Gene 306 (2003) 13–25

www.elsevier.com/locate/gene

The Plasmodium falciparum family of Rab GTPases

Emmanuel Quevillona, Tobias Spielmannb, Karima Brahimic, Debasish Chattopadhyayd,
Edouard Yeramiane, Gordon Langsleya,*
a
Laboratoire de Signalisation Immunoparasitaire, URA CNRS 1960, Department of Parasitology, Institut Pasteur, 28 rue du Dr. Roux, Paris Cedex 15, France
b
Molecular Parasitology, Swiss Tropical Institute, Socinstrasse 57, CH-4002 Basel, Switzerland
c
Unité de Biochimie et de Biologie Moléculaire des Insectes, Institut Pasteur, 28 rue du Dr. Roux, Paris Cedex 15, France
d
Division of Geographic Medicine, University of Alabama at Birmingham, CBSE-250, 1025 18th Street South, Birmingham, AL 35294, USA
e
Genopôle, Centre de Bioinformatique, FRE CNRS 2364, Institute Pasteur, 28 rue du Dr. Roux, Paris Cedex 15, France
Received 12 August 2002; received in revised form 5 November 2002; accepted 31 December 2002
Received by B. Dujon

Abstract
Rab GTPases are key regulators of vesicular traffic in eukaryotic cells. Here we sought a global characterization and description of the
Plasmodium falciparum family of Rab GTPases. We used a combination of bioinformatic analyses, experimental testing of predictions,
structure modelling and phylogenetics. These analyses led to the identification of seven new parasite Rabs. Accordingly we estimate that the
P. falciparum family is made up of 11 genes. We show that ten members of this family are transcribed in infected erythrocytes. Concerning
the various members of the family, a series of specific as well as global conclusions can be drawn. Rabs predicted to be compartment-specific
show different subcellular distributions. This is demonstrated for PfRab1A and PfRab11A, with the generation of specific antisera. The
sequence analyses reveal several peculiarities, with possible functional implications. One of the transcribed genes, Pfrab5b, does not encode
a classical C-terminus, suggestive of a novel regulatory role for this GTPase. Another, Pfrab5a, previously identified as a rab gene located on
chromosome 2, possesses a 30-amino-acid insertion in its GTP-binding domain. Structural considerations suggest that this insertion could
represent a novel interaction interface. We used conserved RabF and RabSF motifs to discriminate between specific parasite Rabs, and
followed their predicted change in position on the structure of PfRab6, as GTP is hydrolysed to GDP. This allowed us to propose their
involvement in potential interaction surfaces, that we extended to human Rab6 and the motifs known to mediate Rabkinesine-6 binding.
Finally, we compared the P. falciparum Rab family to those of Saccharomyces cerevisiae and Schizosaccharomyces pombe and found that
parasite Rabs segregate into possible functional clads. Such grouping into clads may give clues to parasite Rab function, and may shed light
on P. falciparum secretory/endocytic pathways.
q 2003 Elsevier Science B.V. All rights reserved.
Keywords: Traffic; Parasite; Gene family; Three-dimensional structure; Phylogeny

