Clinical Oral Investigations

https://doi.org/10.1007/s00784-021-03923-7

ORIGINAL ARTICLE

Identification of Fusobacterium nucleatum in primary

and secondary endodontic infections and its association with clinical
features by using two different methods
Brenda P. F. A. Gomes 1 & Juliana D. Bronzato 1 & Rebecca F. Almeida-Gomes 2 & Ericka T. Pinheiro 1,3 &
Ezilmara L. R. Sousa 1,4 & Rogério C. Jacinto 1,5

Received: 19 October 2020 / Accepted: 29 March 2021

# The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature 2021

Abstract
Objective Fusobacterium nucleatum is an important oral pathogen involved in endodontic infections. This study aimed to assess
the frequency of Fusobacterium nucleatum in primary and secondary endodontic infections and its associations with the clinical
features in a Brazilian population by using both culture and nested PCR methods.
Methods A total of 100 microbial samples from patients with primary (n=50) and secondary endodontic infections (n=50) were
analyzed by using culture and nested PCR methods. Strict anaerobic techniques were used for culture and identification of
F. nucleatum. The DNA extracted from the samples was analyzed for the presence of target species by using species-specific primers.
Results Culture and nested PCR methods detected F. nucleatum, respectively, in 11/100 and 82/100 root canals. F. nucleatum
was isolated by culture from 10/50 (20%) root canals with primary infections and from 1/50 (2%) root canal with secondary/
persistent infections. Nested PCR detected F. nucleatum in 42/50 (84%) root canals with primary infections and in 40/50 (80%)
root canals with secondary/persistent endodontic infections. F. nucleatum was associated with spontaneous pain, tenderness to
percussion, pain on palpation, swelling, tooth mobility, wet root canals, hemorrhagic exudate, tooth decay, inadequate restora-
tion, and poor endodontic filling.
Conclusion F. nucleatum was found in more cases of primary endodontic infections than in cases of secondary/persistent ones. A
higher prevalence of F. nucleatum was detected by using the nested PCR method than by using culture. The presence of
F. nucleatum in the root canals was associated with several clinical features.
Clinical relevance The high prevalence of F. nucleatum in the root canals detected by molecular methods, and its association with
several clinical features reveals the importance of these species in the development of apical pathologies and reinforces the need
of an endodontic treatment directed to bacterial elimination.

Keywords Endodontics . Fusobacterium nucleatum . PCR .

* Brenda P. F. A. Gomes Culture
bpgomes@fop.unicamp.br

1
Department of Restorative Dentistry, Division of Endodontics, Introduction
Piracicaba Dental School, State University of Campinas –
UNICAMP, Av. Limeira 901. Bairro Areao, Piracicaba, SP, Brazil Fusobacterium spp. are Gram-negative, non-motile, non-
2
Faculty of Medical Sciences, University Center Lusíada – UNILUS, spore-forming, obligate anaerobic rods belonging to the
Santos, SP, Brazil phylum Fusobacteria. Individual cells are supposed to
3
Department of Operative Dentistry, Division of Endodontics, The share a similar fusiform morphology of 5 to 10 μm in
University of São Paulo School of Dentistry – FOUSP, São length [1]. Fusobacterium nucleatum is the most isolated
Paulo, SP, Brazil
Fusobacterium spp. in the oral cavity [2], being known to
4
Department of Semiology and Clinic, Division of Endodontics, be a bridge organism between primary and secondary col-
School of Dentistry, Federal University of Pelotas – UFPEL,
Pelotas, RS, Brazil
onizers of the dental plaque [3]. This bacterium is found
5
in higher levels in periodontal disease compared to
Department of Preventive and Restorative Dentistry, School of
Dentistry, Araçatuba, São Paulo State University – UNESP,
healthy gingiva [4].
Araçatuba, SP, Brazil

