al-Mahadin, K. El-Tarabily, N. P. Shah, and
[35] R. Martı́n, S. Miquel, L. Benevides et al., “Functional charac- M. Ayyash, “Characterization of potential probiotic lactic acid
terization of novel Faecalibacterium prausnitzii strains isolated bacteria isolated from camel milk,” LWT—Food Science and
from healthy volunteers: A step forward in the use of F. praus- Technology, vol. 79, pp. 316–325, 2017.
nitzii as a next-generation probiotic,” Frontiers in Microbiology, [50] K. Ghatani and B. Tamang, “Assessment of probiotic character-
vol. 8, 2017. istics of lactic acid bacteria isolated from fermented yak milk
[36] R. Rubio, A. Jofré, B. Martı́n, T. Aymerich, and M. Garriga, products of Sikkim, India: Chhurpi, Shyow, and Khachu,” Food
“Characterization of lactic acid bacteria isolated from infant Biotechnology, vol. 31, no. 3, pp. 210–232, 2017.
faeces as potential probiotic starter cultures for fermented [51] G. Makete, O. A. Aiyegoro, and M. S. Thantsha, “Isolation, iden-
sausages,” Food Microbiology, vol. 38, pp. 303–311, 2014. tification and screening of potential probiotic bacteria in milk
[37] R. Rubio, B. Martı́n, T. Aymerich, and M. Garriga, “The from south african saanen goats,” Probiotics and Antimicrobial
potential probiotic Lactobacillus rhamnosus CTC1679 survives Proteins, vol. 9, no. 3, pp. 246–254, 2017.
the passage through the gastrointestinal tract and its use as [52] K. Damodharan, S. A. Palaniyandi, S. H. Yang, and J. W. Suh,
starter culture results in safe nutritionally enhanced fermented “Functional probiotic characterization and in vivo cholesterol-
sausages,” International Journal of Food Microbiology, vol. 186, lowering activity of lactobacillus helveticus isolated from fer-
pp. 55–60, 2014. mented cow milk,” Journal of Microbiology and Biotechnology,
[38] D. I. A. Pereira and G. R. Gibson, “Cholesterol assimilation by vol. 26, no. 10, pp. 1675–1686, 2016.
lactic acid bacteria and bifidobacteria isolated from the human [53] A. Rzepkowska, D. Zielińska, A. Ołdak, and D. Kołożyn-
gut,” Applied and Environmental Microbiology, vol. 68, no. 9, pp. Krajewska, “Organic whey as a source of Lactobacillus strains
4689–4693, 2002. with selected technological and antimicrobial properties,” Inter-
[39] N. A. Reis, M. A. F. Saraiva, E. A. A. Duarte, E. A. de Carvalho, national Journal of Food Science & Technology, vol. 52, no. 9, pp.
B. B. Vieira, and N. S. Evangelista-Barreto, “Probiotic properties 1983–1994, 2017.
of lactic acid bacteria isolated from human milk,” Journal of [54] G. Zoumpopoulou, A. Tzouvanou, E. Mavrogonatou et al.,
Applied Microbiology, vol. 121, no. 3, pp. 811–820, 2016. “Probiotic features of lactic acid bacteria isolated from a diverse
[40] M. Jiang, F. Zhang, C. Wan et al., “Evaluation of probiotic pool of traditional Greek dairy products regarding specific
properties of Lactobacillus plantarum WLPL04 isolated from strain-host interactions,” Probiotics and Antimicrobial Proteins,
human breast milk,” Journal of Dairy Science, vol. 99, no. 3, pp. pp. 1–10, 2017.
1736–1746, 2016. [55] A. Ołdak, D. Zielińska, A. Rzepkowska, and D. Kołozyn-
[41] Q. S. Damaceno, J. P. Souza, J. R. Nicoli et al., “Evaluation of Krajewska, “Comparison of antibacterial activity of Lactobacil-
potential probiotics isolated from human milk and colostrum,” lus plantarum strains isolated from two different kinds of
Probiotics and Antimicrobial Proteins, vol. 9, no. 4, pp. 371–379, regional cheeses from Poland: oscypek and korycinski cheese,”
2017. BioMed Research International, vol. 2017, Article ID 6820369, 10
[42] P. Burns, J. Alard, J. Hrdy et al., “Spray-drying process preserves pages, 2017.
the protective capacity of a breast milk-derived Bifidobacterium [56] Z. Xing, W. Tang, W. Geng, Y. Zheng, and Y. Wang, “In vitro and
lactis strain on acute and chronic colitis in mice,” Scientific in vivo evaluation of the probiotic attributes of Lactobacillus
Reports, vol. 7, 2017. kefiranofaciens XL10 isolated from Tibetan kefir grain,” Applied
[43] S. Sandes, L. Alvim, B. Silva et al., “Selection of new lactic Microbiology and Biotechnology, vol. 101, no. 6, pp. 2467–2477,
acid bacteria strains bearing probiotic features from mucosal 2017.
microbiota of healthy calves: Looking for immunobiotics [57] M. Shakibaie, T. Mohammadi-Khorsand, M. Adeli-Sardou et
through in vitro and in vivo approaches for immunoprophylaxis al., “Probiotic and antioxidant properties of selenium-enriched
applications,” Microbiological Research, vol. 200, pp. 1–13, 2017. Lactobacillus brevis LSe isolated from an Iranian traditional
dairy product,” Journal of Trace Elements in Medicine and [71] S. K. Palaniswamy and V. Govindaswamy, “In-vitro probiotic
Biology, vol. 40, pp. 1–9, 2017. characteristics assessment of feruloyl esterase and glutamate
[58] V. Botthoulath, A. Upaichit, and U. Thumarat, “Identification decarboxylase producing Lactobacillus spp. isolated from tra-
and in vitro assessment of potential probiotic characteristics ditional fermented millet porridge (kambu koozh),” LWT- Food
and antibacterial effects of Lactobacillus plantarum subsp. Science and Technology, vol. 68, pp. 208–216, 2016.
plantarum SKI19, a bacteriocinogenic strain isolated from [72] M. Perricone, A. Bevilacqua, M. R. Corbo, and M. Sini-
Thai fermented pork sausage,” Journal of Food Science and gaglia, “Technological characterization and probiotic traits of
Technology, vol. 55, no. 7, pp. 2774–2785, 2018. yeasts isolated from Altamura sourdough to select promising
[59] Q. Han, B. Kong, Q. Chen, F. Sun, and H. Zhang, “In vitro microorganisms as functional starter cultures for cereal-based
comparison of probiotic properties of lactic acid bacteria products,” Food Microbiology, vol. 38, pp. 26–35, 2014.
isolated from Harbin dry sausages and selected probiotics,” [73] E. F. Garcia, W. A. Luciano, D. E. Xavier et al., “Identification
Journal of Functional Foods, vol. 32, pp. 391–400, 2017. of lactic acid bacteria in fruit pulp processing byproducts and
[60] A. Rzepkowska, D. Zielińska, A. Ołdak, and D. Kołożyn- potential probiotic properties of selected Lactobacillus strains,”
Krajewska, “Safety assessment and antimicrobial properties of Frontiers in Microbiology, vol. 7, 2016.
the lactic acid bacteria strains isolated from polish raw fer- [74] J. C. Amorim, R. H. Piccoli, and W. F. Duarte, “Probiotic
mented meat products,” International Journal of Food Properties, potential of yeasts isolated from pineapple and their use in
vol. 20, no. 11, pp. 2736–2747, 2017. the elaboration of potentially functional fermented beverages,”
[61] A. M. Hernández-Alcántara, C. Wacher, M. G. Llamas, P. López, Food Research International, vol. 107, pp. 518–527, 2018.
and M. L. Pérez-Chabela, “Probiotic properties and stress [75] B. Vitali, G. Minervini, C. G. Rizzello et al., “Novel probiotic
response of thermotolerant lactic acid bacteria isolated from candidates for humans isolated from raw fruits and vegetables,”
cooked meat products,” LWT- Food Science and Technology, vol. Food Microbiology, vol. 31, no. 1, pp. 116–125, 2012.
91, pp. 249–257, 2018.
[76] C.-B. Hu, T. Zendo, J. Nakayama, and K. Sonomoto, “Descrip-
[62] C. Aarti, A. Khusro, R. Varghese et al., “In vitro studies on tion of durancin TW-49M, a novel enterocin B-homologous
probiotic and antioxidant properties of Lactobacillus brevis bacteriocin in carrot-isolated Enterococcus durans QU 49,”
strain LAP2 isolated from Hentak, a fermented fish product of Journal of Applied Microbiology, vol. 105, no. 3, pp. 681–690,
North-East India,” LWT- Food Science and Technology, vol. 86, 2008.
pp. 438–446, 2017.
[77] O. Ashayerizadeh, B. Dastar, F. Samadi, M. Khomeiri, A. Yam-
[63] Y. Yamada, M. Endou, S. Morikawa, J. Shima, and N. Komat-
chi, and S. Zerehdaran, “Study on the chemical and microbial
shzaki, “Lactic acid bacteria isolated from japanese fermented
composition and probiotic characteristics of dominant lactic
fish (funa-sushi) inhibit mesangial proliferative glomeru-
acid bacteria in fermented poultry slaughterhouse waste,” Waste
lonephritis by alcohol intake with stress,” Journal of Nutrition
Management, vol. 65, pp. 178–185, 2017.
and Metabolism, 2018.
[78] A. Lee, K.-C. Cheng, and J.-R. Liu, “Isolation and characteri-
[64] M.-S. Park, N.-E. Song, S.-H. Baik, H.-O. Pae, and S. H.
zation of a Bacillus amyloliquefaciens strain with zearalenone
Park, “Oral administration of lactobacilli isolated from Jeot-
removal ability and its probiotic potential,” PLoS ONE, vol. 12,
gal, a salted fermented seafood, inhibits the development of
no. 8, 2017.
2,4-dinitrofluorobenzene-induced atopic dermatitis in mice,”
Experimental and Therapeutic Medicine, vol. 14, no. 1, pp. 635– [79] I. Scheirlinck, R. Van Der Meulen, L. De Vuyst, P. Vandamme,
641, 2017. and G. Huys, “Molecular source tracking of predominant
[65] C.-H. Kang, T. Gu, and J.-S. So, “Possible probiotic lactic acid lactic acid bacteria in traditional Belgian sourdoughs and their
bacteria isolated from oysters (crassostrea gigas),” Probiotics production environments,” Journal of Applied Microbiology, vol.
and Antimicrobial Proteins, pp. 1–12, 2017. 106, no. 4, pp. 1081–1092, 2009.
[66] N.-K. Lee, K. J. Han, S.-H. Son, S. J. Eom, S.-K. Lee, and H.- [80] V. I. H. Islam, N. P. Babu, P. Pandikumar, and S. Ignacimuthu,
D. Paik, “Multifunctional effect of probiotic Lactococcus lactis “Isolation and characterization of putative probiotic bacterial
KC24 isolated from kimchi,” LWT- Food Science and Technology, strain, bacillus amyloliquefaciens, from north east himalayan
vol. 64, no. 2, pp. 1036–1041, 2015. soil based on in vitro and in vivo functional properties,”
Probiotics and Antimicrobial Proteins, vol. 3, no. 3-4, pp. 175–
[67] D. Zielińska, A. Rzepkowska, A. Radawska, and K. Zieliński, “In
185, 2011.
vitro screening of selected probiotic properties of Lactobacillus
strains isolated from traditional fermented cabbage and cucum- [81] P. Markowiak, K. Slizewska, and K. Śliżewska, “The role of
ber,” Current Microbiology, vol. 70, no. 2, pp. 183–194, 2015. probiotics, prebiotics and synbiotics in animal nutrition,” Gut
[68] J. S. Oliveira, K. Costa, L. B. Acurcio et al., “In vitro and in Pathogens, vol. 10, no. 1, p. 21, 2018.
vivo evaluation of two potential probiotic lactobacilli isolated [82] A. Billiet, I. Meeus, M. Cnockaert et al., “Effect of oral admin-
from cocoa fermentation (Theobroma cacao L.),” Journal of istration of lactic acid bacteria on colony performance and gut
Functional Foods, vol. 47, pp. 184–191, 2018. microbiota in indoor-reared bumblebees (Bombus terrestris),”
[69] M. Giles-Gómez, J. G. S. Garcı́a, V. Matus, I. C. Quintana, Apidologie, vol. 48, no. 1, pp. 41–50, 2017.
F. Bolı́var, and A. Escalante, “In vitro and in vivo probiotic [83] J. A. Interaminense, J. L. Vogeley, C. K. Gouveia et al., “In
assessment of Leuconostoc mesenteroides P45 isolated from vitro and in vivo potential probiotic activity of Bacillus subtilis
pulque, a Mexican traditional alcoholic beverage,” SpringerPlus, and Shewanella algae for use in Litopenaeus vannamei rearing,”
vol. 5, no. 1, 2016. Aquaculture, vol. 488, pp. 114–122, 2018.
[70] A. Oh, E. B.-M. Daliri, and D. H. Oh, “Screening for potential [84] X.-H. Guo, J.-M. Kim, H.-M. Nam, S.-Y. Park, and J.-M.
probiotic bacteria from Korean fermented soybean paste: In Kim, “Screening lactic acid bacteria from swine origins for
vitro and Caenorhabditis elegans model testing,” LWT- Food multistrain probiotics based on in vitro functional properties,”
Science and Technology, vol. 88, pp. 132–138, 2018. Anaerobe, vol. 16, no. 4, pp. 321–326, 2010.
[85] M. S. Shin, S. K. Han, A. R. Ji, K. S. Kim, and W. K. Lee, “Isolation [100] G. P. Martino, M. Espariz, G. G. Nizo, L. Esteban, V. S. Blancato,
and characterization of bacteriocin-producing bacteria from and C. Magni, “Safety assessment and functional properties
the gastrointestinal tract of broiler chickens for probiotic use,” of four enterococci strains isolated from regional Argentinean
Journal of Applied Microbiology, vol. 105, no. 6, pp. 2203–2212, cheese,” International Journal of Food Microbiology, vol. 277, pp.
2008. 1–9, 2018.
[86] D.-H. Kim and B. Austin, “Characterization of probiotic [101] S. Ruiz-Moyano, A. Martı́n, M. J. Benito, F. P. Nevado, and
carnobacteria isolated from rainbow trout (Oncorhynchus M. d. G. Córdoba, “Screening of lactic acid bacteria and bifi-
mykiss) intestine,” Letters in Applied Microbiology, vol. 47, no. dobacteria for potential probiotic use in Iberian dry fermented
3, pp. 141–147, 2008. sausages,” Meat Science, vol. 80, no. 3, pp. 715–721, 2008.
[87] M. S. R. Rajoka, H. Zhao, Y. Lu et al., “Anticancer potential [102] D. Vasilev, B. Aleksic, A. Tarbuk et al., “Identification of
against cervix cancer (HeLa) cell line of probiotic Lactobacillus lactic acid bacteria isolated from serbian traditional fermented
casei and Lactobacillus paracasei strains isolated from human sausages sremski and lemeski kulen,” Procedia Food Science, vol.
breast milk,” Food & Function, vol. 9, no. 5, pp. 2705–2715, 2018. 5, pp. 300–303, 2015.
[88] R. Arroyo, V. Martı́n, A. Maldonado, E. Jiménez, L. Fernández, [103] T. Kuda, M. Kawahara, M. Nemoto, H. Takahashi, and B.
and J. M. Rodrı́guez, “Treatment of infectious mastitis during Kimura, “In vitro antioxidant and anti-inflammation properties
lactation: Antibiotics versus oral administration of lactobacilli of lactic acid bacteria isolated from fish intestines and fer-
isolated from breast milk,” Clinical Infectious Diseases, vol. 50, mented fish from the Sanriku Satoumi region in Japan,” Food
no. 12, pp. 1551–1558, 2010. Research International, vol. 64, pp. 248–255, 2014.
[89] R. Martı́n, S. Langa, C. Reviriego et al., “Human milk is a source [104] R. Senthong, S. Chanthachum, and P. Sumpavapol, “Screening
of lactic acid bacteria for the infant gut,” Journal of Pediatrics, and identification of probiotic lactic acid bacteria isolated from
vol. 143, no. 6, pp. 754–758, 2003. Poo-Khem,” in Proceedings of the Nutrition and Food Sciences,
[90] L. Fernández, S. Langa, V. Martı́n et al., “The human milk vol. 39, pp. 111–115, 2012.
microbiota: origin and potential roles in health and disease,” [105] N. Tajabadi, M. Mardan, M. Y. A. Manap, and S. Mustafa,
Pharmacological Research, vol. 69, no. 1, pp. 1–10, 2013. “Molecular identification of Lactobacillus spp. isolated from the
[91] F. Patrignani, R. Lanciotti, J. M. Mathara, M. E. Guerzoni, honey comb of the honey bee (Apis dorsata) by 16S rRNA gene
and W. H. Holzapfel, “Potential of functional strains, isolated sequencing,” Journal of Apicultural Research, vol. 52, no. 5, pp.
from traditional Maasai milk, as starters for the production of 235–241, 2013.
fermented milks,” International Journal of Food Microbiology, [106] A. A. Hamdy, N. A. Elattal, M. A. Amin et al., “In vivo
vol. 107, no. 1, pp. 1–11, 2006. assessment of possible probiotic properties of Bacillus subtilis
[92] T. Ya, Q. Zhang, F. Chu et al., “Immunological evaluation of and prebiotic properties of levan,” Biocatalysis and Agricultural
Lactobacillus casei Zhang: A newly isolated strain from koumiss Biotechnology, vol. 13, pp. 190–197, 2018.
in Inner Mongolia, China,” BMC Immunology, vol. 9, article no. [107] Z. Cao, H. Pan, H. Tong et al., “In vitro evaluation of pro-
68, 2008. biotic potential of Pediococcus pentosaceus L1 isolated from
[93] Z. Sun, W. Liu, W. Gao et al., “Identification and character- paocai—a Chinese fermented vegetable,” Annals of Microbiol-
ization of the dominant lactic acid bacteria from kurut: The ogy, vol. 66, no. 3, pp. 963–971, 2016.
naturally fermented yak milk in Qinghai, China,” The Journal of [108] M. R. Swain, M. Anandharaj, R. C. Ray, and R. P. Rani,
General and Applied Microbiology, vol. 56, no. 1, pp. 1–10, 2010. “Fermented fruits and vegetables of Asia: a potential source
of probiotics,” Biotechnology Research International, vol. 2014,
[94] A. B. Shori, “Camel milk and its fermented products as a source
Article ID 250424, 19 pages, 2014.
of potential probiotic strains and novel food cultures: A mini
review,” PharmaNutrition, vol. 5, no. 3, pp. 84–88, 2017. [109] A. Adesulu-Dahunsi, K. Jeyaram, and A. Sanni, “Probiotic and
technological properties of exopolysaccharide producing lactic
[95] W. L. G. de Almeida Júnior, Í. D. S. Ferrari, J. V. de Souza, C. D.
acid bacteria isolated from cereal-based nigerian fermented
A. da Silva, M. M. da Costa, and F. S. Dias, “Characterization
food products,” Food Control, vol. 92, pp. 225–231, 2018.
and evaluation of lactic acid bacteria isolated from goat milk,”
Food Control, vol. 53, pp. 96–103, 2015. [110] N. Sharma, N. Yadav, H. Bhagwani, D. Chahar, and B. Singh,
“Screening of lactic acid bacteria from effluent samples of jaipur
[96] A. A. Bengoa, L. Zavala, P. Carasi et al., “Simulated gastroin-
dairy,” International Journal of Waste Resources, vol. 8, no. 332,
testinal conditions increase adhesion ability of Lactobacillus
p. 2, 2018.
paracasei strains isolated from kefir to Caco-2 cells and mucin,”
Food Research International, vol. 103, pp. 462–467, 2018. [111] D. Zielińska, E. Długosz, and A. Zawistowska-Deniziak,
“A Probiotics and Antimicrobial Proteins,” https://doi.org/
[97] C. Caggia, M. De Angelis, I. Pitino, A. Pino, and C. L. Randazzo,
10.1007/s12602-018-9458-z, 2018.
“Probiotic features of Lactobacillus strains isolated from Ragu-
sano and Pecorino Siciliano cheeses,” Food Microbiology, vol. 50, [112] L. Fontana, M. Bermudez-Brito, J. Plaza-Diaz, S. Muñoz-
pp. 109–117, 2015. Quezada, and A. Gil, “Sources, isolation, characterisation and
evaluation of probiotics,” British Journal of Nutrition, vol. 109,
[98] S. C. Ribeiro, C. Stanton, B. Yang, R. P. Ross, and C. C. G. Silva,
no. supplement 2, pp. S35–S50, 2013.
“Conjugated linoleic acid production and probiotic assessment
of Lactobacillus plantarum isolated from Pico cheese,” LWT-
Food Science and Technology, vol. 90, pp. 403–411, 2018.
[99] S. Grigoryan, I. Bazukyan, and A. Trchounian, “Aggregation
and adhesion activity of lactobacilli isolated from fermented
products in vitro and in vivo: a potential probiotic strain,”
Probiotics and Antimicrobial Proteins, vol. 10, no. 2, pp. 269-267,
2017.
Hindawi
https://doi.org/10.1155/2018/6104015
Research Article
Multiplex Real-Time Polymerase Chain Reaction for
Simultaneous Quantification of Salmonella spp., Escherichia
coli, and Staphylococcus aureus in Different Food Matrices:
Advantages and Disadvantages
Amanda Teixeira Sampaio Lopes,1 George Rêgo Albuquerque,1,2

and Bianca Mendes Maciel 1,3
1
Graduation Program in Animal Science, Santa Cruz State University, Ilhéus (BA), Brazil
2
Department of Agricultural and Environmental Sciences, Santa Cruz State University, Ilhéus (BA), Brazil
3
Department of Biological Sciences, Santa Cruz State University, Ilhéus (BA), Brazil
Correspondence should be addressed to Bianca Mendes Maciel; bmmaciel@uesc.br
Received 3 August 2018; Accepted 6 September 2018; Published 25 September 2018
Copyright © 2018 Amanda Teixeira Sampaio Lopes et al. This is an open access article distributed under the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is
properly cited.
Quantitative real-time polymerase chain reactions (qPCRs) of the most prevalent bacteria causing foodborne diseases worldwide,
such as Salmonella spp., Escherichia coli, and Staphylococcus aureus, can be an important tool for quantitative microbial risk
assessment, which requires numerical data to determine the level of contamination at a specific stage of food production. However,
most of qPCR assays described in the literature for these pathogens are qualitative; their objective is pathogen detection and not
pathogen quantification. Thus, the aim of our work was to develop a qPCR for the simultaneous quantification of Salmonella spp.,
E. coli, and S. aureus and to propose its use in the analysis of foods, as a tool for microbiological quality monitoring. For this, a
multiplex qPCR was standardized for the simultaneous quantification of specific fragments of target genes (ssf, phoA, and nuc)
corresponding to each one of the mentioned bacteria. The limit of detection of the technique was 13, 10, and 12 gene copies for
ssf, phoA, and nuc, respectively; standard curves showed R2 > 0.99, with efficiencies ranging from 99 to 110%, and inter- and
intraexperiment reproducibility presented a low coefficient of variation in all trials. This methodology was applied in different food
matrices (milk, ground beef, and oyster meat), and the results were compared with official microbiological culture methodology
and with ready-to-use test. Advantages and disadvantages of each methodology used in this study are pointed out. We suggest that
this multiplex qPCR can be used as a rapid screening technique for the analysis of food microbiological quality.
1. Introduction States [3] and in Brazil [4]. In 2016, the CDC estimated the
number of illnesses, hospitalizations, and deaths from FBD in
Foodborne diseases (FBDs) constitute a serious public health the United States; Salmonella spp. (nontyphoid) and S. aureus
problem worldwide, owing to the significant morbidity and were among the prevailing pathogens related to illnesses,
mortality rates associated with FBDs. The Centers for Disease holding the second and fifth places, respectively. Concerning
Control and Prevention (CDC) estimates that, each year, hospitalizations, infections by Salmonella and E. coli (STEC
approximately 48 million Americans are infected, 128 000 are 0157) occupied the first and fifth places, respectively, and,
hospitalized, and 3000 die from FBDs [1]. Salmonella spp., among the FBDs resulting in death, Salmonella occupied
Escherichia coli, and Staphylococcus aureus are among the the first place [3]. In Brazil, research carried out between
ten most common bacteria causing notified bacterial FBD the years 2000 and 2016 confirmed that, among the 11.477
globally [2] and are also in the list of the main causes of notified outbreaks of FBDs, 1627 were caused by Salmonella
diseases, hospitalizations, and deaths from FBD in the United spp. (14.2% of the total), 865 by S. aureus (7.5%), and 749 by
E. coli (6.5%) [4, 5]. However, the true incidence is difficult to the Easy DNA Extraction Kit (Invitrogen, Carlsbad, CA,
determine owing to subnotification and nonidentification of USA). The DNA from each strain was quantified at 260
the cause of the outbreaks. and 280 nm using the Nano Drop 2000 spectrophotometer
In addition to providing information on the epidemio- (Thermo Scientific, Waltham, MA, USA) and was then used
logical relevance of pathogens in FBDs, the quantification in conventional PCR to amplify the target gene of each strain
of these pathogens in foods can provide information about and produce the qPCR standard curve.
feedstock quality and about the possible failures during food
processing. For example, the presence of these microorgan- 2.2. Amplification of Target Genes. A conventional PCR
isms can indicate fecal contamination of human or animal was performed using specific primers for the target genes
origin (E. coli) and presence of pathogens (Salmonella spp.) of each bacterium (Table 1) in individual reactions. The
and can further indicate inadequate sanitary conditions dur- amplifications were performed in a final volume of 50 𝜇L
ing the processing of the product (S. aureus). Thus, methods containing 0.2 𝜇M of each primer (forward and reverse,
that rapidly quantify these pathogens in real time can be used Table 1), 0.2 mM dNTPs, 1.5 𝜇M MgCl2, 2.0 U Taq DNA
as a tool for quality management focused on food safety. Polymerase (Invitrogen), PCR 1X buffer, and 3 𝜇L of DNA.
Currently, food safety not only is a concern to public health, Sterile ultrapure water (DNase- and RNase-free) was added
but also corresponds to a competitive advantage in the food to reach a final reaction volume of 50 𝜇L. The reactions were
industries, because a consumer who is more interested and performed in a Proflex PCR thermal cycler system (Applied
concerned about the quality of consumed products presses Biosystems, Life Technologies, Carlsbad, CA, USA) using the
the market to offer quality products and services [9]. following program: one cycle of 94∘ C for 5 min, 32 cycles
In recent years, the food industries have adopted methods of 94∘ C for 60 s, 58∘ C for 30 s, and 72∘ C for 60 s, and one
used as microbiological quality management tools for the cycle of 72∘ C for 10 min. The PCR products were visualized
rapid detection of FBD-causing microorganisms and dete- after 1% agarose gel electrophoresis by staining with Sybr Safe
riorating organisms [10]. To obtain quick results and enable (Invitrogen). Subsequently, the PCR products were purified
the handling of several samples in the same analysis, various using a PureLink Quick Extraction Kit (Invitrogen) and
methods have been developed in recent decades, comprised quantified using the Nano Drop 2000 spectrophotometer
of many different detection technologies based on culture (Thermo Scientific).
with differential plating media, serological, and molecular
techniques. Among them, the quantitative polymerase chain 2.3. Production of Standard Curves. The purified products
reaction (qPCR) is a sensitive method that quantifies the of target gene amplifications for each bacterial strain were
number of pathogens in a sample through the quantification diluted to 20 ng/𝜇L and the gene copy numbers were deter-
of bacterial DNA in real time. When compared to other mined by the formula:
tests used for microbial contamination analysis in foods,
qPCR is considered more sensitive and specific. Furthermore, Gene copy number = Amount of DNA (𝜇g) × 6.022 ×
through this method, it is possible to perform multiplex 1023 /DNA fragment (bp) × 106 × 650.
testing, allowing the simultaneous quantification of more
than one pathogen in a single reaction [11, 12], thus making it Standard curves used in qPCR were built using serial dilu-
an important tool for food analysis. tions (10X) of the target genes from each strain, as follows: ssf
Thus, this study aimed to standardize the qPCR technique Salmonella (8.64 × 101 to 8.64 × 106 copies), phoA E. coli (7.2
for the simultaneous quantification of Salmonella spp., E. coli, × 101 to 7.2 × 105 copies), and nuc S. aureus (1.3 × 101 to 1.3 ×
and S. aureus, through the development of a multiplex test, 106 copies).
thus proposing its use for food analysis. This methodology
was applied in different food matrices (milk, beef, and oyster 2.4. Multiplex qPCR for Simultaneous Quantification of
meat), and the results were compared with microbiological Salmonella spp., E. coli, and S. aureus. Multiplex qPCR
culture methodologies, such as the official culture method was performed using TaqMan Fast Advanced Master Mix
(performed according to the Brazilian legislation) and the (Invitrogen) for the simultaneous quantification of the three
ready-to-use test Compact Dry. pathogens.
The multiplex qPCR was performed in an AB 7500
2. Materials and Methods Fast (Applied Biosystems) using TaqMan. MGB probes
and primers (Table 1) were designed using software Primer
2.1. Bacterial Strains. Strains of Salmonella enterica serovar Express, version 3.0 (Life Technologies).
Enteritidis PT4, E. coli (INCQS 00033), and S. aureus (INCQS Amplifications were performed at a final volume of 20 𝜇L
00186) obtained from the microbial culture collection of containing 2.0 𝜇L of DNA corresponding to each point of the
the National Institute of Health Quality Control (INCQS, curve, 10.0 𝜇L of TaqMan Fast Advanced Master Mix reagent
Instituto Nacional de Controle de Qualidade em Saúde) (Invitrogen), and forward and reverse primers at a concen-
of Oswaldo Cruz Foundation/RJ were used in this study. tration of 5 𝜇M. For the Salmonella and E. coli amplifications,
An isolated colony of each microorganism was inoculated 0.5 𝜇L of specific primers was used in each reaction, and
in 1.0 mL of tryptic soy broth (TSB; HiMedia, Mumbai, for the S. aureus amplification, 0.4 𝜇L of primers was used.
India) and incubated at 37∘ C for 18–24 h. This bacterial In addition, 0.5 𝜇L of each MGB TaqMan probe specific for
suspension was then used for genomic DNA extraction using Salmonella (FAM) and E. coli (NED) and 0.4 MGB TaqMan
Table 1: Primers and probes used in PCR and qPCR.