1. Introduction parasitophorous vacuole. Consequently, the parasite is

Infection of human erythrocytes by Plasmodium falci-
parum not only poses a significant public health problem,
but it also represents an interesting problem for cell
biologists. This is due to the fact that within the red blood
cell the parasite resides within a vacuole, called the
Abbreviations: GTP, guanosyl triphosphate; GDP, guanosyl
diphosphate; PVM, the parasitophorous vacuole membrane; ORF, open
reading frame; PCR, polymerase chain reaction; RACE, rapid amplification
of cDNA ends; RT, reverse transcription.
* Corresponding author. Tel.: þ 33-1-4568-8922; fax: þ33-1-4568-8639.
E-mail address: langsley@pasteur.fr (G. Langsley).
0378-1119/03/$ - see front matter q 2003 Elsevier Science B.V. All rights reserved.
doi:10.1016/S0378-1119(03)00381-0
separated from the milieu externe by three membrane
barriers, its own plasma membrane, the parasitophorous
vacuole membrane (PVM) and the erythrocyte plasma
membrane. In spite of this, the parasite is able to secrete and
take up substances across these barriers, and understanding
how this is achieved has driven research into P. falciparum
encoded Rab GTPases, reviewed in Ward et al. (1997). Rabs
belong to the Ras-super family of small GTPases and they
are involved in the regulation of vesicular transport of
eukaryotic cells (Zerial and McBride, 2001). Rabs from
different species display a significant degree of sequence
conservation due mainly to homology conferred by their
14 E. Quevillon et al. / Gene 306 (2003) 13–25
GTP-binding domains (Pereira-Leal and Seabra, 2000).
Synthetic oligonucleotide primers based on sequence
encoding the GTP-binding domains were used to amplify
a number of partial P. falciparum rab genes (de Castro et al.,
1996). Moreover, the complete sequence of cDNAs for both
P. falciparum rab6 and rab11 has been reported (de Castro
et al., 1996; Langsley and Chakrabarti, 1996), and the
crystal structure of PfRab6 in the GDP-bound conformation
has been determined (Chattopadhyay et al., 2000).
Rab association with membrane is due to prenylation of
the C-terminus and the parasite enzyme responsible for this
modification has been described (Chakrabarti et al., 1998).
Rabs recycle from the acceptor to the donor membrane in
their GDP-bound conformation associated with a carrier
called rabGDI and the corresponding P. falciparum gene has
been isolated (Attal and Langsley, 1996). Therefore, it
would appear that the human malaria parasite encodes some
of the necessary effectors for a functional Rab system,
although effector proteins for a specific parasite Rab have
yet to be described. This is even true for PfRab6, PfRab11
and PfRab5 effectors even though these parasite genes have
been identified; a gene displaying significant similarity to
Pfrab5 is located on chromosome 2 (Gardner et al., 1998).
In higher eukaryotic cells Rab5 is located on early
endosomes and controls the immediate steps of endocytosis
and homeotypic fusion of these organelles (Chavrier et al.,
1990), whilst the role of Rab11 in regulating recycling
endosomes is less well understood. Nonetheless, Rab11 is
clearly involved in the late recycling of transferrin receptor
back to the plasma membrane and it is also involved in
transport events between recycling endosomes and the
trans-Golgi-network (Ullrich et al., 1996). Lastly, the
human Rab6A0 isoform similar to PfRab6 regulates
intracellular transport from endosomes to the Golgi
complex (Mallard et al., 2002).
The sequence of P. falciparum genome has only just
been recently published (Hall et al., 2002; Gardner et al.,
2002; Hyman et al., 2002) and represents a valuable
resource in the computer-assisted search for conserved
genes such as Pfrabs and their effectors. As part of our
ongoing studies of P. falciparum Rab GTPases, we decided
to estimate the size of the Pfrab gene family, as this would
throw light on the parasite’s potential to regulate vesicular
transport. Our experimental analysis indicates that the P.
falciparum rab family is composed of 11 genes and we
demonstrate that ten are transcribed in infected erythro-
cytes. We noticed that specific RabF motifs (Pereira-Leal
and Seabra, 2000, 2001), are conserved in all P. falciparum
Rabs and that they appear to define two distinct parasite
PfRab subsets. Given that Saccharomyces cerevisiae and
Schizosaccharomyces pombe encode a similar number of
rab/ypt genes (11 and seven, respectively) we directly
compared the three families in an attempt to identify
parasite orthologues, as this would give some idea of their
potential function. Strikingly, both S. cerevisiae and P.
falciparum lack Rab4, a GTPase specific for early endo-
somes in higher eukaryotes (McCaffrey et al., 2001), whilst
only P. falciparum encodes Rab2, a mediator of the
formation of pre-Golgi intermediates (Tisdale and Balch,
1996).
2. Materials and methods
2.1. Data base mining
Homology searches for sequences similar to previously
cloned P. falciparum genes (de Castro et al., 1996; Langsley
and Chakrabarti, 1996) was performed by Psi-BLAST either
at http://www.ncbi.nlm.nih.gov/Malaria/plasmodiumblcus.
html, or at http://plasmodb.org/restricted/plasmoDBblast.
shtml. All 11 putative PfRabs were individually Psi-
BLASTed against the P. falciparum databases and in each
case only 11 Rabs were identified. The corresponding
genomic sequences were downloaded, potential splice
acceptor and donor sites identified, and all possible ORFs
translated. The putative amino acid sequences were scanned
for the presence of conserved Rab motifs (Pereira-Leal and
Seabra, 2000). In such a way the complete putative exon/
intron structure for seven additional rab genes was
compiled.
2.2. 3 0 -RACE, Northern probes and DNA sequence analysis
RNA was extracted as for Transcriptional analysis (see
below) and cDNA was primed with an oligodT oligomer:
ATTCTAGAGGCCGAGGCGGCCT(20). The intron/exon
structure for rab1b, rab2, rab5b, rab5c, rab7 and rab18 was
confirmed by DNA sequence determination of the corre-
sponding cDNAs. Based on the available genomic sequence
oligonucleotide primers were synthesized and used to
amplify cDNA encompassing the putative 50 -ATG and 30 -
stop codon. The sequence of the amplified cDNA was
directly determined on both strands and deposited in the
database.
For rab1b (accession number AJ409198) the following
oligomers were used:
rab1b 50 -GTTCAAATCACAATGAATGATAGC
rab1b 30 -GTAACCACGTTGATCTAGCTC
For rab2 (accession number AJ308736):
rab2 50 -AAAAAAACCCCCCCTTTTAAG
rab2 30 -GAAAATACTGTAAAAAAGCATG
For rab5a (accession number AAC71889) insert confor-
mation oligos were:
rab5a fw GAATACTAACACAACAATAGGTGC
rab5a rv TTGATTAACCCATGTCTTAGCTCG
 E. Quevillon et al. / Gene 306 (2003) 13–25 15

Table 1
Accession numbers for the proteins used to compile the consensus tree

Organism Protein Accession no. Organism Protein Accession no.