In endodontics, F. nucleatum was reported to prevail in
pulpitis, radicular cysts [5], apical periodontitis [6], persistent
apical periodontitis [7], and severe acute endodontic infection,
including dento-alveolar abscesses [8], and flare-ups [9].
Fusobacterium spp. were associated with tooth pain, tender-
ness to percussion, wet root canals (presence of clear, hemor-
rhagic, or purulent exudates), and the presence of purulent
exudates [10].
Primary infections are related to non-endodontically
treated teeth, whereas secondary or persistent endodontic
infections affect failed endodontically treated teeth [10,
11]. The microbiota found in the cases of endodontic fail-
ure comprises a more restricted group of species com-
pared to primary infections. Facultative anaerobic and
Gram-positive bacteria predominate in root canals of
failed endodontically treated teeth, whereas strict anaero-
bic bacteria such as Fusobacterium spp., Porphyromonas
spp., Prevotella spp., Parvimonas spp., Tannerella spp.,
Treponema spp., Dialister spp., Filifactor spp.,
Actinomyces spp., Olsenella spp., and Pseudoramibacter
spp. predominate in root canals of teeth with primary
endodontic infections [11].
There are two main methods to identify microorganisms:
culture-dependent and culture-independent assays. The for-
mer is a gold standard method to isolate viable bacteria.
Despite the fact that many bacteria still cannot be cultured,
there is a broad spectrum of microorganisms which can be
cultured, including Fusobacterium spp. [12], especially with
the improvement of culture techniques.
Culture-independent assays are DNA-based and have
been often used to determine the bacterial composition
in endodontic infections, but they cannot be routinely
used to determine whether a microbe is viable or not
because DNA persists in the environment after cell
death [13]. One advantage of the molecular techniques
is their capacity to detect a wide range of different
species in a small volume of a sample [12, 14].
However, adequate controls are necessary to prove that
the species identified were actually present in the orig-
inal samples.
To the authors’ best of knowledge, there is no study
up to now evaluating the presence of Fusobacterium
nucleatum by using a sizable number of samples from
two distinct endodontic infections by two different
methods of identification. Hence, this study aimed to
assess the frequency of Fusobacterium nucleatum in
primary and secondary endodontic infections and its as-
sociations with the clinical features in a Brazilian pop-
ulation by using both culture and nested PCR methods.
The null hypothesis tested was that there is no relation-
ship between specific clinical features and the presence
of F. nucleatum in primary and secondary/persistent
endodontic infections.
Clin Oral Invest
Materials and methods
Ethical aspects and patient selection
This cross-sectional study was approved by the Human
Research Ethics Committee of the Piracicaba Dental School
of the State University of Campinas (UNICAMP) according
to protocol number CAAE 86140218.0.0000.5418. All pa-
tients signed an informed consent form prior to their
participation.
A total of 100 patients were included, with 50 requiring
endodontic treatment for primary infections and 50 for sec-
ondary endodontic infections.
Inclusion criteria for patients with primary
endodontic infections
Only patients whose teeth had pulp necrosis, confirmed by the
absence of response to pulp sensitivity test with Endo-Ice
(1,1,1,2 tetrafluoroethane, Hygenic Corp., Akron, OH, USA)
were included.
Inclusion criteria for patients with secondary
endodontic infections
Endodontic treatment failure was determined based on both
clinical and radiographic examinations, which should show
the presence of persistent signs and/or symptoms, including
pain on palpation, discomfort to percussion, periapical radio-
lucent lesion, and/or persistent sinus tract. In addition, voids in
or around the filling of the root canal were also considered a
reason for retreatment [15, 16].
Exclusion criteria for all patients
Patients who had received antibiotic therapy in the preceding
three months or those with systemic disease, tooth with ex-
posed root canal, tooth that could not be isolated, tooth with
periodontal pockets deeper than 3 mm, immature teeth, and
history of dental trauma were not included in this study.
Clinical features
The clinical features included history of previous pain, tender-
ness to percussion, pain on palpation, tooth mobility, presence
of sinus tract (endodontic or periodontal origin), presence of
swelling in periodontal tissues (i.e., acute abscess), and inter-
nal status of the root canal (e.g., dry canal or presence of clear,
hemorrhagic or purulent exudates detected as a distinct damp-
ening or stain on the sampling paper points). Each type of
exudate was analyzed separately and then grouped with other
types under the denomination “wet root canal.” Periradicular
status was defined as acute periradicular periodontitis or
Clin Oral Invest
abscess (i.e., acute apical abscess, chronic apical abscess, and
phoenix abscess).
The failure of root canal treatment was determined based
on clinical and radiographic examinations. Previous root canal
treatment of the teeth was carried out by unknown operators,
and root canal fillings were rated as good if no void was
present within 2 mm of the radiographic apex. If one or more
than one of these criteria were not met, the root canal fillings
were rated as poor [16, 17].
Clinical and sampling procedures
Protocols for disinfection of the operative field, sampling pro-
cedures, and clinical procedures regarding both primary and
secondary infections have been described elsewhere [15, 18].
Briefly, the patient’s facial skin was decontaminated with
2% CHX solution (Drogal, Piracicaba, SP, Brazil) prior to
intervention. After local anesthesia (2% lidocaine with
1:100,000 epinephrine), the teeth were isolated with a rubber
dam to prevent infiltration of saliva.
Operative field, crown, and surrounding structures were
disinfected by using 30% H2O2 (v/v) for 30 s, followed by
2.5% NaOCl for the same period of time and then neutralized
with 5% sodium thiosulfate. The disinfection protocol was
checked by taking a swab sample from both internal and ex-
ternal surfaces of the crown and from adjacent structural areas.
Next, the swab sample was streaked onto a plate containing
5% defibrinated sheep blood and fastidious anaerobe agar
(FAA, LAB M, Heywood, Lancashire, UK) before being in-
cubated anaerobically and aerobically, respectively, for up to
14 days [19]. DNA extraction from the swab and PCR analy-
sis were then performed by using universal bacterial primers
(Table 1). If any positive cultures or DNA amplification prod-
ucts were detected, then the patient was excluded from the
study.
A two-stage access cavity preparation was performed by
using a sterile high-speed diamond bur without the use of
water spray, but under manual irrigation with sterile saline
solution. The first stage was performed to promote a major
removal of contaminants, including carious lesions and resto-
rations. In the second stage, before entering the pulp chamber,
Table 1 Primers and probes used
in this study Primers and Specificity/location/orientation
probes
Fnuc Fusobacterium nucleatum/Fn/16S/F
Sm785 Universal primer/16S/785 bp from 5= end/
F
422 Universal primer/23S/422 bp from 5= end/
R
L189 Universal primer/23S/R
the access cavity was disinfected according to the protocol
described earlier. Sterility of the internal surface of the access
cavity was checked as previously described, and all proce-
dures were performed aseptically.
Sampling procedures for primary endodontic
infection
After checking the sterility of the access cavity, a new sterile
bur was used followed by irrigation with sterile water.
Microbiological sampling was performed by introducing three
consecutive sterile #20 paper points (Dentsply-Maillefer,
Ballaigues, Switzerland) into the full length of the root canal
and retaining them in position for 60 s. All materials, includ-
ing the paper points used in this study, were heat sterilized at
220°C for 4 h, in order to eliminate possible contamination
and bacterial remnants.
Next, the paper points were immediately transferred to a
test tube containing 1 mL of the VMGA III transport medium
and placed in an anaerobic workstation (Don Whitley
Scientific, Bradford, UK) for 15 min. After thoroughly shak-
ing the endodontic sample in a mixer for 60 s (Vortex;
Marconi, São Paulo, Brazil), 250 μL of the transport medium
was used for culture and 750 μL in 3 different vials (250 μL
each) was frozen at 80°C for further molecular analyses.
Sampling procedures for secondary endodontic
infections
After checking the sterility of the access cavity, a new sterile
bur was used under irrigation with sterile saline to access the
root canal. The root-filling materials were removed by gently
introducing Reciproc R25 files (VDW, Munich, Germany)
along the working length, as determined by pre-operative ra-
diograph and according to the manufacturer’s instructions, in
a crown-down movement, trying to avoid enlarging the root
canal. No chemical solvent was used and the canal was filled
with saline solution. The root filling materials removed were
collected in the test tubes with the transport media. Next,
microbial sampling continued with sterile paper points as pre-
viously described.
Sequence
TTCGGGGAAACCTAAAGACA
GGTGG
GGATTAGATACCCTGGTAGTC
GGAGTATTTAGCTT
GGTACTTAGATGTTTCAGTTC