Target gene
Reference strain Primes 1 (5󸀠 -3󸀠 )a bp Reference Primers 2 (5󸀠 -3󸀠 ) and Probesb bp
(GenBank accession no.)
Escherichia coli F:GGTAACGTTTCTACCGCAGAGTTG 468 Shome et al. F: CCGGGTAACGCTCTGGAA 54
phoA
ATCC 25922 2011 [6] R: AAGCAGCTGTTCGGTAATCGA
(FJ546461) R:CAGGGTTGGTACACTGTCATTACG
INCQS 00033 P:AAGGCGGAAAAGG
Salmonella Salmonela specific fragment: (ssf) Aabo et al. F: CGGCGAATTTTTGCGACTAT 59
F (ST15): GGTAGAAATTCCCAGCGGGTACTG 429
Enteritidis PT4 patent EP0707659 A1 1993 [7] R: TGGCTTCGCTTTATGTTCGA
(IOC) (AE006468.1:fragment 1409127 to
R (ST11): AGCCAACCATTGCTAAATTGGCGCA P: AGGTTACCGTGGAGGC
1409555)
S. aureus F: GCGATTGATGGTGATACGGTT 276 Brakstad et F:GGTCAACCAATGACATTCAGACTATT 82
nuc : nuclease
ATCC 6538 al., 1992 [8] R: GCCATATTTCTCTACACCTTTTTTAG
(NC 002758.2) R: CAAGCCTTGACGAACTAAAGC
INCQS 00186 P: TGATACACCTGAAACAAA
a
Used in the conventional PCR to amplify the target gene. The PCR product was used to build the standard curve of the qPCR.
b
Designed in this study through Primer Express Software For Real-Time PCR, version 3.0 (Applied Biosystems).
3
probe for S. aureus (VIC) were used at a concentration Brazil). For multiplex qPCR analyses, 1.0 g of each sample
of 5 𝜇M. Sterile ultrapure water (DNase- and RNase-free) food was used for DNA extraction using the Easy DNA
was then added to reach a final volume of 20 𝜇L. Each run extraction Kit (Invitrogen). The DNA samples were quanti-
consisted of one cycle at 50∘ C for 2 min, one cycle at 95∘ C for fied using the Nano Drop 2000 (Thermo Scientific) and were
20 s, and 45 cycles at 95∘ C for 3 s and 60∘ C for 30 s. diluted to 50 ng/𝜇L. The DNA (2 𝜇L) was used to estimate
gene copy numbers for each bacterial strain through qPCR,
2.5. Sensitivity, Specificity, and Reproducibility of qPCR. To using TaqMan multiplex reactions, as described previous-
evaluate intra- and interassay reproducibility, the average of ly.
the cycle threshold (CT ), the standard deviation (CT SD), For microbiological culture analyses, 25 g (or 25 mL)
and the coefficient of variation (CV) were calculated in five of each food homogenate was mixed with 225 mL of 0.1%
different reactions, including three replicates of each target peptone water (Acumedia). The mixtures were homogenized
gene, using known concentrations of 105 to 101 copies of each again and 10-fold serially diluted in triplicate. The samples
target gene. were analyzed using rapid identification kits (Compact Dry,
The limit of detection of each gene was determined HyServe GmbH & Co. KG, Uffing, Germany), according to
using 1:2 serial dilutions as follows: ssf Salmonella (864, 432, the manufacturer’s instructions, to enumerate total coliforms
216, 108, 54, 27, 13.5, and 6.75 gene copy numbers), phoA and Escherichia coli (Compact Dry EC) and Staphylococcus
E. coli (396, 198, 99, 41.5, 24.75, 12.38, and 6.19 gene copy aureus (Compact Dry XSA) and detect Salmonella spp.
numbers), and nuc S. aureus (671, 355.5, 167.75, 83.87, 41.93, (Compact Dry SL). Analyses were also performed accord-
20.96, 10.48, and 5.24 gene copy numbers). In order to ing to the Brazilian legislation described in the Normative
confirm the specificity of the primers and probes used in Instruction No. 62 of August 26, 2003, of the Ministry of
qPCR, the sequences of target genes were initially aligned Agriculture, Livestock and Supply that addressed the Official
using the Basic Local Alignment Search Tool (BLASTn) Analytical Methods for Microbiological Analysis of Products
(http://blast.ncbi.nlm.gov/Blast.cgi) to check the similarity of Animal Origin and of Water [13] that is in accordance with
with sequences available in the database. “Compendium of Methods for the Microbiological Exam-
ination of Foods” of American Public Health Association
2.6. Determination of Gene Copy Number in a Single Bacterial (APHA), as described below.
Colony-Forming Unit (cfu). The bacterial strains were inocu-
lated on tryptic soy agar plates (TSA; HiMedia) and incubated Enumeration of Coliforms and E. coli. The total coliform and E.
at 37∘ C for 18–24 h. After this period, a colony of each bac- coli counts were determined by plating the samples on solid
terium was used for the TaqMan qPCR, as described above. medium. Aliquots (1 mL) of each dilution were cultured on
The colonies of Salmonella and E. coli were used directly in violet red bile agar (VRBA; HiMedia) and the plates were
the reaction. For S. aureus, one colony was first transferred incubated at 35∘ C for 18–24 h. Five presumptive colonies were
to a microtube containing 10 𝜇L of sterile ultrapure water and picked and each was transferred to a tube containing brilliant
subjected to heating at 100∘ C for approximately 15 min in a green lactose broth (BGLB; HiMedia), and incubated at 35∘ C.
dry water bath (Loccus Biotecnologia, Cotia, SP, Brazil) until The tubes were examined at 24 and 48 h for gas production
all the water evaporated; the remaining content was used in and to determine the coliform count at 35∘ C. One aliquot of
the reaction. The experiments were carried out in triplicate. each gas-positive tube was cultured in EC broth (HiMedia)
and incubated at 45∘ C. The tubes were also examined at 24 h
2.7. Application of Multiplex qPCR Technique and Microbi- for gas production and to determine the coliform count at
ological Culture Methodologies for Salmonella spp., E. coli, 45∘ C. One aliquot of each gas-positive tube was cultured in
and S. aureus Quantification in Different Food Matrices. eosin methylene blue agar (EMB; HiMedia) and incubated at
Three different food matrices (ground beef, milk, and oyster 45∘ C for 24 h. The suspect colonies were counted and tested
meat) were used to compare multiplex qPCR technique with by specific biochemical analysis (indole, methyl red, Voges-
microbiological culture methodologies, such as the official Proskauer, and Simon citrate test) to confirm the presence of
culture method (performed according to the Brazilian leg- E. coli.
islation) and the rapid test Compact Dry (HyServer), for
Salmonella spp., Escherichia coli, and Staphylococcus aureus Enumeration of Staphylococcus aureus. One milliliter of each
quantifications. Figure 1 shows a schematic summary of the dilution was divided on the surface of three Baird-Parker
methodological procedure. (BP; Acumedia Neogen do Brasil, Indaiatuba, SP, Brazil) agar
One colony of Salmonella enterica serovar Enteritidis plates. The plates were incubated at 35∘ C for 48 h and five
phage type 4 and Escherichia coli were inoculated separately presumptive colonies were selected for catalase, coagulase,
in 10 mL TSB (HiMedia) and one colony of Staphylococcus and thermostable DNase tests.
aureus was inoculated in 10 mL Brain Heart Broth (BHI;
HiMedia). The bacterial suspensions were incubated at Detection of Salmonella spp. For detection of Salmonella
37∘ C/18 h under constant agitation (130 rpm). One mL of spp., 25 g of the sample was mixed with 225 mL of buffered
each culture (approximately 5 × 108 cfu) was inoculated peptone water and incubated at 37∘ C. After 24 h, 1 mL was
together in each food matrix (1 Kg sterile ground beef, 1L transferred from each tube to 9 mL selenite-cystine (SC;
UHT milk, and 1 Kg sterile oyster meat) and then, the food Merck KGaA, Darmstadt, Germany) broth and Rappaport-
was homogenized for 5 min in a tissue mixer (Novatecnica, Vassiliadis (RV; Merck) broth and incubated at 43∘ C for 24 h.
[1] One colony of Salmonella in 10 mL TSB;

[2] One colony of E. coli in 10 mL TSB;
[3] One colony of S. aureus in 10 mL BHI
∘
 C / 18 h
1 2 3
SIMULTANEOUS BACTERIAL QUANTIFICATION

1 mL of each microorganism (≅2 x 10 8 cfu)
10
MOLECULAR METHOD
1
0.1
0.01
ΔRn
0.001
0.0001
0.00001
0.000001
0.0000001
DIRECT 0 2 4 6 8 10 12 14 16 18 20 22 24
Cycle
26 28 30 32 34 36 38 40 42 44
1 Kg sterile ground beef 1L UHT milk 1 Kg sterile oyster meat DNA EXTRACTION MULTIPLEX qPCR
(2 hours)
25 g + 225 mL BPW 25 mL + 225 mL BPW 25 g + 225 mL BPW
Salmonella identification E. coli counting S. aureus counting
37 ∘ C/ON Serial dilutions Serial dilutions
CULTURE BASED METHODS

TRADITIONAL CULTURE COMPACT DRY SL TRADITIONAL CULTURE COMPACT DRY EC TRADITIONAL CULTURE COMPACT DRY SA
(5 days) (2 days) (5 -6 days) (1 day) (3-4 days) (1 day)
VRBA BP Agar
35∘ C / ON
RV and SC ∘
35 C / 48 h
Broth
BGLB Broth
∘
 C / ON
∘
37 C / ON 35∘ C / ON 37∘ C / ON 37∘ C / ON
BHI Broth
XLD
SS Biochemical tests EC Broth Biochemical tests
HE and PCR confirmation 45∘ C / ON ∘ (24-48 h)
35 C / ON
37∘ C / ON (24-48 h)
EMB Biochemical tests

∘
45 C / ON (24-48 h)
Figure 1: Schematic summary of the methodological procedure for artificial bacterial inoculation in different food matrices and comparison
of multiplex qPCR technique with microbiological culture methodologies for Salmonella spp. detection, Escherichia coli, and Staphylococcus
aureus quantification (see Material and Methods).
A sample (1 mL) from each broth was plated onto xylose- 1.25 mM MgCl2 , 200 𝜇M each deoxyribonucleoside triphos-
lysine deoxycholate (XLD; Acumedia), Hektoen Enteric (HE; phate (Invitrogen), 10 pmol sense and anti-sense primers
HiMedia), and Salmonella-Shigella (SS; Merck) agars. The (Invitrogen), 1.25 U Taq DNA polymerase (Invitrogen),
plates were incubated overnight at 37∘ C. Typical colonies and one suspected Salmonella colony. The volume of the
were submitted to biochemical screening on triple sugar iron reaction mixture was made up with ultrapure water. The
agar (TSI; HiMedia), lysine iron agar (LIA; HiMedia), and amplification cycle consisted of an initial denaturation step
urea agar (UA; Merck). The presence of Salmonella spp. was at 94∘ C for 5 min, followed by 35 cycles of 94∘ C for 30 s,
confirmed by testing presumptive colonies using two sets 60∘ C for 30 s, and 72∘ C for 1 min, and a final extension step
of primers to amplify a conserved region for Salmonella at 72∘ C for 10 min. The PCR products were visualized by
genus: ST11 (5󸀠 -AGCCAACCATTGCTAAATTGGCGCA-3󸀠 ) loading 5 𝜇L suspension onto 1% agarose gel, staining with
and ST15 (5󸀠 -TTTGCGACTATCAGGTTACCGTGG-3󸀠 ) [1]. SYBR Safe (Invitrogen), and examining the same under UV
The 25 𝜇l PCR mixture contained 1X PCR buffer (Invitrogen), light.
Table 2: Inter- and intra-assay reproducibility of qPCR.
Intra-assay Reproducibilitya Interassay Reproducibilityb

Gene copy numbers
Ct (average) SD CV (%) Ct (average) SD CV (%)
Salmonella (ssf)
8.62 × 106 26.86 0.58 2.10 26.36 0.06 0.20
8.62 × 105 30.29 0.53 1.00 29.86 0.20 0.60
8.62 × 104 33.83 0.35 1.00 33.53 0.17 0.50
8.62 × 103 36.47 0.29 0.80 36.22 0.04 0.10
8.62 × 102 39.71 0.13 0.30 39.62 0.02 0.05
8.62 × 101 42.54 0.70 1.00 42.54 0.70 1.00
Escherichia coli (phoA)
7.92 × 105 21.67 0.97 4.00 20.83 0.02 0.10
7.92 × 104 24.99 0.80 3.00 24.29 0.001 0.01
7.92 × 103 29.00 0.89 3.00 28.23 0.03 0.10
7.92 × 102 31.65 1.08 3.00 30.72 0.21 0.70
7.92 × 101 34.39 0.47 1.00 33.97 0.001 0.02
Staphylococcus aureus (nuc)
1.30 × 105 25.67 1.93 6.00 25.08 0.10 0.40
1.30 × 104 28.83 1.44 4.00 28.19 0.04 0.10
1.30 × 103 31.66 0.62 1.00 31.29 0.03 0.10
1.30 × 102 34.70 0.37 1.00 34.79 0.05 0.10
1.30 × 101 37.59 0.16 0.40 40.80 0.14 0.03
a
Average between three replicates.
b
Average between five different reactions.
Ct: cycle threshold; SD: standard deviation; CV: coefficient of variation.
Table 3: Specific gene copy numbers in one colony-forming unit (cfu) through TaqMan qPCR.
Microorganism (target gene) Cta SD CV (%) Gene copy number/cfua

Salmonella (ssf) 58.78 0.20 0.34 2.10 × 108
Escherichia coli (phoA) 46.94 0.28 0.60 1.28 × 107
Staphylococcus aureus (nuc) 47.48 0.64 1.37 7.9 × 1011
a
Average between three replicates.
Ct: cycle threshold; SD: standard deviation; CV: coefficient of variation.
2.8. Statistical Analysis. The average and standard deviations for ssf (Salmonella), phoA (E. coli), and nuc (S. aureus) genes,
of bacterial quantities detected by all tests were calculated, respectively.
submitted to variance analysis (one-way ANOVA), and Through the BLASTn Program, all sequences amplified by
compared by Tukey’s test. For the comparison of variances, the primers described in this study showed 100% similarity
Bartlett’s test was used. The values of p ≤ 0.05 were considered with Salmonella (AE 006468.2), E. coli (FJ546461), and S.
statistically significant. Data were analyzed using the Software aureus (AP 017320.1).
GraphPad Prism, version 5.03 (San Diego, CA, USA). The coefficients of variation (CV) of the intra- and
interassays were statistically low. The CV of the interassay
was 0.41% for Salmonella, 0.19% for E. coli, and 0.15% for S.
3. Results
aureus (Table 2). For the intra-assay, the CV was 1.03% for
3.1. Standard Curves. In qPCR reactions, the linear corre- Salmonella, 2.8% for E. coli, and 2.5% for S. aureus (Table 2).
lation coefficient (𝑅2 ) of the standard curves of the three
microorganisms was high: 0.998 for Salmonella, 0.992 for E. 3.3. Determination of Gene Copy Numbers in One Bacterial
coli, and 0.999 S. aureus. The amplification curve presented Colony-Forming Unit (cfu). Quantification of the nuc gene in
an Eff of 99.033% for Salmonella, 106.79% for S. aureus, and one cfu of S. aureus showed there were 7.9 × 1011 copies/ cfu.
110.74% for E. coli (Figure 2). The phoA gene was present in 1.28 × 107 copies/ cfu in E. coli,
and ssf was present in 2.10 × 108 copies/ cfu in Salmonella. The
3.2. Sensitivity, Specificity, and Reproducibility of qPCR. In CV between triplicates was less than 1.4% in all amplifications
qPCR reactions, the limit of detection was 13, 10, and 12 copies (Table 3).
10 Limit of detection:
Salmonella (ssf) 43 13.5 copies
42 1
1
41
40
0.1 39 2
6 5 4 3 2 1 38
0.01 37
36
35 3
ΔRn
0.001
＃４
34
33
0.0001 32 4
31
0.00001 30
29 5
0.000001 28
27
26 6
0.0000001
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 10 20 30 100200 1000 10000 100000 1000000 10000000 100000000
Quantity
Eff: 99.033% Cycle  : 0.998
(a)
34.5 Limit of detection:
E. coli (phoA) 34.0 12.38 copies
33.5
0.1 33.0 1
32.5
32.0
5 4 3 2 1 31.5
31.0
0.01 30.5
30.0 2
29.5
29.0
28.5
0.001 28.0
ΔRn
27.5
＃４
3
27.0
26.5
26.0
0.0001 25.5
25.0
24.5
24.0
23.5 4
0.00001 23.0
22.5
22.0
21.5
21.0
20.5
0.000001 5
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 10 20 30 100 200 1000 10000 100000 1000000 10000000
 Quantity
Eff: 110.74 % Cycle  : 0.992
(b)
1
S. aureus (nuc) 41 Limit of detection:
40 1
10.48 copies
39
0.1
38
6 5 4 3 2 1
37 2
0.01 36
35
34 3
33
ΔRn
＃４
0.001
32
31
4
0.0001 30
29
28
5
0.00001 27
26
25
0.000001 6
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 1 2 3 4 5 10 20 30 100 200 1000 10000 100000 1000000
Cycle Quantity
Eff: 106.79%  : 0.999
(c)
Figure 2: Amplification curves (left) and standard curves through TaqMan qPCR of serial dilutions of target genes. Copy numbers of each
gene: (a) ssf from Salmonella spp. (8.64 × 106 to 8.64 × 101 ); (b) phoA from Escherichia coli (7.2 × 105 to 7.2 × 101 ); (c) nuc from Staphylococcus
aureus (1.3 × 105 to 1.3 × 100 ).
3.4. Comparison between Multiplex qPCR and Microbiological in milk and ground beef samples, although the difference
Culture Methodologies for Salmonella spp. Detection, E. coli, in approximately one log in bacterial quantity was detected.
and S. aureus Quantification in Different Food Matrices. In these food matrices, both tests presented significant
No statistically significant difference was observed in the difference when compared with Compact Dry (Figures 3(a)
comparison between the averages of E. coli and S. aureus and 3(b)). The same was observed for S. aureus quantification
quantities detected by multiplex qPCR and traditional culture in oyster meat (Figure 3(c), right). However, for E. coli
E coli S. aureus
07
10 07 B 10 B
A A
10 06 10 06
Bacterial quantity
Bacterial quantity
A A
10 05 10 05
10 04 10 04
10 03 10 03
10 02 10 02
Multiplex qPCR
Traditional culture
Compact Dry
Multiplex qPCR
Traditional culture
Compact Dry
(a)
E coli S. aureus
B B
07
10 10 07
A
10 06 A
Bacterial quantity
Bacterial quantity
10 06 A
A
10 05 10 05
10 04 10 04
10 03 10 03
10 02 10 02
Multiplex qPCR
Traditional culture
Compact Dry
Multiplex qPCR
Traditional culture
Compact Dry
(b)
E coli S. aureus B
1007 A 1007
A A
B
1006 1006
Bacterial quantity
Bacterial quantity
1005 1005
1004 1004
1003 1003
1002 1002
Multiplex qPCR
Traditional culture
Compact Dry
Multiplex qPCR
Traditional culture
Compact Dry
(c)
Figure 3: Average between Escherichia coli (in the left) and Staphylococcus aureus (in the right) quantities detected by multiplex qPCR assay,
traditional culture method, and Compact Dry after artificial bacterial inoculation in UHT milk (a), sterile ground beef (b), and sterile oyster
meat (c). In qPCR, the gene copy numbers (phoA for E. coli and nuc for S. aureus) determined the bacterial quantities. In traditional culture
and Compact Dry methodologies, colony-forming unit (cfu/g or cfu/mL) determined the bacterial quantities in food. Different letters mean
statistical difference by Tukey’s test (p ≤ 0.05).
quantification in this food matrix, the traditional culture gene copy numbers in one cfu was necessary, mainly because
showed significant difference when compared with multiplex we did not use any methodology to enrich the food samples;
qPCR and Compact Dry (Figure 3(c), left). therefore, we could predict the contamination level of the
For Salmonella spp. quantification through multiplex food earlier, even before the bacteria grew to form colonies.
qPCR, the averages of the ssf copy numbers were 5 log10 , 5.1 We assumed that if we could determine the average gene
log10 , and 4.8 log10 in milk, ground beef, and oyster meat copy number in one cfu, the quantitative results generated
samples, respectively. These results could not be compared by qPCR could provide data that allow us to infer the level
with culture methodologies because those methods are not of food contamination per bacterial cells. However, the qPCR
used to quantify this pathogen but only to detect it. does not define the viability of bacterial cells, because the gene
can be detected even in unviable cells [22]. The determination
4. Discussion of the gene copy numbers in a single cfu of Salmonella,
E. coli, and S. aureus using TaqMan showed a low CV in
For food quality control, the standardization of methods that repetitions (average 0.77 ± 0.5, Table 3), which demonstrates
simultaneously quantify the three main foodborne pathogens high repeatability. One cfu of S. aureus produced 7.9 × 1011 nuc
(Salmonella spp., E. coli, and S. aureus) generates fast results gene copies, showing three to four logs more gene copies than
that allow the early intervention of control strategies. It can ssf in Salmonella (2.10 × 108 ) and phoA in E. coli (1.28 × 107 ),
also be an important tool for quantitative microbial risk respectively. This difference must be considered during the
assessment, which requires numerical data that evaluate the multiplex analysis, because the determination of increased
performance objectives in a productive chain, determin- copy numbers of nuc gene does not mean that the food
ing the level of contamination at a specific stage of food is more contaminated with S. aureus than with E. coli or
production, and evaluating if the hazard is diminished (or Salmonella.
eliminated) after processing or after control measures [14]. The average of bacterial quantification in the different
Thus, qPCR using probes marked with fluorophores that food matrices through multiplex qPCR was 5.7 log10 , and no
emit fluorescence at different wavelengths can be a good statistical difference was observed compared with traditional
alternative for use as a rapid test; it allows the amplified culture methodology (5.5.log10 ). Despite this, in milk and
products of two or more regions of DNA to be quantified ground beef, approximately one log10 of difference was
in a specific manner for specific targets in the same reaction, observed (Figure 3). This result can be caused by competition
providing results in real time [15]. of primers for the reagents available in the reaction mix, since
The sensitivity, amplification efficiency, reproducibility, there is no concentration’s variation of its components, as the
and coefficient of linearity of the standard curves in qPCR mix is ready to use (according to manufactory’s instruction).
were found to be consistent. The combination of primers and This means that the same mix used for singleplex reactions is
probes designed in this study retained the expected efficiency used the same way in multiplex reactions, probably reflecting
in multiplex analysis for the simultaneous quantification of the competitive nature of the process. In addition, the ampli-
Salmonella, E. coli, and S. aureus. The amplification efficiency fication of one target DNA (including nonspecific products)
(Eff %) assesses whether the primer pairs amplify the target may be more expressive than the other targets, resulting in a
gene exponentially at each cycle and must be between 90 decrease of the efficiency and sensitivity in multiplex reaction
and 110%. The reactions with Eff within these values are [23]. This difficulty in performing multiplex tests is described
considered efficient [16]. The standard curves for Salmonella, as one of the disadvantages of real-time PCR, including other
E. coli, and S. aureus quantifications were highly reproducible, points, such as the need for qualified personnel, the high
as indicated by the low intraexperiment (< 6.0%) and inter- cost of equipment, and its inherent ability to not distinguish
experiment (< 1.0%) CV (Table 2). A good linear correlation living cells and dead cells [24]. However, the authors also
was also obtained in all curves (> 0.99). emphasize the advantages of using this molecular technique
Multiplex qPCR reaction demonstrated high sensitivity for diagnosis; since it can be monitored in real time, it does
for enumerating small amounts of DNA molecules. This not need to perform any postreaction processing, such as the
can be confirmed by the limit of detection of 13 copies for electrophoresis gel; the reactions are rapid due to short cycles,
ssf (Salmonella), 10 copies for phoA gene (E. coli), and 12 confirmation of amplification in real time, and being specific,
copies for nuc gene (S. aureus). Usually, researchers evaluate sensitive, and reproducible reactions. Thus, multiplex qPCR
the limit of detection of the qPCR techniques by counting can be a powerful tool for fast screening of large number of
cfu/g or cfu/mL, so they can determine the minimal amount samples. In addition, for Salmonella diagnosis, different from
of cfu in food that can be detected by qPCR. According culture methods, qPCR allow enumeration of the pathogen,
to previous studies, the limit of detection of Salmonella in being a useful tool for Quantitative Microbial Risk Assess-
food was 2 to 5 cfu/25 g and 5 cfu/100 g [17, 18]. For E. ment, in which quantitative data are recommended [22].
coli, the limit of detection has been described as 1 to 5 The average of bacterial quantification in the different
cfu/25 g [19, 20] and for S. aureus, Elizaquiável and Aznar food matrices through the ready-to-use test Compact Dry
[21] could detect 103 cfu/g by qPCR. These studies did not was 6.6 log10 , presenting significant difference when com-
determine the gene copy numbers per cfu, because the tests pared with traditional culture method and multiplex qPCR.
were qualitative with the objective of pathogen detection In our study, this method presented high sensitivity, detecting
and not pathogen quantification. In our work, since the one log10 more than the bacterial amounts inoculated in
objective was pathogen quantification, the determination of the food, increasing the numbers of false-positive samples.
Table 4: Advantages, disadvantages, and purposes of use of multiplex qPCR described in this study, ready-to-use Compact Dry, and
traditional culture methodology in food industries.
Multiplex qPCR Ready-to-use Compact Dry Traditional culture

Bacterial amount inoculated 5.3 log10 5.3 log10 5.3 log10
Bacterial amount detected
5.7 log10 6.6 log10 5.5 log10
(average)a
2 hours (simultaneous 3-4 days ( S. aureus)
1 day (E. coli and S. aureus)
Estimated time of analysis quantification of Salmonella, 5-6 days ( E. coli)
2 days (Salmonella)
E. coli and S. aureus ) 5 days (Salmonella)
(i) Monitoring in real time;
(ii) Does not need to perform
(i) Standardized method;
post-reaction processing; (i) Ease of sample inoculation;
(ii) “Gold standard” in food
(iii) Fast; (ii) Smaller size than
diagnostics;
(iv) Confirmation of conventional plates;
(iii) Do not require expensive
Advantages amplification in real time; (iii) Easy to discard
infrastructure;
(v) Specific, sensitive and (iv) Reduction of practical use
(iv) Realistic results (similar
reproducible; and laboratory time;
bacterial quantification to the
(vi) Simultaneous (v) Less employee training;
amount inoculated).
quantification of different
pathogens.
(i) Competitive amplification
(decrease of the efficiency and
(i) Analyses are
sensitivity in multiplex
labor-intensive
reaction); (i) False positive results;
(ii) Require a lot of reagent
Disadvantages (ii) Need for qualified (ii) Spends, at least, one day
media;
personnel; for results.
(iii) Time consuming analysis
(iii) High cost of equipment;
(more than 3 days).
(iv) Do not distinguish living
cells and dead cells.
Fast screening methods of Screening method for
Official method for food
large number of samples. bacterial enumeration. Useful
Purposes of use microbiological analysis.
Useful for microbiological for microbiological quality
Useful for regulatory agencies.
quality control. control.
a
Average of bacterial quantification (Salmonella, E. coli, and S. aureus) in ground beef, milk, and oyster meat. Salmonella was not quantified through Compact
Dry and Traditional culture method.
Differently, previous studies performed by Teramura [25], Each technique has its particularity and the purpose of
Hosokawa [26], and Kodaka [27] obtained compatible results use depends on objective, infrastructure, and time available
of this chromogenic method when compared to traditional to obtain results. Table 4 summarizes each method used in
culture techniques. For food industries, the advantages of this this study, pointing out the advantages and disadvantages,
method include ease of sample inoculation, smaller size than and purposes of use in food industries.
conventional plates, being easy to discard [26], reduction of
practical use and laboratory time, less employee training, 5. Conclusion
longer shelf life, storage space [27], being an easy screening
method for bacterial enumeration, and useful for quality The technique described in this study can be tested for
control. use in simultaneously quantifying Salmonella, E. coli, and
The traditional culture methodology performed in this S. aureus at different stages of production/processing in the
study obtained results close to the bacterial amounts inoc- food industries, in order to assess whether microbiological
ulated in food. Jasson [28] describes that this standardized hazards decrease or increase during the processing steps. By
method of classical culture is still in use by many laboratories, generating specific results related to the quantities of each
especially by regulatory agencies, because they are harmo- microorganism, the increased copy numbers of a target gene
nized methods, considered as the “gold standard” in food can provide information about the type of contamination
diagnostics. However, the disadvantage is that although they that may be occurring in a processing step. For example,
do not require expensive infrastructure, laboratories must increased copy numbers of nuc gene (S. aureus) might
be equipped, analyses are labor-intensive to execute, require imply contamination by handling, increased copy numbers
the use of large volumes reagent media, and encompass of phoA gene (E. coli) might suggest fecal contamination, and
procedures that take so long in the analysis as in the data increased copy numbers of ssf (Salmonella) might indicate
collection. that the processing has not been able to eliminate pathogenic
microorganisms. This approach would aid in achieving more [9] C. Bellaver, “Segurança Alimentar e Controle de Qualidade no
targeted quality control. Uso de Ingredientes Alimentação de Suı́nos,” in Proceedings of
the II Conferência Internacional Virtual sobre qualidade de carne
suı́na, EMBRAPA, Ed., pp. 119–125, Concórdia, SC, 2001.
Data Availability [10] M. Wiedmann, S. Wang, L. Post, and K. Nightingale, “Assess-
No data were used to support this study. ment criteria and approaches for rapid detection methods to be
used in the food industry,” Journal of Food Protection, vol. 77, no.
4, pp. 670–690, 2014.
Conflicts of Interest [11] S. Kurkela and D. W. G. Brown, “Molecular diagnostic tech-
niques,” Medicine, vol. 37, no. 10, pp. 535–540, 2009.
The authors declare that there are no conflicts of interest [12] F. Postollec, H. Falentin, S. Pavan, J. Combrisson, and D. Sohier,
regarding the publication of this paper. “Recent advances in quantitative PCR (qPCR) applications in
food microbiology,” Food Microbiology, vol. 28, no. 5, pp. 848–
Acknowledgments 861, 2011.
[13] Brasil, “Instrução Normativa N∘ 62, de 26 de Agosto de 2003.”
This work was supported by Fundação de Amparo a Ministério da Agricultura, Pecuária e Abastecimento. In: Diário
Pesquisa do Estado da Bahia, Brasil (FAPESB), Finance Code oficial da União. vol.1: 14, 2003.
#RED0003/2012. This study was also financed in part by the [14] EFSA, “Opinion of the scientific panel BIOHAZ related to
Coordenação de Aperfeiçoamento de Pessoal de Nı́vel Supe- “risk assessment and mitigation options of Salmonella in pig
rior, Brasil (CAPES), Finance Code 001, for the scholarship production”,” The EFSA Journal, vol. 341, pp. 1–131, 2006.
granted to Amanda Teixeira Sampaio Lopes. [15] M. C. Edwards and R. A. Gibbs, “Multiplex PCR: Advantages,
development, and applications,” Genome Research, vol. 3, no. 4,
pp. S65–S75, 1994.
References [16] M. Raymaekers, R. Smets, B. Maes, and R. Cartuyvels, “Check-
[1] CDC, Estimates of Foodborne Illness in the United States, Center list for optimization and validation of real-time PCR assays,”
for Diasease Control and Prevention, 2011, http://www.cdc.gov/ Journal of Clinical Laboratory Analysis, vol. 23, no. 3, pp. 145–
foodborneburden/2011-foodborne-estimates.html. 151, 2009.
[2] WHO, “WHO estimates of the global burden of food- [17] N. González-Escalona, E. W. Brown, and G. Zhang, “Develop-
borne diseases: foodborne disease burden epidemiology ref- ment and evaluation of a multiplex real-time PCR (qPCR) assay
erence group (2007-2016),” in WHO Library Cataloguing- targeting ttrRSBCA locus and invA gene for accurate detection
in-Publication Data, 2016, http://apps.who.int/iris/bitstream/ of Salmonella spp. in fresh produce and eggs,” Food Research
10665/199350/1/9789241565165 eng.pdf?ua=1. International, vol. 48, no. 1, pp. 202–208, 2012.
[3] CDC, Estimates of Foodborne Illness in the United States – Bur- [18] A. Garrido, M.-J. Chapela, B. Román, P. Fajardo, J. M. Vieites,
den of Foodborne Illness: Findings, Center for Diasease Control and A. G. Cabado, “In-house validation of a multiplex real-
and Prevention, 2016, http://www.cdc.gov/foodborneburden/ time PCR method for simultaneous detection of Salmonella
2011-foodborne-estimates.html. spp., Escherichia coli O157 and Listeria monocytogenes,” Inter-
[4] Brasil, Sistema de Informação de Agravos de Notificação national Journal of Food Microbiology, vol. 164, no. 1, pp. 92–98,
(SINAN net). Ministério da Saúde, Secretaria de Vigilância 2013.
em Saúde, Departamento de Vigilância Epidemiológica, Coor- [19] A. Garrido, M.-J. Chapela, B. Román et al., “A new multiplex
denação Geral de Vigilância das Doenças Transmissı́veis. real-time PCR developed method for Salmonella spp. and
Brası́lia, BR, 2014. https://disciplinas.stoa.usp.br/pluginfile.php/ Listeria monocytogenes detection in food and environmental
270383/mod resource/content/1/Vigil%C3%A2ncia%20Epide- samples,” Food Control, vol. 30, no. 1, pp. 76–85, 2013.
miol%C3%B3gica%20das%20Doen%C3%A7as%20%20Trans- [20] E. Omiccioli, G. Amagliani, G. Brandi, and M. Magnani, “A
mitidas%20por%20Alimentos%20%E2%80%93%20VE-DTA new platform for Real-Time PCR detection of Salmonella spp.,
.pdf. Listeria monocytogenes and Escherichia coli O157 in milk,”
[5] Brasil, Sistema de Informação de Agravos de Notificação Food Microbiology, vol. 26, no. 6, pp. 615–622, 2009.
(SINAN net). Ministério da Saúde, Secretaria de Vigilância [21] P. Elizaquı́vel and R. Aznar, “A multiplex Rti-PCR reaction for
em Saúde, Departamento de Vigilância Epidemiológica, Coor- simultaneous detection of Escherichia coli O157:H7, Salmonella
denação Geral de Vigilância das Doenças Transmissı́veis. spp. Staphylococcus aureus on fresh, minimally processed
Brası́lia, BR, 2016. http://portalsaude.saude.gov.br/images/pdf/ vegetables,” Food Microbiology, vol. 25, no. 5, pp. 705–713, 2008.
2016/junho/08/Apresenta—-o-Surtos-DTA-2016.pdf. [22] B. Malorny, C. Löfström, M. Wagner, N. Krämer, and J. Hoorfar,
[6] B. R. Shome, S. Das Mitra, M. Bhuvana et al., “Multiplex PCR “Enumeration of Salmonella bacteria in food and feed samples
assay for species identification of bovine mastitis pathogens,” by real-time PCR for quantitative microbial risk assessment,”
Journal of Applied Microbiology, vol. 111, no. 6, pp. 1349–1356, Applied and Environmental Microbiology, vol. 74, no. 5, pp.
2011. 1299–1304, 2008.
[7] S. Aabo, O. Rasmussen, L. Roseen, P. Sørensen, and J. Olsen, [23] E. M. Elnifro, A. M. Ashshi, R. J. Cooper, and P. E. Klapper,
“Salmonella identification by the polymerase chain reaction,” “Multiplex PCR: Optimization and application in diagnostic
Molecular and Cellular Probes, vol. 7, no. 3, pp. 171–178, 1993. virology,” Clinical Microbiology Reviews, vol. 13, no. 4, pp. 559–
[8] O. G. Brakstad, K. Aasbakk, and J. A. Maeland, “Detection of 570, 2000.
Staphylococcus aureus by polymerase chain reaction amplifica- [24] P. Kralik and M. Ricchi, “A basic guide to real time PCR
tion of the nuc gene,” Journal of Clinical Microbiology, vol. 30, in microbial diagnostics: Definitions, parameters, and every-
no. 7, pp. 1654–1660, 1992. thing,” Frontiers in Microbiology, vol. 8, no. 108, 2017.
[25] T. Hajime, M. Shingo, and K. Hidemasa, “Evaluation of the