Saccharomyces cerevisiae YPT31 X72833 Plasmodium falciparum Rab1A AF201953

YPT1 X00209 Rab1B AJ409198
YPT32 X72834 Rab2 AJ308736
YPT52 Z28239 Rab5A AAC71889
YPT6 U17244 Rab5B AJ422110
YPT7 X68144 Rab5C AJ420321
YPT53 X76175 Rab6 X92977
YPT10 Z36133 Rab7 AJ290938
YPT21/51 X76173 Rab11A X93161
Sec4 M16507 Rab11B ND
YPT11 Z71580 Rab18 AJ438271

Schizosaccharomyces pombe YPT5 S34729/CAB11737 Homo sapiens RHO6 AF498967

YPT7 OS94655/CAB38603
YPT4 CAB11239
RYH1 S12789/P17608
YPT1 S04590
YPT2 S12790
YPT3 S10026/CAA92383

For rab5b (accession number AJ422110): 2.3. Transcriptional analysis

Northern blots were performed as described (Spielmann

rab5b 50 -TCCCCGCAACATATATATATTTCC
and Beck, 2000). Briefly, total RNA of synchronized
rab5b 30 -TTATAGAATTTTAATCACAAAACGAC
parasites was prepared using TRIzol reagent (Gibco BRL)
and separated by electrophoresis in a 1.5% agarose gel. The
For rab5c (accession number AJ420321):
RNA was transferred to a Hybond XL membrane (Amer-
sham Pharmacia Biotech) in 10£ SSC containing 10 mM
rab5c 50 -TTTCATCCTTTTACATATATTCC NaOH using a vacuum blotter (Appligene). [32P]dCTP-
rab5c 30 -AAATGATAACAATCGTTGTAAAC labelled probes were generated with High Prime solution
(Roche Molecular Biochemicals) and hybridized to the
For rab7 (accession number AJ290938): membrane in UltraHyb (Ambion) at 42 8C. Filters were
washed at high stringency and exposed to Kodak MS films
for 6– 12 h at 2 80 8C with a Transcreen HE enhancer
rab7 50 -TTTAGGTATCATTGTAAAATC
(Kodak). To probe the Northerns radiolabelled full length
rab7 30 -GTGTACAAATATATGCACCC
Pfrab2 and Pfrab7 cDNAs were used.
For rab11b:
2.4. Indirect fluorescent antibody analysis

rab11b 50 -AACGCTTATCCCATATGAGAAGG A PfRab1A-specific peptide (acetyl-RFRTIKVDDKC)

rab11 30 -ACAACAAATAAAGGAGGTGACATC and a PfRab11A-specific peptide (acetyl-DNDKNETKKC)
were synthesized and coupled to keyhole limpet haemo-
For rab18 (accession number AJ438271): cyanin and used to immunize rabbits, as described for the
anti-PfRab6 anti-peptide sera (de Castro et al., 1996). The
rabbit anti-PfRab1A, anti-PfRab11A, anti-PfRab6 and
rab18 50 -TTTGTTTTTTTAAAAAAATG
mouse anti-PfP39 sera were incubated at 1/100 dilution
rab18 30 -CAAGCGCAATTGGATC
with cold, air-dried and acetone-fixed parasites, for 30 min
in humidified chamber at 37 8C. Slides were washed three
For 30 -RACE of rab5b:
times in PBS (pH 7.4) for 10 min and incubated with FITC-
anti-rabbit IgG (H þ L), or FITC-anti-mouse IgG (H þ L)
RACErv ATTCTAGAGGCCGAGGCGGCC (Alexa Interchim, France). For double staining the incu-
rab5bRACE-1 CAGAGATGGTCATGAAGTTTTGT- bations were performed first with the rabbit anti-PfRab1A,
GAAC or anti-PfRab11A, or anti-PfRab6 followed by a second
rab5bRACE-2 ATTCTAGAGGCCGAGGCGGCC incubation with the mouse anti-PfP39. After washes both
16 E. Quevillon et al. / Gene 306 (2003) 13–25

the FITC-anti-rabbit and anti-mouse phycoerythrin-labeled

This paper; Spielmann and Beck, 2000 #15

the gene identification following the complete annotation of the genome (Hall et al., 2002; Gardner et al., 2002 2; Hyman et al., 2002) and publication reference. For each gene the number of exons is
For each of the P. falciparum rab genes, various information (whenever available) are provided in a synthetic table: gene name, functional characterization, accession number(s), chromosome number with

indicated. When a gene identification is followed by an asterisk, corrections have been made to the corresponding annotation (number of exons and/or exons boundaries). The corrections are as follows.
IgG (H þ L) (Catalag Laboratories, Tebu, France) were
added as above.

Langsley and Chakrabarti, 1996 #4

2.5. Molecular modelling

de Castro et al., 1996 #3

Gardner et al., 1998 #11 Homology model for the GTP-complex of PfRab6 was
predicted using GDP-bound PfRab6 and GTP analogue
bound structures of mouse Rab3A (PDB code: 3RABA) and
Unpublished

This paper
This paper

This paper
This paper

This paper
This paper
mouse Rab5C (PDB code:1HUQ) with the help of the
program Modeller (Sali and Blundell, 1993). Homology
model for PfRab5A (the insertion region was deleted) and
PfRab5C was predicted using Swiss-Model (http://www.
expasy.ch/) and was based on the GDP-bound structure of P.
falciparum Rab6 and the above mentioned two structures.
Langsley and Chakrabarti, 1996 chr13: PF13_0119 (5 exons)

2.6. Phylogenetic tree analysis

Pfrab11b: complement(join(1599452..1599498,1599669..1599878,1599993..1600214,1600410..1600465,1600658..1600723,1600998..1601016)).