In the case of multi-rooted teeth, both in cases of primary
and secondary infections, only the largest root canal with
periradicular radiolucency was sampled for microbial evalua-
tion, which was limited to a single ecologic environment. In
the case of a dry root canal, a second paper point moistened in
sterile saline solution was used to ensure adequate sample
acquisition. In the case of a wet root canal, as many paper
points as needed were used to absorb all the fluid from the
canal.
Clinical procedures in both primary and secondary
infections
After collecting the microbial samples that were ana-
lyzed in the present study, endodontic treatment/re-
treatment was performed in all cases under a high mag-
nification microscope (DF Vasconcellos S/A, São Paulo,
SP, Brazil).
Reciproc R25 and R40 files (VDW, Munich, Germany)
were used during chemo-mechanical preparation (CMP)
according to the manufacturer’s protocol in a reciprocat-
ing motion generated by an electric motor (VDW Silver,
Munich, Germany). Reciproc files were used in an in-and-
out pecking motion (approximately 3-mm amplitude) with
slight apical pressure. After three pecking motions, the
file was removed from the root canal and cleaned with
sterile gauze. Next, a manual # 20 K-file was placed into
the working length (WL) for checking the patency. This
protocol was repeated until the Reciproc file reached the
WL (zero point displayed on the apex locator). An auxil-
iary chemical substance (ACS) was used during the CMP,
that is, 2% CHX gel (Endogel, Essencial Pharma Ltd.
Itapetininga, SP, Brazil) consisting of a gel base (1%
Natrosol) with CHX gluconate (pH 7). Natrosol gel (hy-
droxymethyl cellulose) is a highly inert, non-ionic and
water-soluble agent. Prior to the insertion of each instru-
ment, the root canal was flooded with 2% CHX gel by
using a 27-G needle attached to a syringe. In order to
remove debris that originated from the mechanical instru-
mentation, 5 mL of saline solution was used immediately
after the use of each endodontic file [15].
A final rinse with 3 mL of 17% EDTA, ultrasonically
activated, was performed as described above. Irrigation
with 5 mL of sterile saline solution was used for EDTA
removal. The root canal was dried with sterile paper
points and filled with a single Reciproc gutta-percha cone
and Endométhasone N sealer (Septodont, Saint-Maur-des-
Fossés, France). Restoration of the access cavities was
performed with a 2-mm layer of temporary cement
(Cimpat, Septodont), followed by a light-cured composite
resin (Filtek Z350; 3M ESPE) combined with Single-bond
Universal adhesive (3M ESPE).
Clin Oral Invest
Laboratorial procedures
Culture technique
Isolation and identification of the microorganisms were per-
formed by using culture techniques for phenotypic character-
ization, as described earlier [10, 18]. Inside the anaerobic
chamber, the transport medium was shaken thoroughly in a
mixer (Vortex; Marconi, São Paulo, Brazil) for 60 s. Serial 10-
fold dilutions were made up to 1:104 in tubes containing
Fastidious Anaerobe Broth (FAB) (LabM, Bury, UK). A vol-
ume of 50 μL of each dilution was plated with sterile plastic
spreaders onto 5% defibrinated sheep blood Fastidious
Anaerobe Agar (FAA) (LabM, Bury, UK) containing 1 mL/
L of hemin and 1 mL/L of vitamin K1. The same dilutions
were also spread onto a selective culture medium (5% sheep
blood FAA+ 0.001% w/v nalidixic acid + 0.5 mg/L of vanco-
mycin) to select Gram-negative anaerobic bacteria, thus im-
proving the possibility of detecting F. nucleatum in the sam-
ples. The plates were incubated at 37°C in an anaerobic atmo-
sphere for up to 14 days and then representative colonies of
each morphologic type were sub-cultured from each bacterial
plate. Pure cultures were initially characterized according to
their Gram-stain characteristic, ability to produce catalase, and
gaseous requirements.
Bacterial cultures that grew small, greyish-white colonies
surrounded by dark gray zones grown on blood after 48 hours
of incubation under anaerobic conditions at 37°C, and that
were classified as strict anaerobic Gram-negative fusiform
rods, presenting 5-10 μm in length, showing slender filaments
with tapered ends, occasionally containing spherical swell-
ings; being catalase-negative, non-motile, non-spore-forming
were then selected for further identification using the Rapid ID
32 A (Bio Mérieux, Marcy-l’Étoile, France). In order to con-
firm their identity, all F. nucleatum strains were subjected to
partial 16S rDNA sequencing and analyzed using the BLAST
software of the National Center for Biotechnology
Information (NCBI) for species determination. All strains
were identified at the species level based on the
F. nucleatum sp. nucleatum ATCC 25586 complete genome
(Accession number AE009951) showing at least a 98% sim-
ilarity level.
Detection of F. nucleatum using nested PCR
Microbial identification was performed by using nested PCR,
as described elsewhere [15, 18].
DNA extraction was performed from samples obtained di-
rectly with Tris-EDTA buffer solution and by using the
QIAamp DNA kit (Qiagen, Valencia, CA, USA) according
to the manufacturer’s instructions.
After extraction, the DNA concentration of the samples
collected from the root canals was measured by using a
Clin Oral Invest