compact dry X-SA method for enumerating Staphylococcus
aureus in artificially contaminated food samples,” Biocontrol
Science, vol. 15, no. 4, pp. 149–154, 2010.
[26] S. Hosokawa and H. Kodaka, “Efficacy of Compact Dry EC
for Coliform Detection in Seafood,” Japanese Journal of Food
[27] H. Kodaka, S. Mizuochi, H. Teramura, and T. Nirazuka, “Com-
parison of the compact dry EC with the most probable number
method (AOAC Official method 966.24) For enumeration of
escherichia coli and coliform bacteria in raw meats,” Journal of
AOAC International, vol. 89, no. 1, pp. 100–114, 2006.
[28] V. Jasson, L. Jacxsens, P. Luning, A. Rajkovic, and M. Uyt-
tendaele, “Alternative microbial methods: An overview and
selection criteria,” Food Microbiology, vol. 27, no. 6, pp. 710–730,
2010.
Hindawi
https://doi.org/10.1155/2018/3428437
Review Article
Probiotics and Their Potential Preventive and
Therapeutic Role for Cancer, High Serum Cholesterol,
and Allergic and HIV Diseases
Yusuf Nazir ,1 Syed Ammar Hussain ,1 Aidil Abdul Hamid ,2 and Yuanda Song 1
1
Colin Ratledge Center for Microbial Lipids, School of Agriculture Engineering and Food Science, Shandong University of Technology,
Zibo 255049, China
2
School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Malaysia
Correspondence should be addressed to Aidil Abdul Hamid; aidilmikrob@gmail.com and Yuanda Song; ysong@sdut.edu.cn
Received 2 May 2018; Revised 12 July 2018; Accepted 7 August 2018; Published 29 August 2018
Academic Editor: Maria E. Potes
Copyright © 2018 Yusuf Nazir et al. This is an open access article distributed under the Creative Commons Attribution License,
The potential health benefits of probiotics have long been elucidated since Metchnikoff and his coworkers postulated the association
of probiotic consumption on human’s health and longevity. Since then, many scientific findings and research have further established
the correlation of probiotic and gut-associated diseases such as irritable bowel disease and chronic and antibiotic-associated
diarrhea. However, the beneficial impact of probiotic is not limited to the gut-associated diseases alone, but also in different
acute and chronic infectious diseases. This is due to the fact that probiotics are able to modify the intestinal microbial ecosystem,
enhance the gut barrier function, provide competitive adherence to the mucosa and epithelium, produce antimicrobial substances,
and modulate the immune activity by enhancing the innate and adaptive immune response. Nevertheless, the current literature
with respect to the association of probiotic and cancer, high serum cholesterol, and allergic and HIV diseases are still scarce and
controversial. Therefore, in the present work, we reviewed the potential preventive and therapeutic role of probiotics for cancer,
high serum cholesterol, and allergic and HIV diseases as well as providing its possible mechanism of actions.
1. Introduction into a host-friendly colony of Bacillus bulgaricus [3]. Since

then, extensive studies on the beneficial effect of probiotics on
The association of live-microbial feed with well-being has human have been conducted and its relation in preventing
a long history which dated back to thousands of years and treating gut-related diseases such as infectious and
ago [1]. However, the use of word “probiotic” was first antibiotic-associated diarrhea, irritable bowel diseases,
introduced in 1974 by Parker who defined it as organisms lactose intolerance, indigestion, and stomach bloating have
and substances that have a beneficial effect on the host animal been established [4]. Due to the significant role of probiotic
by contributing to its intestinal microbial balance and since in enhancing the gut health and overall human well-being,
then, the definition of probiotic has been improved several the demand for probiotic-based nutriment has increased
times [2]. The first documented study on probiotic was tremendously. In 2007, the global market for probiotic
reported by Metchnikoff and his coworkers who discussed ingredients, supplements, and foods worth was $14.9 billion
his view on the lower gut flora and the beneficial effects of and it augmented up to US$16 billion in 2008. Furthermore,
fermented milk on human’s health and longevity. Therefore, the probiotics market is anticipated to expand from $37.7 in
he was awarded the Nobel Prize in Medicine in 1908 for his 2016 to $71.9 billion by 2025, at a CAGR of 7.49% [5, 6].
cellular (phagocytic) theory of immunity and has inspired In addition to improving the gut health, probiotics
generations of scientists and food product developers with his have also been documented to exert other health-promoting
proposal to transform the “toxic” flora of the large intestine effects including chronic diseases such as cancer [7–9], high
serum cholesterol [10], and allergy [11] and slowing the Agriculture Organization of the United Nations and World
disease progression and symptoms of the HIV-infected indi- Health Organization (FAO/WHO) with a minor grammatical
vidual such as bacterial translocations as well as vulvovaginal changes [19]. The revised definition stressed the need for a
candidiasis in women [12]. Preventive and therapeutic role of probiotic to be viable and the experts emphasized that there is
probiotic on cancer has been established via several mecha- no such entity as dead probiotic and if dead organism conveys
nisms including modulation of gut microbiota, enhancement benefits, it should be referred to a different term. Several
of gut barrier functions, degradation of potential carcinogens hypotheses were elucidated concerning series of the evolve-
and enhancement of immune system [7]. For instance, a study ment in probiotics definition. Apart from the advancement
by Ma et al. [8] found that probiotic Bacillus polyfermenticus on genomic tools that contributes to the identification of new
exerts an anticancer effect on human colon cancer cells probiotic species and mechanism of actions, involvement of
stimulating IgG production and modulates the number of many regulatory organizations and pharmaceutical compa-
CD4þ, CD8þ, or NK cells. In another study involving 54 nies may also contribute to the changes [20].
women found that a daily probiotic consumption for 6 Most probiotics are commonly known as lactic acid
months enhanced the clearance of human papillomavirus bacteria (LAB) due to their ability to produce lactic acid when
(HPV) which is known to be the culprit of cervical can- fermented with substrate rich in sugar. The LAB was initially
cer [9]. Furthermore, past in vivo studies showed that subdivided into the genera Betabacterium, Thermobacterium,
the administration of probiotics are effective in improving Streptobacterium, Streptococcus, Betacoccus, Tetracoccus, and
lipid profiles, including the reduction of serum/plasma total Microbacterium on the basis of their morphologic and phe-
cholesterol, LDL-cholesterol, and triglycerides or increment notypic features. Today, only Streptococcus is still retained,
of HDL-cholesterol [10]. For example, probiotic Lactobacillus whereas most of the others have been renamed into Lacto-
reuteri NCIMB 30242 and a few other Lactobacillus and bacillus, Bifidobacterium, and Enterococcus sp. [21, 22].
Bifidobacterium strain have shown that they have potential in Lactobacillus refers to Gram-positive rods, lactic acid
reducing serum cholesterol level especially LDL-cholesterol producing bacteria which are mostly obligate and facultative
which is established to be one of the major precursors of anaerobes, predominantly found in the human gastrointesti-
many chronic diseases including cardiovascular diseases, nal and genitourinary tracts [23, 24]. On the other hand,
hypertension, hyperlipidemia, and build-up of atheroscle- Bifidobacterium are commonly straight anaerobes, Gram-
rotic plaque in the arteries [10, 13, 14]. In addition, several positive, nonsporing, pleomorphic rod bacteria which pro-
other studies demonstrated that probiotic intake reduces the duce lactic and acetic acids as the product of carbohydrates
prevalence of allergic diseases including atopic dermatitis fermentation [25, 26]. Compared to Lactobacillus, Bifidobac-
rhinoconjunctivitis [11] and asthma [15] as well as alleviating terium is more difficult to be cultivated due to its obligate
the common symptoms associated with HIV patients [12]. anaerobes properties and often needs extra maintenance
However, the literature on the beneficial impact of pro- when cultivated in the food product such as yogurt.
biotic on these diseases is still limited and controversial. In Nowadays, the interest in probiotic research and indus-
addition, most studies often do not sufficiently address the trialization is on developing consortia of different probiotic
mechanisms by which probiotics modulate, treat, and reduce species and strain. This is due to the fact that many studies
the progression of these diseases. Therefore, this review have proven that it delivers superior impact on human health
will discuss the association of probiotics in preventing and compared to the use of single probiotic strain. For instance,
reducing the prevalence of the aforementioned diseases as probiotic VSL#3 which contained 8 different mixtures of pro-
well as providing its possible mechanisms of actions. biotics was proven to be effective in treating several diseases
including ulcerative colitis, irritable bowel disease, diarrhea,
2. Probiotic improving hepatic insulin resistance in diabetic patients,
enhancing the immune system of the consumer, and many
Probiotics commonly refer to viable microorganisms which more [27–31]. In addition, combinations of Bifidobacterium
were originated from the gut that has beneficial health infantis with Lactobacillus acidophilus were also proven to be
impacts on the consumer. Etymologically, the probiotic term effective in reducing the incidence of necrotizing enterocolitis
appears to be a composite of the Latin preposition pro (“for” (NEC) and NEC-associated mortality in critically ill neonates
or “in support”) and the Greek adjective (biotic) from the [32]. However, it is very important to ensure that the probiotic
noun bios (“life”) meaning “for life” or “in support of life” consortia do not cross-inhibit among themselves as they will
[16]. The definition of probiotic has a long evolutionary reduce the efficacy of the probiotic product. For instance, a
history. It was first used by Lilley and Stillwell [17] to seminal study of a probiotic product containing 15 bacterial
describe substances secreted by one microorganism that showed a significant cross-inhibition of growth among the
stimulated the growth of another and was later used to strains, causing it to be less effective than single strains [33].
describe tissue extracts that stimulated microbial growth Therefore, it is recommended for the probiotic product to
and animal feed supplements exerting a beneficial effect be tested in human and any benefits they provide should be
on animals by contributing to their intestinal flora balance stated and supported by peer-reviewed publication in order
[18]. Since then, the definition of probiotic had evolved over to ensure the effectiveness of the product [20].
time and today, probiotic is defined as “live organisms that, In addition, plenty of bacteria were regarded as a pro-
when ingested in adequate amounts, exert a health benefit biotic, but many do not satisfy its desirable properties.
to the host” retaining the previous definitions by Food and According to Mitropoulou et al. [34], several aspects have
to be taken into consideration before considering the bac- as with low viability in dairy products during storage remains
teria as potential probiotic. These aspects include safety a major problem in most probiotic products. Therefore,
and functional and technological characteristics. In order to technologies such as immobilization and encapsulation were
ensure the safety of the probiotic products, it is essential employed to ensure and maintain the viability and quality
for the probiotic microorganism to be nonpathogenic and of the probiotic product. In general, immobilization and
recognized as GRAS for human consumption by US Food and encapsulation of probiotic provide protection of cells against
Drug Administration (FDA). These properties are important physicochemical changes, such as pH, temperature, bile
since some bacteria originated from human GI tract are also salts, higher cell densities and cell loads, higher productivity
pathogenic in nature such as Helicobacter pylori, Clostridium and efficiency, improved substrate utilization, reduced risk
difficile, and many more. for microbial contamination, and faster fermentation and
Furthermore, the functional criteria of probiotics should maturation rates [34]. However, these techniques are beyond
be established based on both in vitro and in vivo assays, and the focus of this paper; therefore, it would not be discussed in
the results should be reflected in controlled human studies. detail.
The probiotic microbes should also be able to survive in Apart from safety, functionality, and viability, intake of
harsh condition of the stomach and GI tract of humans in sufficient probiotic dosage is another key factor to ensure its
order to ensure its efficacy [35]. These claims may include efficacy on human health. Although the information about
the ability of the probiotics to withstand the gastric juice the minimum effective concentrations is still limited and
and bile salt. These are due to the fact that many microbes controversial, it is generally accepted that probiotic products
which are claimed as probiotic are not capable of subsisting should have a minimum concentration of 106 CFU/mL or
the acidity level of gastric juices as well as the bile salt. This gram and that a total of 108 to 109 probiotic microorganisms
condition has risen many debates among the probiotic con- should be consumed daily to have an optimal beneficial
sumer, researcher, and industries. However, several studies impact on the consumer [14].
have reported that nonviable probiotics could also devour
beneficial effects on human health [36, 37]. This is because not 3. Association of Probiotic and Its Mechanism
all mechanisms nor clinical benefits of probiotic concomitant on Human Health
with viability and even cell wall or the DNA components
may have beneficial health impact on human [38]. A study To date, the association of probiotic and human health
reported that both viable and nonviable Lactobacillus bacteria has been well established. The mechanisms underlying the
exhibit a similar beneficial effect toward lactose tolerance beneficial effects of probiotics on human are largely unknown
by lactase-deficient subjects. Similarly, in the treatment of but are likely to be multifactorial. There are several postu-
acute gastroenteritis, some probiotics showed clinical efficacy lated antagonistic mechanisms of probiotics on pathogenic
in shortening the duration of diarrhea in both viable and microorganisms and diseases which may include competing
nonviable forms [36]. for nutrients as growth substrates, providing and enhancing
However, other probiotic species such as Saccharomyces the gut barrier functions, competitive adherence to the
boulardii should be in a viable form to show effective effect mucosa and epithelium, producing antimicrobial substances,
in candidiasis treatment, differing from most Lactobacillus and modulating the immune system [41, 42].
strains that showed efficacy in both viable and nonviable state One of the ways probiotics promote human health is
[36]. Hence, the association of the probiotics viability and its by inhibiting the growth of pathogenic bacteria. Probiotics
therapeutic impact are still dubious and seem to depend on compete for nutrients especially for their growth and prolif-
the microbial species and on the disorder. Therefore, experts eration that would otherwise be utilized by pathogens. For
suggested that probiotic should best be in a viable form to example, a sufficient number of probiotics may possibly con-
exhibit a wider therapeutic benefit on human [19]. This is sume most of the available monosaccharides, which results
because viable probiotics are able to colonize and adhere at in the inhibition of pathogenic organism which is solely
the GI tract of human, providing competitive exclusion of dependent upon monosaccharide for its growth such as of
pathogens which therefore maintain the normal intestinal Clostridium difficile. Thus the growth of pathogenic microbes
flora. Dead or nonviable probiotic would not be able to would be stunted and consequently reduce the prevalence
provide similar mechanisms and, therefore, their beneficial of pathogenic bacteria in the GI tract [43]. Furthermore,
impact would be limited. In addition, the current definition probiotics enhance the gut barrier function by providing a
of probiotic emphasizes the needs of probiotic in a viable form competitive exclusion for cellular attachment to the mucosa
as discussed in the previous sections. secreted by the epithelial layer of GI the track. Maintaining
The concern of viability is limited to the ability of the the epithelial layer is one of a major defence mechanisms
probiotic to withstand not only the bile and gastric juices, but of probiotics. This is because once this barrier function
also food production and processing (technological criteria). is disrupted, pathogenic bacteria and food antigens can
This is because the viability of bacteria is often reduced extend up to the submucosa and can induce inflammatory
during the food manufacture, distribution, and storage. Many responses, which may result in intestinal disorders, such as
surveys have shown large fluctuations and poor viability inflammatory bowel disease [44, 45]. Disruption of intestinal
of probiotic bacteria especially Bifidobacterium, in food barrier resulted in bacterial translocation which is one of
products, such as yogurt preparations [39, 40]. The sensitivity the primary inducers of several types of cancers and other
of Bifidobacterium to low pH and hydrogen peroxide as well complications. Several studies demonstrated that probiotics
such as Lactobacillus rhamnosus strain GG and Lactobacillus the innate immune response of mice by phosphorylation
plantarum 299 showed the ability to inhibit attachment of of NF-𝜅B, p65, p3, MAPK, and MAPKAPK-2 signalling
enteropathogenic Escherichia coli in the GI tract [43, 46]. In pathway [52]. In addition, another study found that probiotic
addition, a number of Lactobacillus bacteria modulate and mixture VSL#3 elicited noninflammatory responses from
enhance the expression of genes involved in tight junction epithelial and immune cells, inhibited IL-8 and systemic
signalling, such as E-cadherin and 𝛽-catenin, to reinforce TNF- 𝛼 production, and improved the histological score
the intestinal barrier integrity. Probiotics do maintain the of inflammation in IL-10 knockout mice [53]. Furthermore,
intestinal barrier integrity by anchoring and adhering to the probiotics can encounter DCs, which have an important role
intestinal mucosa. Several Lactobacillus proteins have been in innate and adaptive immunity. Both intestinal epithelial
shown to promote mucous adhesion by displaying surface cells (IECs) and DCs can interact with and respond to gut
adhesins and integrate with complex glycoprotein mixture microorganisms through their PPRs [41].
(i.e., mucin) secreted by the intestinal epithelial cell to provide However, most preventive and therapeutic mechanism
competitive exclusion of pathogens from the mucus [41]. of probiotics are generally species and diseases specific.
Another proposed mechanism of probiotic is the mod- Therefore, in this review, we are going to discuss the potential
ification of the microbial flora through the synthesis of low role of probiotics in reducing the prevalence of cancer, hyper-
molecular weight compounds such as organic acid as well cholesterolemia, dermatitis, and allergic symptoms, and com-
as large molecular weight antimicrobial compounds termed mon symptoms associated with HIV-infected individual and
as bacteriocins [41]. Examples of organic acids are acetic providing their possible mechanisms of actions.
and lactic acids. These compounds have been proven to
exhibit strong inhibitory effect against pathogenic Gram- 4. Probiotic and Cancer
negative bacteria such as Helicobacter pylori which has been
implicated with many gastrointestinal disorders. The mode of In 2012, cancer is classified as the second major death cause
actions of these acids includes lowering the intracellular pH in different regions of the world with an estimated number of
or accumulating the ionized form of the organic acid which 14.1 million new cases and 8.2 million death and expected to
will disrupt the pH balance of the pathogen and consequently increase up to 21 million cases with 13.2 million causalities
inhibit the growth of the pathogen [47, 48]. Furthermore, by 2030. Cancer is caused by a progressive aggregation of
probiotics also produce bacteriocins and other compounds. mutations in the genetic material of cell. Uncontrolled prolif-
Bacteriocins are compounds produced by bacteria that have eration of cells, insensibility of growth factors, and capacity
a biologically active protein moiety and antibactericidal to infect surrounding tissues are the general characteristic
activity. The example of bacteriocins produced by probiotics of malignant tumors observed in most cancer patient [69–
are lactacin B from L. acidophilus, bifidocin B produced 72]. According to Anand et al. [73], only 5-10% of all cancer
by Bifidobacterium bifidum NCFB 1454, plantaricin from L. cases can be attributed to genetic defects, while 90-95% of
plantarum, and nisin from Lactococcus lactis [49]. These the cases are related to external factors. According to the
compounds were proven to be effective against food-borne World Cancer Report (2014), around one-third of all deaths
pathogen and its common mechanism includes destruction caused by cancer are resulting from high body mass, low
of target cells by pore formation and/or inhibition of cell wall fruits and vegetable intake, sedentary lifestyle, tobacco intake,
synthesis. For instance, bifidocin B, which is produced by B. and alcohol ingestion [74].
bifidum NCFB 1454, exerts a strong inhibitory activity against The association of probiotic in preventing, treating, and
several pathogenic bacteria, including Salmonella enterica ser. reducing the progression of cancer cell has been established
typhimurium SL1344 and E. coli C1845 [50]. years ago. Extensive research using human cancer cells/cell
It is well known that probiotic bacteria can stimulate the lines has proven that probiotics possess antiproliferative
immune response by modulating the adaptive and innate or proapoptotic activities in on a wide range of cancer
responses of the host [41]. The adaptive immune response cells including colon, stomach, breast, cervix, and myeloid
depends on B and T lymphocytes, which are specific for leukaemia cells [7, 75–85]. According to Russo et al. [76]
particular antigens whereas innate immune system responds and Orlando et al. [77], probiotic Lactobacillus rhamnosus
to common structures called pathogen-associated molecular strain GG (LGG) and Bifidobacterium adolescentis SPM0212
patterns (PAMPs) shared by the vast majority of pathogens. showed a significant antiproliferative role and inhibit human
The primary response to pathogens is triggered by pat- gastric cancer cells and three colonic cancer cells lines
tern recognition receptors (PPRs), which bind PAMPs. The including HT-29, SW 480, and Caco-2. Another study [85]
best-studied PPRs are Toll-like receptors (TLRs). TLRs are found that the kefir product containing Lactobacillus kefiri
transmembrane proteins expressed on various immune and possessed apoptotic effect on myeloid leukaemia cell lines.
nonimmune cells, such as B cells, natural killer cells, dendritic In addition, Enterococcus lactis IW5 which was obtained
cells (DC), macrophages, fibroblasts, epithelial cells, and from human gut strongly inhibited the growth of several
endothelial cells. It is well established that probiotics can pathogenic bacteria and decreased the viability of different
suppress intestinal inflammation via the downregulation of cancer cells, such as HeLa, MCF-7, AGS, HT-29, and Caco2,
TLR expression, secretion of metabolites that may inhibit representing the potential therapeutic effect of probiotic on
TNF-𝛼 from entering blood mononuclear cells, and inhi- cancer patients [86].
bition of NF- 𝜅B signalling in enterocytes [51]. In a study, The anticancer effect of probiotic on cancer patients was
Lactobacillus casei ATCC27139 has significantly enhanced demonstrated in Table 1. Probiotic treatments have been
Table 1: Anticancer effect of probiotic on cancer patients.
Probiotic strain Subjects Dose and duration of study Effects (P<0.05) Ref
(i) Lactobacillus plantarum
Probiotics decreased the serum
CGMCC no.1258;1011 (CFU)/g
zonulin concentration, duration of
(ii) Lactobacillus
postoperative pyrexia, duration of
Lactobacillus plantarum CGMCC, (i) Colorectal cancer patients acidophilus;1011 CFU/g,
antibiotic therapy, and rate of
Lactobacillus acidophilus-11 (ii) 150 patients (1;1 ratio of (iii) Bifidobacterium longum-881010 [54]
postoperative infectious
and Bifidobacterium longum-88 probiotic and placebo group) (CFU/g)
complications as well as inhibited
(iv) The patients administrated with
the p38 mitogen-activated protein
probiotic 6 days preoperatively and
kinase signalling pathway.
10 days postoperative.
61.5% reduction of a liver cancer
Lactobacillus rhamnosus LC705 and (i) Aflatoxin-induced liver cancer
5 weeks, (1:1, wt: wt) at a dose of biomarker which leads to reduced
Propionibacterium freudenreichii (ii) 90 male students with high [55]
2–5×1010 colony-forming units/day urinary excretion of aflatoxin
subsp. shermanii strains aflatoxin level in urine
B1-N7guanine (AFB-N7-guanine)
Regular consumption of LcS and
(i) Breast cancer Frequent consumption of Yakult
isoflavones since adolescence was
(ii) 968 breast cancer patients (306 containing Lactobacillus casei
Lactobacillus casei Shirota(LcS) inversely associated with the [56]
probiotic group; 662 control) aged Shirota and isoflavones from soy
incidence of breast cancer in
40 to 55. product for 2 years
Japanese women.
(i) Bladder cancer
Habitual intake of lactic acid
(ii) A total of 180 cases (mean age: 200 g of yoghurt containing L.
Lactobacillus acidophilus L1 bacteria reduces the risk of bladder [57]
67 years, SD 10) and 445 acidophilus L1 for 10 weeks
cancer.
population-based controls
(i) Cervical cancer
60 % reduction in human papilloma
(ii) 54 women Daily administration of (Yakult)
Lactobacillus casei Shirota (LcS) virus (HPV) associated infection [8]
with an HPV-positive intra containing LcS for 6 months.
and cervical cancer precursors.
epithelial lesion
5
shown to be effective in preventing, treating, and reducing the permeability and attenuated the inflammatory response [97,
progression of several types of cancers including colorectal, 98]. Probiotic has also proven to enhance the expression
liver, breast, bladder, colon, and cervical in cancer patients of tight junctions’ protein such as mucin gene (MUC2 and
(Table 1). Due to these reasons, probiotics-based regimens are MUC3), which will enforce and enhance the intestinal gut
often used as an adjuvant during anticancer chemotherapy barrier functions [41]. These data suggest a protective role of
treatments. probiotic role in maintaining the mucus layer integrity, which
However, the potential mechanisms of probiotic in pre- is essential for an effective intestinal barrier function.
venting, treating, and reducing the progression of cancer
are still poorly understood and need to be further eluci-
(iii) Degradation of Potential Carcinogens and Protective Effect
dated. Up to date, there are several reported and established
of DNA Damage. Carcinogens such as 2-dimethylhydrazine
mechanisms in cancer prevention and treatment by probiotic
(DMH) and N-nitrosodimethylamine (NDMA) are sub-
which may include (i) modulation of gut microbiota, (ii)
stances which can cause changes in the DNA sequence
enhancement of gut barrier functions, (iii) degradation of
which may lead to tumorigenesis. The potential of probi-
potential carcinogens and protection effect of DNA damage
otic in degrading carcinogenic compound has been studied
of intestinal epithelium, and (iv) enhancement of immune
substantially [99]. A study on the effect of freeze-dried
and inflammatory system in the body.
probiotics supplementation which consists of Lactobacillus
acidophilus Delvo Pro LA-1, Lactobacillus rhamnosus GG,
(i) Microbiota Modulation. One of the potential mechanisms Bifidobacterium animalis CSCC1941, and Streptococcus ther-
of probiotic is modulating the composition of gut microbial mophilus DD145 strains on 100 DMH-induced intestinal
species by maintaining the balance and suppressing the tumors rats showed significant inhibition of tumors within
growth of potential pathogenic or cancer-inducing bacteria the rat colon compared to control group [100].
in the gut. For example, several Gram-positive probiotic can In addition, probiotic is also proven to decrease mutagen-
synthesize antimicrobial peptides, acetic, lactic, and propi- induced DNA damage or DNA adduct formation in the
onic acid which reduce the intestinal pH and consequently colonic epithelium [101–104]. An in vitro study using rat
inhibit the growth of several pathogenic Gram-negative intestinal epithelial cells showed preventive role of probiotics
bacteria [87]. These data were further supported by several against enterocyte apoptosis and loss of intestinal barrier
other studies [88–90] which showed that several strains function caused by 5-fluorouracil (5-FU) [105], while an
of lactobacilli have antagonistic activities against Gram- in vivo study with rats demonstrated that combination of
negative gastric-cancer-related Helicobacter pylori. Further- resistant starch and B. lactis facilitated the apoptotic response
more, another study found that some Lactobacillus strains to carcinogen-induced DNA damage of the rat colorectal cells
produce lactic acid which inhibits the growth of Salmonella [106]. The administration of probiotics or synbiotics signif-
enterica [91]. In the Simulator of the Human Intestinal icantly decreased the activities of intestinal procarcinogen
Microbial Ecosystem (SHIME) model, L. acidophilus or L. enzymes which was associated with colonic carcinogenesis
casei increased LAB with a concomitant decrease of fecal in experimental animal models [107–109]. Administration
coliforms and clostridia [92]. In addition, a study reported of a probiotic bacteria, Bacillus polyfermenticus, significantly
by Li et al. [93] found that probiotics caused shifts in the gut reduced the number of DMH-induced ACF in F344 rats,
microbiota composition toward specific beneficial bacteria, when compared to the controls (DMH-treated, no probiotics
for example, Prevotella and Oscillibacter. These bacteria are supplementation) [110]. Furthermore, a study conducted by
known to produce anti-inflammatory metabolites, which Ohkawara et al. [111] reported that the probiotics-treated
subsequently decreased the Th17 polarization and favoured group showed significantly less DMH-induced DNA damage,
the differentiation of anti-inflammatory Treg/Type 1 regula- less blood lipid peroxidation, and increased Total Radical
tory T (Tr1) cells in the gut. Trapping Antioxidant Potential (TRAP) by 9.3 % versus the
controls.
(ii) Enhancement of Gut Barrier Function. Maintaining the
gut epithelial barriers is crucial as it maintains a peaceful rela- (iv) Enhancement of Immune System, Signalling Pathway, and
tionship with commensal microorganisms while protecting Reduction of Inflammatory Reaction. Series of studies have
the host from pathogens and pathobionts. Dysbiosis, which is proved that probiotic enhances the immune system of a
an alteration in the composition of the gut microbiota asso- cancer patient. Lakritz et al. [112] reported that Lactobacillus
ciated with pathology, disrupts the physiological interaction reuteri ATCC-PTA-6475 inhibited mammary carcinogenesis
between epithelial cells and the microbiota, results in breach- in wild-type and FVB strain erbB2 (HER2) (genetically
ing of the barriers, inducing inflammatory pathologies, and susceptible to mammary tumors mimicking breast cancer
may contribute to cancer initiation and progression [94]. in human) mutant mice by triggering CD4+ and CD25+
Commane et al. [95] indicated that the fermentation products lymphocytes. Another study reported that supplementation
of pro- and prebiotics prevented disruption of the intestinal of Lactobacillus casei strain Shirota enhance NK and T cells
epithelial barrier, while Ko et al. [96] demonstrated that L. activities and improve the phagocytic activity of macrophages
plantarum inhibited the decrease in transepithelial resistance which consequently inhibit cancer progression in mice
of Caco-2 cells. Administration of probiotic products to infected with a various type of cancers [113–115]. Study on
patients undergoing biliary drainage reduces the intestinal patients with colon cancer showed that oral administration
of Bacillus polyfermenticus stimulates IgG production and cholesterol-lowering mechanisms of probiotics which are
modulates the number of CD4þ, CD8þ or NK cells [7]. summarized in this review. The mechanisms include the
Other studies has also speculated that incorporation of following.
probiotics in the diet has a substantial impact on cell sig-
nalling system of the cancer patients. L. reuteri may prevent (i) Enzymatic Deconjugation of Bile Acids by Bile Salt Hydro-
carcinogenesis via downregulating NF-𝜅B-dependent genes lase. Bile consists of cholesterol, phospholipids, conjugated
which regulate cell proliferation (Cox-2, cyclin D1) and sur- bile acids, bile pigments, and electrolytes. Probiotics reduce
vival (Bcl-2, Bcl-xL) [116]. In another study, 150 patients with the cholesterol level by deconjugating the bile salt. Deconju-
colorectal carcinoma administered with probiotic showed gation of the bile salt causes it to be less soluble and absorbed
significant reduction of the disease complication through by the intestines, leading to their elimination in the faeces.
inhibition of p38 mitogen-activated protein kinase signalling Cholesterol is then used to synthesize new bile acids in
pathway compared to control group [54]. In addition, a novel homeostatic response, resulting in lower serum cholesterol in
purified Lactobacillus acidophilus 20079 exopolysaccharide, the blood [123].
LA-EPS-20079 inhibit in human colon cancer by molecularly
regulates both apoptotic and NF-𝜅B inflammatory pathways (ii) Ability to Bind Cholesterol in the Small Intestines. The
[117]. ability of cholesterol-binding of probiotic appeared to be
Furthermore, inflammation causes cancer development growth and strain specific. Hosono [124] reported that several
through processes that involve genotoxicity, aberrant tis- probiotic such as Lactobacillus gasseri has the ability to
sue repair, proliferative responses, invasion, and metas- remove cholesterol from a laboratory media via binding onto
tasis. Major inflammatory pathways that are involved in its cellular surfaces. Furthermore, Kimoto et al. [125] have
inflammation-induced carcinogenesis converge at the level further strengthened the finding by showing that both living
of the transcription factors signal transducer and activator and dead probiotics have the ability to reduce the choles-
of transcription 3 (STAT3) and nuclear factor-𝜅B (NF-𝜅B) terol level by exerting the similar mechanism. However, the
[118]. Probiotics have been shown to have anti-inflammatory authors found that growing cells removed more cholesterol
activities through regulating the production of inflammatory than dead cells.
mediators such as interleukins, interferons, and cytokines
resulting in the effective control of inflammation and car-
cinogenesis [106]. For instance, Matsumoto et al. [119] and (iii) Assimilation and Incorporation of Cholesterol into the
Appleyard et al. [120] have shown that supplementation of Cellular Membranes of Probiotics. A study [125] found that
Lactobacillus and VSL#3 probiotic reduce and delay transition several probiotic lactococci strains reduce cholesterol level
from inflammation to dysplasia in a rat model of colitis- by assimilating and incorporating the cholesterol into their
associated cancer. cellular membranes during the growth phase, thus lowering
cholesterol level in blood. Incorporation of cholesterol into
the cellular membrane benefits the bacterial strain by increas-
5. Probiotic and Cholesterol ing its membrane strength and subsequently lead to higher
The other popular application of probiotic in maintaining cellular resistance toward lysis.
human health is by reducing serum cholesterol level in blood.
High content of low-density lipoprotein cholesterol (LDL- (iv) Converting Cholesterol into Coprostanol. Furthermore,
C) is a major precursor to hypertension, hyperlipidemia, probiotic could also reduce the cholesterol level by convert-
and coronary heart diseases as well as causing build-up of ing it into coprostanol. The coprostanol will then directly
atherosclerotic plaque in the arteries [9]. Therefore, by main- excrete in faeces, resulting in decreases amount of choles-
taining the serum LDL-cholesterol level at the optimal ranges, terol being assimilated from the body. The probiotic possi-
the chances of getting the aforementioned diseases may bly initiated the conversion of cholesterol into coprostanol
possibly be reduced significantly. Table 2 showed several ran- by producing cholesterol dehydrogenase/isomerase which
domized controlled clinical trials on the hypocholesterolemic transforms cholesterol to cholest-4-en-3-one, an intermedi-
effect of probiotics on human subjects [58–65]. In another ate cofactor in the conversion of cholesterol to coprostanol
elegant study, pooled data from 485 participants which were [126].
divided into 3 groups; “high”, borderline high, and normal
serum cholesterol levels in randomized controlled clinical (v) Decrease the Concentration of Cholesteryl Esters in LDL
trials suggested that probiotic consumption significantly low- Particles. Administration of a synbiotic containing L. aci-
ered LDL-C and total cholesterol levels among all categories, dophilus ATCC 4962, fructooligosaccharides, inulin, and
compared to the control group [121]. This study further mannitol in hypercholesterolemic pig reduced total choles-
supported the beneficial impact of probiotic consumption in terol by lowering concentration of cholesteryl esters in the
reducing serum cholesterol level in human. LDL particles and a higher concentration in triacylglycerol
However, most studies on the efficacy of probiotic in [127]. Triacylglycerol-enriched LDL particles are more sus-
modulating cholesterol level often do not sufficiently address ceptible to hydrolysis and removal from blood, while the loss
its mechanisms. Therefore, hypocholesterolemic mechanism of cholesteryl esters forms smaller and denser LDL particles
of probiotic will be discussed in this review. An ele- leading to higher removal rates from blood compared to
gant review by Ooi and Liong [122] demonstrated several larger LDL particles.
8
Table 2: Hypocholesterolemic effects of probiotic on human.