Multiple alignment of the P. falciparum, S. pombe and S.

cerevisiae Rabs proteins was performed using ClustalW
1.8.2 with all default parameters. A distance matrix was
computed with ProtDist 3.5 (PHYLIP Package) with a
chr13: MAL13P1.205* (6 exons)

bootstrap value of 1000 and a Kimura formula as distance

chr13: MAL13P1.51 (6 exons)
chr2: PFB0500c (simple gene)
chr5: PFE0690c (simple gene)

chr11: PF11_0461* (4 exons)

model. Phylogenetic trees were performed using the

chr1: MAL1P1.59 (9 exons)
chr12: PFL1500w (7exons)

chr8: PF08_0110 (4 exons)

chr5: PFE0625w (6 exons)

chr9: PFI0155c (5 exons)

Neighbour-joining method. The multiple data set was

analysed and rooted with Human Rho6 protein as an out-
group. From these 1000 trees, the Consens program derived
a consensus tree. The accession numbers for the proteins
used to compile the tree are given in Table 1.

3. Results and discussion

Pfrab6: complement(join(10731..11231,11554..11619,11728..11768,12119..12134));

3.1. The P. falciparum rab family consists of 11 genes

AAC71889
AF201953
AJ237914

AJ409198
AJ308736

AJ422110
AJ420321

AJ290938

AJ438271
U41269

X92977

X93161
Characterization and genomic annotation of the P. falciparum rab gene family

Prior to publication of the P. falciparum genome

ND

sequence (Hall et al., 2002; Gardner et al., 2002; Hyman

et al., 2002) we performed repeated computer-assisted (Psi-
BLASTs) homology searches using each of the candidate
Endosome-endosome and/or vacuole fusion

genes as probes against the non-annotated P. falciparum

databases that allowed us to estimate that the Pfrab family
comprises 11 members (Table 2 and Fig. 1). Thus, we have
identified and characterized (see below) genes encoding
seven new putative full-length PfRab proteins (see Table 2
for accession numbers). From the sequence alignments it is
Vacuole size regulation
Recycling endosomes

clear that the chromosome 2-specific rab gene (Gardner

et al., 1998) that herein we call Pfrab5a, encodes a 30-
Vacuole size

amino-acid insertion absent in the nine other P. falciparum

ER to Golgi

ER to Golgi

Intra-Golgi

Rab GTPases (Fig. 1).

As this insertion could be encoded by a cryptic intron, we
performed PCR on both genomic DNA and first strand
cDNA, isolated from infected red blood cells, and confirmed
that it is indeed transcribed into mRNA and that Pfrab5a is
PfRab11b
PfRab11a

expressed in asexual blood stages (Fig. 2B). An 80-amino-

PfRab1b

PfRab5b

PfRab18
PfRab1a

PfRab5a

PfRab5c
Table 2

PfRab2

PfRab6
PfRab7

acid insertion also occurs in GTP-binding region of

ScYpt11 (http://genome-www4.stanford.edu/cgi-bin/SGD/
 E. Quevillon et al. / Gene 306 (2003) 13–25 17

Fig. 1. ClustalW alignment of the 11 members of the P. falciparum Rab family. The different conserved motifs are colour coded with RabF1 (red), RabF2
(cyan), RabF3 (violet) and RabF4 (rose). All RabSF motifs are coloured green and the GTP-binding motifs (PM1, PM2, PM3, G1, G2, G3) shown in grey. The
internal double cysteine in PfRab5B is underlined. Note the 30-amino-acid insertion between the RabF1 and RabF2 motifs of PfRab5A and that PfRab5B has
an unusual C-terminus (NNP).
18 E. Quevillon et al. / Gene 306 (2003) 13–25

Fig. 2. Amplification of Pfrabs by RT–PCR. P. falciparum total RNA was primed with oligo(dT) and reverse transcribed. (A) cDNA was amplified by PCR
with primer pairs encompassing the predicted Pfrab coding regions including 50 and 30 in-frame stop codons to confirm the complete intron-exon structure by
sequencing (þ ). PCR on the reaction without reverse transcriptase (2) and on genomic DNA (g) were performed as controls. With Pfrab11b-specific primers a
signal was obtained on genomic DNA only, but not on cDNA. (B) RT–PCR with primers flanking the sequence encoding the Pfrab5a insertion showed the
presence of this sequence in the mature mRNA. (C) 30 -RACE to verify absence of a CC/CXC motif in the C-terminus of Pfrab5b by sequencing amplified
product. Lanes 1 and 2 correspond to PCR reactions performed with rabRACE primers 1 and 2, respectively. Size standards are indicated in kilobases.