spectrophotometer (Nanodrop 2000; Thermo Scientific, nucleatum are shown in Table 1. The reference bacterial strain
Wilmington, DE, USA) operating at a 260-nm wavelength. of Fusobacterium nucleatum (ATCC 25586) used in this
The first amplification used universal primers for regions cov- study was acquired from the American Type Culture
ering the genes 16S and 23S rRNA (Table 1). Collection (ATCC, Baltimore, MD, USA).
PCR reactions were run in a total amount of 50 μL for each
sample containing 5 μL of buffer for PCR reaction (10x
PCR primer specificity
Reaction Buffer, Invitrogen, São Paulo, SP, Brazil), 2 μL of
a mixture of phosphate deoxyribonucleotides (2 mM)
The species-specific primer in the 16S rDNA coding region
(dNTPs, Invitrogen, São Paulo, SP, Brazil), 4 μL of magne-
was selected based on the previous investigation of endodon-
sium chloride solution (25 mM) (MgCl2, Invitrogen, São
tic bacteria by cloning and sequencing the bacterial 16S gene
Paulo, Brazil), 1 μL of a 20 mM forward and reverse primer
[20]. and on sequences available in GenBank. The species
solutions (20 mM) (Invitrogen, São Paulo, SP, Brazil), 34.8
specificity was further confirmed by sequencing at least one
μL of ultrapure water free of DNAase and RNAase, 0.12 μL
PCR product from a clinical sample for the specific primer in
of Taq polymerase enzyme (Invitrogen, Taq Platinum, São
an ABI Prism 310 automated sequencer (AME Bioscience
Paulo, SP, Brazil), and 2 μL of DNA extracted from the sam-
Ltd, London UK) as described by Rumpf et al. [21].
ple collected from the root canal at a CO-concentration of 40
ng/mL. The reaction consisted of initial denaturation (95 °C
for 2 min), 22 cycles of denaturation (94 °C for 1 min), an- Statistical analysis
nealing (42 °C for 2min), and extension (72 °C for 3 min),
followed by a final extension (72 °C for 10 min). The data collected for each case (clinical features) were typed
The products of the PCR reaction were analyzed by using into a spreadsheet and statistically analyzed by using the SPSS
1% agarose gel electrophoresis (Invitrogen, São Paulo, SP, software for Windows (SPSS, Chicago, IL, USA). Pearson’s
Brazil) stained with ethidium bromide, EDTA (pH 8.0), and chi-squared test or one-sided Fisher’s exact test, when appro-
TBE buffer (5 μg/mL) (Invitrogen, São Paulo, SP, Brazil). A priate, was chosen to test the null hypothesis that there was no
molecular weight standard of 1Kb (DNA ladder, Invitrogen, relationship between specific clinical features and presence of
São Paulo, SP, Brazil) was added to each gel. After each run F. nucleatum in primary and secondary/persistent endodontic
(60 volts for 40 min), the bands were observed with an ultra- infections.
violet light transilluminator. Positive or negative identification
was based on the presence/absence of clear bands of approx-
imately 1500 bp.
Results
After checking the success of the universal reaction (first
reaction), an aliquot of 1 μL of its product was used to perform
Clinical features
the second PCR reaction, but now using a species-specific
primer (F) combined with L189R primer (Table 1). The reac-
The sample population consisted mostly of females and
tions were processed in a total amount of 25 μL for each
single-rooted upper teeth (Table 2), and the patients’ age
sample with 2.5 μL of buffer for PCR reaction (Invitrogen,
ranged from 14 to 72 years old. In the retreatment cases, the
São Paulo, SP, Brazil), 2.5 μL of a mixture of phosphate
average time spent from the initial endodontic treatment to the
deoxyribonucleotides (2mM) (Invitrogen, São Paulo, SP,
Brazil), 1.5 μL of sodium magnesium solution (25 mM)
(Invitrogen, São Paulo, SP, Brazil), 0.62 μL of 100 μM of Table 2 The total number of cases (%) of primary and secondary
forward and reverse primer solutions each (20 mM) infections according to the general clinical features
(Invitrogen, São Paulo, SP, Brazil), 16.14 μL of ultrapure
General clinical features Primary infection Secondary infection
DNAase and RNAase water, 0.12 μL of Taq polymerase en-
zyme (Invitrogen, Taq Platinum, São Paulo, Brazil), and 1 μL Female 29 (58%) 35 (70%)
aliquot of the first reaction. The reaction consisted of initial Male 21 (42%) 15 (30%)
denaturation (95° C for 2 min), 22 cycles of denaturation (94 Age < 30 years old 27 (54%) 12 (24%)
°C for 1 min), annealing (42 °C for 2min) and extension (72 Age ≥ 30 years old 23 (46%) 38 (76%)
°C for 3 min), followed by final extension (72 °C for 10 min), Upper teeth 30 (60%) 27 (54%)
track fading (94 °C for 1 min), annealing (52 °C for 2 min), Lower teeth 20 (40%) 23 (46%)
and extension (72 °C for 3 min). The reading was performed Single rooted 40 (80%) 40 (80%)
following the same pattern as the previous one. Bi-rooted 8 (15%) 10 (20%)
Binding region specificity, synthesis direction, and se- Three-rooted 2 (4%) -
quence of the primers used for detection of Fusobacterium

beginning of the retreatment was 7.82 years (varying from 2 to
30 years).
Microbiological findings
The disinfection protocol was proved to be effective as there
was no microbial growth on the control plates after 14 days
and no DNA band was found in the agarose gels. Microbial
DNA was recovered from all infected root canals (n = 100) by
using nested PCR.
A higher prevalence of F. nucleatum was detected by using
nested PCR (82/100) than by culture (11/100). F. nucleatum
was found in more cases of primary endodontic infections (42/
50; 84%) than in secondary/persistent ones (40/50; 80%).
F. nucleatum was isolated by culture in ten of the 50 (20%)
root canals with primary infections and in one of the 50 (2%)
root canals with secondary/persistent infections.
Significant associations of F. nucleatum with wet root ca-
nals (using PCR) and hemorrhagic exudate (using culture)
were found in primary infections (Table 3).
No significant associations were found between
F. nucleatum and the clinical features investigated in second-
ary infections.
When a total of 100 samples were considered for statistical
analysis, independently of the infection type using culture
technique, significant associations were found between
F. nucleatum and spontaneous pain, tenderness to percussion,
pain on palpation, swelling, tooth mobility, wet root canals,
hemorrhagic exudate, and poor endodontic filling (all P <
0.05).
Similarly, when a total of 100 samples were considered for
statistical analysis, independently of the infection type using
nested PCR, significant associations were found between the
presence of F. nucleatum and wet root canals, decay, and poor
coronal restoration (all P < 0.05).
Discussion
Fusobacterium nucleatum is an important oral pathogen in-
volved in endodontic infections. In this study, 100 samples of
patients with primary and secondary endodontic infections
were analyzed by using both culture and nested PCR so that
the frequency of F. nucleatum in endodontic infections could
be assessed. A higher prevalence of F. nucleatum was detect-
ed by using nested PCR than by using culture. F. nucleatum
was found in more cases of primary endodontic infections
than in secondary/persistent ones. PCR techniques present
high sensitivity, precision, rapid analysis, reproducibility,
quality control, and reduced contamination [22]. Another ad-
vantage is that a vast number of samples can be evaluated
simultaneously, being a valuable method in the investigation
of strictly anaerobic microorganisms, such as F. nucleatum.
Clin Oral Invest
Besides, nested PCR simplifies the identification of bacterial
DNA present at very low levels, while anaerobic culture only
detects viable bacteria, without targeting specific species [22].
Fusobacterium spp., as other critical anaerobes, are diffi-
cult to grow in in vitro conditions. F. nucleatum is a fastidious
anaerobe whose energy comes from the fermentation of sugar
or amino acids [23]. These bacteria also have an optimum
growth pH of around 7.4 [24]. The difficulty in growing
F. nucleatum in in vitro conditions, besides the fact that nested
PCR can detect bacteria in the presence of a limited number of
cells (10 cells) [25], might explain why this bacteria was re-
currently recovered from samples by using PCR rather than by
culture. The sensitivity of the culture is approximately 104 to
105 cells with non-selective media and 103 with selective one
[26].
Viable F. nucleatum was recovered from 10/50 root canals
with primary infection and from 1/50 root canals with second-
ary infection, which is in accordance with the literature [10].
In the present study, samples were collected with paper points,
which were moistened in cases of dry canals to enhance the
recovery of bacteria and bacterial DNA. This is a standard
protocol that has been successfully applied in several reports
[6, 10, 15, 16, 18]. Despite the limitations, as only materials
from the main canal are collected, this technique enables sam-
pling teeth present in the oral cavity. Cryopulverization is the
only method that ensures that the entire root is processed,
including areas other than the main root canal such as dentinal
tubules, recesses, isthmi, lateral canals, and apical ramifica-
tions [27]. However, this technique can only be used for tooth
specimens obtained by extraction or periradicular surgery.
With regard to the culture technique, our results showed
that the prevalence of F. nucleatum in primary infections was
20% (10/50), which is in accordance with the findings by
Gomes et al. [10], who found this species in 17% of the root
canals (7/41); Sousa et al. [28], 20% (12/60) of the root canals
with periapical abscesses; and Moraes et al. [29], 15.4% (2/13)
of the root canals. However, our findings disagree with those
reported by Jacinto et al. [30], who found F. nucleatum in
34.55% (38/110) of the samples.
The prevalence of F. nucleatum was 2% (1/50) in root
canals with secondary endodontic infections, whereas other
studies in the literature have reported prevalence of 0% [10]
and 1.7% (1/60) [16] in root canals by using culture tech-
niques. However, a much higher number of positive results
for F. nucleatum was detected by nested PCR. Thus, the PCR
results could bring important perceptions regarding the role of
F. nucleatum in secondary infections. Many species of bacte-
ria may enter in a viable-but-non-culturable (VBNC) state
when exposed to stressful conditions such as starvation [31],
thus being able to persist after endodontic therapy. The pres-
ence of VBNC bacteria in retreatment cases may lead to an
underestimation of the role of these species in the failure of the
endodontic treatment. Pathogenic bacteria can be nonvirulent
Clin Oral Invest