Dose and duration of
Probiotic strain Subjects Effects (P<0.05) Ref.
study
(i) Significant reduction in LDL-C in volunteers with
9 baseline TC<5mM during the 0±12 week period (13.9%)
2x10 CFU encapsulated
Lactobacillus 49 normal to mildly (ii) Significant reduction in TC in volunteers with
Lactobacillus plantarum
plantarum ECGC hypercholesterolaemic baseline TC 6mM in the 0±6 week period (37.6%) [58]
ECGC 13110402 twice daily
13110402 adults (iii) A significant decrease in TAG (53.9%)
for 16 weeks.
(iv) increase in HDL-C (14.7%) in the over 60 years
population in the 6±12 week period
Consumed an RAC
containing an
(i) The reduction of total cholesterol (from 6.5 ± 1.0 to
45 clinically asymptomatic anti-oxidative and
Lactobacillus 5.7 ± 0.9 mmol/l)
hypercholesterolaemic anti-atherogenic probiotic [59]
fermentum ME-3 (ii) HDL cholesterol level rose from 1.60 ± 0.31to 1.67 ±
participants Lactobacillus fermentum
0.34mml/l)
ME-3 (LFME-3) for 4
weeks.
Daily ingestion of 80 mL
51 subjects with metabolic
Bifidobacterium fermented milk with 2.72 x (i) 7.7 % decrease of total cholesterol
syndrome (MetS) other [60]
lactis HN019 1010 CFU of B. lactis HN019 (ii) LDL-cholesterol reduce by 13%
cardiovascular risks
for 45 days.
Streptococcus thermophiles
30 subjects, respectively, Daily consumption of ST-fermented milk beneficial in
(ST) -fermented milk or
Streptococcus with average serum healthy or mildly hyper- LDL cholesterolaemic subjects.
non-fermented placebo [61]
thermophilus LDL-cholesterol levels of The benefits were particularly remarkable in subjects
milk (PC) was consumed
about 140 mg/dl. who had higher levels of MDA-LDL.
once a day for 12 weeks
48-volunteers with serum 200 g of yoghurt containing
Lactobacillus Reduction of 2.4% total cholesterol level compared to
cholesterol level ranging L. [62]
acidophilus L1 the placebo group.
from 5.40 to 8.32 mmol/L acidophilus L1 for 10 weeks
32 subjects with baseline
cholesterol ranging from
Incorporation of 108 CFU/g (i) a significant decline in serum total cholesterol,
Bifidobacterium 220-280 mg/dL, body
B. longumBL1 daily for 4 LDL-cholesterol and triglycerides [63]
longumBL1 weight ranging from
weeks. (ii) 14.5% increase in HDL-cholesterol
55.4-81.8 kg, aged 28-60
years old
Table 2: Continued.
Dose and duration of
Probiotic strain Subjects Effects (P<0.05) Ref.
study
36 healthy volunteers with
moderately elevated
fibrinogen concentrations
Lactobacillus
(>3.0 g/L); 35-45 years old; 400 mL of rose-hip drink
plantarum (i) 2.5% decrease in total serum cholesterol level
mean total cholesterol of containing 5.0 × 107 [64]
299v (ii) Decrease in LDL-C by 7.9%
5.59 ± 0.88 mmol/L for CFU/mL daily for 6 weeks.
(ProViva)
treatment group &
5.51±0.75 mmol/L for
control group.
32 patients between
Enterococcus 200 g of Gaio containing
36-65 years old with mean
faecium& 2 strains 105 -109 /mL of E. faecium&
total cholesterol of 48.47 ± (i) Total cholesterol reduced by 5.3%
of Streptococcus 5-20× 108 /mL of S. [65]
26.75 mg/dL and mean (ii)LDL cholesterol reduce by 6.15%
thermophilus thermophilus daily for 16
LDL-C of 172.22±21.17
(Causido; Gaio) weeks
mg/dL
9
Table 3: Potential antiallergic effect of probiotic on human.
Probiotic
Types of allergy microorgan- Outcomes Ref.
isms
Supplementation of Lactobacillus rhamnosus to
Lactobacillus
Eczema and rhinoconjunctivitis high-risk infant for 4 years significantly shows [66]
rhamnosus
protective effect and reduce the prevalence of eczema
HN001
and rhinoconjunctivitis by 50%.
Lactobacillus Fourteen weeks supplementation of L. plantarum
Atopic dermatitis plantarum CJLP133 showed beneficial impact to all the atopic [67]
CJLP133 dermatitis patients compared to the control group.
The study found that Lactobacillus salivarius treatment
Allergic rhinitis Lactobacillus [68]
reduces rhinitis symptoms and drug usage in children
salivarius
with allergic rhinitis.
Pulmonary function and peak expiratory flow rates
(PEFR) increased significantly, and the clinical
Asthma and allergic rhinitis Lactobacillus [12]
symptom scores for asthma and allergic
gasseri
rhinitisdecreased in the probiotic-treated patients as
compared to the controls.
By reducing cholesterol level in the blood, the risk of atopic diseases including eczema, rhinoconjunctivitis, atopic
developing coronary heart disease, hypertension, atheroscle- dermatitis, allergic rhinitis, and asthma (Table 3). However,
rosis, heart attack, and stroke is reduced by nearly half. There- not all probiotic bacteria are effective in preventing/treating
fore, probiotic supplementation could be a potential adjuvant allergic reaction and most of the mechanisms of action are
for coronary heart disease, hypertension, atherosclerosis, species and strain specific as well as time-dependent. For
heart attack, and stroke treatment. instance, supplementation of Bifidobacterium animalis subsp
lactis HN019 with the dose of 109 CFU/day for 4 years had
6. Probiotic and Allergy no effect on infant with eczema disease whereas supplemen-
tation of Lactobacillus rhamnosus HN001 with the similar
An allergy occurs when a person’s immune system reacts study design has shown significant protective effect and
with the substance in the environment known as an allergen reduced the prevalence of eczema and rhinoconjunctivitis
that is harmless for most people. Allergic reactions may by 50% compared to control [66]. This study suggested the
include anaphylaxis, asthma, and contact dermatitis as well importance of choosing the right probiotic species and strain
as being allergic to drug, food, latex, seasonal, mold, and to ensure its efficiency for allergic treatment.
animals. Although most types of allergic reactions are not Even though the favourable effects of probiotics on
medically severe, some of them such as asthma, atopic various allergic and atopic diseases have been considered for
dermatitis, anaphylaxis, and rhino conjunctivitis (atopic dis- decades, little is known about how probiotics modify the
eases) may be life-threatening without a proper treatment immune system and atopic disease development. Recently,
[128]. Recent evidence suggests that exposure to bacteria Özdemir [130] has described the potential mechanism of
in early life may exhibit a protective role against allergy. probiotics in preventing and treating allergy as shown in
Several studies demonstrated that the guts of children who Figure 1. The possible mechanism includes intestinal barrier
were born through vaginal and breastfed are prone to be maturation and immune response modulation by balancing
colonized with Bifidobacteria and Lactobacillus bacteria while Th1/Th2 ratio while suppressing Th17 cells, local and sys-
the caesarean and formula-fed infant, however, tend to have temic anti-inflammatory effects, Tolerogenic Dendritic and
a flora that is more complex, consisting mostly of Coliforms Regulatory T (Treg) cell development, and modification of
and Bacteroides. Therefore, most caesarean and formula-fed other lymphocyte subgroups, as well as pattern recognition
infant have a significantly lower prevalence of Bifidobacteria receptor (TLR) stimulation [130].
and they are normally associated with frequent respiratory Probiotics induce intestinal barrier maturation by provid-
allergies [129]. This study indicated that the composition of ing the maturational signal for the gut-associated lymphoid
gut bacteria has a significant role in allergy prevention and tissues (GALT). Furthermore, some probiotics are able to
treatment. Therefore, there has been obvious interest in the alter the cytokine profiles released by peripheral blood
potential benefits of modifying the gastrointestinal flora by mononuclear cells and redirect the immune system in a
using probiotic supplementation for allergy treatment. regulatory or tolerant mode which will provide balance in
Until now, several randomized, double-blind, placebo- Th1/Th2 productions as well as suppressing the proinflam-
controlled studies found that supplementation of probiotics matory cytokines (Th17 cells) productions. Probiotic also
have a significant influence in treating patients with allergy or provides local and systemic anti-inflammatory impact by
2) Th1/Th2 balance
1) Intestine barrier
and Th17
maturation
cell suppression
Mechanism of
6) Pattern-recognition Prevention / 3) Local and systemic
(Toll-Like Receptor: Therapy of anti-inflammatory
TLR) stimulation Allergy by effects
probiotic
4) Tolerogenic
5) Modification of
dendritic and
other lymphocyte regulatory T (Treg)
subgroups cell development
Figure 1: Potential antiallergic mechanism of probiotic on host.
increasing the secretions of IL-10 in the gut and reducing the A study has been conducted to elucidate the impact
productions of proinflammatory cytokines, e.g., IFN-𝛾, TNF- of probiotic consumption on bacterial translocation among
𝛼, and IL-12 [130]. HIV-infected individuals [133]. The study was performed
In addition, recent research suggested that probiotics are with 44 HIV+ patients who was administrated with S.
involved in the development of Tolerogenic dendritic and boulardii over 4 weeks, the results showed that LPS-binding
regulatory T (Tregs) cell differentiation which will reduce the protein (a marker of translocation) and IL-6 (a marker
prevalence of the allergic reactions. Moreover, T cells induced of inflammation) were significantly decreased compared
by Bifidobacterium bifidum may drive dendritic cells as gen- with placebo recipients. Another study which was carried
erators of more IL-10 [27]. Probiotics do exhibit their actions out toward HIV-infected individuals in Mwanza, Tanzania,
by modifying other lymphocyte subgroups. A study showed established that yogurt supplemented with Lactobacillus
that probiotic consumption reduces CD4+ and the CD25+ rhamnosus effectively alleviates GI symptoms and improves
cells counts and amplified CD8+ cells which improve the productivity, nutritional intake, and tolerance to antiretro-
prevalence of eczema in preschool children. Finally, probiotic viral treatment among the patients [134]. However, a meta-
consumption stimulates Toll-like receptor activity. The TLR- analysis study by Carter et al. [132] determined that the effect
mediated actions of probiotics require immunoregulatory of probiotic on bacterial translocation toward HIV patients
cytokines, e.g., IL-10 and TGF-𝛽 and diverse subgroups was inconclusive and suggested that further studies should
of Treg cells, particularly CD4+, CD25+, FoxP3+ cells for be contemplated.
TLR-4 stimulators, and NKT cells for the TLR-3 stimulator The other symptom of individual with impaired GI tract is
[130]. severe diarrhea and it is commonly associated with the HIV-
infected subject. HIV-infected patient supplemented with
7. Probiotics and HIV probiotic in their diet have shown significant improvement
and alleviation of diarrhea. A study conducted by Anukam
HIV-infected individuals often have impaired gastrointesti- et al. [135] found that 18 out of 24 HIV+ adult women
nal (GI) tract which leads to microbial translocation and who experience severe diarrhea with flatulence and nausea
consequently contributes to chronic immune activation and significantly alleviate the symptoms within 30 days after being
disease progression. Although antiretroviral (ARV) treat- supplemented with probiotics. However, the symptoms reap-
ment of HIV-infected individuals improves their prognosis, pear after 3 months of discontinuing the treatment, indicating
ARV-treated individuals still have increased morbidity and the importance of continuous consumption of probiotics to
mortality compared with uninfected individuals [131]. Sup- experience persistent beneficial impact. In another pilot study
plementation of probiotics has shown to be beneficial in treat- conducted for 12 weeks with 35 HIV+ adults with diarrhea
ing and preventing GI-associated diseases such as diarrhea, showed that 36% of the patients resolved the diarrhea
irritable bowel diseases, and much more by enhancing the gut symptom completely after being supplemented with probiotic
barrier function, thus preventing bacterial translocation from and glutamine in their diet [136]. Furthermore, another study
the gut [41]. Therefore, since HIV-infected individuals have conducted with 171 HIV+ adults with approximately 60%
significantly impaired GI tract, the potential of probiotics of them on ARV who consume yogurt for 3 years have
in improving and slowing the progression of the diseases experienced significantly less ARV- related stomach pain
would be discussed in this review. Apart from bacterial as well as fewer GI symptoms that affects daily life [137].
translocations, the other hallmark in HIV-infected individual Probiotics also have shown to benefit and treat the symptom
includes severe diarrhea, a significant decrease in CD4 cells, in HIV+ children. A meta-analysis study in children infected
and bacterial vaginosis [132] which would also be deliberated with HIV disease shows significant decrease in the duration
in this review. of diarrhea and fever [138]. These studies concluded that
probiotics significantly improve the diarrhea symptom in gastrointestinal barrier, and inhibition of potential pathogens
adults and children infected with HIV. or carcinogenesis in the gut. Together with the enhancement
The other hallmark of patients infected with HIV diseases of systemic immune or/and anti-inflammatory activities,
is that they have a significantly low number of CD4 cells probiotics may play a part in reducing the risk of multiple
count. This is due to the fact that HIV virus uses CD4 cell to chronic diseases including cancer, high serum cholesterol-
reproduce and proliferate which leads to significant decrease associated diseases, and allergic and HIV diseases. Never-
in CD4 counts and consequently damage the immune system theless, beneficial effects of probiotic on the aforementioned
of the infected individuals. Supplementation with probiotics diseases on human are still controversial due to several
has shown to improve the CD4 counts in HIV-infected factors including inappropriate design of study, inadequate
individuals. A study found that 8 out of 12 ARV-naive patients concentration of effective dosage, interaction with nutritional
who consumed probiotic yogurt daily for 15 days increase the components in food, and the utilization of animal models
CD4 counts up to 4-fold compared to placebo group [135]. A without further confirmation with human clinical trials. Also,
meta-analysis review by Carter et al. [132] found that 4 out of 7 the use of animal models does not always adequately reflect
studies on HIV+ patients who received ARV treatment show what occurs in the human body, since their metabolism may
profound increase of 62 CD4/year after including probiotic be significantly different. Therefore, it is recommended that
in their daily regime. In addition, another study reported that further studies, especially long-term human complementary
women with CD4 <200 showed a significant increase of CD4 studies, should be addressed to clarify the contention.
cells with the mean of 93 cells/𝜇L versus a mean decrease of
69 cells/𝜇L among placebo recipients [139]. However, 2-week Conflicts of Interest
and 3-month study of 17 patients showed no impact on their
CD4 cell counts, proposing that probiotics only improve CD4 The authors declare no conflicts of interest.
counts modestly among HIV-infected individuals.
Finally, the impact on probiotic supplementation among Authors’ Contributions
HIV-infected women with bacterial vaginosis was also
elucidated in this review. Bacterial vaginosis is a condi- Yusuf Nazir contributed to conception of review, design,
tion in which vaginal flora which is commonly domi- analysis, and interpretation of data, drafting of manuscript,
nated by lactobacilli gradually shifted to a complex mix of and critical revision. Syed Ammar Hussain assisted in critical
pathogenic anaerobic bacteria such as Gardnerella vaginalis revision. Aidil Abdul Hamid helped in conception of review
and Mycoplasma hominis. This condition has been reported and design of the study. Yuanda Song contributed to concep-
to facilitate disease progression as well as the transmission tion of review, design, and critical revision.
of HIV disease [140]. A randomized, double-blind, placebo-
controlled study conducted with 65 HIV-infected women Acknowledgments
(Nugent score between 4 to 10) supplemented with Lacto-
bacillus rhamnosus GR1 and Lactobacillus reuteri RC daily The authors are pleased to state that this work is supported
or placebo for 6 months were elucidated. The author found by National Natural Science Foundation of China (Grants
that these probiotics did not enhance the cure of this diseases nos. 31670064 and 31271812) and TaiShan Industrial Experts
among women with HIV but may prevent disease progression Programme.
among the populations. Therefore, probiotics may be used as
an adjuvant for bacterial vaginosis treatment for HIV patients References
in order to prevent it from spreading [141]. [1] M. Kroger, J. A. Kurmann, and J. L. Raic, “Fermented milks –
In conclusion, supplementation of probiotic has been past and present,” Journal of Food Science and Technology, vol.
shown to be beneficial in alleviating the common symptoms 43, pp. 92–99, 1989.
associated with HIV patients. Given the paucity of evidence [2] R. Fuller, “Probiotics for farm animals,” in Probiotics. A Critical
for adverse events, low cost, and potential for economic value Review, G. W. Tannock, Ed., pp. 15–22, Horizon Scientific Press,
to people living in poverty [138], the use of probiotics in Wymondham, UK, 1999.
treating and preventing further progression of HIV-infected [3] E. Metchnikoff, The Prolongation of Life: Optimistic Studies, GP
individual seems to be practical and feasible. Restoration Putnam’s Sons, New York, NY, USA, 1907.
of gut flora to a more healthful ecology may have several [4] M. L. Ritchie and T. N. Romanuk, “A meta-analysis of probiotic
important clinical benefits particularly in conjunction with efficacy for gastrointestinal diseases,” PLoS ONE, vol. 7, no. 4,
improved nutrition and access to micronutrient supplemen- Article ID e34938, 2012.
tation which will result in a better health among the HIV- [5] D. Granato, G. F. Branco, F. Nazzaro, A. G. Cruz, and J. A. F.
infected individuals. Faria, “Functional foods and nondairy probiotic food develop-
ment: trends, concepts, and products,” Comprehensive Reviews
8. Conclusions in Food Science and Food Safety, vol. 9, no. 3, pp. 292–302, 2010.
[6] Inkwood Research, “Global probiotics market forecast 2017-
Probiotics have obtained increasing medical importance 2025,” 2016.
because of their beneficial effects on the host health. Oral [7] M. Rossi, S. S. Mirbagheri, A. Keshavarzian, and F. Bishehsari,
administration of probiotics has multiple effects such as nor- “Nutraceuticals in colorectal cancer: A mechanistic approach,”
malization of the intestinal microflora, improvement of the European Journal of Pharmacology, vol. 833, pp. 396–402, 2018.
[8] E. L. Ma, Y. J. Choi, J. Choi, C. Pothoulakis, S. H. Rhee, and E. [24] K. Gupta, A. E. Stapleton, T. M. Hooton, P. L. Roberts, C. L. Fen-
Im, “The anticancer effect of probiotic Bacillus polyfermenticus nell, and W. E. Stamm, “Inverse association of H2O2-produc-
on human colon cancer cells is mediated through ErbB2 and ing lactobacilli and vaginal Escherichia coli colonization in
ErbB3 inhibition,” International Journal of Cancer, vol. 127, no. women with recurrent urinary tract infections,” The Journal of
4, pp. 780–790, 2010. Infectious Diseases, vol. 178, no. 2, pp. 446–450, 1998.
[9] V. Verhoeven, N. Renard, A. Makar et al., “Probiotics enhance [25] E. Vlková, J. Medková, and V. Rada, “Comparison of four
the clearance of human papillomavirus-related cervical lesions: methods for identification of bifidobacteria to the genus level,”
A prospective controlled pilot study,” European Journal of Can- Czech Journal of Food Sciences, vol. 20, no. No. 5, pp. 171–174,
cer Prevention, vol. 22, no. 1, pp. 46–51, 2013. 2011.
[10] G. Ettinger, K. MacDonald, G. Reid, and J. P. Burton, “The [26] G. Klein, A. Pack, C. Bonaparte, and G. Reuter, “Taxonomy and
influence of the human microbiome and probiotics on cardio- physiology of probiotic lactic acid bacteria,” International Jour-
vascular health,” Gut Microbes, vol. 5, no. 6, pp. 719–728, 2015. nal of Food Microbiology, vol. 41, no. 2, pp. 103–125, 1998.
[11] G. Di Felice, B. Barletta, C. Butteroni et al., “Use of probiotic [27] E. Miele, F. Pascarella, E. Giannetti, L. Quaglietta, R. N.
bacteria for prevention and therapy of allergic diseases: studies Baldassano, and A. Staiano, “Effect of a probiotic preparation
in mouse model of allergic sensitization,” Journal of Clinical (VSL#3) on induction and maintenance of remission in children
Gastroenterology, vol. 42, pp. S130–S132, 2008. with ulcerative colitis,” American Journal of Gastroenterology,
[12] F. C. Nwosu, E. Avershina, R. Wilson, and K. Rudi, “Gut micro- vol. 104, no. 2, pp. 437–443, 2009.
biota in HIV infection: Implication for disease progression and [28] J. Dong, G. Teng, T. Wei, W. Gao, H. Wang, and J. Green,
management,” Gastroenterology Research and Practice, vol. 2014, “Methodological quality assessment of meta-analyses and sys-
Article ID 803185, 6 pages, 2014. tematic reviews of probiotics in inflammatory bowel disease and
[13] S. I. Sayin, A. Wahlström, J. Felin et al., “Gut microbiota regu- pouchitis,” PLoS ONE, vol. 11, no. 12, Article ID e0168785, 2016.
lates bile acid metabolism by reducing the levels of tauro-beta- [29] A. P. Dubey, K. Rajeshwari, A. Chakravarty, and G. Famularo,
muricholic acid, a naturally occurring FXR antagonist,” Cell “Use of VSL#3 in the treatment of rotavirus diarrhea in children:
Metabolism, vol. 17, no. 2, pp. 225–235, 2013. preliminary results,” Journal of Clinical Gastroenterology, vol.
[14] M. Sanders, “Probiotics: definition, sources, selection, and uses,” 42, pp. S126–S129, 2008.
Clinical Infectious Diseases, vol. 46, no. s2, pp. S58–S61, 2008. [30] X. Ma, J. Hua, and Z. Li, “Probiotics improve high fat diet-
[15] Y.-S. Chen, Y.-L. Lin, R.-L. Jan, H.-H. Chen, and J.-Y. Wang, induced hepatic steatosis and insulin resistance by increasing
“Randomized placebo-controlled trial of lactobacillus on asth- hepatic NKT cells,” Journal of Hepatology, vol. 49, no. 5, pp. 821–
matic children with allergic rhinitis,” Pediatric Pulmonology, 830, 2008.
vol. 45, no. 11, pp. 1111–1120, 2010. [31] M. Schlee, J. Harder, B. Köten, E. F. Stange, J. Wehkamp, and K.
[16] C. Ezema, “Probiotics in animal production: a review,” Journal Fellermann, “Probiotic lactobacilli and VSL#3 induce entero-
of Veterinary Medicine and Animal Health, vol. 5, no. 11, pp. 308– cyte 𝛽-defensin 2,” Clinical & Experimental Immunology, vol.
316, 2013. 151, no. 3, pp. 528–535, 2008.
[17] D. M. Lilly and R. H. Stillwell, “Probiotics: growth-promoting [32] V. Nair and A. S. Soraisham, “Probiotics and prebiotics: role in
factors produced by microorganisms,” Science, vol. 147, no. 3659, prevention of nosocomial sepsis in preterm infants,” Interna-
pp. 747-748, 1965. tional Journal of Pediatrics, vol. 2013, Article ID 874726, 8 pages,
[18] G. S. Sperti, Probiotics, AVI Publishing, Westport, Conn, USA, 2013.
1971. [33] C. M. C. Chapman, G. R. Gibson, and I. Rowland, “In vitro eval-
[19] C. Hill, F. Guarner, G. Reid et al., “Expert consensus document: uation of single- and multi-strain probiotics: Inter-species inhi-
the International Scientific Association for Probiotics and bition between probiotic strains, and inhibition of pathogens,”
Prebiotics consensus statement on the scope and appropriate Anaerobe, vol. 18, no. 4, pp. 405–413, 2012.
use of the term probiotic,” Nature Reviews Gastroenterology & [34] G. Mitropoulou, V. Nedovic, A. Goyal, and Y. Kourkoutas,
Hepatology, vol. 11, no. 8, pp. 506–514, 2014. “Immobilization technologies in probiotic food production,”
[20] G. Reid, “Probiotics: definition, scope and mechanisms of Journal of Nutrition and Metabolism, vol. 2013, Article ID
action,” Best Practice & Research Clinical Gastroenterology, vol. 716861, 15 pages, 2013.
30, no. 1, pp. 17–25, 2016. [35] M. Alander, R. Satokari, R. Korpela et al., “Persistence of coloni-
[21] W. H. Holzapfel, P. Haberer, R. Geisen, J. Björkroth, and U. zation of human colonic mucosa by a probiotic strain, Lacto-
Schillinger, “Taxonomy and important features of probiotic bacillus rhamnosus GG, after oral consumption,” Applied and
microorganisms in food and nutrition,” American Journal of Environmental Microbiology, vol. 65, no. 1, pp. 351–354, 1999.
Clinical Nutrition, vol. 73, no. 2, pp. 365S–373S, 2001. [36] A. C. Ouwehand and S. J. Salminen, “The health effects of
[22] D. Harzallah and H. Belhadj, “Lactic acid bacteria as probiotics: cultured milk products with viable and non-viable bacteria,”
characteristics, selection criteria and role in immunomodula- International Dairy Journal, vol. 8, no. 9, pp. 749–758, 1998.
tion of human GI muccosal barrier,” in Lactic Acid Bacteria – [37] S. J. Lahtinen, “Probiotic viability – does it matter?” Microbial
R&D for Food, Health and Livestock Purposes, p. 198, Inteck, Ecology in Health & Disease, vol. 23, no. 1, Article ID 18567, 2012.
2013. [38] M. Kechagia, D. Basoulis, S. Konstantopoulou, D. Dimitriadi,
[23] T. Fujisawa, Y. Benno, T. Yaeshima, and T. Mitsuoka, “Taxo- K. Gyftopoulou, N. Skarmoutsou et al., “Health benefits of
nomic study of the Lactobacillus acidophilus group, with recog- probiotics: a review,” ISRN Nutrition, vol. 2013, Article ID
nition of Lactobacillus gallinarum sp. nov. and Lactobacillus 481651, 2013.
johnsonii sp. nov. and synonymy of Lactobacillus acidophilus [39] N. P. Shah, W. E. V. Lankaputhra, M. L. Britz, and W. S. A. Kyle,
group A3 (Johnson et al. 1980) with the type strain of Lacto- “Survival of Lactobacillus acidophilus and Bifidobacterium
bacillus amylovorus (Nakamura 1981),” International Journal of bifidum in commercial yoghurt during refrigerated storage,”
Systematic Bacteriology, vol. 42, no. 3, pp. 487–491, 1992. International Dairy Journal, vol. 5, no. 5, pp. 515–521, 1995.
[40] U. Schillinger, “Isolation and identification of lactobacilli from cancer in young men from Southern China,” American Journal
novel-type probiotic and mild yoghurts and their stability of Clinical Nutrition, vol. 83, no. 5, pp. 1199–1203, 2006.
during refrigerated storage,” International Journal of Food [56] M. Toi, S. Hirota, A. Tomotaki et al., “Probiotic beverage with
Microbiology, vol. 47, no. 1-2, pp. 79–87, 1999. soy isoflavone consumption for breast cancer prevention: A
[41] M. Bermudez-Brito, J. Plaza-Dı́az, S. Muñoz-Quezada, C. case-control study,” Current Nutrition and Food Science, vol. 9,
Gómez-Llorente, and A. Gil, “Probiotic mechanisms of action,” no. 3, pp. 194–200, 2013.
Annals of Nutrition and Metabolism, vol. 61, no. 2, pp. 160–174, [57] Y. Ohashi, S. Nakai, T. Tsukamoto et al., “Habitual intake of
2012. lactic acid bacteria and risk reduction of bladder cancer,” Uro-
[42] A. Khalighi, R. Behdani, and S. Kouhestani, “Probiotics-A logia Internationalis, vol. 68, no. 4, pp. 273–280, 2002.
comprehensive review of their classification, mode of action [58] A. Costabile, I. Buttarazzi, S. Kolida et al., “An in vivo assess-
and role in human nutrition,” in Probiotics and Prebiotics in ment of the cholesterol-lowering efficacy of Lactobacillus plan-
Human Nutrition and Health, V. Rao and L. G. Rao, Eds., InTech tarum ECGC 13110402 in normal to mildly hypercholestero-
Publishers, 2016. laemic adults,” PLoS ONE, vol. 12, no. 12, Article ID e0187964,
[43] K. H. Wilson and F. Perini, “Role of competition for nutrients in 2017.
suppression of Clostridium difficile by the colonic microflora,” [59] T. Kullisaar, K. Zilmer, T. Salum, A. Rehema, and M. Zilmer,
Infection and Immunity, vol. 56, no. 10, pp. 2610–2614, 1988. “The use of probiotic L. fermentum ME-3 containing Reg’Activ
[44] L. V. Hooper, T. S. Stappenbeck, C. V. Hong, and J. I. Gordon, Cholesterol supplement for 4 weeks has a positive influence
“Angiogenins: A new class of microbicidal proteins involved in on blood lipoprotein profiles and inflammatory cytokines: an
innate immunity,” Nature Immunology, vol. 4, no. 3, pp. 269– open-label preliminary study,” Nutrition Journal, vol. 15, no. 1,
273, 2003. p. 93, 2016.
[45] R. B. Sartor, “Mechanisms of disease: pathogenesis of Crohn’s [60] L. J. Bernini, A. N. C. Simão, D. F. Alfieri et al., “Beneficial
disease and ulcerative colitis,” Nature Clinical Practice Gastroen- effects of Bifidobacterium lactis on lipid profile and cytokines in
terology & Hepatology, vol. 3, no. 7, pp. 390–407, 2006. patients with metabolic syndrome: A randomized trial. Effects
[46] J. E. Pizzorno, Textbook of Natural Medicine, Elsevier Health of probiotics on metabolic syndrome,” Nutrition Journal , vol.
Sciences, 2013. 32, no. 6, pp. 716–719, 2016.
[47] A. C. Ouwehand, “Antimicrobial components from lactic acid [61] M. Ito, S. Kusuhara, W. Yokoi et al., “Streptococcus ther-
bacteria,” in Lactic Acid Bacteria: Microbiology and Functional mophilus fermented milk reduces serum MDA-LDL and blood
Aspects, S. Salminen and A. von Wright, Eds., pp. 139–159, pressure in healthy and mildly hypercholesterolaemic adults,”
Dekker, New York, NY, USA, 1998. Beneficial Microbes, vol. 8, no. 2, pp. 171–178, 2017.
[48] J. B. Russell and F. Diez-Gonzalez, “The effects of fermentation [62] J. W. Anderson and S. E. Gilliland, “Effect of fermented milk
acids on bacterial growth,” in Advances in Microbial Physiology, (yogurt) containing Lactobacillus acidophilus L1 on serum
vol. 39, pp. 205–234, Academic Press, 1997. cholesterol in hypercholesterolemic humans,” Journal of the
[49] D. S. Nielsen, G.-S. Cho, A. Hanak, M. Huch, C. M. A. P. Franz, American College of Nutrition, vol. 18, no. 1, pp. 43–50, 1999.
and N. Arneborg, “The effect of bacteriocin-producing Lacto- [63] J. Z. Xiao, S. Kondo, N. Takahashi et al., “Effects of milk products
bacillus plantarum strains on the intracellular pH of sessile and fermented by Bifidobacterium longum on blood lipids in rats
planktonic Listeria monocytogenes single cells,” International and healthy adult male volunteers,” Journal of Dairy Science, vol.
Journal of Food Microbiology, vol. 141, pp. S53–S59, 2010. 86, no. 7, pp. 2452–2461, 2003.
[50] V. Lievin, I. Peiffer, S. Hudault et al., “Bifidobacterium strains [64] M. Naruszewicz, M.-L. Johansson, D. Zapolska-Downar, and H.
from resident infant human gastrointestinal microflora exert Bukowska, “Effect of Lactobacillus plantarum 299v on cardio-
antimicrobial activity,” Gut, vol. 47, no. 5, pp. 646–652, 2000. vascular disease risk factors in smokers,” American Journal of
[51] C. Gómez-Llorente, S. Muñoz, and A. Gil, “Role of Toll-like Clinical Nutrition, vol. 76, no. 6, pp. 1249–1255, 2002.
receptors in the development of immunotolerance mediated by [65] M. C. Bertolami, A. A. Faludi, and M. Batlouni, “Evaluation of
probiotics,” Proceedings of the Nutrition Society, vol. 69, no. 3, the effects of a new fermented milk product (Gaio) on primary
pp. 381–389, 2010. hypercholesterolemia,” European Journal of Clinical Nutrition,
[52] Y.-G. Kim, T. Ohta, T. Takahashi et al., “Probiotic Lactobacillus vol. 53, no. 2, pp. 97–101, 1999.
casei activates innate immunity via NF-𝜅B and p38 MAP kinase [66] K. Wickens, P. Black, T. V. Stanley et al., “A protective effect
signaling pathways,” Microbes and Infection, vol. 8, no. 4, pp. of Lactobacillus rhamnosus HN001 against eczema in the first
994–1005, 2006. 2 years of life persists to age 4 years,” Clinical & Experimental
[53] C. Pagnini, R. Saeed, G. Bamias, K. O. Arseneau, T. T. Pizarro, Allergy, vol. 42, no. 7, pp. 1071–1079, 2012.
and F. Cominelli, “Probiotics promote gut health through stim- [67] Y. Han, B. Kim, J. Ban et al., “A randomized trial of Lactobacillus
ulation of epithelial innate immunity,” Proceedings of the plantarum CJLP133 for the treatment of atopic dermatitis,”
National Acadamy of Sciences of the United States of America, Pediatric Allergy and Immunology, vol. 23, no. 7, pp. 667–673,
vol. 107, no. 1, pp. 454–459, 2010. 2012.
[54] Z.-H. Liu, M.-J. Huang, X.-W. Zhang et al., “The effects of [68] T.-Y. Lin, C.-J. Chen, L.-K. Chen, S.-H. Wen, and R.-H. Jan,
perioperative probiotic treatment on serum zonulin concen- “Effect of probiotics on allergic rhinitis in Df, Dp or dust-
tration and subsequent postoperative infectious complications sensitive children: A randomized double blind controlled trial,”
after colorectal cancer surgery: A double-center and double- Indian Pediatrics, vol. 50, no. 2, pp. 209–213, 2013.
blind randomized clinical trial,” American Journal of Clinical [69] A. H. Otake, R. Chammas, and R. Zatz, “Câncer: novos alvos
Nutrition, vol. 97, no. 1, pp. 117–126, 2013. para tratamento,” Ciencia Hoje, vol. 38, no. 223, p. 28, 2006.
[55] H. S. El-Nezami, N. N. Polychronaki, J. Ma et al., “Probiotic [70] L. Balducci, “Aging, frailty, and chemotherapy,” Cancer Control,
supplementation reduces a biomarker for increased risk of liver vol. 14, no. 1, pp. 7–12, 2007.
[71] J. Luo, N. L. Solimini, and S. J. Elledge, “Principles of cancer [87] J. Šušković, K. Blazenka, J. Beganović, A. L. Pavunc, K. Habjanič,
therapy: Oncogene and non-oncogene addiction,” Cell, vol. 136, and S. Matosic, “Antimicrobial activity—the most important
no. 5, pp. 823–837, 2009. property of probiotic and starter lactic acid bacteria,” ood
[72] D. Hanahan and R. A. Weinberg, “Hallmarks of cancer: the next Technology and Biotechnology, vol. 48, no. 3, pp. 296–307, 2010.
generation,” Cell, vol. 144, no. 5, pp. 646–674, 2011. [88] Y. Oh, M. S. Osato, X. Han, G. Bennett, and W. K. Hong,
[73] P. Anand, A. B. Kunnumakara, C. Sundaram et al., “Cancer “Folk yoghurt kills Helicobacter pylori,” Journal of Applied
is a preventable disease that requires major lifestyle changes,” Microbiology, vol. 93, no. 6, pp. 1083–1088, 2002.
Pharmaceutical Research, vol. 25, no. 9, pp. 2097–2116, 2008. [89] X. Chen, X.-M. Liu, F. Tian et al., “Antagonistic activities of
[74] S. McGuire, “World Cancer Report 2014. Geneva, Switzerland: Lactobacilli against Helicobacter pylori growth and infection in
World Health Organization, International Agency for Research human gastric epithelial cells,” Journal of Food Science, vol. 77,
on Cancer, WHO Press, 2015,” Advances in Nutrition, vol. 7, no. no. 1, pp. M9–M14, 2012.
2, pp. 418-419, 2016. [90] C.-H. Kuo, S. S. W. Wang, C.-Y. Lu et al., “Long-term use of
[75] J. W. Lee, J. G. Shin, E. H. Kim, H. E. Kang, I. B. Yim et al., probiotic-containing yogurts is a safe way to prevent Helicobac-
“Immunomodulatory and antitumor effects in vivo by the cyto- ter pylori: Based on a mongolian Gerbil’s model,” Biochemistry
plasmic fraction of Lactobacillus casei and Bifidobacterium Research International, vol. 2013, Article ID 594561, 7 pages,
longum,” Journal of Veterinary Science, vol. 5, pp. 41–48, 2004. 2013.
[76] F. Russo, A. Orlando, M. Linsalata, A. Cavallini, and C. Messa, [91] L. Makras, V. Triantafyllou, D. Fayol-Messaoudi et al., “Kinetic
“Effects of Lactobacillus rhamnosus GG on the cell growth and analysis of the antibacterial activity of probiotic lactobacilli
polyamine metabolism in HGC-27 human gastric cancer cells,” towards Salmonella enterica serovar Typhimurium reveals a
Nutrition and Cancer, vol. 59, no. 1, pp. 106–114, 2007. role for lactic acid and other inhibitory compounds,” Research
[77] A. Orlando, M. G. Refolo, C. Messa et al., “Antiproliferative in Microbiology, vol. 157, no. 3, pp. 241–247, 2006.
and proapoptotic effects of viable or heat-killed Lactobacillus [92] P. Chaikham, A. Apichartsrangkoon, W. Jirarattanarangsri, and
paracasei IMPC2.1 and Lactobacillus rhamnosus GG in HGC- T. Van de Wiele, “Influence of encapsulated probiotics com-
27 gastric and DLD-1 colon cell lines,” Nutrition and Cancer, vol. bined with pressurized longan juice on colon microflora and
64, no. 7, pp. 1103–1111, 2012. their metabolic activities on the exposure to simulated dynamic
[78] Y. Kim, D. Lee, and D. Kim, “Inhibition of proliferation in colon gastrointestinal tract,” Food Research International, vol. 49, no.
cancer cell lines and harmful enzyme activity of colon bac- 1, pp. 133–142, 2012.
teria by Bifidobacterium adolescentis SPM0212,” Archives of [93] J. Li, C. Y. Sung, N. Lee et al., “Probiotics modulated gut micro-
Pharmacal Research, vol. 31, no. 4, pp. 468–473, 2008. biota suppresses hepatocellular carcinoma growth in mice,”
[79] Y. Kim, S. Oh, H. S. Yun, S. Oh, and S. H. Kim, “Cell-bound Proceedings of the National Acadamy of Sciences of the United
exopolysaccharide from probiotic bacteria induces autophagic States of America, vol. 113, no. 9, pp. E1306–E1315, 2016.
cell death of tumour cells,” Letters in Applied Microbiology, vol. [94] S. Roy and G. Trinchieri, “Microbiota: A key orchestrator of
51, no. 2, pp. 123–130, 2010. cancer therapy,” Nature Reviews Cancer, vol. 17, no. 5, pp. 271–
[80] A. Borowicki, A. Michelmann, K. Stein et al., “Fermented 285, 2017.
wheat aleurone enriched with probiotic strains LGG and Bb12 [95] D. M. Commane, C. T. Shortt, S. Silvi, A. Cresci, R. M. Hughes,
modulates markers of tumor progression in human colon cells,” and I. R. Rowland, “Effects of fermentation products of pro- and
Nutrition and Cancer, vol. 63, no. 1, pp. 151–160, 2011. prebiotics on trans-epithelial electrical resistance in an in vitro
[81] K. Stein, A. Borowicki, D. Scharlau et al., “Effects of synbiotic model of the colon,” Nutrition and Cancer, vol. 51, no. 1, pp. 102–
fermentation products on primary chemoprevention in human 109, 2005.
colon cells,” The Journal of Nutritional Biochemistry, vol. 23, no. [96] J. S. Ko, H. R. Yang, J. Y. Chang, and J. K. Seo, “Lactobacil-
7, pp. 777–784, 2012. lus plantarum inhibits epithelial barrier dysfunction and inter-
[82] F. J. Cousin, S. Jouan-Lanhouet, M.-T. Dimanche-Boitrel, L. lukin-8 secretion induced by tumor necrosis factor-𝛼,” World
Corcos, and G. Jan, “Milk fermented by propionibacterium Journal of Gastroenterology, vol. 13, no. 13, pp. 1962–1965, 2007.
freudenreichii induces apoptosis of HGT-1 human gastric can- [97] C. Jones, S. A. Badger, M. Regan et al., “Modulation of gut
cer cells,” PLoS ONE, vol. 7, no. 3, Article ID e31892, 2012. barrier function in patients with obstructive jaundice using
[83] M. Cha, D. Lee, H. An et al., “Antiviral activity of Bifidobac- probiotic LP299v,” European Journal of Gastroenterology &
terium adolescentisSPM1005-A on human papillomavirus type Hepatology, vol. 25, no. 12, pp. 1424–1430, 2013.
16,” BMC Medicine, vol. 10, no. 1, article 72, 2012. [98] S. Ahrne and M. L. J. Hagslatt, “Effect of lactobacilli on para-
[84] R. Azam, S. Ghafouri-Fard, M. Tabrizi et al., “Lactobacillus acid- cellular permeability in the gut,” Nutrients, vol. 3, no. 1, pp. 104–
ophilus and Lactobacillus crispatus culture supernatants down- 117, 2011.
regulate expression of cancer-testis genes in the MDA-MB-231 [99] A.-Q. Yu and L. Li, “The Potential Role of Probiotics in Cancer
cell line,” Asian Pacific Journal of Cancer Prevention, vol. 15, no. Prevention and Treatment,” Nutrition and Cancer, vol. 68, no. 4,
10, pp. 4255–4259, 2014. pp. 535–544, 2016.
[85] M. Ghoneum and J. Gimzewski, “Apoptotic effect of a novel kefir [100] G. H. McIntosh, P. J. Royle, and M. J. Playne, “A probiotic strain
product, PFT, on multidrug-resistant myeloid leukemia cells via of L. Acidophilus reduces DMH-induced large intestinal tumors
a hole-piercing mechanism,” International Journal of Oncology, in male sprague-dawley rats,” Nutrition and Cancer, vol. 35, no.
vol. 44, no. 3, pp. 830–837, 2014. 2, pp. 153–159, 1999.
[86] Y. Nami, B. Haghshenas, M. Haghshenas, N. Abdullah, and A. [101] H. Horie, M. Zeisig, K. Hirayama, T. Midtvedt, L. Möller, and J.
Y. Khosroushahi, “The Prophylactic effect of probiotic Entero- Rafter, “Probiotic mixture decreases DNA adduct formation in
coccus lactis IW5 against different human cancer cells,” Fron- colonic epithelium induced by the food mutagen 2-amino-9H-
tiers in Microbiology, vol. 6, 2015. pyrido[2,3-b]indole in a human-flora associated mouse model,”
European Journal of Cancer Prevention, vol. 12, no. 2, pp. 101–107, colonic tumorigenesis through suppressed colonic mucosa cel-
2003. lular proliferation and increased stimulation of macrophages,”
[102] D. L. Oberreuther-Moschner, G. Jahreis, G. Rechkemmer, and Journal of Agricultural and Food Chemistry, vol. 59, no. 24, pp.
B. L. Pool-Zobel, “Dietary intervention with the probiotics 13337–13345, 2011.
Lactobacillus acidophilus 145 Bifidobacterium longum 913 [116] D. K. Lee, S. Jang, M. J. Kim et al., “Anti-proliferative effects of
modulates the potential of human faecal water to induce Bifidobacterium adolescentis SPM0212 extract on human colon
damage in HT29clone19A cells,” British Journal of Nutrition, vol. cancer cell lines,” BMC Cancer, vol. 8, 2008.
91, no. 6, pp. 925–932, 2004. [117] N. M. El-Deeb, A. M. Yassin, L. A. Al-Madboly, and A. El-
[103] S.-L. Yeh, M.-S. Lin, and H.-L. Chen, “Inhibitory effects of a sol- Hawiet, “A novel purified Lactobacillus acidophilus 20079 exo-
uble dietary fiber from Amorphophallus konjac on cytotoxicity polysaccharide, LA-EPS-20079, molecularly regulates both
and DNA damage induced by fecal water in caco-2 cells,” Planta apoptotic and NF-ΚB inflammatory pathways in human colon
Medica, vol. 73, no. 13, pp. 1384–1388, 2007. cancer,” Microbial Cell Factories, vol. 17, no. 1, article 29, 2018.
[104] A. Kumar, N. K. Singh, and P. R. Sinha, “Inhibition of 1,2- [118] E. Elinav, R. Nowarski, C. A. Thaiss, B. Hu, C. Jin, and R.
dimethylhydrazine induced colon genotoxicity in rats by the A. Flavell, “Inflammation-induced cancer: crosstalk between
administration of probiotic curd,” Molecular Biology Reports, tumours, immune cells and microorganisms,” Nature Reviews
vol. 37, no. 3, pp. 1373–1376, 2010. Cancer, vol. 13, no. 11, pp. 759–771, 2013.
[105] L. D. Prisciandaro, M. S. Geier, A. E. Chua et al., “Probiotic fac- [119] S. Matsumoto, T. Hara, M. Nagaoka et al., “A component
tors partially prevent changes to caspases 3 and 7 activation and of polysaccharide peptidoglycan complex on Lactobacillus
transepithelial electrical resistance in a model of 5-fluorouracil- induced an improvement of murine model of inflammatory
induced epithelial cell damage,” Supportive Care in Cancer, vol. bowel disease and colitis-associated cancer,” The Journal of
20, no. 12, pp. 3205–3210, 2012. Immunology, vol. 128, no. 1, pp. e170–e180, 2009.
[106] R. K. Le Leu, I. L. Brown, Y. Hu et al., “A synbiotic combination [120] C. B. Appleyard, M. L. Cruz, A. A. Isidro, J. C. Arthur, C. Jobin,
of resistant starch and Bifidobacterium lactis facilitates apop- and C. de Simone, “Pretreatment with the probiotic VSL#3
totic deletion of carcinogen-damaged dells in rat colon,” Journal delays transition from inflammation to dysplasia in a rat model
of Nutrition, vol. 135, no. 5, pp. 996–1001, 2005. of colitis-associated cancer,” American Journal of Physiology-
[107] I. R. Rowland, C. J. Rumney, J. T. Coutts, and L. C. Lievense, Gastrointestinal and Liver Physiology, vol. 301, no. 6, pp. G1004–
“Effect of Bifidobacterium longum and inulin on gut bacterial G1013, 2011.
metabolism and carcinogen-induced aberrant crypt foci in
[121] Z. Guo, X. M. Liu, Q. X. Zhang et al., “Influence of consumption
rats,” Carcinogenesis, vol. 19, no. 2, pp. 281–285, 1998.
of probiotics on the plasma lipid profile: A meta-analysis of
[108] S. Nakanishi, K. Kataoka, T. Kuwahara, and Y. Ohnishi, “Effects randomised controlled trials,” Nutrition, Metabolism & Cardio-
of high amylose maize starch and clostridium butyricum on vascular Diseases, vol. 21, no. 11, pp. 844–850, 2011.
metabolism in colonic microbiota and formation of azoxy-
[122] L.-G. Ooi and M.-T. Liong, “Cholesterol-lowering effects of
methane-induced aberrant crypt foci in the rat colon,” Micro-
probiotics and prebiotics: a review of in vivo and in vitro
biology and Immunology, vol. 47, no. 12, pp. 951–958, 2003.
findings,” International Journal of Molecular Sciences, vol. 11, no.
[109] A. De Moreno De LeBlanc and G. Perdigón, “Reduction of 6, pp. 2499–2522, 2010.
𝛽-glucuronidase and nitroreductase activity by yoghurt in a
murine colon cancer model,” Biocell, vol. 29, no. 1, pp. 15–24, [123] M. Begley, C. Hill, and C. G. M. Gahan, “Bile salt hydrolase
2005. activity in probiotics,” Applied and Environmental Microbiology,
vol. 72, no. 3, pp. 1729–1738, 2006.
[110] E. Park, G.-I. Jeon, J.-S. Park, and H.-D. Paik, “A probiotic strain
of Bacillus polyfermenticus reduces DMH induced precancerous [124] Usman and A. Hosono, “Bile tolerance, taurocholate deconjuga-
lesions in F344 male rat,” Biological & Pharmaceutical Bulletin, tion, and binding of cholesterol by Lactobacillus gasseri strains,”
vol. 30, no. 3, pp. 569–574, 2007. Journal of Dairy Science, vol. 82, no. 2, pp. 243–248, 1999.
[111] S. Ohkawara, H. Furuya, K. Nagashima, N. Asanuma, and [125] H. Kimoto, S. Ohmomo, and T. Okamoto, “Cholesterol removal
T. Hino, “Oral administration of Butyrivibrio fibrisolvens, from media by lactococci,” Journal of Dairy Science, vol. 85, no.
a butyrate-producing bacterium, decreases the formation of 12, pp. 3182–3188, 2002.
aberrant crypt foci in the colon and rectum of mice,” Journal [126] Y.-R. Chiang, W. Ismail, D. Heintz, C. Schaeffer, A. Van Dorsse-
of Nutrition, vol. 135, no. 12, pp. 2878–2883, 2005. laer, and G. Fuchs, “Study of anoxic and oxic cholesterol meta-
[112] J. R. Lakritz, T. Poutahidis, T. Levkovich et al., “Beneficial bolism by Sterolibacterium denitrificans,” Journal of Bacteriol-
bacteria stimulate host immune cells to counteract dietary and ogy, vol. 190, no. 3, pp. 905–914, 2008.
genetic predisposition to mammary cancer in mice,” Interna- [127] M.-T. Liong, F. R. Dunshea, and N. P. Shah, “Effects of a
tional Journal of Cancer, vol. 135, no. 3, pp. 529–540, 2014. synbiotic containing Lactobacillus acidophilus ATCC 4962 on
[113] K. Yamazaki, A. Tsunoda, M. Sibusawa et al., “The effect of plasma lipid profiles and morphology of erythrocytes in hyper-
an oral administration of Lactobacillus casei strain shirota on cholesterolaemic pigs on high- and low-fat diets,” British Journal
azoxymethane-induced colonic aberrant crypt foci and colon of Nutrition, vol. 98, no. 4, pp. 736–744, 2007.
cancer in the rat,” Oncology Reports, vol. 7, no. 5, pp. 977–1059, [128] S. F. Thomsen, “Epidemiology and natural history of atopic
2000. diseases,” European Clinical Respiratory Journal, vol. 2, no. 1,
[114] A. Takagi, T. Matsuzaki, M. Sato, K. Nomoto, M. Morotomi, Article ID 24642, 2015.
and T. Yokokura, “Enhancement of natural killer cytotoxicity [129] T. Matsuki, K. Watanabe, R. Tanaka, M. Fukuda, and H. Oyaizu,
delayed murine carcinogenesis by a probiotic microorganism,” “Distribution of bifidobacterial species in human intestinal
Carcinogenesis, vol. 22, no. 4, pp. 599–605, 2001. microflora examined with 16S rRNA-gene-targeted species-
[115] N.-P. Foo, H. O. Yang, H.-H. Chiu et al., “Probiotics prevent specific primers,” Applied and Environmental Microbiology, vol.
the development of 1,2-dimethylhydrazine (DMH)-induced 65, no. 10, pp. 4506–4512, 1999.
[130] O. Ozdemir, “Prebiotics and probiotics in allergy: potential