locus.pl?locus ¼ ypt11) and an insertion of 9 amino acids in
the GTP-binding region of human Rab27 (accession number
I39198). Thus, stretches of amino acid insertions within the
GTP-binding domains although rare occur in Rabs of
different organisms.
If translated into a functional protein, the 30-amino-acid
insertion would significantly disrupt the switch I region of
PfRab5A. The insertion occurs between RabF1 and RabF2
motif (see Fig. 1). Comparative analysis of GDP-bound
Fig. 3. Ribbon drawing showing the putative structure of PfRab5A.
Localization of the RabF and RabSF motifs is shown using the same colour
code as in Fig. 1. Note that the PfRab5A structure is shown without 30-
amino-acid insertion, whose position is indicated in blue.
PfRab6 structure (PDB code: 1D5C), with the GTP-bound
structures of Rab3a (PDB codes: 3RAB and 1ZBD)
revealed that the temperature factor of several amino acid
residues in this area are among the highest in the GDP-
bound state, but are relatively low in the GTP bound
conformation (Chattopadhyay et al., 2000). This implies
certain flexibility in this region particularly in the GDP-
bound form. Whether or not the inserted sequence can loop
out to form an additional domain to interact with specific
molecules awaits further biochemical and structural ver-
ification. The structure of the edited PfRab5A from which
the 30-amino-acid insertion was deleted could be predicted
by Swiss-Model package, as shown in Fig. 3. However,
attempts to model the full-length protein using this method
were not successful. The insertion occurs at an edge of the
molecule between the two residues shown in blue in Fig. 3.
In an attempt to see if there is any characteristic
distribution of amino acids in the structural elements of
isoform-specific Rabs, we compared the distribution of
aromatic amino acids, in the published structure of mouse
Rab5c and homology models of PfRab5A and PfRab5C. As
shown in panels A –C of Fig. 4, PfRab5A exhibits a different
distribution pattern of aromatic amino acids (Phe, Tyr and
Trp) as compared to PfRab5C and mouse Rab5C. Although
there may be some uncertainty in the position and/or
orientation of side chains in PfRab5A and PfRab5C models,
the compositional distribution of amino acid residues in
different isoforms may dictate their interactions with
specific effector molecules.
Rab proteins usually have at their C-termini CXC or CC
motifs that are subjected to prenylation and these fatty acids
assure attachment to the vesicle’s membrane. We were
unable to identify either a CXC or CC motif encoded in the
genomic sequence several kilobases downstream of the
Pfrab5b gene. This could be due to the fact that like human
Rab8 and Rab23, PfRab5B unusually terminates with a
single cysteine (Casey and Seabra, 1996). To confirm the
Pfrab5b sequence we performed 30 -RACE and determined
 E. Quevillon et al. / Gene 306 (2003) 13–25
Fig. 4. Ribbon drawings showing distribution of aromatic residues (in gold ball and stick), on models of PfRab5A and PfRab5C compared to the mouse Rab5C
structure in the same orientation. Localization of RabF and RabSF motifs is indicated in for PfRab5A. Note that in PfRab5A a cluster of three aromatic residues
(Phe, Tyr and Trp) occurs close to the site (coloured blue) of the 30-amino-acid insertion.
the 30 -end of the Pfrab5b cDNA and indeed the encoded C-
terminus ends in NNP (Fig. 2C). This could imply that
PfRab5B is a cytosolic GTPase, similar to what has been
proposed for human Rab24 and a new member (WTH3) of
the rab6 gene family (Erdman et al., 2000; Shan et al.,
2002). However, a recently identified plant Rab
(BAB32953) from A. thaliana also lacks C-terminal
prenylation motifs, but encodes putative N-terminal myr-
istoylation and palmitoylation motifs (Pereira-Leal and
Seabra, 2001). Interestingly, PfRab5B also encodes a
putative N-terminal myristoylation site between residues 2
to 7 (GCSSST), suggesting that perhaps Apicomplexa
parasites, like plants, might use this type of modification to
attach certain Rabs to membranes. If true, such a Rab would
be anchored to the membrane in the opposite orientation (N-
terminal proximal) to the majority of Rab GTPases (C-
terminal proximal). Alternatively, prenylation could occur
at an internal cysteine such as the CC motif present at
residues 141 –142 of the 207 amino acids of PfRab5B
Fig. 5. Intra-erythrocytic transcription profile for Pfrab2 and PfRab7. Total
RNA was isolated from infected erythrocytes at different time points post
invasion and probed with Pfrab2- and Pfrab7-specific probes. Track 1, 0–8
h; track 2, 8–16 h; track 3, 17– 25 h; track 4, 27–35 h; track 5, 35–43 h
post-invasion. Expression profiles for the two genes differs with Pfrab2
being strongest in ring (track 1) and young trophozoite (track 2) stages, but
still readily detected in mature trophozoites (track 3), young and mature
schizonts (tracks 4 and 5). Transcripts for Pfrab7 could only be readily
detected in mature trophozoites and early schizonts (tracks 3 and 4).
19
(Fig.1, underlined). Whether the Pfrab5b gene codes for a
cytosolic, or membrane bound GTPase, remains to be
determined. However, the fact that this unusual Rab GTPase
is expressed in asexual blood stage parasites argues that it
might play some novel regulatory role and a possibility
could be in multi-drug resistance, similar to human WTH3/
rab6 (Shan et al., 2002).
We have been able to confirm either by Northern blotting
(see Fig. 5 for Pfrab2 and Pfrab7), or by RT –PCR (Fig. 2)
that six out of the seven new Pfrabs are expressed in
infected red blood cells. We were unable to detect
transcripts only for Pfrab11b, even though this gene is
predicted to encode all of the hallmarks of a functional Rab
GTPase. It is possible that Pfrab11b is only expressed in
sporozoites and/or hepatocytes, as these life-cycle stages
were not tested. Tissue-specific expression occurs for a
number of human Rabs and it is conceivable that PfRab11B
represents a stage-specific parasite Rab. In this context, the
intra-erythrocytic expression of Pfrab2 and Pfrab7merits
mention, as during asexual stage development their
expression levels alter with Pfrab7 being particularly
restricted to trophozoites and early schizonts (see Fig. 5).
We note that the gene that we have named Pfrab18 has a
cryptic intron (Fig. 2A) and as a consequence the lysine-rich
stretch predicted for this gene at PlasmoDB (http://
plasmodb.org/) is absent in mature message. In all, only
Pfrab1a and Pfrab5a lack introns, the others have multiple
introns and with the exception of Pfrab11b their positions
were determined by comparing the cDNA and genomic
sequences and are indicated in Table 2. For Pfrab11b the
introns were predicted using the different annotation tools,
including the PBGI programme that we have recently
described (Yeramian et al., 2002).
3.2. PfRabs predicted to be compartment-specific have
different sub-cellular locations
In order to generate evidence that the Pfrab-specific
transcripts we have detected by Northern blot, or RT – PCR
20 E. Quevillon et al. / Gene 306 (2003) 13–25