Table 3 Clinical features and the

presence of Fusobacterium Primary infection (n=50) Secondary infection (n=50)
nucleatum isolated by culture
technique or detected by nested Clinical feature Total Culture Nested Total Culture Nested
PCR in primary and secondary cases technique PCR cases technique PCR
endodontic infections (n=10) (n=42) (n=1) (n=40)

Symptomatic cases 50 10 42 22 1 17
Asymptomatic cases 0 0 0 28 0 23
Periapical radiolucency 33 9 26 50 1 40
No periapical 17 1 16 0 0 0
radiolucency
Spontaneous Pain 43 10 36 2 0 2
Previous pain 22 5 18 16 1 11
Tenderness to percussion 50 10 42 22 1 16
Pain on palpation 39 9 34 2 0 2
Mobility 11 4 11 1 0 1
Dry canals 20 2 14 48 1 38
Wet canals 30 8 28 * 2 0 2
Clear exudate 5 2 4 0 0 0
Hemorrhagic exudate 5 3* 5 0 0 0
Purulent exudate 20 4 19 2 0 2
Swelling 32 9 27 0 0 0
Sinus tract 7 0 6 5 0 4
Acute apical periodontitis 26 9 20 2 0 2
Acute apical abscess 17 1 16 0 0 0
Chronic apical abscess 7 0 6 5 0 4
phoenix abscess 0 0 0 2 0 2
Abscess (acute, chronic, 50 10 42 7 0 6
phoenix abscess)
Poor endodontic filling - - - 29 0 24
Good endodontic filling - - - 21 1 16
Good coronal restoration 1 1 1 12 0 10
Poor coronal restoration 21 4 20 38 1 30
Decay 28 5 21 0 0 0

*p<0.05
The “total cases” means the total number of cases collected that presented the clinical feature. The numbers
presented in the “culture technique” and “Nested PCR” mean the total samples that presented Fusobacterium
nucleatum

in the VBNC-state, but regain virulence after being reactivated
under favorable conditions, such as the saliva coronal
microleakage into the previously root-filled canals.
With regard to the nested PCR, we detected F. nucleatum
in 84% (42/50) of the root canals with primary endodontic
infection, which disagrees with the findings by Moraes et al.
[29], who detected the species in 15.4% (2/13) of the samples.
In secondary infections, we detected F. nucleatum in 80% of
the root canals, which agrees with the findings by Barbosa-
Ribeiro et al. [18], who found the species in 75% (15/20) of
the samples from failed endodontically treated teeth.
However, our findings disagree with those reported by
Siqueira and Rôças [32], who detected the species in 10%
(2/21) of the root canals. Considering that cross-reactions of
the primers used for detection of F. nucleatum with other
bacteria could influence the results of the nested PCR, the
specificity of the primers was confirmed by sequencing of
PCR products. Besides, in the present investigation, several
negative controls were used in every PCR test, both in the first
and second rounds of amplification to monitor the occurrence
of false-positive results, which showed negative results.
Fusobacterium is also a strategic pathogen, as its presence
supports further colonization by other pathogens [3, 33], such
as P. gingivalis [34], C. albicans [35], T. forsythia [36], and
others. Without its presence, many species would not survive
as F. nucleatum acts as a bridge organism [3]. This