mechanisms of prebiotics’ and probiotics’ actions in allergy -
(part 1),” MOJ Immunology, vol. 3, no. 1, Article ID 00069, 2016.
[131] N. R. Klatt, L. A. Canary, X. Sun et al., “Probiotic/prebiotic
supplementation of antiretrovirals improves gastrointestinal
immunity in SIV-infected macaques,” The Journal of Clinical
Investigation, vol. 123, no. 2, pp. 903–907, 2013.
[132] G. M. Carter, A. Esmaeili, H. Shah et al., “Probiotics in human
immunodeficiency virus infection: a systematic review and
evidence synthesis of benefits and risks,” Open Forum Infectious
Diseases, vol. 3, no. 4, Article ID ofw164, 2016.
[133] J. Villar-Garcı́a, J. J. Hernández, R. Güerri-Fernández et al.,
“Effect of probiotics (Saccharomyces boulardii) on microbial
translocation and inflammation in HIV-treated patients: a
double-blind, randomized, placebo-controlled trial,” Journal of
Acquired Immune Deficiency Syndromes, vol. 68, no. 3, pp. 256–
263, 2015.
[134] M. A. Whaling, I. Luginaah, G. Reid et al., “Perceptions about
probiotic yogurt for health and nutrition in the context of
HIV/AIDS in Mwanza, Tanzania,” Journal of Health, Population
and Nutrition, vol. 30, no. 1, pp. 31–40, 2012.
[135] K. C. Anukam, E. O. Osazuwa, H. B. Osadolor, A. W. Bruce, and
G. Reid, “Yogurt containing probiotic Lactobacillus rhamnosus
GR-1 and L. reuteri RC-14 helps resolve moderate diarrhea and
increases CD4 count in HIV/AIDS patients,” Journal of Clinical
Gastroenterology, vol. 42, no. 3, pp. 239–243, 2008.
[136] C. R. Heiser, J. A. Ernst, J. T. Barrett, N. French, M. Schutz, and
M. P. Dube, “Probiotics, soluble fiber, and L-glutamine (GLN)
reduce nelfinavir (NFV)or lopinavir/ritonavir (LPV/r)-related
diarrhea,” Journal of the International Association of Physicians
in AIDS Care, vol. 3, no. 4, pp. 121–129, 2004.
[137] S. L. Irvine, R. Hummelen, and S. Hekmat, “Probiotic yogurt
consumption may improve gastrointestinal symptoms, pro-
ductivity, and nutritional intake of people living with human
immunodeficiency virus in Mwanza, Tanzania,” Nutrition
Research, vol. 31, no. 12, pp. 875–881, 2011.
[138] P. Salari, S. Nikfar, and M. Abdollahi, “A meta-analysis and
systematic review on the effect of probiotics in acute diarrhea,”
Inflammation & Allergy - Drug Targets, vol. 11, no. 1, pp. 3–14,
2012.
[139] R. Hummelen, J. Changalucha, N. L. Butamanya et al., “Effect
of 25 weeks probiotic supplementation on immune function of
HIV patients.,” Gut Microbes, vol. 2, no. 2, pp. 80–85, 2011.
[140] S. L. Hillier, M. A. Krohn, L. K. Rabe, S. J. Klebanoff, and D. A.
Eschenbach, “The normal vaginal flora, H2O2-producing lac-
tobacilli, and bacterial vaginosis in pregnant women,” Clinical
Infectious Diseases, vol. 16, pp. S273–S281, 1993.
[141] R. Hummelen, J. Changalucha, N. L. Butamanya, A. Cook, J.
D. F. Habbema, and G. Reid, “Lactobacillus rhamnosus GR-
1 and L. reuteri RC-14 to prevent or cure bacterial vaginosis
among women with HIV,” International Journal of Gynecology
and Obstetrics, vol. 111, no. 3, pp. 245–248, 2010.
Hindawi
https://doi.org/10.1155/2018/4526576
Research Article
Molecular Basis of Macrolide Resistance in Campylobacter
Strains Isolated from Poultry in South Korea
Bai Wei and Min Kang

Department of Veterinary Infectious Diseases and Avian Diseases, College of Veterinary Medicine and Center for Poultry
Diseases Control, Chonbuk National University, Jeonju, Republic of Korea
Correspondence should be addressed to Min Kang; vet.minkang@gmail.com
Received 11 March 2018; Accepted 19 June 2018; Published 5 July 2018
Academic Editor: Marı́a de Guı́a Córdoba
Copyright © 2018 Bai Wei and Min Kang. This is an open access article distributed under the Creative Commons Attribution
cited.
We investigated the molecular mechanisms underlying macrolide resistance in 38 strains of Campylobacter isolated from poultry.
Twenty-seven strains were resistant to azithromycin and erythromycin, five showed intermediate azithromycin resistance and
erythromycin susceptibility, and six showed azithromycin resistance and erythromycin susceptibility. Four Campylobacter jejuni
and six Campylobacter coli strains had azithromycin MICs which were 8–16 and 2–8-fold greater than those of erythromycin,
respectively. The A2075G mutation in the 23S rRNA gene was detected in 11 resistant strains with MICs ranging from 64 to ≥
512 𝜇g/mL. Mutations including V137A, V137S, and a six-amino acid insertion (114-VAKKAP-115) in ribosomal protein L22 were
detected in the C. jejuni strains. Erythromycin ribosome methylase B-erm(B) was not detected in any strain. All strains except three
showed increased susceptibility to erythromycin with twofold to 256-fold MIC change in the presence of phenylalanine arginine
ß-naphthylamide (PAßN); the effects of PAßN on azithromycin MICs were limited in comparison to those on erythromycin MICs,
and 13 strains showed no azithromycin MIC change in the presence of PAßN. Differences between azithromycin and erythromycin
resistance and macrolide resistance phenotypes and genotypes were observed even in highly resistant strains. Further studies are
required to better understand macrolide resistance in Campylobacter.
1. Introduction the macrocyclic ring of the macrolide [3]. Point mutations