Fig. 6. Different PfRabs have different sub-cellular distributions in schizont-infected erythrocytes. Panel (A) shows control rabbit pre-immune serum. Panel (B)
shows a multinucleated schizont decorated with anti-PfRab1A antibodies giving a perinuclear staining. Panels (C) and (D) (phase contrast) show the pattern
obtained with the anti-PfRab11A antibodies. Clearly, PfRab1A and PfRab11A display different distributions. Panel (E) shows the pattern obtained with anti-
Pf39 antibodies specific for the endoplasmic reticulum. Panel (F) shows a double-labelling with anti-PfRab1A (green) and Pf39 (red) antibodies, where co-
localization stains yellow. Panel (G) shows a double-labelling with anti-PfRab11A (green) and anti-Pf39 (red) and no co-localization is observed. Panel (H)
shows anti-PfRab6 (green) and anti-Pf39 (red), where co-localization stains yellow.

are actually translated into protein we raised antibodies to
specific peptides derived from PfRab1A and PfRab11A and
performed indirect-immunofluorescence microscopy (Fig.
6). The specificity of the anti-peptide antisera was
confirmed by Western blots and each identified only a
single polypeptide (presented to referees, data not shown)
and their pre-immune sera gave no reaction with infected
erythrocytes (Fig. 6A). From its sequence homology
PfRab1A is expected to be an intermediate compartment
(between the ER and Golgi) specific Rab (Saraste et al.,
1995), and indeed it gives a perinuclear staining (Fig. 6B)
and co-localizes with Pf39 (Fig. 6F), a known ER specific
 E. Quevillon et al. / Gene 306 (2003) 13–25 21

Fig. 7. Ribbon drawing showing superposition of PfRab6-GDP bound structure (1D5C) in white and PfRab6-GTP model in grey. The RabF and SF motifs are
shown coloured as previously. Location of GDP in 1D5C is shown in sticks. Note that only RabF1 (F1) and RabF3 (F3) are predicted to change their position as
GTP is hydrolysed to GDP.