characteristic is part of the pathogenesis caused by
F. nucleatum and its adhesion to other microorganisms en-
hances their microbial activity [35]. Besides, F. nucleatum is
often detected in extra-oral infections in conjunction with oth-
er oral species, suggesting an oral source of these infections.
In fact, F. nucleatum possesses essential virulence mecha-
nisms for colonization, evasion of host defense, and spread
into deeper tissues [37]. Although many studies have related
F. nucleatum to extra-oral infections such as cardiovascular
diseases; adverse pregnancy outcomes; rheumatoid arthritis;
respiratory tract infections; brain abscesses; lung, liver, or
splenic abscesses; and appendicitis, studies are still needed
to elucidate the role of these bacteria in the systemic health
[38].
Primary endodontic infection is characterized by a higher
number of bacterial species compared to secondary infections
[11], which may favor the predominance of Fusobacterium.
On the other hand, secondary infections are known to have a
restricted number of microorganisms that can survive in a
harsh environment and have a minimum bacterial growth
due to poor nutrients [11]. This may explain why
F. nucleatum was more prevalent in primary endodontic in-
fection than in secondary endodontic infection [11, 16].
The association of F. nucleatum with spontaneous
pain, tenderness to percussion, pain on palpation, swell-
ing, tooth mobility, wet root canals, and hemorrhagic ex-
udate suggests an inflammatory response in the periapical
tissues induced by the bacterial infection inside the root
canals. F. nucleatum can activate inflammation by stimu-
lating the production of pro-inflammatory cytokines [39,
40]. Various proteins are related to F. nucleatum viru-
lence, such as the immunosuppressives FipA [41] and
Fap2 [42]; FomA [43], RadD [44], Aid1 [45], and
CmpA [46], all responsible for interbacterial co-
aggregation; and FadA, responsible for cell attachment
and intracellular invasion [47]. However, adhesins are
not the only virulence factors of F. nucleatum.
Lipopolysaccharides are also known to induce the produc-
tion of IL-1 and bone resorption [11], and they are the
current focus of research in the identification of methods
for controlling Gram-negative bacteria in endodontic in-
fections. F. nucleatum LPS was found to be relatively
more stimulatory of IL-1β and TNF-α secretion com-
pared to P. gingivalis LPS. Differences may be explained
by the variation in the composition of the LPS molecular
structure among the bacterial species, which can possibly
facilitate the recognition of the LPS receptor-dependent
mechanism. This variation includes differences in the
number of phosphate groups as well as in the amount
and position of lipid A fatty acids [48].
F nucleatum has also been associated with tooth decay,
inadequate restoration, and poor endodontic filling, with
the latter being observed in endodontically treated teeth.
Clin Oral Invest
All these clinical features are one of the main reasons for
root canal infection or unsuccessful endodontic treatment,
allowing the invasion of microorganisms into the root
canal system [16].
In the present study, after the investigation of the presence
of F. nucleatum in the initial samples, the chemo-mechanical
preparation was performed using 2% CHX gel as the auxiliary
chemical substance. CHX was chosen due to its wide range of
antimicrobial activity, substantivity (residual antimicrobial ac-
tivity), lower cytotoxicity than NaOCl while demonstrating
efficient clinical performance, lubricating properties, rheolog-
ical action (present in the gel presentation, keeping the debris
in suspension), among other properties. CHX has been recom-
mended as an alternative to NaOCl, especially in cases of open
apex, root resorption, foramen enlargement, and root perfora-
tion, due to its biocompatibility, or in cases of allergy related
to bleaching solutions [49]. However, it does not have the
ability to dissolve tissues, as does sodium hypochlorite, which
remains the most widely used endodontic irrigant, mainly for
such ability and for its potent antimicrobial activity [50]. A
systematic revision [51] has shown that the chemo-
mechanical preparation with both NaOCl and CHX reduced
the endotoxin levels compared to the initial ones found in
primary endodontic infections. Several clinical trials have
been reported using chlorhexidine for root canal preparation
[18, 19]. Further randomized clinical trials are needed to in-
vestigate the influence of 2% CHX gel on the success of
endodontic treatment compared to NaOCl, especially in infec-
tions with predominance of Gram-negative bacteria such as
F. nucleatum.
The association of culture with PCR methods allowed
the detection of a wider range of F. nucleatum bacteria
in primary and secondary endodontic infections, as well
as their relationship with several clinical features, which
reinforces the role played by this important pathogen in
such infections.
Conclusion
F. nucleatum was found in more cases of primary endodontic
infections than in cases of secondary/persistent ones. A higher
prevalence of F. nucleatum was detected by using nested PCR
than by culture. The presence of F. nucleatum in the root
canals was associated with several clinical features.
Funding This work was supported by the Brazilian agencies São Paulo
Research Foundation (FAPESP, grant number 2015/23479-5), National
Scientific and Technological Development Council (CNPq, grant num-
bers 308162/2014-5 and 303852/2019-4), and Coordination for
Improvement of Higher Education Personnel (CAPES - Finance Code
001, process numbers 88887.369163/2019-00 and 88887.342794/2019-
00).
Clin Oral Invest
Declarations
Ethical approval All the procedures performed in the present study were
in accordance with ethical standards established by the local human re-
search ethics committee and with the 1964 Helsinki declaration and its
later amendments or comparable ethical standards.
Informed consent Informed consent was obtained from all the partici-
pants included in the study.
Conflict of interest The authors declare no competing interests.
References
1. Bolstad AI, Jensen HB, Bakken V (1996) Taxonomy, biology, and
periodontal aspects of Fusobacterium nucleatum. Clin Microbiol