in domain V of the 23S rRNA at positions 2,074 and 2,075
Infection with Campylobacter spp. is considered to be the are the most common mechanisms for high-level macrolide
most common cause of bacterial gastroenteritis in humans resistance in Campylobacter spp. [4]. Several modifications in
worldwide. Macrolides are considered the first drug of the ribosomal proteins L4 and L22 are associated with low-
choice for treating Campylobacter gastroenteritis. Resistance to intermediate-level macrolide resistance in Campylobac-
to macrolides has been reported in a few scattered clinical ter [4]. The chromosomally encoded multidrug resistance-
isolates of Campylobacter across the world. High prevalence nodulation-cell division (RND) efflux system is involved
of macrolide-resistant Campylobacter spp., especially C. coli, in intrinsic and acquired macrolide resistance in Campy-
in animal meat has been reported [1], and this finding is of lobacter spp. [4]. A ribosomal methylase, encoded by the
concern because of the risk of transmission of such isolates erythromycin ribosome methylase B-erm(B) gene, located
to human. in the chromosomal multidrug resistance genomic island
Modification of the antibiotic target genes via methyla- (MDRGI) in C. coli from swine, was reported for the first time
tion or mutation, and efflux of antibiotics from bacterial cells in China in 2014 [5]. Subsequently, several reports emerged
could induce macrolide resistance [2]. The most important of erm(B)-harboring C. jejuni in animal meat including that
macrolide resistance mechanism in Campylobacter involves of swine and chicken and in human diarrheal samples [6, 7].
the modification of ribosomal target sites and weakening of Outside China, an erm(B)-positive C. coli strain was isolated
the interaction between the tunnel wall of the ribosome and from chicken in Spain in 2016 [8].
Macrolides are a class of natural or semisynthetic strains collected from each source was as follows: (1) in 176
products comprising a large macrocyclic lactone ring to feces samples from breeder chicken farms, 88 isolates of
which one or more deoxy sugars are attached [2]. The Campylobacter were collected and 17 strains (one C. jejuni
lactone rings can be either 14-membered (clarithromycin, and 16 C. coli) showed resistance to azithromycin; (2) in
dirithromycin, erythromycin, and roxithromycin), 15- 1,003 samples (feces and environmental samples) from broiler
membered (azithromycin), or 16-membered (josamycin, chicken farms, 55 isolates were collected and none of them
kitasamycin, spiramycin, and tylosin) [2]. In general, showed resistance to azithromycin or erythromycin; (3) in
modification of ribosomal targets and drug efflux confer 249 chicken meat samples from retail markets, 104 isolates
cross-resistance to macrolides. During antibiotic treatment were collected and 15 strains (10 C. jejuni and five C. coli)
in clinical settings, erythromycin and azithromycin are showed resistance to azithromycin; and (4) in 106 duck
widely used because they have a broad spectrum of meat sample from retail markets, 102 isolates were collected
activity not only against Gram-positive bacteria, but also and six strains (four C. jejuni and two C. coli) showed
against Gram-negative bacteria [9]. Azithromycin is more resistance to azithromycin. The MICs of azithromycin and
potent than erythromycin against Gram-negative bacteria
erythromycin were determined using agar or broth dilution
including Campylobacter, with a lower MIC [9]. However,
methods and the breakpoints were as defined by the National
azithromycin shows a higher MIC than erythromycin
Antimicrobial Resistance Monitoring System (NARMS) for
against Gram-positive bacteria and rarely acts against
azithromycin: susceptible, ≤ 2 𝜇g/mL; intermediate, 4 𝜇g/mL;
Gram-negative bacteria [10, 11]. The diverse mechanisms
and resistant, ≥ 8 𝜇g/mL. The MIC breakpoints for ery-
underlying resistance to erythromycin and azithromycin
thromycin were susceptible, ≤ 8 𝜇g/mL; intermediate, 16
continue to be unclear.
𝜇g/mL; and resistant, ≥ 32 𝜇g/mL [17]. The reference strain
It is well known that the handling and/or consumption
C. jejuni ATCC 33560 was used as the quality control
of chicken meat are the main causes of human infection strain.
with Campylobacter. Other poultry sources also pose a
similar threat to human health. Even though the verti-
2.2. Characterization of Macrolide Resistance in Campylobac-
cal transmission of Campylobacter is questionable, breeder
ter Strains. Genomic DNA templates for PCR were prepared
chicken harboring antibiotic-resistant bacteria could be
using fresh Campylobacter colonies on 5 % sheep blood agar
a public health threat as they can horizontally transmit
plates (Komed, Seongnam, South Korea) by adding 100 𝜇l
antibiotic-resistant Campylobacter to broiler chicken in the
sterile distilled water and boiling in a heater block at 100∘ C
production chain, indirectly leading to human infection for 15 min. Mutations at positions 2,074 and 2,075 of the
[12]. With the increasing consumption of duck meat around domain V of 23S rRNA gene were analyzed by sequencing
the world and worldwide reports of duck-related product- all three copies of 23S rRNA. Three separate reactions were
induced human campylobacteriosis, researchers are focusing
employed to amplify the three copies of the 23S rRNA gene
more on antibiotic-resistant Campylobacter found in duck
in all C. jejuni and C. coli strains [3]. Subsequently, potential
[13, 14]. Even though the occurrence of highly macrolide-
macrolide resistance-associated mutations were identified by
resistant Campylobacter in breeder chicken and macrolide-
sequencing a 308-bp fragment from each copy of the target
resistant Campylobacter in duck meat has been reported
gene [3].
[15, 16], the causes of macrolide resistance in these species
In addition, to assess the contribution of mutations
have rarely been reported. Therefore, we investigated the
within the ribosomal genes rplD and rplV encoding L4 and
genetic basis of macrolide resistance in Campylobacter from L22, respectively, to macrolide resistance, sequence analysis
poultry sources including breeder chicken and chicken and of these genes was performed for all 38 strains. L4- and
duck meat and identified the isolated strains as C. jejuni L22-encoding genes were amplified as previously described
and C. coli; these strains showed different levels of resis- [18]. The presence of the recently reported macrolide
tance to azithromycin and erythromycin, evaluated using resistance-related ribosomal RNA methylase gene, erm(B),
molecular methods. Additionally, we sought to investigate was confirmed using a method described by Zhang et al.
the diverse mechanisms underlying the higher resistance [6]. To investigate the role of drug efflux in macrolide
to azithromycin, but not to erythromycin, shown by the resistance, cmeB, an efflux pump gene (1,070 bp), was
Campylobacter strains. amplified using the method described by Pumbwe et al.
[19].
2. Materials and Methods PCR products were purified using JET-SORB gel
extraction kit (Genomed, Kampenhout, Belgium) following
2.1. Origin of Campylobacter Strains and Minimal Inhibitory the manufacturer’s instructions. Subsequently, they were
Concentrations (MIC) Determination. A total of 38 strains sequenced using an ABI 3100 Genetic Analyzer (Applied
of Campylobacter (15 strains of C. jejuni and 23 strains C. Biosystems, Foster City, CA). The sequences were analyzed
coli) showing either intermediate resistance or resistance and compared with the reference sequence using the
to azithromycin and erythromycin were used in this study software MEGA (version 5.0). A macrolide-susceptible
(Tables 1 and 2). The strains were isolated from poultry strain of NCTC 11168 (GenBank: AL111168.1) was used as a
between 2013 and 2016 in a previous study [16]. The sample reference strain to analyze the mutations in genes encoding
sources were divided into four types, and the number of 23S rRNA, L4, and L22.
Table 1: Characteristics of macrolide resistance genes in Campylobacter jejuni strains showing varied resistance to azithromycin and erythromycina .
MIC (𝜇g/mL) Mutations
L22
Strain Source Azithromycin Erythromycin 𝑐𝑚𝑒𝐵c 𝑒𝑟𝑚𝐵c 23S
L4 L22 insertions
-EPI +EPI Foldb -EPI +EPI Foldb rRNA
33560 ATCC 0.25 0.06 4 1 0.25 4 nt nt wt wt wt wt
A16-CF-329-3 CM 4 0.5 8 0.5 0.5 1 + - wt V196A A103V, S109A wt
CM13-HL-010-1 CM 4 0.125 32 8 0.25 32 + - wt V80I, V196A A103V, S109A, V137A wt
CM13-HL-012-1 CM 4 0.5 8 8 0.125 64 + - wt V80I, V196A A103V, S109A, V137A wt
CM13-MWC-BS-004 CM 8 0.125 64 0.5 0.025 20 + - wt V196A A103V, S109A, V137A wt
A16-CF-127-1-S1 BC 8 0.25 32 1 0.25 4 + - wt wt wt wt
V121A, T177S, M192I,
A16-CF-318-3 CM 8 0.25 32 1 0.015 67 + - wt V137S 114VAKKAP115
V196A
DM13-MP-WS-002 DM 8 0.5 16 64 0.25 256 + - wt V196A A103V, S109A, V137A wt
CM13-OP-004-1 CM 8 0.25 32 64 0.5 128 + - wt wt wt wt
A16-CF-129-1-S1 CM 8 0.125 64 128 0.5 256 + - wt wt wt wt
CM13-HL-BS-021 CM 16 1 16 32 2 16 + - wt V196A wt wt
DM13-JDW-WL-007 DM 16 0.25 64 64 0.5 128 - - wt V196A V137A 114VAKKAP115
V121A, T177S, M192I,
DM13-JDW-WL-009 DM 16 16 1 64 64 1 + - wt S109A, V137A 114VAKKAP115
V196A
CM13-MWC-WL-008 CM 16 1 16 64 1 64 + - wt V196A A103V, S109A, V137A wt
I65V, A103V, S109A,
CM13-DW-BL-005 CM 16 1 16 64 1 64 + - wt V196A wt
V137A
I65V, A103V, S109A,
DM13-JW-SS-017 DM 32 0.5 64 64 0.5 128 + - wt V121A, V196A wt
V137A
a. Abbreviations: ATCC, American Type Culture Collection; CM, chicken meat; BC, breeder chicken; DM, duck meat; EPI: efflux pump inhibitor; nt: not test; A: Ala; I: Ile; K: Lys; M: Met; P: Pro; S: Ser; V: Val; T:
Thr; wt: wild type.
b. Fold values were calculated as MIC without EPI/MIC with EPI.
c. +/-, indicates whether or not the target genes were detected.
The MIC breakpoints for azithromycin: susceptible, ≤ 2 𝜇g/mL; intermediate, 4 𝜇g/mL; and resistant, ≥ 8 𝜇g/mL; for erythromycin: susceptible, ≤ 8 𝜇g/mL; intermediate, 16 𝜇g/mL; and resistant, ≥ 32 𝜇g/mL.
3
4
Table 2: Characteristics of macrolide-resistance genes in Campylobacter coli strains showing varied resistance to azithromycin and erythromycina .
MIC (𝜇g/mL) Mutations
Strain Source Azithromycin Erythromycin cmeBc ermBc
23S rRNA L4 L22
-EPI +EPI Foldb -EPI +EPI Foldb
A16-CF-319-1 CM 4 1 4 1 0.5 2 - - wt wt wt
A16-CF-330-1 CM 4 1 4 1 0.5 2 - - wt V196A I65V, A74G
A16-CF-130-1-S1 BC 8 8 1 2 0.5 4 + - wt wt I65V, A74G
A16-CF-128-1-S1 BC 8 8 1 128 64 2 - - wt V121A, V196A I65V, A74G
CM13-HL-BS-020 CM 16 0.5 32 32 0.5 64 - - wt V196A I65V, A74G
CM13-HL-BL-031 CM 16 1 16 64 0.25 256 - - wt V196A I65V, A74G
CM13-MC-BS-006 CM 16 0.125 128 64 2 32 - - wt V196A I65V, A74G
DM13-MWC-SS-013 DM 32 2 16 4 0.125 32 - - wt V196A I65V, A74G
DM13-MP-WS-007 DM 32 0.5 64 8 0.5 16 - - wt V196A I65V, A74G
A16-CF-130-2-S1 BC 64 64 1 32 32 1 - - wt V196A I65V, A74G
A16-CF-107-2-S2 BC 64 64 1 64 32 2 - - A2075G wt I65V, A74G, S109A
A16-CF-128-1-S4 BC 128 2 64 128 4 32 - - wt V196A I65V, A74G, S109A
A16-CF-124-2-S3 BC 128 4 32 128 2 64 - - wt V196A I65V, A74G, S109A
A16-CF-107-2-S4 BC ≥512 64 8 ≥512 64 8 - - A2075G wt I65V, A74G, S109A
A16-CF-124-1-S1 BC ≥512 ≥512 1 ≥512 64 8 - - A2075G wt I65V, A74G, S109A
A16-CF-126-2-S1 BC ≥512 64 8 ≥512 32 16 - - A2075G wt I65V, A74G, S109A
A16-CF-126-2-S2 BC ≥512 ≥512 1 ≥512 64 8 - - A2075G V196A I65V, A74G, S109A
A16-CF-126-2-S4 BC ≥512 ≥512 1 ≥512 64 8 - - A2075G V121A, V196A I65V, A74G, S109A
A16-CF-118-2-S3 BC ≥512 ≥512 1 ≥512 64 8 + - A2075G V121A, V196A I65V, A74G, S109A
a. Abbreviations: CM: chicken meat; BC: breeder chicken; DM: duck meat; EPI: efflux pump inhibitor; A, Ala; G: Gly; I: Ile; S: Ser; V: Val; wt: wild type.
b. Fold values were calculated as (MIC without EPI)/(MIC with EPI).
c. +/-, indicates whether or not the target genes were detected.
The MIC breakpoints for azithromycin: susceptible, ≤ 2 𝜇g/mL; intermediate, 4 𝜇g/mL; and resistant, ≥ 8 𝜇g/mL; for erythromycin: susceptible, ≤ 8 𝜇g/mL; intermediate, 16 𝜇g/mL; and resistant, ≥ 32 𝜇g/mL.
2.3. Effects of an Efflux Pump Inhibitor (EPI) on Macrolide acid substitutions observed in L22 sequences, a six-amino
Resistance. To investigate the contributions of efflux pump acid sequence (VAKKAP) present between positions 114 and
activity to macrolide resistance, the MICs of azithromycin 115 was also identified in three azithromycin-resistant strains
and erythromycin were determined in presence of the EPI of C. jejuni.
phenylalanine arginine ß-naphthylamide (PAßN, Sigma, St. Minimal genetic diversity in L4 and L22 amino acid
Louis, Missouri). The broth microdilution method was used substitutions was observed in 23 strains of C. coli from
to determine the MICs in the presence of 20 𝜇g/mL PAßN in poultry. The substitution V121A was identified in L4 from
Mueller-Hinton broth (Oxoid, Basingstoke, England). The C. five C. coli strains and the substitution V196A was identified
jejuni ATCC 33560 was used as the reference strain. in L4 from 15 C. coli strains; the substitutions I65V and
A74G were identified in L22 from nine C. coli strains and the
substitutions I65V, A74G, and S109A were identified in L22
3. Results from 13 C. coli strains.
3.1. Variation in Resistance to Azithromycin and Erythromycin.
Among the 38 tested Campylobacter strains, 27 strains, of 3.4. PCR Detection of the cmeB and erm(B) Gene. The
which nine were C. jejuni and 18 were C. coli, were resistant presence of cmeB in 14 (93.3 %) C. jejuni strains and 4 (17.4
to azithromycin and erythromycin (Tables 1 and 2). A total %) C. coli strains was confirmed using PCR. However, none
of five strains (three C. jejuni and two C. coli) showed of the investigated strains of C. jejuni and C. coli harbored
intermediate resistance to azithromycin with an MIC of 4 erm(B), as observed in the PCR results obtained.
𝜇g/mL and were susceptible to erythromycin with MICs
ranging from 0.5 to 8 𝜇g/mL. A total of six strains (three C. 3.5. Efficacy of an EPI. The effects of PAßN on the MICs
jejuni and three C. coli) were resistant to azithromycin and of macrolide antibiotics in the C. jejuni and C. coli strains
susceptible to erythromycin with MICs ranging from 8–32 are shown in Tables 1 and 2. The presence of PAßN greatly
𝜇g/mL and 0.5–8 𝜇g/mL, respectively. MICs of azithromycin decreased the MICs of azithromycin and erythromycin
against four strains of C. jejuni (A16-CF-329-3, CM13-MWC- against most of C. jejuni and C. coli strains. In the Campy-
BS-004, A16-CF-127-1-S1, and A16-CF-318-3) and six strains lobacter strains with no mutations in the 23S rRNA gene, all
of C. coli (A16-CF-319-1, A16-CF-330-1, A16-CF-130-1-S1, the azithromycin intermediate/resistant strains were restored
DM13-MWC-SS-013, DM13-MP-WS-007, and A16-CF-130-2- to susceptibility except for four strains (DM13-JDW-WL-
S1) were 8–16 and 2–8-fold higher, respectively, than those of 009, A16-CF-128-1-S1, A16-CF-130-2-S1, and A16-CF-130-1-
erythromycin. S1), and all erythromycin-resistant strains were restored to
susceptibility except three strains (DM13-JDW-WL-009, A16-
3.2. Sequence Analysis of the 23S rRNA. All of the 15 C. jejuni CF-128-1-S1, and A16-CF-130-2-S1).
strains, including one strain (A16-CF-129-1-S1) showing a All the strains showed increased susceptibility to ery-
high-level resistance to erythromycin with an MIC of 128 thromycin in the presence of PAßN with at least two-fold to
𝜇g/mL, harbored a wild-type 23S rRNA sequence (Table 1). 256-fold MIC change, except two C. jejuni strains and one C.
The point mutation A2075G was detected in all three coli strain which showed no MIC change. The effect of PAßN
copies of the 23S rRNA gene from 11 strains of C. coli, which on azithromycin MIC was lesser than that on erythromycin
were resistant to azithromycin and erythromycin with MICs MIC, with 13 strains (one C. jejuni and 12 C. coli) of the 38
ranging from 64 to ≥ 512 𝜇g/mL (Table 2). Two strains of strains showing no MIC change in the presence of PAßN. In
C. coli (A16-CF-128-1-S4 and A16-CF-124-2-S3) showed high- addition, of the 11 strains carrying mutations in the 23S rRNA
level resistance to azithromycin and erythromycin (MIC = gene, nine showed no change in azithromycin MIC while all
128 𝜇g/mL) and did not harbor any mutations in the 23S 11 strains showed a 2–16-fold decrease in erythromycin MIC.
rRNA gene, and one strain (A16-CF-128-1-S1) showed high-
level resistance to erythromycin (MIC = 128 𝜇g/mL) and did
not harbor any mutations in the 23S rRNA gene. The other 4. Discussion
five strains of C. coli were resistant to both azithromycin and In this study, Campylobacter strains isolated from breeder
erythromycin, with no mutations in the 23S rRNA gene. chicken and chicken and duck meat between 2013 and
2016 were used to investigate the molecular mechanisms
3.3. Investigation of the Ribosomal Proteins L4 and L22. underlying macrolide resistance in C. jejuni and C. coli.
Analysis of amino acid sequences of the ribosomal pro- Our data revealed that point mutations at positions 2,075 in
teins L22 and L4 from the C. jejuni and C. coli strains domain V of the 23S rRNA gene contributed to high-level
revealed the presence of different combinations of amino azithromycin and erythromycin resistance in 11 Campylobac-
acid substitutions (Tables 1 and 2). The following amino ter strains. These mutations were not present in C. jejuni and
acid substitutions were identified in L4 from C. jejuni; V80I, C. coli strains with a low-level or intermediate resistance to
T177S, and M192I in two isolates, V121A in three isolates, and azithromycin and erythromycin. This finding supports pre-
V196A in 12 isolates. The following amino acid substitutions viously published reports that suggested a predominant role
were identified in L22 from C. jejuni; I65V in two isolates, for this mutation in macrolide resistance [4, 20]. The binding
A103V in eight isolates, S109A in nine isolates, V137S in one site substitutions of A2075G, A2074G, and A2074C in the
isolate, and V137A in eight isolates. In addition to the amino 23S rRNA gene in C. jejuni and C. coli have been implicated
in high-level resistance to azithromycin and erythromycin in of Campylobacter strains harboring such substitutions and
the field and in the laboratory [4]. The substitution A2075G showing reduced susceptibility to erythromycin did not lead
was the most prevalent genetic mutation conferring high to the elucidation of the mechanistic significance of these
macrolide resistance in the field, suggesting A2075G may amino acid substitutions in the present study.
provide specific biological or survival advantages compared In addition to single amino acid substitutions, a six-
to A2074G and A2074C [3, 20–22]. Our results were also amino acid insertion (114-VAKKAP-115) within the 𝛽-hairpin
consistent with those of previous studies in Korea that region of L22 was found in three C. jejuni strains show-
suggested that the A2075G mutation in the 23S rRNA gene ing azithromycin resistance and reduced susceptibility to
appeared to be the main contributor to high macrolide erythromycin (Table 1). Amino acid insertions in L22 have
resistance [23, 24]. been reported in a number of bacterial species, both Gram-
As observed in several other species of Gram-negative negative and Gram-positive [30, 31]. For example, insertions
bacteria, RND efflux pumps confer resistance to macrolides at position 86 or 98 in L22 reportedly conferred macrolide
in Campylobacter spp. Inhibition of the efflux pumps resistance in C. jejuni and C. coli [26], and a six-amino acid
using EPIs increases the susceptibility of Campylobacter to insertion between T108 and V109 in L22 of Streptococcus con-
macrolides [20]. Our results showed that an EPI promoted ferred resistance to azithromycin and erythromycin [32]. The
a marked decrease in resistance to both azithromycin and significance of this insertion in L22 of Campylobacter in rela-
erythromycin in most of Campylobacter strains (Tables 1 tion to macrolide resistance needs to be investigated. In the
and 2). In highly erythromycin-resistant strains, the presence present study, all strains which showed reduced susceptibility
of the A2075G 23S rRNA gene mutation and efflux pump to azithromycin and erythromycin, except one C. coli strain,
activity indicated synergism between these two resistance carried the mutations I65V and A74G. These substitutions
mechanisms in Campylobacter [20]. However, this may not were not observed in C. jejuni strains. The significance of the
apply to azithromycin because nine out of 11 strains with coexistence of these amino acid substitutions is unknown.
the A2075G 23S rRNA mutation showed no azithromycin The occurrence of such mutations may be associated with
MIC change in the presence of PAßN. Our result was local environmental conditions and other selective pressures;
consistent with that of a previous study which found that high most of the previously reported C. coli strains, carrying both
azithromycin resistance in Campylobacter was mainly due to the amino acid substitutions, were isolated from chicken and
the A2075G 23S rRNA mutation [25]. These results suggest swine in Korea [23]. Further studies are required to assess
that the A2075G 23S rRNA mutation in Campylobacter was whether the coexistence of these amino acid substitutions
sufficient to confer high-level resistance to azithromycin, contributes to Campylobacter macrolide resistance.
while the mutation synergizes with the drug efflux pump Erythromycin, the first 14-membered macrolide, is active
system to confer high erythromycin resistance. Further against Gram-positive and some Gram-negative microorgan-
studies are required to assess the contribution of different isms. To improve acid stability and oral bioavailability of ery-
mechanisms to erythromycin and azithromycin resistance in thromycin, the first 15-membered macrolide, azithromycin,
Campylobacter. was developed by inserting a basic nitrogen atom into the
A number of previous studies have reported that modifi- macrocyclic ring [33]. Azithromycin exhibited enhanced in
cations in the ribosomal proteins L4 and L22 were associated vitro and in vivo potency against Gram-positive and Gram-
with a lower level of macrolide resistance [26]. Numer- negative bacteria compared to erythromycin [34]. Bacte-
ous substitutions and insertions in the ribosomal protein riostatic and bactericidal activity of azithromycin against
sequences in macrolide-resistant strains have been docu- Campylobacter was up to four times more potent than
mented. Amino acids at the positions 63–74 are a part that of erythromycin [9]. In this study, we found four
of the most important target region in L4; no variation C. jejuni strains and six C. coli strains showing higher
was found in this region of L4 in the present study. In resistance to azithromycin than to erythromycin; and the
contrast, the most frequent changes, V121A and V196A, were MIC of azithromycin was 8–16 and 2–8-fold higher against
located outside the important target region. The mutations the C. jejuni strains and the C. coli strain, respectively,
at positions 121 and 196 were identified in susceptible and compared to that of erythromycin. Additionally, even in the
resistant isolates in previous studies. This suggests that these presence of PAßN, two C. jejuni strains (CM13-MWC-BS-
substitutions are unlikely to contribute directly to macrolide 004 and A16-CF-318-3) and five C. coli (A16-CF-319-1, A16-
resistance [27]. Other substitutions such as V80I, T177S, and CF-330-1, A16-CF-130-1-S1, DM13-MWC-SS-013, and A16-
M192I were also identified in erythromycin-susceptible and CF-130-2-S1) showed higher MICs of azithromycin than of
-resistant isolates previously [23, 27]. In L22, substitutions erythromycin. These results were in agreement with those
including I65V, A74G, A103V, and S109A were identified in of previous studies in which erythromycin had a lower
erythromycin-susceptible and -resistant isolates previously MIC than azithromycin against both Campylobacter and
[27, 28]. The mutations V137A and V137S, located in the 𝛽- other Gram-positive bacteria [10, 23, 35, 36]. Ribosomal
hairpin region close to the C-terminus, were identified in protein polymorphisms might affect the MICs of different
C. jejuni strains. L22 consists of a small 𝛼 plus 𝛽 domain, macrolides, and an amino acid substitution (A86E) was iden-
with the 𝛽-hairpin contributing to the formation of the tified in L22 from azithromycin-resistant and erythromycin-
polypeptide tunnel exit at the surface of the ribosome. The susceptible Campylobacter in a previous study [37]. Further,
mutation in this domain might change the surface properties azithromycin was found to be less affected by drug efflux
and block macrolide binding [29]. Nevertheless, isolation compared with erythromycin, and inactivation of the cmeB
gene led to greater MIC change of erythromycin than of [37], numerous studies have reported differences between
azithromycin [25]. In the present study, the substitution A86E macrolide resistance phenotypes and genotypes of Campy-
was not observed in L22 from C. jejuni and C. coli strains, lobacter from various sources. These studies revealed that C.
and higher MICs of azithromycin than of erythromycin were jejuni and C. coli strains were resistant to macrolides but did
observed even in the presence of an EPI. This may indicate not harbor the corresponding genes or mutations required
different contributing factors for macrolide resistance, apart for resistance [3, 27, 35, 44]. In this study, 27 Campylobacter
from efflux pump-mediated mechanisms. Further studies strains with both azithromycin and erythromycin resistance
are required to verify the diverse mechanisms underlying did not harbor any mutations within the corresponding
erythromycin and azithromycin resistance and to facilitate genes. Further, three strains were did not harbor any mutation
the development of strategies to control macrolide-resistant even in the presence of EPI. In such a situation, even after
Campylobacter. In addition, considering that poultry meat is WGS, phenotypic testing would be necessary to confirm
a common source of human pathogens, careful thought must macrolide susceptibility of strains given that only deep WGS
be given to select effective antibiotics against Campylobacter can detect resistance.
strains from poultry meat showing higher resistance to In the present study, we investigated the macrolide
azithromycin than to erythromycin. resistance of C. jejuni and C. coli from breeder chicken and
A relatively low prevalence of cmeB in C. coli strains chicken and duck meat. Chicken meat is a well-known and a
compared with that in C. jejuni strains was found in this study. major source for campylobacteriosis in humans; macrolide-
This was consistent with findings of a recent study on turkeys resistant Campylobacter could be transmitted from duck and
reported by Olah et al. [38]. The primers used were unable breeder chicken to humans. In our study, Campylobacter with
to detect cmeB due to the high sequence variation of cmeB in high resistance to azithromycin and erythromycin was found
C. coli isolates [39]. Differences between C. jejuni and C. coli in breeder chicken. Vertical transmission of Campylobacter
strains should be further investigated. is questionable and it has been reported that antibiotic-
The gene erm(B) is involved in a major mechanism under- resistant Campylobacter from breeder chicken showed clonal
lying macrolide resistance in other bacteria, especially Gram- homology to that found in humans [1]. In addition, the
positive bacteria [2]. The transferable erm(B) gene located increased consumption of ducks, especially in Asia, also
in MDRGI on the chromosome and plasmids with high increases the risk of transmission of antibiotic-resistant
prevalence in Gram-positive bacteria has been described in Campylobacter to humans [13, 14]. Therefore, monitoring
highly erythromycin-resistant Campylobacter strains [5]. An populations of macrolide-resistant Campylobacter in poultry,
increase in the incidence of erm(B)-carrying Campylobacter including breeder chicken and duck, is required.
strains was reported in China, and their prevalence increased It is noteworthy that all Campylobacter strains in the
from 0.7 % during 2007–2009 to 6.4 % during 2011–2012 [40]. present study showing high resistance to azithromycin and
It is noteworthy that a recent study showed a particularly erythromycin belonged to a single C. coli population isolated
high prevalence (15.1 %) of erm(B) in strains in a province from breeder chicken. Similar to a previous study, macrolide
of southern China in 2017 [41]. The isolation of an erm(B)- resistance has been usually observed in C. coli, and it is
carrying clinical C. jejuni strain in 1994 suggests that erm(B) believed that the high resistance in Campylobacter is due to
has a property of diffusional spread along time and space extensive exposure to macrolide derivatives [45]. All Campy-
[7]. Following the characterization of erm(B)-positive C. coli lobacter strains with low or high macrolide resistance were
isolated from chicken in Europe, researchers focused on the found in breeder chicken from a single integrated company
transferable erm(B), located in MDRGI on the chromosome with no difference in management practices or antibiotic
as well as on plasmids. The erm(B) gene has not been detected usage. This may suggest that polymorphisms, which cause
in macrolide-resistant C. jejuni and C. coli from various macrolide resistance, could develop even under similar envi-
sources including human clinical specimens, retail meat, and ronment pressure. This is in agreement with a previous study
fecal samples from food animals in the USA or in macrolide- in which it was shown that Campylobacter utilizes complex
resistant C. coli from colon contents of swine in France
and different mechanisms to develop macrolide resistance in
[37, 42]; in this study, erm(B) was not detected in C. jejuni
the field [46]. Therefore, further studies are required to elu-
and C. coli strains from poultry including breeder chicken or
cidate mechanisms underlying the development of macrolide
chicken and duck meat between 2013 and 2016. Continuous
resistance in Campylobacter during chicken growth.
monitoring of erm(B) in Campylobacter is required, due to its
highly transmittable nature.
Recent studies have shown that whole-genome sequenc- 5. Conclusions
ing (WGS) analysis can potentially be a rapid approach to
define resistance genotypes and predict resistance pheno- In conclusion, the data presented here confirmed previous
types of bacteria with great sensitivity and specificity, and findings, revealing that a mutation in the 23S rRNA gene
numerous proof-of-principle studies have also highlighted at position 2075 showed high-level azithromycin resistance
the value of WGS as a primary diagnostic tool to detect in Campylobacter and that the 23S rRNA gene mutation
antibiotic resistance [43]. In Campylobacter, although a acts synergistically with drug efflux to causes erythromycin
recent study showed that the correlation between resistance resistance. Studies using a larger number of C. jejuni and
phenotypes and genotypes was 100 % in terms of resis- C. coli strains showing high resistance to azithromycin but
tance to tetracycline, fluoroquinolones, and erythromycin not erythromycin are required to investigate the diverse
mechanisms underlying azithromycin and erythromycin [6] A. Zhang, L. Song, H. Liang et al., “Molecular subtyping and
resistance in Campylobacter spp. Further investigations are erythromycin resistance of Campylobacter in China,” Journal of
required to elucidate the significance of the observed amino Applied Microbiology, vol. 121, no. 1, pp. 287–293, 2016.
acid substitutions V137A and V137S and the six-amino acid [7] J. Zhou, M. Zhang, W. Yang, Y. Fang, G. Wang, and F. Hou, “A
insertion identified in L22 from C. jejuni strains. None seventeen-year observation of the antimicrobial susceptibility
of the investigated strains of C. jejuni and C. coli from of clinical Campylobacter jejuni and the molecular mechanisms
chicken and duck harbored erm(B); further surveillance of erythromycin-resistant isolates in Beijing, China,” Interna-
might be required to confirm this. Because differences tional Journal of Infectious Diseases, vol. 42, pp. 28–33, 2016.
between macrolide resistance phenotypes and genotypes of [8] D. Florez-Cuadrado, M. Ugarte-Ruiz, A. Quesada, G. Palomo,
Campylobacter showing high resistance were found, fur- L. Domı́nguez, and M. C. Porrero, “Description of an erm(B)-
ther studies are needed to improve our understanding carrying Campylobacter coli isolate in Europe,” Journal of
of macrolide resistance in Campylobacter. To prevent and Antimicrobial Chemotherapy, vol. 71, no. 3, pp. 841–843, 2016.
control macrolide resistance in Campylobacter, mechanisms [9] J. Retsema, A. Girard, W. Schelkly et al., “Spectrum and mode
underlying resistance development during chicken growth of action of azithromycin (CP-62,993), a new 15-membered-
need to be elucidated. In addition, populations of macrolide- ring macrolide with improved potency against gram-negative
resistant Campylobacter in poultry including breeder chicken organisms,” Antimicrobial Agents and Chemotherapy, vol. 31, no.
and duck need to be monitored. 12, pp. 1939–1947, 1987.
[10] A. Canu, B. Malbruny, M. Coquemont, T. A. Davies, P. C. Appel-
baum, and R. Leclercq, “Diversity of ribosomal mutations con-
Data Availability ferring resistance to macrolides, clindamycin, streptogramin,
Sequence data that support the findings of this study have and telithromycin in Streptococcus pneumoniae,” Antimicrobial
Agents and Chemotherapy, vol. 46, no. 1, pp. 125–131, 2002.
been deposited in the GenBank with the accession number
MH084527-MH084640. [11] E. Giovanetti, M. P. Montanari, M. Mingoia, and P. E. Varaldo,
“Phenotypes and genotypes of erythromycin-resistant Strepto-
coccus pyogenes strains in Italy and heterogeneity of inducibly
Conflicts of Interest resistant strains,” Antimicrobial Agents and Chemotherapy, vol.
43, no. 8, pp. 1935–1940, 1999.
The authors have no conflicts of interest to declare.
[12] N. A. Cox, L. J. Richardson, J. J. Maurer et al., “Evidence for
horizontal and vertical transmission in Campylobacter passage
Acknowledgments from hen to her progeny,” Journal of Food Protection, vol. 75, no.
10, pp. 1896–1902, 2012.
This work was supported by Korea Institute of Planning and [13] M. Abid, H. Wimalarathna, J. Mills et al., “Duck liver-associated
Evaluation for Technology in Food, Agriculture, Forestry, and outbreak of Campylobacter infection among humans, United
Fisheries (nos. 716002-7, 315035-5), Basic Science Research Kingdom, 2011,” Emerging Infectious Diseases, vol. 19, no. 8, pp.
Program through the NRF funded by the Ministry of Edu- 1310–1313, 2013.
cation (2017R1D1A1B03030883), and Research of Animal
[14] F. Adzitey, N. Huda, and G. R. Rahmat Ali, “Prevalence
and Plant Quarantine Agency (Z-1543073-2015-16-01), South and antibiotic resistance of Campylobacter, Salmonella, and L.
Korea. monocytogenes in ducks: a review,” Foodborne Pathogens and
Disease, vol. 9, no. 6, pp. 498–505, 2012.
References [15] D. Pérez-Boto, F. J. Garcı́a-Peña, J. C. Abad-Moreno, and M. A.
Echeita, “Antimicrobial susceptibilities of Campylobacter jejuni
[1] European Food Safety Authority, “The European Union sum- and Campylobacter coli strains isolated from two early stages of
mary report on trends and sources of zoonoses, zoonotic poultry production,” Microbial Drug Resistance, vol. 19, no. 4,
agents and food-borne outbreaks in 2011 has been published,” pp. 323–330, 2013.
Eurosurveillance, vol. 18, no. 15, pp. 45-45, 2013.
[16] B. Wei, S.-Y. Cha, R.-H. Yoon et al., “Prevalence and antimi-
[2] M. Gaynor and A. S. Mankin, “Macrolide antibiotics: binding
crobial resistance of Campylobacter spp. isolated from retail
site, mechanism of action, resistance,” Current Topics in Medic-
chicken and duck meat in South Korea,” Food Control, vol. 62,
inal Chemistry, vol. 3, no. 9, pp. 949–960, 2003.
pp. 63–68, 2016.
[3] A. Gibreel, V. N. Kos, M. Keelan et al., “Macrolide resistance in
Campylobacter jejuni and Campylobacter coli: Molecular mech- [17] National Antimicrobial Resistance Monitoring System, NARMS
anism and stability of the resistance phenotype,” Antimicrobial retail meat annual report, U.S. Food and Drug Administration,
Agents and Chemotherapy, vol. 49, no. 7, pp. 2753–2759, 2005. Washington, DC, USA, 2011.
[4] T. Luangtongkum, B. Jeon, J. Han, P. Plummer, C. M. Logue, and [18] H. Hao, Z. Yuan, Z. Shen et al., “Mutational and transcriptomic
Q. Zhang, “Antibiotic resistance in Campylobacter: Emergence, changes involved in the development of macrolide resistance in
transmission and persistence,” Future Microbiology, vol. 4, no. Campylobacter jejuni,” Antimicrobial Agents and Chemotherapy,
2, pp. 189–200, 2009. vol. 57, no. 3, pp. 1369–1378, 2013.
[5] S. Qin, Y. Wang, Q. Zhang et al., “Report of ribosomal RNA [19] L. Pumbwe and L. J. V. Piddock, “Identification and molecular
methylase gene erm(B) in multidrug-resistant Campylobacter characterisation of CmeB, a Campylobacter jejuni multidrug
coli,” Journal of Antimicrobial Chemotherapy, vol. 69, no. 4, pp. efflux pump,” FEMS Microbiology Letters, vol. 206, no. 2, pp.
964–968, 2014. 185–189, 2002.
[20] H. Bolinger and S. Kathariou, “The current state of macrolide [35] S. R. Ladely, R. J. Meinersmann, M. D. Englen, P. J. Fedorka-
resistance in Campylobacter spp.: Trends and impacts of resis- Cray, and M. A. Harrison, “23S rRNA gene mutations con-
tance mechanisms,” Applied and Environmental Microbiology, tributing to macrolide resistance in Campylobacter jejuni and
vol. 83, no. 12, 2017. Campylobacter coli,” Foodborne Pathogens and Disease, vol. 6,
[21] D. Pérez-Boto, J. A. López-Portolés, C. Simón, S. Valdezate, and no. 1, pp. 91–98, 2009.
M. A. Echeita, “Study of the molecular mechanisms involved [36] D. E. Taylor and N. Chang, “In vitro susceptibilities of Campy-
in high-level macrolide resistance of Spanish Campylobacter lobacter jejuni and Campylobacter coli to azithromycin and
jejuni and Campylobacter coli strains,” Journal of Antimicrobial erythromycin,” Antimicrobial Agents and Chemotherapy, vol. 35,
Chemotherapy, vol. 65, no. 10, pp. 2083–2088, 2010. no. 9, pp. 1917-1918, 1991.
[22] A. Gibreel and D. E. Taylor, “Macrolide resistance in Campy- [37] S. Zhao, G. H. Tyson, Y. Chen et al., “Whole-genome sequenc-
lobacter jejuni and Campylobacter coli,” Journal of Antimicrobial ing analysis accurately predicts antimicrobial resistance phe-
Chemotherapy, vol. 58, no. 2, pp. 243–255, 2006. notypes in Campylobacter spp,” Applied and Environmental
[23] S.-K. Lim, D.-C. Moon, M. H. Chae et al., “Macrolide resistance
mechanisms and virulence factors in erythromycin-resistant [38] P. A. Olah, C. Doetkott, M. K. Fakhr, and C. M. Logue, “Preva-
Campylobacter species isolated from chicken and swine feces lence of the Campylobacter multi-drug efflux pump (CmeABC)
and carcasses,” Journal of Veterinary Medical Science, vol. 78, no. in Campylobacter spp. isolated from freshly processed turkeys,”
12, pp. 1791–1795, 2016. Food Microbiology, vol. 23, no. 5, pp. 453–460, 2006.
[24] E. Shin and Y. Lee, “Characterization of erythromycin-resistant [39] C. Cagliero, L. Cloix, A. Cloeckaert, and S. Payot, “High genetic
porcine isolates of Campylobacter coli,” Microbial Drug Resis- variation in the multidrug transporter cmeB gene in Campy-
tance, vol. 16, no. 3, pp. 231–239, 2010. lobacter jejuni and Campylobacter coli,” Journal of Antimicrobial
[25] C. Cagliero, C. Mouline, S. Payot, and A. Cloeckaert, “Involve-
[40] Y. Wang, M. Zhang, F. Deng et al., “Emergence of multidrug-
ment of the CmeABC efflux pump in the macrolide resistance
resistant Campylobacter species isolates with a horizon-
of Campylobacter coli,” Journal of Antimicrobial Chemotherapy,
tally acquired rRNA methylase,” Antimicrobial Agents and
vol. 56, no. 5, pp. 948–950, 2005.
[26] C. Cagliero, C. Mouline, A. Cloeckaert, and S. Payot, “Synergy [41] D. Liu, F. Deng, Y. Gao et al., “Dissemination of erm(B)
between efflux pump CmeABC and modifications in ribosomal and its associated multidrug-resistance genomic islands in
proteins L4 and L22 in conferring macrolide resistance in Campylobacter from 2013 to 2015,” Veterinary Microbiology, vol.
Campylobacter jejuni and Campylobacter coli,” Antimicrobial 204, pp. 20–24, 2017.
[42] I. Kempf, A. Kerouanton, S. Bougeard et al., “Campylobacter
[27] M. Lehtopolku, P. Kotilainen, M. Haanperä-Heikkinen et al., coli in organic and conventional pig production in France and
“Ribosomal mutations as the main cause of macrolide resistance Sweden: Prevalence and antimicrobial resistance,” Frontiers in
in Campylobacter jejuni and Campylobacter coli,” Antimicrobial Microbiology, vol. 8, 2017.
[43] C. U. Köser, M. J. Ellington, and S. J. Peacock, “Whole-
[28] D. Corcoran, T. Quinn, L. Cotter, and S. Fanning, “An inves- genome sequencing to control antimicrobial resistance,” Trends
tigation of the molecular mechanisms contributing to high- in Genetics, vol. 30, no. 9, pp. 401–407, 2014.
level erythromycin resistance in Campylobacter,” International [44] M. Kurinčič, N. Botteldoorn, L. Herman, and S. Smole Možina,
Journal of Antimicrobial Agents, vol. 27, no. 1, pp. 40–45, 2006. “Mechanisms of erythromycin resistance of Campylobacter spp.
[29] S. T. Gregory and A. E. Dahlberg, “Erythromycin resistance isolated from food, animals and humans,” International Journal
mutations in ribosomal proteins L22 and L4 perturb the higher of Food Microbiology, vol. 120, no. 1-2, pp. 186–190, 2007.
order structure of 23 S ribosomal RNA,” Journal of Molecular [45] J. Lin, M. Yan, O. Sahin, S. Pereira, Y.-J. Chang, and Q. Zhang,
Biology, vol. 289, no. 4, pp. 827–834, 1999. “Effect of macrolide usage on emergence of erythromycin-
[30] M. Peric, B. Bozdogan, M. R. Jacobs, and P. C. Appelbaum, resistant Campylobacter isolates in chickens,” Antimicrobial
“Effects of an efflux mechanism and ribosomal mutations Agents and Chemotherapy, vol. 51, no. 5, pp. 1678–1686, 2007.
on macrolide susceptibility of Haemophilus influenzae clinical [46] D. B. Caldwell, Y. Wang, and J. Lin, “Development, stability, and
isolates,” Antimicrobial Agents and Chemotherapy, vol. 47, no. 3, molecular mechanisms of macrolide resistance in Campylobac-
pp. 1017–1022, 2003. ter jejuni,” Antimicrobial Agents and Chemotherapy, vol. 52, no.
[31] C. Fyfe, T. H. Grossman, K. Kerstein, and J. Sutcliffe, “Resistance 11, pp. 3947–3954, 2008.
to macrolide antibiotics in public health pathogens,” Cold Spring
Harbor Perspectives in Medicine, vol. 6, no. 10, 2016.
[32] E. Pérez-Trallero, J. M. Marimon, L. Iglesias, and J. Larruskain,
“Fluoroquinolone and macrolide treatment failure in pneumo-
coccal pneumonia and selection of multidrug-resistant isolates,”
Emerging Infectious Diseases, vol. 9, no. 9, pp. 1159–1162, 2003.
[33] D. Jelić and R. Antolović, “From Erythromycin to Azithromycin
and New Potential Ribosome-Binding Antimicrobials,”
Antibiotics-Basel, vol. 5, no. 3, 2016.
[34] J. G. Den Hollander, J. D. Knudsen, J. W. Mouton et al.,
“Comparison of pharmacodynamics of azithromycin and ery-
thromycin in vitro and in vivo,” Antimicrobial Agents and
Hindawi
https://doi.org/10.1155/2018/3067494
Research Article
Prevalence, Genetic Heterogeneity, and
Antibiotic Resistance Profile of Listeria spp. and
Listeria monocytogenes at Farm Level: A Highlight of
ERIC- and BOX-PCR to Reveal Genetic Diversity
Lesley Maurice Bilung ,1 Lai Sin Chai,1 Ahmad Syatir Tahar,1