marker (Templeton et al., 1997). In contrast, PfRab11A is
expected to be specific for recycling endosomes (Ullrich
et al., 1996), and the antibodies decorate vesicular-like
structures (Fig. 6C,D) that do not co-localize with Pf39 (Fig.
6G). For comparison, we used antibodies to Golgi-specific
PfRab6 (Fig. 6E), whose distribution overlaps with Pf39
(Fig. 6H). Although fine details cannot be discerned by
simple immunofluorescence microscopy, it is clear that
PfRabs predicted to be specific for different compartments
have different sub-cellular distributions.
3.3. Cross-species conservation of RabF motifs
Recently, a comparison of small GTPases of the human
Ras super-family identified a series of small sequence
motifs specific for the Rab sub-family (Pereira-Leal and
Seabra, 2000, 2001). We verified that these specific motifs
are present in the putative P. falciparum Rabs (Fig. 1).
Interestingly, although the RabSF3, and to some extent SF4
motifs, are conserved in all 11 P. falciparum Rabs, the
RabSF1 motif and to a lesser extent RabSF2 appear to
delineate two sub-groups (see Fig. 1). A specific RabSF1
motif can be seen for PfRabs 1, 2 and 11, with a well-
conserved RabSF2 motif being present in PfRab1 and
PfRab2. Previously, Pereira-Leal and Seabra noticed that
RabF motifs occur close to the switch region and argued that
they may be involved in mediating interactions with Rab-
effector proteins. If true, their conservation in Rabs from P.
falciparum argues that the mechanism of recognition of
certain Rab-effectors has been conserved from lower
eukaryotic parasites through to Man. Moreover, the
distribution of the RabSF1 and RabSF2 motifs suggests
that PfRabs 1, 2 and 11 might share a common effector. The
RabSF4 motif seems to be extremely variable among P.
falciparum Rabs. Only the first residue (F) in this motif is
conserved among all except for PfRab5C. As seen in Figs. 7
and 8, this motif resides in helix a5 and in conjunction with
RabSF1 and RabSF3 forms a surface for interaction with
specific effectors, for example, Rabphilin, in the case of
Rab3a (Ostermeier and Brunger, 1999).
3.4. Repositioning of RabF motifs during the GTP to GDP
switch
Following its comparison with mammalian Rab3 bound
to GTP and recently determined GPPNP complex of Rab5a,
we were able to model the conformational changes in the
PfRab6 protein during the GTP to GDP switch (Chatto-
22 E. Quevillon et al. / Gene 306 (2003) 13–25
Fig. 8. Ribbon diagram showing the position of PfRab6 equivalent residues
of human Rab6 isoforms. The RabF and SF motifs are shown coloured. The
corresponding residues V60, A85 and A86 are shown in ball and stick on
the GDP-bound structure of PfRab6 (1D5C), and combined with RabSF1
(SF1) and RabF4 (F4) they appear to form an interface.
padhyay et al., 2000). We therefore asked whether the
surface distribution of the RabF motifs were predicted to
change following GTP hydrolysis, as this might impact on
their potential interactions with Rab-effector proteins (Fig.
7). The image shows RabF and RabSF motifs on the crystal
structure of PfRab6-GDP (white) overlaid with PfRab6-
GTP model (grey). We note that only two of the RabF
motifs, RabF1 and RabF3 which lie within the switch I and
switch II regions, show changes in their position, the other
three RabF motifs remaining in the same position in both
conformational states. RabF4, which lies within the helix
a2-loop5 may also undergo changes in specific cases, since
any conformational changes in F3 region can result in
movement of F4. This implies that RabF1 and RabF3 might
mediate binding to effectors, where the interactions are
determined by GTP ! GDP hydrolysis. Also note that
RabSF motifs do not change much in position (except for
loop area of RabSF2, at the N-terminal edge of RabF1) and
as such these motifs might mediate more ‘constitutive’
binding to effectors that could be specific for Rab subsets.
Fig. 9. Phylogenetic tree analysis of P. falciparum Rabs compared to those of S. cerevisiae (Sc) and S. pombe (Sp). The different P. falciparum Rabs form clads
with yeast Rabs, where each clad can be considered to represent a functional group. The numbers on the consensus tree indicate the number of times the
partition of the species into two sets, which are separated by the branch occurred among the trees, out of 1000 trees analysed. The tree was rooted on human
Rho6 as an out-group protein.
Two amino acids residues (TV) in human Rab6 are
known to be important for mediating interaction with
Rabkinesin-6 and we have previously discussed that of the
equivalent residues in PfRab6 only the first alanine A(85) is
exposed, whilst the second alanine A(86) is buried
(Chattopadhyay et al., 2000). Fig. 8 shows that AA motif
occurs at the C-terminal edge of RabF4. Indeed, the exposed
A(85) together with the loop region of the SF3 motif and the
C-terminal portion of RabF4 sequence may provide binding
surface for a large molecule, such as a putative P.
falciparum Rab6 effector. Interestingly, the human
Rab6A’ isoform expressing the AA motif similar to P.
falciparum, does not interact with Rabkinesin-6, nor does it
appear to regulate retrograde transport from the Golgi to the
ER (Echard et al., 2000), rather it appears to regulate
endosome to Golgi transport (Mallard et al., 2002). Also we
have to consider that the N-terminal end of Rab6 houses the
RabSF1 motif that is very flexible and not visible in PfRab6
structure beyond residue 11. The other human Rab6 isoform
specific residue, V60 (PfRab6 numbering) is at the N-
terminal edge of the RabF2 motif and is partially exposed.
This residue is involved in hydrophobic interaction with
RabSF1 region and may mediate a novel effector
interaction.
3.5. Phylogenetic tree analysis of parasite and yeast Rabs
Rab GTPases of S. cerevisiae and S. pombe can be
considered as a paradigm for eukaryotic Rab function due to
the small size of their families and easy genetic analysis of
their function. Similar to the two fungi P. falciparum is a
unicellular lower eukaryote and comparison between the
three different families ought to be particularly informative
(Pereira-Leal and Seabra, 2001). Moreover, the P. falci-
parum family of 11 genes is similar in size to S. cerevisiae
(11 genes) and S. pombe (7 genes), suggesting that direct
comparison might give some insight into the potential
function of a given P. falciparum Rab. The tree presented in
Fig. 9 shows the result of this comparison using PfRab5A
lacking the 30-amino-acid insertion as the insertion did not
alter the position of PfRab5A (data not shown).
The two smallest groups are those composed of PfRab6,