Rev 9:55–71. https://doi.org/10.1128/CMR.9.1.55-71.1996
2. Garcia-Carretero R, Lopez-Lomba M, Carrasco-Fernandez B,
Duran-Valle MT (2017) Clinical features and outcomes of
Fusobacterium species infections in a ten-year follow-up. J Crit
Care Med 3:141–147. https://doi.org/10.1515/jccm-2017-0029
3. Kolenbrander PE, Palmer RJ Jr, Periasamy S, Jakubovics NS
(2010) Oral multispecies biofilm development and the key role of
cell-cell distance. Nat Rev Microbiol 8:471–480. https://doi.org/10.
1038/nrmicro2381
4. Moore WE, Moore LV (1994) The bacteria of periodontal diseases.
Periodontol 2000 5:66–77. https://doi.org/10.1111/j.1600-0757.
1994.tb00019.x
5. Tek M, Metin M, Sener I, Bereket C, Tokac M, Kazancioglu HO,
Ezirganli S (2013) The predominant bacteria isolated from radicular
cysts. Head Face Med 9:25. https://doi.org/10.1186/1746-160X-9-
25
6. Sundqvist G (1992) Ecology of the root canal flora. J Endod 18:
427–430. https://doi.org/10.1016/s0099-2399(06)80842-3
7. Zakaria MN, Takeshita T, Shibata Y, Maeda H, Wada N, Akamine
A, Yamashita Y (2014) Microbial community in persistent apical
periodontitis: a 16S rRNA gene clone library analysis. Int Endod J
48:717–728. https://doi.org/10.1111/iej.12361
8. Brook I (2003) Microbiology and management of endodontic in-
fections in children. J Clin Pediatr Dent 28:13–17. https://doi.org/
10.17796/jcpd.28.1.uwjxq61753506255
9. Villanueva LECP (2002) Fusobacterium nucleatum in endodontic
flare-ups. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 93:
179–183. https://doi.org/10.1067/moe.2002.120803
10. Gomes BP, Pinheiro ET, Gade-Neto CR, Sousa EL, Ferraz CC,
Zaia AA, Teixeira FB, Souza-Filho FJ (2004) Microbiological ex-
amination of infected dental root canals. Oral Microbiol Immunol
19:71–76. https://doi.org/10.1046/j.0902-0055.2003.00116.x
11. Gomes BPFA, Herrera DR (2018) Etiologic role of root canal in-
fection in apical periodontitis and its relationship with clinical
symptomatology. Braz Oral Res 32:82–110. https://doi.org/10.
1590/1807-3107bor-2018.vol32.0069
12. Siqueira JF Jr, Rocas IN (2005) Exploiting molecular methods to
explore endodontic infections: Part 1–current molecular technolo-
gies for microbiological diagnosis. J Endod 31:411–423. https://
doi.org/10.1097/01.don.0000157989.44949.26
13. Josephson KL, Gerba CP, Pepper IL (1993) Polymerase chain re-
action detection of nonviable bacterial pathogens. Appl Environ
Microbiol 59:3513–3515. https://doi.org/10.1128/AEM.59.10.
3513-3515.1993
14. Tang YW, Procop GW, Persing DH (1997) Molecular diagnostics
of infectious diseases. Clin Chem 43:2021–2038
15. Gomes BPFA, Louzada LM, Almeida-Gomes RF, Pinheiro ET,
Sousa ELR, Jacinto RC, Arruda-Vasconcelos R (2020)
Investigation of Filifactor alocis in primary and in secondary end-
odontic infections: A molecular study. Arch Oral Biol 118:104826.
https://doi.org/10.1016/j.archoralbio.2020.104826
16. Pinheiro ET, Gomes BP, Ferraz CC, Sousa EL, Teixeira FB, Souza-
Filho FJ (2003) Microorganisms from canals of root-filled teeth
with periapical lesions. Int Endod J 36:1–11. https://doi.org/10.
1046/j.1365-2591.2003.00603.x
17. Ray HA, Trope M (1995) Periapical status of endodontically treated
teeth in relation to the technical quality of the root filling and the
coronal restoration. Int Endod J 28:12–18. https://doi.org/10.1111/j.
1365-2591.1995.tb00150.x
18. Barbosa-Ribeiro M, Arruda-Vasconcelos R, Louzada LM, Dos
Santos DG, Andreote FD Gomes BPFA (2021) Microbiological
analysis of endodontically treated teeth with apical periodontitis
before and after endodontic retreatment. Clin Oral Investig 25:
2017–2027. https://doi.org/10.1007/s00784-020-03510-2
19. Gomes BP, Berber VB, Kokaras AS, Chen T, Paster BJ (2015)
Microbiomes of endodontic-periodontal lesions before and after
chemomechanical preparation. J Endod 41:1975–1984. https://doi.
org/10.1016/j.joen.2015.08.022
20. Gomes BPFA, Griffen AL, Kumar PS, Leys EJ. (2004) Molecular
and culture analysis of bacteria in infected root canals. J Dent Res
83 1040 SL
21. Rumpf RW, Griffen AL, Wen BG, Leys EJ (1999) Sequencing of
the ribosomal intergenic spacer region for strain indentification of
Porphyromonas gingivalis. J Clin Microbiol 37:2723–2725. https://
doi.org/10.1128/JCM.37.8.2723-2725.1999
22. Schochetman G, Ou CY, Jones WK (1988) Polymerase chain re-
action. J Infect Dis 158:1154–1157. https://doi.org/10.1093/infdis/
158.6.1154
23. Robrish SA, Thompson J (1990) Regulation of fructose metabolism
and polymer synthesis by Fusobacterium nucleatum ATCC 10953.
J Bacteriol 172:5714–5723. https://doi.org/10.1128/jb.172.10.
5714-5723.1990
24. Rogers AH, Zilm PS, Gully NJ, Pfennig AL, Marsh PD (1991)
Aspects of the growth and metabolism of Fusobacterium nucleatum
ATCC 10953 in continuous culture. Oral Microbiol Immunol 6:
250–255. https://doi.org/10.1111/j.1399-302x.1991.tb00486.x
25. Spratt DA (2004) Significance of bacterial identification by molec-
ular biology methods. Endod Top 9:5–14. https://doi.org/10.1111/j.
1601-1546.2004.00106.x
26. Zambon JJ, Haraszthy VI (1995) The laboratory diagnosis of peri-
odontal infections. Periodontol 2000 7:69–82. https://doi.org/10.
1111/j.1600-0757.1995.tb00037.x
27. Alves FR, Siqueira JF, Carmo FL, Santos AL, Peixoto RS, Rôças
IN, Rosado AS (2009) Bacterial community profiling of cryogeni-
cally ground samples from the apical and coronal root segments of
teeth with apical periodontitis. J Endod 35:486–492. https://doi.org/
10.1016/j.joen.2008.12.022
28. Sousa EL, Gomes BP, Jacinto RC, Zaia AA, Ferraz CC (2013)
Microbiological profile and antimicrobial susceptibility pattern of
infected root canals associated with periapical abscesses. Eur J Clin
Microbiol Infect Dis 32:573–580. https://doi.org/10.1007/s10096-
012-1777-5
29. Moraes SR, Siqueira JFJ, Colombo AP, Rôças IN, Ferreira MCS,
Domingues RMCP (2002) Comparison of the effectiveness of bac-
terial culture, 16S rDNA directed polymerase chain ceaction, and
checkerboard DNA-DNA hybridization for detection of
Fusobacterium nucleatum in endodontic infections. J Endod 28:
86–89. https://doi.org/10.1097/00004770-200202000-00009
30. Jacinto RC, Montagner F, Signoretti FG, Almeida GC, Gomes BP
(2008) Frequency, microbial interactions, and antimicrobial suscep-
tibility of Fusobacterium nucleatum and Fusobacterium