Chong Kian Ted ,2 and Kasing Apun 1
1
Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia
2
Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia
Correspondence should be addressed to Lesley Maurice Bilung; mblesley@unimas.my
Received 16 March 2018; Revised 2 May 2018; Accepted 3 June 2018; Published 3 July 2018
Academic Editor: Marta Laranjo
Copyright © 2018 Lesley Maurice Bilung et al. This is an open access article distributed under the Creative Commons Attribution
cited.
This study aimed to identify Listeria spp. and L. monocytogenes, characterize the isolates, and determine the antibiotic resistance
profiles of the isolates Listeria spp. and L. monocytogenes in fresh produce, fertilizer, and environmental samples from vegetable
farms (organic and conventional farms). A total of 386 samples (vegetables, soil, water, and fertilizer with manure) were
examined. The identification of bacterial isolates was performed using PCR and characterized using ERIC-PCR and BOX-PCR. The
discriminating power of the typing method was analyzed using Simpson’s Index of Diversity. Thirty-four (n=34) Listeria isolates
were subjected to antimicrobial susceptibility test using the disc-diffusion technique. The PCR analysis revealed that Listeria spp.
were present in 7.51% (29/386) of all the samples (vegetable, soil, fertilizer, and water). None of the samples examined were positive
for the presence of L. monocytogenes. Percentages of 100% (15/15) and 73.30% (11/15) of the Listeria spp. isolated from vegetables,
fertilizer, and soil from organic farm B had indistinguishable DNA fingerprints by using ERIC-PCR and BOX-PCR, respectively.
Listeria spp. isolated from 86 samples of vegetable, fertilizer, and environment of organic farm A and conventional farm C had
distinct DNA fingerprints. Simpson’s Index of Diversity, D, of ERIC-PCR and BOX-PCR is 0.604 and 0.888, respectively. Antibiotic
susceptibility test revealed that most of the Listeria spp. in this study were found to be resistant to ampicillin, rifampin, penicillin G,
tetracycline, clindamycin, cephalothin, and ceftriaxone. The isolates had MAR index ranging between 0.31 and 0.85. In conclusion,
hygienic measures at farm level are crucial to the reduction of Listeria transmission along the food chain.
1. Introduction oxacillin, tetracycline, and nalidixic acid [5, 6]. Therefore,

it is important to monitor the antibiotic susceptibility of
Listeria is a gram-positive, rod-shaped, and non-spore- Listeria spp. and L. monocytogenes to ensure the effectiveness
forming bacterium [1]. Genus of Listeria is classified into 17 of listeriosis treatment.
species including Listeria monocytogenes that is a common Repetitive sequence-based PCR (Rep-PCR) is a DNA
causative agent of human foodborne infection, listeriosis [2]. amplification technique for bacterial genomic fingerprinting
Listeriosis is usually treated with antibiotic therapy involving by using repetitive DNA elements present within bacterial
the use of penicillin, ampicillin, rifampin, gentamicin, tetra- genome. There are four main types of repetitive sequences
cycline, erythromycin, chloramphenicol, or trimethoprim used for molecular typing which include enterobacterial
with sulfamethoxazole alone or in combination [3, 4]. Pre- repetitive intergenic consensus (ERIC) sequence, BOX ele-
vious researches have shown that Listeria spp. may be resis- ments, repetitive extragenic palindromic sequences (REP
tant to several antibiotics such as clindamycin, daptomycin, elements), and (GTG)5 [7]. Utilization interspersed repetitive
Table 1: Sampling period and agricultural practices for respective of composted animal manures and plant waste as fertilizer;
sampling sites. however, it does not practice crop rotation and synthetic
chemical pesticides are applied to the produce biweekly.
Date of
The vegetable samples and soil samples were collected
Sampling site Agricultural practices sampling
trips from the fields while the fertilizer samples were collected
from the fertilizer storage places. Water samples were col-
(i) Crop rotations 19/02/14
Organic Farm (ii) Organic fertilizer 13/03/14
lected from the respective water sources (pond or rainwater).
A (iii) Mechanical weed control 24/03/14 All samples were kept in ice box and transported to the
(iv) No pesticides 21/04/14 Molecular Microbiology Laboratory at Universiti Malaysia
(i) Crop rotations 11/08/14
Sarawak.
Organic Farm (ii) Organic fertilizer 13/10/14
B (iii) Mechanical weed control 27/10/14 2.2. Sample Processing and Listeria Enrichment. Sample pro-
(iv) No pesticides 17/11/14 cessing was done as described in Ozbey et al. [25]. First,
12/05/14 25 g (or 25 ml) of each sample (soil, fertilizer, and water)
(i) No crop rotation
Conventional 09/06/14 was weighed or measured and then transferred into conical
(ii) Organic fertilizer
Farm C 30/06/14 flasks containing 225 ml of Listeria Enrichment Broth (LEB)
(iii) Application of synthetic pesticides
14/07/14 (Oxoid, United States). After that, the flasks were incubated
at 30∘ C for 48 hr. Vegetable samples were weighed (25 g) and
cut into pieces before being transferred into the conical flasks
sequence-based tools can be used in bacterial fingerprinting containing 225 ml of LEB followed by incubation at 30∘ C for
since the distance between each of the sequences varies 48 hr.
among strains [8] and have been used to type wide range of
gram-negative and several gram-positive bacteria [7]. ERIC-
PCR has been used for intraspecies fingerprinting of Bacillus 2.3. Enumeration of Listeria spp. The enriched bacterial
anthracis and Bacillus cereus [9], Enterobacter sakazakii [10], cultures (100 𝜇l) from the samples were transferred and
Lactobacillus [11], Listeria monocytogenes [12], and Salmonella spread on PALCAM agar (Merck, Germany). The PALCAM
Enteritidis [13, 14]. Meanwhile, BOX-PCR has been well agar plates were incubated at 37∘ C for 48 hr. Listeria spp.
used in typing of Escherichia coli [15–17], Bifidobacterium colonies appeared to be greyish-green or black in color and
[7], Streptomyces [18], Aeromonas spp. [19], Burkholderia surrounded by black halo on PALCAM agar [26]. These
pseudomallei [20], and Bacillus anthracis [21]. Nonetheless, colonies were observed, counted, and recorded.
ERIC sequence-based PCR (ERIC-PCR) and BOX-PCR were
used in this study as they are rapid subtyping methods and 2.4. DNA Extraction. Prior to amplification, genomic DNA
have high discrimination power [2, 22, 23]. was extracted using GF-1 Nucleic Acid Extraction Kits
According to Strawn et al. [24], agricultural practices (Vivantis, United States) according to manufacturer’s guide.
(irrigation with contaminated water, fertilization with con- DNA template was further subjected to PCR-based analysis.
taminated manure and contaminated soil) could increase the
risk of bacterial contamination of vegetables. Therefore, this 2.5. Identification of Listeria spp. and Listeria monocytogenes
study was carried out to assess the contamination levels of
Listeria spp. and L. monocytogenes in vegetables, fertilizer, 2.5.1. DNA Extraction. Presumptive Listeria spp. colonies
and environmental samples (soil and water) at farm level were selected from PALCAM agar and subjected to DNA
practicing organic and conventional farming in Sarawak, to extraction using GF-1 Nucleic Acid Extraction Kits (Vivantis,
obtain information on the genetic diversity of the Listeria spp. United States) according to the manufacturer’s guide. DNA
isolates using Repetitive Intergenic Consensus Polymerase template was further subjected to PCR-based analysis.
Chain Reaction (ERIC-PCR) and BOX-PCR. Further, the
study aimed to compare the effectiveness of ERIC-PCR and 2.5.2. Polymerase Chain Reaction (PCR) for Listeria spp. PCR
BOX-PCR for genetic diversity of Listeria spp. and determine detection of Listeria spp. was carried out as described by
antibiotic resistance profiles of the Listeria spp. isolates. Jeyaletchumi et al. [27] and Wong et al. [28] with slight
modification in the concentration of reagents. The primer
2. Materials and Methods pairs used for the detection of Listeria spp. (genus specific)
were 5󸀠 -CTC CAT AAA GGT GAT CCT-3󸀠 and 5󸀠 -CAG CAG
2.1. Sampling Sites and Sample Collection. A total of 206 CCG CGG TAA TAC-3󸀠 . These primers were designed to
vegetable samples, 60 fertilizer samples, 60 soil samples, and amplify a 938 bp region in the 16S rRNA gene. To prepare
60 water samples were collected from two organic farms 25 𝜇l of PCR mixture, 0.2 M of forward primer, 0.2 M of
(organic farm A and organic farm B) and one conventional reverse primer, 5.5 𝜇l of DNA template, 1.5 𝜇l of 10× Taq PCR
farm (conventional farm C) in Kuching, Sarawak. As shown buffer, 0.2 𝜇l dNTP, 1.5 mM MgCl2 , and 1.5 unit of Taq DNA
in Table 1, the organic farms practice crop rotations, applica- polymerase were mixed together. Lastly, the PCR products
tion of composted chicken waste and plant waste as fertilizer, were separated on 1% agarose gel with 100 kb DNA ladder for
mechanical methods to control weeds, and restricted use 75 min, stained with ethidium bromide, and viewed under a
of pesticides. The conventional farm also practices the use UV transilluminator (Maestrogen, Taiwan).
Table 2: PCR conditions for ERIC-PCR.

PCR steps Temperature (∘ C) Duration (min) Cycle
Initial denaturation 95 5.00 -
Denaturation 90 0.50
Annealing 50 0.50 30
Elongation 52 1.00
Final Extension 72 8.00 -
Table 3: PCR conditions for BOX-PCR.

PCR steps Temperature (∘ C) Duration (min) Cycle
Initial denaturation 94 5.00 -
Denaturation 94 1.00
Annealing 40 2.00 35
Elongation 72 2.00
Final Extension 72 10.00 -
2.5.3. Polymerase Chain Reaction (PCR) for Listeria mono- viewed under a UV transilluminator (Maestrogen, Taiwan).
cytogenes. PCR detection of L. monocytogenes was carried The DNA band patterns were analyzed and a dendrogram
out as described by Awaisheh [29] with a modification in was generated for the Listeria isolates by using BioNumerics
the concentration of reagents. The primer pairs used for the 7.5 software program (Applied Maths, Sint-Martens-Latem,
detection of L. monocytogenes were 5󸀠 -CAT TAG TGG AAA Belgium) using Dice coefficient and the unweighted pair
GAT GGA ATG-3󸀠 and 5󸀠 -GTA TCC TCC AGA GTG ATC group method (UPGMA) [33]. Simpson’s Index of Diversity,
GA-3󸀠 which amplify 730 bp region of the listeriolysin (hlyA) D, was also calculated.
gene. To prepare 25 𝜇l of PCR mixture, 0.4 M of hlyA forward The discriminating power of this typing method was
primer, 0.4 M of hlyA reverse primer, 5 𝜇l of DNA template, calculated by using Simpson’s Index of Diversity, D [34]. The
2.5 𝜇l of 10× Taq PCR buffer, 0.2 mM dNTP, 0.8 mM MgCl2 , higher the discriminatory index, the greater the effective-
and 2.5 units of Taq DNA polymerase were mixed together. ness of a particular fingerprinting method to discriminate
Lastly, the PCR products were separated on 1% agarose gel different strains [35]. This index was given by the following
with 100 kb DNA ladder for 75 min. The gel was stained with equation:
ethidium bromide and viewed under a UV transilluminator
s
(Maestrogen, Taiwan). 1
𝐷=1−( ) ∑n𝑗 (n𝑗 − 1) (1)
𝑁 (𝑁 − 1) 𝑗=1
2.6. Genetic Diversity Analysis Using ERIC and BOX-PCR.
The ERIC-PCR condition for this method was in accor- “N” denotes the total number of strains in the sample
dance with Indrawattana et al. [30] and Laciar et al. population, “s” denotes the total number of types described,
[31]. Meanwhile, the BOX-PCR condition followed Jamali “nj ” denotes the number of strains belonging to the jth type.
and Thong [32] and Versalovic et al. [8] with slight
modifications on the reagent concentration and reaction 2.7. Antibiotic Susceptibility Test. Antibiotic susceptibility of
condition. In ERIC-PCR, the primer pairs used were isolated Listeria spp. was carried out with the disc-diffusion
5󸀠 -ATGTAAGCTCCTGGGGATTCAC-3󸀠 and 5󸀠 -AAG- method by Chen et al. [5] and Morobe et al. [36] with a slight
TAAGTGACTGGGGTGAGCG-3󸀠 . To prepare 25 𝜇l of PCR modification. The antibiotic discs (Oxoid, the United States)
mixture, 1.0 M of forward primer, 1.0 M of reverse primer, 3.0 used were ampicillin (10 𝜇g), cephalothin (30 𝜇g), chloram-
l of DNA template, 5.0 𝜇l of 5×Taq PCR buffer, 0.2 mM dNTP, phenicol (30 𝜇g), clindamycin (2 𝜇g), erythromycin (15 𝜇g),
2.0 mM MgCl2 , and 1.0 unit of Taq DNA polymerase were gentamycin (10 𝜇g), penicillin G (10 𝜇g), rifampin (5 𝜇g),
mixed together. The PCR reaction was carried out according streptomycin (10 𝜇g), tetracycline (30 𝜇g), sulfamethoxa-
to the condition in Table 2. In BOX-PCR, the primer used zole/trimethoprim (23.75 𝜇g/1.25 𝜇g), novobiocin (30 𝜇g),
was BOX A1R (5󸀠 -CTACGG CAA GGC GAC GCT GAC G- nitrofurantoin (10 𝜇g), and ceftriaxone. First, the overnight
3󸀠 ). To prepare 25 𝜇l of PCR mixture, 400 𝜇M of each dNTPs, culture grown in Mueller-Hinton broth was spread uniformly
1×PCR buffer, 3 mM MgCl2 , 4 𝜇M of primer, and 2.5 U Taq onto the Mueller-Hinton agar plate. Antibiotic discs were
DNA polymerase (Promega) were mixed together. The PCR then placed onto the surface of each plate (4 antibiotics/Petri
reaction was carried out according to the condition in Table 3. dish) using antibiotic-disc dispenser (Oxoid, United States).
The PCR products from ERIC- and BOX-PCR were After incubation at 37∘ C for 24 hr, the diameter of growth
separated in 2% agarose gel with 100 kb DNA ladder for inhibition zone surrounding each disc was measured and
90 min. Then, the gel was stained with ethidium bromide and interpreted according to the CLSI (Clinical and Laboratory
prevalence of Listeria spp. among the three farms. For water

samples, Listeria spp. were only present in 33.30% (8/24) of
water samples from conventional farm C.
3.3. Prevalence of Listeria monocytogenes Based on PCR

Analysis. PCR detection of L. monocytogenes in the samples
was carried out by using primer pairs which amplified
730 bp region of the listeriolysin (hlyA) gene. However, L.
monocytogenes was absent in all the samples analyzed.
3.4. Genetic Diversity of Listeria Isolates Using ERIC-PCR.

Figure 1: PCR amplification of 16S rRNA gene of Listeria spp. with The electrophoretic profile of DNA fragments obtained after
the expected size of 938 bp, in fertilizer samples obtained from ERIC-PCR amplification yielded 1-5 bands with size approxi-
organic farm B. Lane 1: 100 bp ladder. Lane 2: L. monocytogenes mately 120 bp to 1450 bp. A common band with molecular size
reference strains ATCC 19155. Lanes 3-8: presumptive Listeria spp. of approximately 520 bp was observed in the electrophoretic
isolates from fertilizer samples. Lane 9: negative control.
profile from most of the isolates. Based on the ERIC-PCR
dendrogram shown in Figure 2, the Listeria spp. isolated from
Standards Institute) 2014 recommendation. Evaluation of the organic farm A, organic farm B, and conventional farm C
Listeria as resistant, susceptible, and intermediate toward the were genetically diverse and heterogeneous as they were not
antibiotics was conducted by referring to the Zone Diameter classified into specific cluster by either sampling area or the
Interpretive Criteria (nearest whole mm) of a particular type of samples. ERIC-PCR analysis produced 11 different
antibiotic of CLSI. The CLSI criteria for staphylococci were DNA fingerprint profiles. Simpson’s Index of Diversity, D, was
referred to in this study because interpretative criteria for calculated for ERIC-PCR based on Hunter and Gaston [34].
Listeria are not available from CLSI with the exception The D value of this technique was calculated to be 0.604.
of susceptibility breakpoints for ampicillin and penicillin.
Multiple antibiotic resistance (MAR) index of an isolate was 3.5. Genetic Diversity of Listeria Isolates Using BOX-PCR.
calculated as defined by Krumperman [37]: The electrophoretic band pattern of BOX-PCR amplification
𝑎 yielded 2-13 bands with size approximately 120 bp to 1550 bp.
MAR index = (2) Based on the BOX-PCR dendrogram shown in Figure 3,
𝑏 Listeria spp. isolated from all the three farms were not
“a” denotes number of antibiotics to which the particular classified according to the types of sample or sampling area.
isolate was resistant and “b” denotes number of antibiotics to Therefore, these Listeria spp. isolates were genetically diverse
which the particular isolate was exposed. and heterogeneous. BOX-PCR analysis produced 14 different
fingerprint profiles. Simpson’s Index of Diversity, D, was
3. Results calculated for BOX-PCR based on Hunter and Gaston [34].
The D value of this technique was calculated to be 0.888.
3.1. Prevalence of Listeria spp. Based on PCR Analysis. Anal-
ysis using PCR assay revealed that Listeria spp. were present 3.6. Antibiotic Susceptibility Test. Thirty-four (n=34) Listeria
in 7.51% (29/386) of all the samples (vegetable, soil, fertilizer, spp. isolated from 29 samples (vegetable, soil, fertilizer, and
and water) collected. It was present in 9.10% (6/66), 8.13% water) collected from all the three farms were subjected to
(13/160), and 6.25% (10/160) of the samples collected from antibiotic susceptibility testing. Listeria spp. isolates were
organic farm A, organic farm B, and conventional farm C, most resistant to clindamycin 97.06% (33/34) and least resis-
respectively. The prevalence of Listeria spp. from all the tant to gentamicin 17.65% (6/34).
samples was shown in Table 4. The gel picture for PCR Listeria spp. were isolated from 11 vegetable samples, 2
amplification of 16S rRNA gene of Listeria spp. was shown in (Chinese mustard and cucumber) from organic farm A and
Figure 1. 9 (Chinese cabbage, romaine/cos lettuce, and Chinese white
cabbage) from organic farm B. Antibiotic resistance graph of
3.2. Enumeration of Listeria spp. in the Vegetables, Soil, Water, vegetable samples from the three farms is shown in Figure 4.
and Fertilizer. The standard plate count (in CFU/g) of Listeria All Listeria spp. isolated from vegetable samples from
spp. in all the samples is also shown in Table 2. Listeria organic farms A and B were resistant to penicillin G, tetra-
spp. were present in 6.70% (2/30) and 8.00% (7/88) of cycline, and clindamycin. For soil samples, Listeria spp. were
vegetable samples from organic farm A and organic farm B, isolated from 6 soil samples, 4 from organic farm A and
respectively. Vegetable samples from organic farm B had the 2 from organic farm B. Antibiotic resistance graph of soil
highest prevalence of Listeria spp. among the three farms, samples from the three farms is shown in Figure 5.
while soil samples from organic farm A have the highest In this study, all Listeria spp. isolated from soil samples
prevalence of Listeria spp. Listeria spp. were not present in from organic farms A and B were resistant to clindamycin,
vegetables and soil samples from conventional farm C. For cephalothin, and ceftriaxone. Two Listeria spp., 4 Listeria
fertilizer samples, organic farms A and B had the highest spp., and 2 Listeria spp. were isolated from the fertilizer
Table 4: Prevalence of Listeria spp. in the organic farms and conventional farm by PCR assay.
Organic farm Conventional farm
No. Types of sample Standard Plate Count Standard Plate Count Standard Plate Count
Organic farm A Organic farm B Conventional farm C
(CFU/g) (CFU/g) (CFU/g)
1 Chinese cabbage (Pak Choy) 0% (0/6) - 14.30% (2/14) 9.50 × 102 -7.70 × 103 0% (0/10) -
2 Lettuce 0% (0/6) - - - 0% (0/12) -
3 Cucumber 16.70% (1/6) 2.10 × 105 - - 0% (0/14) -
4 Yardlong bean 0% (0/4) - - - 0% (0/14) -
Chinese flowering cabbage
5 0% (0/3) - 0% (0/16) - 0% (0/10) -
(Choy Sum)
6 Tomato 0% (0/3) - - - 0% (0/8) -
7 Chinese Mustard 100% (1/1) 2.50 × 104 0% (0/12) - 0% (0/10) -
8 Romaine/cos Lettuce 0% (0/1) - 25% (4/16) 2.10 × 103 - 9.90 × 104 - -
9 Chinese Kale (Kailan) - - 0% (0/8) - 0% (0/10) -
Chinese white cabbage (Sawi
10 - - 6.30% (1/16) 1.30 × 104 - -
Manis)
11 Local vegetable (Sabi Sative) - - 0% (0/6) - - -
12 Soil 16.70% (2/12) 3.30 × 103 -6.90 × 104 8.30% (2/24) 1.00 × 105 -1.20 × 105 0% (0/24) -
13 Fertilizer 16.70% (2/12) 1.20 × 104 -2.20 × 104 16.70% (4/24) 5.10 × 104 -7.00 × 105 8.30% (2/24) 4.30 × 104 -1.50 × 105
14 Water 0% (0/12) - 0% (0/24) - 33.30% (8/24) 1.00 × 103 -3.50 × 106
Total 9.10% (6/66) 8.13% (13/160) 6.25% (10/160)
“ – “ denotes not available.
5
Figure 2: Dendrogram constructed for ERIC-PCR of Listeria spp. in vegetable, fertilizer, and environmental samples collected from organic
farm A, organic farm B, and conventional farm. “A” denotes organic farm A, “B” denotes organic farm B, “C” denotes organic farm C, “(a)”
denotes Listeria spp. isolated from vegetables, soil, fertilizer, and water from organic farm A, organic farm B, and conventional farm C, “(b)”
denotes Listeria spp. isolated from soil and water from organic farm A and conventional farm C, “(c)” denotes Listeria spp. isolated from
vegetable and water from organic farm B and conventional farm C, and “(d)” denotes Listeria spp. isolated from soil from organic farm A.
samples collected from organic farm A, organic farm B, and spp. from organic farm A had the highest MAR index of
conventional farm C, respectively. Antibiotic resistance graph 0.85. For water samples, Listeria spp. were isolated only from
of fertilizer samples from the three farms is shown in Figure 6. conventional farm C, and the highest MAR index was 0.77.
The results revealed that all Listeria spp. isolated from
fertilizer samples were resistant to clindamycin and ceftri- 4. Discussion
axone. Conventional farm C was the only farm where the
water samples were detected with Listeria spp., with 9 Listeria 4.1. Prevalence of Listeria spp. from the Vegetables, Soil, Water,
spp. isolated. Antibiotic resistance graph of water samples and Fertilizer. As shown in Table 4, a total of five vegetables
from the 3 farms is shown in Figure 5. All (100%) (9/9) from organic farms A and B had high concentration of
of the Listeria spp. were resistant to penicillin G. MAR Listeria spp. in the vegetables (ranging from 9.50 × 102
index defined by Krumperman [37] was evaluated for all to 2.10 × 105 CFU/g). However, none of vegetables from
the isolates. In this study, Listeria spp. isolates demonstrated conventional farm C was positive. According to the Public
MAR; they were resistant to at least four of the thirteen Health England [38], samples consisting of more than 100
antibiotics tested. The MAR indexes for all the isolates are CFU/g of Listeria spp. are considered unsatisfactory and
recorded in Table 5. For vegetable samples, Listeria spp. investigation is required. Therefore, the vegetable samples
in Chinese mustard from organic farm A and romaine/cos collected from organic farms A and B were considered
lettuce from organic farm B had the highest MAR index of unsatisfactory and this represents the risk of contracting
0.85. For soil samples, Listeria spp. from organic farm A had listeriosis associated with fresh produce consumption. Lis-
the highest MAR index of 0.69. For fertilizer samples, Listeria teria spp. were present in 16.70% (2/12) and 8.30% (2/24)
Figure 3: Dendrogram constructed for BOX-PCR of Listeria spp. in vegetable, fertilizer, and environmental samples collected from organic
farm A, organic farm B, and conventional farm C. “A” denotes organic farm A, “B” denotes organic farm B, “C” denotes organic farm C,
“(a)” denotes Listeria spp. isolated from vegetables, soil, and fertilizer from organic farm A and organic farm B, “(b)” denotes Listeria spp.
isolated from vegetable, soil, and water from organic farm A and conventional farm C, “(c)” denotes Listeria spp. isolated from vegetables,
fertilizer, and water from organic farm A, organic farm B, and conventional farm C, and “(d)” denotes Listeria spp. isolated from water from
conventional farm C.
of soil from organic farms A and B. Listeria spp. are widely detected in 33.30% (8/24) of the water from conventional
distributed in the environment including soil, vegetation, farm C. According to Galvez et al. [42] and Chitarra et al.
surface water, sewage, animal feeds, farm environments, and [43], pathogenic bacteria such as Salmonella, pathogenic E.
food-processing environments [39]. According to Vackachan coli, and L. monocytogenes can be found in irrigation water
et al. [40], contaminated fertilizer and humidity of the for fresh produce. These pathogenic bacteria can internalize
soil may increase the risk of soil contamination. Therefore, crops through the roots and survive in them. This study also
measures should be taken for the use of contaminated soil revealed no presence of L. monocytogenes in all the samples
to reduce the presence of the bacteria. The fertilizer used (vegetable, soil, water, and fertilizer) from all farms which
by the three farms in the present study was animal waste could indicate lower potential of disease burden as the species
compost (chicken litter) and plant waste. Such fertilizers are is commonly causing human infections [2].
usually used as they are of low cost, organic, and containing
notable amount of nutrients. Normally, composting of animal 4.2. Genetic Heterogeneity of Listeria spp. Based on ERIC-
waste can inactivate large populations of human pathogens and BOX-PCR Analysis. The findings from both ERIC-PCR
but improper composting or cross-contamination results in and BOX-PCR analysis in the present study showed that
the high survival rate of these pathogens. Improper com- the Listeria spp. isolates were not grouped together based
posting may also result in the regrowth of the pathogens in on the types of samples and the source of isolation. They
the finished compost products under a range of favorable were not classified into specific cluster by either sampling
conditions [41]. Listeria spp. were absent in the water samples area or the type of samples. In the present study, the
from organic farms A and B. However, Listeria spp. were Listeria spp. isolated from organic farm A, organic farm
Antibiotic resistance of Listeria spp. from vegetables Antibiotic resistance of Listeria spp. from fertilizer
100 100
Percentage of resistance (%)

90 90
80 80
70 70
60 60
50 50
40
40 30
30 20
20 10
10 0
Trimethoprim/sulfamethoxazole
Ampicillin
Rifampin
Penicillin G
Gentamicin
Erythromycin
Tetracycline
Clindamycin
Chloramphenicol
Nitrofurantoin
Streptomycin
Cephalothin
Ceftriaxone
0
Rifampin
Penicillin G
Gentamicin
Erythromycin
Tetracycline
Clindamycin
Chloramphenicol
Nitrofurantoin
Streptomycin
Cephalothin
Ceftriaxone
Ampicillin
Antibiotics
Antibiotics
Organic farm A
Organic farm A Organic farm B
Organic farm B Conventional farm C
Conventional farm C
Figure 6: Percentage of antibiotic resistance of Listeria spp. from
Figure 4: Percentage of antibiotic resistance of Listeria spp. from fertilizer samples from organic farm A, organic farm B, and
vegetable samples from organic farm A, organic farm B, and conventional farm C.
conventional farm C.
BOX-PCR had greater discriminatory power than ERIC-

Antibiotic resistance of Listeria spp. from soil
PCR for fingerprinting Listeria spp. isolates of this study. In
100 comparison, the discriminatory power for both BOX-PCR
90 and ERIC-PCR analysis was lower as compared to the finding

80 by Jersek et al. [44] which revealed ERIC-PCR was suitable
70
60 for the typing of L. monocytogenes isolates as the index of
50 discrimination was high (0.98). Another study conducted
40 by Jamali and Thong [32] reported that the discrimination
30
20
indexes for REP-PCR, BOX-PCR, RAPD, and PFGE were
10 0.992, 0.998, 1, and 0.916, respectively. They suggested that
0 different subtyping methods often give different discrimina-
Rifampin
Penicillin G
Gentamicin
Erythromycin
Tetracycline
Clindamycin
Chloramphenicol
Nitrofurantoin
Streptomycin
Cephalothin
Ceftriaxone
Ampicillin
tory powers. Therefore, it is necessary to use more than one

subtyping approach to provide a more accurate description of
the genetic diversity of microorganisms in the study. On the
other hand, other fingerprinting tools such as REP-PCR and
(GTG)5 are well employed in bacterial typing [8] which can
be tested in further study.
Antibiotics
Organic farm A 4.3. Antibiotic Susceptibility of the Listeria Isolates. This

Organic farm B present study revealed that 97.06% (33/34) of Listeria spp. iso-
Conventional farm C lated from vegetables, soil, fertilizer, and water from organic
farm A, organic farm B, and conventional farm C were
Figure 5: Percentage of antibiotic resistance of Listeria spp. from
soil samples from organic farm A, organic farm B, and conventional resistant to clindamycin. Chen et al. [5] found that all Listeria
farm C. spp. isolates in catfish fillets and processing environment
were resistant to clindamycin. Gamboa-Marin et al. [45] also
revealed that L. monocytogenes, Listeria spp., and L. ivanovii
B, and conventional farm C were genetically diverse and from swine processing facilities in Colombia had major
heterogeneous. The heterogeneity was expected as the isolates resistance and intermediate susceptibility to clindamycin. In
were collected from different types of sample (vegetable, the present study, Listeria spp. from the three farms showed
soil, fertilizer, and water) and sampling locations (organic the lowest resistance against gentamicin. This is comparable
farm A, organic farm B, and conventional farm C). In this to a study by Li et al. [46] which revealed gentamicin
study, Simpson’s Index of Diversity, D, value for ERIC- and exhibited good activity against Listeria spp. from processed
BOX-PCR was 0.604 and 0.888, respectively. According to bison in the USA.
Kqueen et al. [35], the higher the discriminatory index, the This study showed that all the Listeria spp. isolates were
greater the effectiveness of a particular fingerprinting method resistant to more than one antibiotic and therefore demon-
to discriminate different strains. Thus, it was shown that strated MAR. According to Krumperman [37], MAR index
Table 5: MAR index for all Listeria spp. isolates from organic farm A, organic farm B, and conventional farm C.
No Source Sample Listeria spp. Isolates Antibiotic Resistance Pattern MAR index
1 Chinese Mustard V9b Amp, Rif, PenG, Gen, Ery, Tet, Chl, Cf, Cli, Nor, Cro 0.85
2 Cucumber V11a Rif, PenG, Ery, Tet, Cli, Nor 0.46
3 S4a Amp, Rif, PenG, Tet, Str, Cf, Cli, Nor, Cro 0.69
4 Soil S4b Rif, PenG, Sxt, Tet, Chl, Str, Cf, Cli, Cro 0.69
Organic Farm A
5 S4e Rif, PenG, Ery, Chl, Cf, Cli, Nor, Cro 0.61
6 Soil S5b Amp, Rif, Ery, Tet Chl, Str, Cf, Cli, Nor, Cro 0.77
7 Fertilizer M4a Amp, Rif, PenG, Gen, Stx, Ery, Tet, Chl, Cf, Cli, Cro 0.85
8 Fertilizer M5b Amp, PenG, Sxt, Ery, Tet, Chl, Cf, Cli, Nor, Cro 0.77
9 Pak Choy V114a Amp, Rif, PenG, Tet, Cf, Cli, Nor, Cro 0.62
10 Pak Choy V116c Amp, PenG, Ery, Tet, Cf, Cli, Nor, Cro 0.62
11 Romaine/cos lettuce V118a Amp, Rif, PenG, Gen, Ery, Tet, Cf, Cli, Cro 0.69
12 Romaine/cos lettuce V118c Amp, Rif, PenG, Gen, Tet, Cf, Cli, Nor, Cro 0.69
13 Romaine/cos lettuce V120b Amp, Rif, PenG, Sxt, Tet, Cf, Cli, Nor, Cro 0.69
14 Romaine/cos lettuce V120e Amp, PenG, Sxt, Ery, Tet, Chl, Str, Cf, Cli, Nor, Cro 0.85
15 V120g Amp, Rif, PenG, Tet, Chl, Str, Cf, Cli, Cro 0.69
16 Organic Farm B Sawi Manis V123e Amp, Rif, PenG, Sxt, Ery, Tet, Str, Cf, Cli, Cro 0.77
17 V123f Amp, PenG, Ery, Tet, Str, Cf, Cli, Cro 0.62
18 Soil S37a Amp, PenG, Sxt, Tet, Cf, Cli, Cro 0.54
19 Soil S37c Amp, PenG, Ery, Tet, Cf, Cli, Cro 0.54
20 Fertilizer M38a PenG, Ery, Tet, Cf, Cli, Nor, Cro 0.54
21 Fertilizer M38f PenG, Tet, Cf, Cli, Cro 0.38
22 Fertilizer M39b PenG, Ery, Tet, Cf, Cli, Cro 0.46
23 Fertilizer M39f Amp, PenG, Ery, Tet, Str, Cli, Cro 0.54
24 Fertilizer M16b Amp, Rif, PenG, Str, Cf, Cli, Cro 0.54
25 Fertilizer M22b Rif, Ery, Tet, Chl, Cli, Cro 0.46
26 Water W21b Rif, PenG, Gen, Tet 0.31
27 Water W23a PenG, Tet, Cf, Cli, Cro 0.38
28 Water W23b Amp, Rif, PenG, Tet, Str, Cf, Cli, Nor, Cro 0.69
29 Conventional Farm C Water W24a Amp, Rif, PenG, Sxt, Tet, Chl, Str, Cf, Cli, Cro 0.77
30 W24b PenG, Tet, Chl, Cli, Nor, Cro 0.46
Water
31 W24c Amp, PenG, Gen, Sxt, Ery, Tet, Chl, Cf, Cli 0.69
32 Water W26a Amp, Rif, PenG, Tet, Str, Cli, Cro 0.54
33 Water W27a PenG, Sxt, Ery, Chl, Cli, Cro 0.46
34 Water W27c Amp, PenG, Sxt, Tet, Str, Cli, Nor, Cro 0.62
“Amp” denotes ampicillin, “Cf” denotes cephalothin, “Cro” denotes chloramphenicol, “Sli” denotes clindamycin, “Ery” denotes erythromycin, “Gen” denotes gentamycin, “PenG” denotes penicillin G, “Rif” denotes
rifampin, “Str” denotes streptomycin, “Tet” denotes tetracycline, “Sxt” denotes sulfamethoxazole/trimethoprim, “Nor” denotes nitrofurantoin, and Cf denotes ceftriaxone.
9
value lower than 0.20 indicates that the organism originated drafting. Lai Sin Chai and Ahmad Syatir Tahar were involved
from a lower risk source in which the antibiotics are seldom in the manuscript drafting and editing. Lai Sin Chai was
or never used. MAR index value higher than 0.20 indicates involved in the sampling collection, processing, and data
that they are originated from a higher risk source which is analysis. Kasing Apun and Lesley Maurice Bilung were
greatly exposed to antibiotics. A study conducted by Jamali involved in the final editing of the manuscript. All authors
et al. [47] reported that 8.40% of Listeria spp. isolated from read and approved the final manuscript.
raw milk in Iran showed multiple antibiotic resistances. In
the present study, all Listeria spp. had MAR index higher than
0.20, suggesting that the Listeria spp. isolates from the three Funding
farms were originated from a higher risk source in which
they had been constantly exposed to antibiotics. MAR of This research is supported by Research Grant no. FRGS/
Listeria spp. in vegetables, soil, and irrigation water could be SG03(01)/970/2013(11).
a result of the usage of animal waste as fertilizer which might
contain antibiotics used to prevent or treat animal diseases Acknowledgments
and promote animal growth. Hu et al. [48] conducted a study
on the migration of antibiotics from manure to soil and from The authors acknowledge Ministry of Higher Education,
soil to vegetables and groundwater. In the study, they applied Malaysia (MOHE), for funding the project.
manure containing antibiotics to organic vegetable bases and
revealed that the soil, vegetables, and water were detected
with antibiotic residues. Some antibiotics are still biologi-
References
cally active despite being in environment. This eventually [1] K. Todar, Listeria monocytogenes. Todar’s Online Textbook of
can initiate development of antibiotics resistance genes in Bacteriology, Department of Bacteriology, University of Wis-
microorganisms. The findings in the present study showed consin, 2012.
that Listeria spp. isolated from the samples from all the [2] P. Jeyaletchumi, R. Tunung, S. P. Margaret, R. Son, M. G.
three farms were multiresistant to the antibiotics tested. The Farinazleen, and Y. K. Cheah, “Review article: detection of
presence of Listeria spp. that were resistant to antibiotics com- Listeria monocytogenes in foods,” International Food Research
monly used to treat human listeriosis (including ampicillin, Journal, vol. 17, no. 1, pp. 1–11, 2010.
chloramphenicol, erythromycin, gentamicin, penicillin G, [3] D. F. Maffei, N. F. D. A. Silveira, and M. D. P. L. M. Catanozi,
rifampin, tetracycline, and sulfamethoxazole/trimethoprim) “Microbiological quality of organic and conventional vegetables
raises the possibility of future acquisition of resistance by L. sold in Brazil,” Food Control, vol. 29, no. 1, pp. 226–230, 2013.
monocytogenes and Listeria spp. [4] D. Walsh, G. Duffy, J. J. Sheridan, I. S. Blair, and D. A. McDowell,
“Antibiotic resistance among Listeria, including Listeria mono-
5. Conclusion cytogenes, in retail foods,” Journal of Applied Microbiology, vol.
90, no. 4, pp. 517–522, 2001.
The findings of this study show current occurrence of Listeria [5] B.-Y. Chen, R. Pyla, T.-J. Kim, J. L. Silva, and Y.-S. Jung, “Antibi-
spp. at farm level of selected organic and conventional otic resistance in Listeria species isolated from catfish fillets and
vegetable farms in Sarawak, Malaysia. Personal hygiene and processing environment,” Letters in Applied Microbiology, vol.
good manufacturing practice at farm level are essential for 50, no. 6, pp. 626–632, 2010.
prevention of the transmission of the organism along the [6] L. Z. Moreno, R. Paixao, D. D. S. Gobbi et al., “Characterization
food chain. Based on the genotyping analysis, all Listeria of antibiotic resistance in Listeria spp. isolated from slaughter-
house environments, pork and human infections,” The Journal
spp. isolates were heterogenous. Nonetheless, BOX-PCR was
of Infection in Developing Countries, vol. 8, no. 4, pp. 416–423,
shown to be better in discriminatory power than ERIC- 2014.
PCR and can be utilized in Listeria typing. This study also
[7] L. Masco, G. Huys, D. Gevers, L. Verbrugghen, and J. Swings,
presented high occurrence of multiple antibiotic resistant “Identification of Bifidobacterium species using rep-PCR finger-
strains in the fresh produce and farm environment which printing,” Systematic and Applied Microbiology, vol. 26, no. 4, pp.
could be an indicator of the excessive use of antibiotics in the 557–563, 2003.
agriculture field. [8] J. Versalovic, M. Schneider, F. J. De Bruijn, and J. R. Lupski,
“Genomic fingerprinting of bacteria using repetitive sequence-
Data Availability based polymerase chain reaction,” Methods in Molecular and
Cellular Biology, vol. 5, no. 1, pp. 25–40, 1994.
Data generated in this study are included in this article. [9] Y.-H. Shangkuan, J.-F. Yang, H.-C. Lin, and M.-F. Shaio, “Com-
parison of PCR–RFLP, ribotyping and ERIC–PCR for typing
Conflicts of Interest Bacillus anthracis and Bacillus cereus strains,” Journal of Applied
The authors declare that they have no conflicts of interest. [10] Y. Ye, Q. Wu, L. Yao, X. Dong, K. Wu, and J. Zhang, “Analysis
of a consensus fragment in ERIC-PCR fingerprinting of Enter-
Authors’ Contributions obacter sakazakii,” International Journal of Food Microbiology,
vol. 132, no. 2-3, pp. 172–175, 2009.
Lesley Maurice Bilung conceived the study and was involved [11] D. P. Stephenson, R. J. Moore, and G. E. Allison, “Comparison
in the design and coordination of the study and manuscript and utilization of repetitive-element PCR techniques for typing
Lactobacillus isolates from the chicken gastrointestinal tract,” Salmonellaand Listeria monocytogenes contamination of pro-
Applied and Environmental Microbiology, vol. 75, no. 21, pp. duce fields,” Applied and Environmental Microbiology, vol. 79,
6764–6776, 2009. no. 24, pp. 7618–7627, 2013.
[12] Z. Ruiz-Bolivar, A. K. Carrascal-Camacho, M. C. Neuque- [25] G. Ozbey, H. B. Ertas, and F. Kok, “Prevalence of Listeria species
Rico et al., “Enterobacterial repetitive intergenic consensus- in camel sausages from retail markets in Aydin province in
polymerase chain reaction (ERIC-PCR) fingerprinting reveals Turkey and RAPD analysis of Listeria monocytogenes isolates,”
intra-serotype variations among circulating Listeria monocyto- Irish Veterinary Journal, vol. 59, no. 6, pp. 342–344, 2006.
genes strains,” Journal of Microbiology Research, vol. 5, no. 13, pp. [26] M. J. Zimbro, D. A. Power, S. M. Miller, G. E. Wilson, and J. A.
1586–1598, 2011. Johnson, Difco & BBL Manual: Manual of Microbiological Cul-
[13] S. Y. Cao, M. S. Wang, A. C. Cheng et al., “Comparative analysis ture Media-Second Edition, Becton, Dickinson and Company,
of intestinal microbial community diversity between healthy 2009.
and orally infected ducklings with Salmonella enteritidis by [27] P. Jeyaletchumi, R. Tunung, P. M. Selina et al., “Evaluation of
ERIC-PCR,” World Journal of Gastroenterology, vol. 14, no. 7, p. Listeria spp. and Listeria monocytogenes in selected vegetable
1120, 2008. farms,” Journal of Tropical Agricultural and Food Science, vol. 39,
[14] R. Chmielewski, A. Wieliczko, M. Kuczkowski, M. Mazurk- no. 2, pp. 255–266, 2011.
iewicz, and M. Ugorski, “Comparison of ITS Profiling, REP-and [28] W. C. Wong, C. F. Pui, R. Tunung et al., “Prevalence of
ERIC-PCR of Salmonella enteritidis isolates from Poland,” Listeria monocytogenes in frozen burger patties in Malaysia,”
Zoonoses and Public Health, vol. 49, no. 4, pp. 163–168, 2002. International Food Research Journal, vol. 19, no. 4, pp. 1751–1756,
[15] P. E. Dombek, L. K. Johnson, S. T. Zimmerley, and M. J. 2012.
Sadowsky, “Use of repetitive DNA sequences and the PCR to [29] S. S. Awaisheh, “Survey of Listeria monocytogenes and other
differentiate Escherichia coli isolates from human and animal Listeria sp. contamination in different common ready-to-eat
sources,” Applied and Environmental Microbiology, vol. 66, no. food products in Jordan,” Pakistan Journal of Biological Sciences,
6, pp. 2572–2577, 2000. vol. 12, no. 23, pp. 1491–1497, 2009.
[16] B.-K. Hahm, Y. Maldonado, E. Schreiber, A. K. Bhunia, and [30] N. Indrawattana, T. Nibaddhasobon, N. Sookrung et al., “Preva-
C. H. Nakatsu, “Subtyping of foodborne and environmental lence of Listeria monocytogenes in raw meats marketed in
isolates of Escherichia coli by multiplex-PCR, rep-PCR, PFGE, Bangkok and characterization of the isolates by phenotypic
ribotyping and AFLP,” Journal of Microbiological Methods, vol. and molecular methods,” Journal of Health, Population and
53, no. 3, pp. 387–399, 2003. Nutrition, vol. 29, no. 1, pp. 26–38, 2011.
[17] B. R. Mohapatra and A. Mazumder, “Comparative efficacy of [31] A. Laciar, L. Vaca, R. Lopresti, A. Vega, C. Mattana, and O. N. P.
five different rep-PCR methods to discriminate Escherichia De Centorbi, “DNA fingerprinting by ERIC-PCR for comparing
coli populations in aquatic environments,” Water Science and Listeria spp. strains isolated from different sources in San Luis,
Technology, vol. 58, no. 3, pp. 537–547, 2008. Argentina,” Revista Argentina de Microbiologı́a, vol. 38, no. 2,
[18] B. Lanoot, M. Vancanneyt, P. Dawyndt et al., “BOX-PCR pp. 55–60, 2006.
fingerprinting as a powerful tool to reveal synonymous names [32] H. Jamali and K. L. Thong, “Genotypic characterization and
in the genus Streptomyces. Emended descriptions are proposed antimicrobial resistance of Listeria monocytogenesfrom ready-
for the species Streptomyces cinereorectus, S. fradiae, S. tricolor, to-eat foods,” Food Control, vol. 44, pp. 1–6, 2014.
S. colombiensis, S. filamentosus, S. vinaceus and S. phaeopur-
[33] C. R. Jackson, L. M. Spicer, J. B. Barrett, and L. M. Hiott, “Appli-
pureus,” Systematic and Applied Microbiology, vol. 27, no. 1, pp.
cation of multiplex PCR, Pulsed-Field Gel Electrophoresis
84–92, 2004.
(PFGE), and BOX-PCR for molecular analysis of Enterococci,”
[19] M. Tacão, A. Alves, M. J. Saavedra, and A. Correia, “BOX-PCR in Gel Electrophoresis-Principles and Basics, S. Magdeldin, Ed.,
is an adequate tool for typing Aeromonas spp,” Antonie van InTech, 2012.
Leeuwenhoek-Journal of Microbiology, vol. 88, no. 2, pp. 173–179,
[34] P. R. Hunter and M. A. Gaston, “Numerical index of the
2005.
discriminatory ability of typing systems: an application of
[20] B. J. Currie, D. Gal, M. Mayo et al., “Using BOX-PCR to exclude Simpson’s index of diversity,” Journal of Clinical Microbiology,
a clonal outbreak of melioidosis,” BMC Infectious Diseases, vol. vol. 26, no. 11, pp. 2465-2466, 1988.
7, article no. 68, 2007.
[35] C. Yoke-Kqueen, K. Teck-Ee, R. Son, N. Yoshitsugu, and N. Mit-
[21] W. Kim, Y.-P. Hong, J.-H. Yoo, W.-B. Lee, C.-S. Choi, and S.-I. suaki, “Molecular characterisation of Vibrio parahaemolyticus
Chung, “Genetic relationships of Bacillus anthracis and closely carrying tdh and trh genes using ERIC-, RAPD- and BOX-PCR
related species based on variable-number tandem repeat analy- on local Malaysia bloody clam and Lala,” International Food
sis and BOX-PCR genomic fingerprinting,” FEMS Microbiology Research Journal, vol. 20, no. 6, pp. 3299–3305, 2013.
Letters, vol. 207, no. 1, pp. 21–27, 2002.
[36] I. C. Morobe, C. L. Obi, M. A. Nyila, B. A. Gashe, and M. I.
[22] D. M. Olive and P. Bean, “Principles and applications of meth- Matsheka, “Molecular characterization and serotyping of
ods for DNA-based typing of microbial organisms,” Journal of Listeria monocytogenes with a focus on food safety and disease
Clinical Microbiology, vol. 37, no. 6, pp. 1661–1669, 1999. prevention,” in Biochemical Testing, J. C. Jimenez-Lopez, Ed.,
[23] M. Fakruddin, K. S. Bin Mannan, R. Mohammad Mazumdar, InTech, 2012, Retrieved November 8, 2012, http://www.intechopen
A. Chowdhury, and M. Nur Hossain, “Identification and char- .com/books/biochemical-testing/molecularcharacterization-and-
acterization of microorganisms: DNA-fingerprinting methods,” serotyping-of-listeriamonocytogenes-isolates-from-various-foods-in-g.
Songklanakarin Journal of Science and Technology, vol. 35, no. 4, [37] P. H. Krumperman, “Multiple antibiotic resistance indexing of
pp. 397–404, 2013. Escherichia coli to identify high-risk sources of fecal contami-
[24] L. K. Strawn, Y. T. Gröhn, S. Warchocki, R. W. Worobo, E. nation of foods,” Applied and Environmental Microbiology, vol.
A. Bihn, and M. Wiedmann, “Risk factors associated with 46, no. 1, pp. 165–170, 1983.
[38] Public Health England, “Detection and enumeration of Listeria

monocytogenes and other Listeria species. Microbiology: Services
Food, Water and Environmental Microbiology Standard Method.
Crown,” 2014.
[39] B. D. Sauders, J. Overdevest, E. Fortes et al., “Diversity of
Listeriaspecies in urban and natural environments,” Applied
and Environmental Microbiology, vol. 78, no. 12, pp. 4420–4433,
2012.
[40] M. B. Vackachan, C. Latha, B. Sunil, and V. K. Menon, “Preva-
lence of Listeria spp. in soils of central Kerala, India,” Interna-
tional Journal of Current Microbiology and Applied Sciences, vol.
4, no. 1, pp. 938–943, 2015.
[41] Z. Chen and X. Jiang, “Microbiological safety of chicken litter
or chicken litter-based organic fertilizers: a review,” Agriculture,
vol. 4, no. 1, pp. 1–29, 2014.
[42] F. Lopez-Galvez, A. Allende, F. Pedrero-Salcedo, J. J. Alarcon,
and M. I. Gil, “Safety assessment of greenhouse hydroponic
tomatoes irrigated with reclaimed and surface water,” Interna-
tional Journal of Food Microbiology, vol. 191, pp. 97–102, 2014.
[43] W. Chitarra, L. Decastelli, A. Garibaldi, and M. L. Gullino,
“Potential uptake of Escherichia coli O157:H7 and Listeria
monocytogenes from growth substrate into leaves of salad plants
and basil grown in soil irrigated with contaminated water,”
International Journal of Food Microbiology, vol. 189, pp. 139–145,
2014.
[44] B. Jeršek, P. Gilot, M. Gubina et al., “Typing of Listeria mono-
cytogenesstrains by repetitive Element sequence-based PCR,”
Journal of Clinical Microbiology, vol. 37, no. 1, pp. 103–109, 1999.
[45] A. Gamboa-Marı́n, D. C. Mejı́a-Wagner, P. A. Moreno-Ocampo
et al., “Antimicrobial susceptibility of Listeria monocytogenes,
Listeria ivanovii and Listeria species isolated from swine pro-
cessing facilities in Colombia,” Journal of Swine Health and
Production, vol. 21, no. 1, pp. 10–21, 2013.
[46] Q. Li, J. S. Sherwood, and C. M. Logue, “Antimicrobial resistance
of Listeria spp. recovered from processed bison,” Letters in
Applied Microbiology, vol. 44, no. 1, pp. 86–91, 2007.
[47] H. Jamali, L. C. Chai, and K. L. Thong, “Detection and isolation
of Listeria spp. and Listeria monocytogenes in ready-to-eat foods
with various selective culture media,” Food Control, vol. 32, no.
1, pp. 19–24, 2013.
[48] X. Hu, Q. Zhou, and Y. Luo, “Occurrence and source analysis
of typical veterinary antibiotics in manure, soil, vegetables and
groundwater from organic vegetable bases, northern China,”
Environmental Pollution, vol. 158, no. 9, pp. 2992–2998, 2010.

Food Micribiology

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Food Micribiology

Uploaded by

Copyright:

Available Formats

BioMed Research International

Lead Guest Editor: Marta Laranjo

Survival and Behavior of Encapsulated Probiotics (Lactobacillus plantarum) in Calcium-Alginate-Soy

Technological Properties of Bifidobacterial Strains Shared by Mother and Child

Improving Ethyl Acetate Production in Baijiu Manufacture by Wickerhamomyces anomalus and

Survival of Coliform Bacteria in Virgin Olive Oil

Extra-Intestinal Fluoroquinolone-Resistant Escherichia coli Strains Isolated from Meat

Duration of Heat Stress Effect on Invasiveness of L. monocytogenes Strains

Marta Laranjo ,1 Mar-a de Gu-a Córdoba,2

Correspondence should be addressed to Marta Laranjo; mlaranjo@uevora.pt

Received 25 March 2019; Accepted 25 March 2019; Published 4 April 2019

Correspondence should be addressed to Hadda-Imene Ouzari; ouzari.imene@gmail.com

Received 3 August 2018; Accepted 10 January 2019; Published 26 February 2019

Guest Editor: Marta Laranjo

1. Introduction (e.g., L. monocytogenes, E. coli, and Salmonella spp.) can be

Table 1: Different treatment of tomatoes juices.

LAB Counts log (Cfu/ml) at 25∘ C

Salmonella Counts log(N/N0) at 25 C

Salmonella Counts log(N/N0) at 4 ∘ C

Citric acid (g/l) at 25∘ C

Ethanol (g/l) at 25∘ C

Lactic acid (g/l) at 25∘ C

Figure 10: Color component of tomatoes juices.

biopreservative strain against Listeria monocytogenes risk, on

Ong-Ard Praepanitchai, Athapol Noomhorm, and Anil Kumar Anal

Correspondence should be addressed to Anil Kumar Anal; anilkumar@ait.ac.th

Guest Editor: Maria E. Potes

1. Introduction exhibiting antimutagenic activities, and preventing carcino-

Cells count (CFU/mL) af ter disintegration of the hydrogel beads

8.51 ± 0.10 log CFU mL−1 , respectively. However, the survival 10

Log CFU mL-1

Log CFU mL-1

various ratios of pure SA and SA/SPI into CaCl2 solution.

Mateja Pate ,1 Jasna MiIunoviI,1 Majda Golob ,1

Correspondence should be addressed to Mateja Pate; mateja.pate@vf.uni-lj.si

Guest Editor: Maria E. Potes

1. Introduction still ranks first among the causative agents of food-borne

Antimicrobial Resistance Distribution of MICs (mg/L)

PFGE profile No. of isolates (n=87) FBO/AOHa Years

PFGE XbaI PFGE XbaI

Isolate ID Resistance pattern PFGE profile No. of isolates/profile

1.2 biofilm than profile A1 (p<0.05), and profile C1 produced

0.8 and B1 and D1 (p= 0.06).

Average biofilm formation (OD at 595nm)

[21] N. Nógrády, Á. Tóth, Á. Kostyák, J. Pászti, and B. Nagy,

Amreen Bashir ,1 Ansar Azeem,1 Yvonne Stedman,2 and Anthony C. Hilton 1

Correspondence should be addressed to Amreen Bashir; bashira6@aston.ac.uk

Guest Editor: Teresa Lemsaddek

2.2. Pet Food Factory Environmental Monitoring

media. Error bars represent standard deviation of the mean.

for Biofilm Formations,” Journal of AU Technology, vol. 15, pp.

Angela Peirotén , Pilar Gaya, Juan Luis Arqués ,

Correspondence should be addressed to Juan Luis Arqués; arques@inia.es

Guest Editor: Teresa Lemsaddek

1. Introduction of 106 cfu/g have been recommended to compensate their

2. Materials and Methods 2.3.2. Microbial Determinations. Microbiological determi-

Strain -80∘ C (21 d) Freeze-drying (21 d)

Growth in milk Storage at 4∘ C Storage at 4∘ C

Table 4: Organic acids in cheeses with bifidobacteria and control cheese.

QI Control B. breve INIA P734 B. bifidum INIA P671

[36]. The increased production of acetoin, 2-butanone, and Data Availability

[43] M. F. Fernández, S. Boris, and C. Barbés, “Probiotic properties

Correspondence should be addressed to Xiuting Li; lixt@btbu.edu.cn

Guest Editor: Teresa Lemsaddek