necrophorum isolated from primary endodontic infections. J Endod
34:1451–1456. https://doi.org/10.1016/j.joen.2008.08.036
31. Li L, Mendis N, Trigui H, Oliver JD, Faucher SP (2014) The im-
portance of the viable but non-culturable state in human bacterial
pathogens. Front Microbiol 2(5):258. https://doi.org/10.3389/
fmicb.2014.00258
32. Siqueira JF Jr, Rôças IN (2004) Polymerase chain reaction-based
analysis of microorganisms associated with failed endodontic treat-
ment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 97:85–
94. https://doi.org/10.1016/s1079-2104(03)00353-6
33. Faran Ali SM, Tanwir F (2012) Oral microbial habitat a dynamic
entity. J Oral Biol Craniofac Res 2:181–187. https://doi.org/10.
1016/j.jobcr.2012.07.001
34. Rosen G, Sela MN (2006) Coaggregation of Porphyromonas
gingivalis and Fusobacterium nucleatum PK 1594 is mediated by
capsular polysaccharide and lipopolysaccharide. FEMS Microbiol
Lett 256:304–310. https://doi.org/10.1111/j.1574-6968.2006.
00131.x
35. Wu T, Cen L, Kaplan C, Zhou X, Lux R, Shi W, He X (2015)
Cellular components mediating coadherence of Candida albicans
and Fusobacterium nucleatum. J Dent Res 94:1432–1438. https://
doi.org/10.1177/0022034515593706
36. Sharma A, Inagaki S, Sigurdson W, Kuramitsu HK (2005) Synergy
between Tannerella forsythia and Fusobacterium nucleatum in bio-
film formation. Oral Microbiol Immunol 20:39–42. https://doi.org/
10.1111/j.1399-302X.2004.00175.x
37. Han YW (2015) Fusobacterium nucleatum: a commensal-turned
pathogen. Curr Opin Microbiol 23C:141–147. https://doi.org/10.
1016/j.mib.2014.11.013
38. Han YW, Wang X (2013) Mobile microbiome: oral bacteria in
extra-oral infections and inflammation. J Dent Res 92:485–491.
https://doi.org/10.1177/0022034513487559
39. Polak D, Wilensky A, Shapira L, Halabi A, Goldstein D, Weiss EI,
Houri-Haddad Y (2009) Mouse model of experimental periodonti-
tis induced by Porphyromonas gingivalis/Fusobacterium nucleatum
infection: bone loss and host response. J Clin Periodontol 36:406–
410. https://doi.org/10.1111/j.1600-051X.2009.01393.x
40. Polak D, Wilensky A, Shapira L, Weiss EI, Houri-Haddad Y (2010)
Vaccination of mice with Porphyromonas gingivalis or
Fusobacterium nucleatum modulates the inflammatory response,
but fails to prevent experimental periodontitis. J Clin Periodontol
37:812–817. https://doi.org/10.1111/j.1600-051X.2010.01598.x
41. Demuth DR, Savary R, Golub E, Shenker BJ (1996) Identification
and analysis of fipA, a Fusobacterium nucleatum immunosuppres-
sive factor gene. Infect Immun 64:1335–1341. https://doi.org/10.
1128/IAI.64.4.1335-1341.1996
42. Kaplan CW, Ma X, Paranjpe A, Jewett A, Lux R, Kinder-Haake S,
Shi W (2010) Fusobacterium nucleatum outer membrane proteins
Clin Oral Invest
Fap2 and RadD induce cell death in human lymphocytes. Infect
Immun 78:4773–4778. https://doi.org/10.1128/IAI.00567-10
43. Bolstad AI, Høgh BT, Jensen HB (1995) Molecular characteriza-
tion of a 40-kDa outer membrane protein, FomA, of Fusobacterium
periodonticum and comparison with Fusobacterium nucleatum.
Oral Microbiol Immunol 10:257–264. https://doi.org. https://doi.
org/10.1111/j.1399-302x.1995.tb00151.x
44. Kaplan CW, Lux R, Haake SK, Shi W (2009) The Fusobacterium
nucleatum outer membrane protein RadD is an arginine-inhibitable
adhesin required for inter-species adherence and the structured ar-
chitecture of multispecies biofilm. Mol Microbiol 71:35–47. https://
doi.org/10.1111/j.1365-2958.2008.06503.x
45. Kaplan A, Kaplan CW, He X, McHardy I, Shi W, Lux R (2014)
Characterization of aid1, a novel gene involved in Fusobacterium
nucleatum interspecies interactions. Microb Ecol 68:379–387.
https://doi.org/10.1007/s00248-014-0400-y
46. Lima BP, Shi W, Lux R (2017) Identification and characterization
of a novel Fusobacterium nucleatum adhesin involved in physical
interaction and biofilm formation with Streptococcus gordonii.
Microbiologyopen 6:e444. https://doi.org/10.1002/mbo3.444
47. Han YW, Ikegami A, Rajanna C, Kawsar HI, Zhou Y, Li M, Sojar
HT, Genco RJ, Kuramitsu HK, Deng CX (2005) Identification and
characterization of a novel adhesin unique to oral fusobacteria. J
Bacteriol 187:5330–5340. https://doi.org/10.1128/JB.187.15.5330-
5340.2005
48. Martinho FC, Leite FRM, Nóbrega LMM, Endo MS, Nascimento
GG, Darveau RP, Gomes BPFA (2016) Comparison of
Fusobacterium nucleatum and Porphyromonas gingivalis lipopoly-
saccharides clinically isolated from root canal infection in the in-
duction of pro-inflammatory cytokines secretion. Braz Dent J 27:
202–207. https://doi.org/10.1590/0103-6440201600572
49. Gomes BP, Vianna ME, Zaia AA, Almeida JF, Souza-Filho FJ,
Ferraz CC (2013) Chlorhexidine in endodontics. Braz Dent J 24:
89–102. https://doi.org/10.1590/0103-6440201302188
50. Srinivasan S, Kumarappan SK, Ramachandran A, Honap MN,
Kadandale S, Rayar (2020) Comparative evaluation of pulp tissue
dissolution ability of sodium hypochlorite by various activation
techniques: An in vitro study. J Conserv Dent 23:304–308.
https://doi.org/10.4103/JCD.JCD_425_20
51. Neelakantan P, Herrera DR, Pecorari VGA, Gomes BPFA (2019)
Endotoxin levels after chemomechanical preparation of root canals
with sodium hypochlorite or chlorhexidine: a systematic review of
clinical trials and meta-analysis. Int Endod J 52:19–27. https://doi.
org/10.1111/iej.12963
Publisher’s note Springer Nature remains neutral with regard to jurisdic-
tional claims in published maps and institutional affiliations.