SpRyh1, plus ScYpt6 and PfRab7, SpTypt7 plus ScYpt7.
Clearly, PfRab6 and PfRab7 can be considered parasite
orthologues of SpRyh1/ScYpt6 and SpTyp7/ScYpt7,
respectively, as they have bootstrap values close to 100
(see Fig. 9). Interestingly, genetic inactivation of ScYpt7
leads to an increase in vacuole size (Gotte et al., 2000). By
analogy therefore, one could predict that PfRab7 has a
similar role in regulating vacuole size within the parasite,
E. Quevillon et al. / Gene 306 (2003) 13–25 23
24 E. Quevillon et al. / Gene 306 (2003) 13–25
and the observation that Pfrab7 expression occurs at a stage
of the lifecycle concurrent with vacuole formation (Fig. 5) is
consistent with this notion.
The parasite Rab5 GTPases form a group with SpYpt5,
ScTpt52, ScYpt53 and Ypt21 and Ypt10. We recall that
PfRab5B has a C-terminus ending in NNP, rather than CC or
CXC and may be a Rab with an unusual function. Within
this clad, interruption of the ScYpt10 gene gives no
discernible phenotype, whereas genetic interruption of
SpYpt5 leads to vesicle accumulation (Armstrong et al.,
1993). Thus, it is difficult to tell from this analysis whether
PfRab5A and/or PfRab5C might regulate endosomal
function, or vacuole-vacuole fusion in P. falciparum.
However, the presence of a 30-amino-acid insertion in
PfRab5A that we have argued could mediate novel effector
interactions, might favour PfRab5C.
The group made up of Rab11-like homologues shows
PfRab11A to be more closely related to SpYpt3 and yeast
null for this function are lethal (Miyake and Yamamoto,
1990) implying that PfRab11A may mediate an essential
recycling endosome function in P. falciparum. The
vesicular-like pattern (Fig. 6C) obtained with specific
antibodies to PfRab11A are consistent with this notion.
PfRab11B is on another earlier branch implying that it
might have a slightly different more ancient function.
Interestingly, PfRab2 and SpYpt4 might be orthologues.
Genetic inactivation of SpYpt4 leads to an increased
vacuole size (Armstrong et al., 1994) implying a similar
role for PfRab2. However, Northern analysis (Fig. 5)
showed that the profile of Pfrab2 expression differs from
that of Pfrab7, suggesting non-identical roles for these two
parasite Rabs in vacuole size regulation, or perhaps separate
roles in regulation of size of different vacuoles.
PfRab1B segregates with SpYpt1 and ScYpt1 suggesting
that it is the P. falciparum orthologue, while PfRab1A
although in the same cluster together with ScSec4 and
SpYpt2 is clearly less closely related. This might suggest that
PfRab1A might have a more parasite-specific function in the
ER to Golgi transport defined by PfRab1B/SpYpt1/ScYpt1
(Segev and Botstein, 1987). PfRab18 would appear to define
an ancestral Rab more closely related to SpYpt2 and ScSec4.
4. Conclusions
We have been able to identify 11 genes making up the P.
falciparum Rab family and established that ten members are
expressed in infected erythrocytes, while no transcripts were
detected for Pfrab11b implying that it is a stage specific
Rab. This is the first characterization of an entire Rab family
of an intracellular pathogen and its description ought to
make it easier to generate markers to analyse intracellular
trafficking of infected erythrocytes in more detail. To
illustrate the point specific antisera were made to two
PfRabs (1A and 11A) predicted to be compartment-specific
and they gave different patterns of fluorescence consistent
with different subcellular locations. The observation that P.
falciparum was found to have the same number of rab genes
as S. cerevisiae, and to possess orthologues to most yeast
Rabs indicates that the parasite secretory/endocytic pathway
is similar in basic structure to the yeast pathway.
Alternatively, some orthologues might fulfil a different
function. For example, PfRab5B lacks a classical C-
terminus required for prenylation, yet encodes a potential
N-terminal myristoylation site implying a novel role for this
parasite Rab. PfRab5A has an unusual 30-amino-acid
insertion that could alter and/or impair protein structure/-
function and this raises extremely interesting structural
biological questions. It is conceivable that Rab isoforms as
well Rab-specific effectors evolved with the increasing
complexity of the cellular structure and function and the
concomitant changes in fine tuning structure of the Rab
proteins. These differences can make putative functional
assignments of parasite Rabs hazardous. Nonetheless,
phylogenetic comparison with Rabs from yeast gave clear
indications to potential function for certain P. falciparum
Rabs, and implied that genetic interruption of some parasite
rab genes may have a null phenotype.
Acknowledgements
We wish to thank the scientists and funding agencies
comprising the international Malaria Genome Project for
making sequence data from the genome of P. falciparum
(3D7) public prior to publication of the completed sequence.
The Sanger Centre (UK) provided sequence for chromo-
somes 1, 3 –9 and 13, with financial support from the
Wellcome Trust. A consortium composed of The Institute
for Genome Research, along with the Naval Medical
Research Center (USA), sequenced chromosomes 2, 10,
11 and 14, with support from NIAID/NIH, the Burroughs
Wellcome Fund, and the Department of Defence. The
Stanford Genome Technology Center (USA) sequenced
chromosome 12, with support from the Burroughs Well-
come Fund. The Plasmodium Genome Database is a
collaborative effort of investigators at the University of
Pennsylvania (USA) and Monash University (Melbourne,
Australia), supported by the Burroughs Wellcome Fund. We
thank Gary Ward for the anti-peptide antisera. The Pasteur
Institute and the CNRS supported this work.
References
Armstrong, J., Craighead, M.W., Watson, R., Ponnambalam, S., Bowden,
S., 1993. Schizosaccharomyces pombe ypt5: a homologue of the rab5
endosome fusion regulator. Mol. Biol. Cell 4, 583– 592.
Armstrong, J., Pidoux, A., Bowden, S., Craighead, M., Bone, N., Robinson,
E., 1994. The ypt proteins of Schizosaccharomyces pombe. Biochem.
Soc. Trans. 22, 460 –463.
Attal, G., Langsley, G., 1996. A Plasmodium falciparum homologue of rab
 E. Quevillon et al. / Gene 306 (2003) 13–25
specific GDP dissociation inhibitor (rabGDI). Mol. Biochem. Parasitol.
79, 91 –95.
Casey, P.J., Seabra, M.C., 1996. Protein prenyltransferases. J. Biol. Chem.
271, 5289–5292.
Chakrabarti, D., Azam, T., DelVecchio, C., Qiu, L., Park, Y.I., Allen, C.M.,
1998. Protein prenyl transferase activities of Plasmodium falciparum.
Mol. Biochem. Parasitol. 94, 175–184.
Chattopadhyay, D., Langsley, G., Carson, M., Recacha, R., DeLucas, L.,
Smith, C., 2000. Structure of the nucleotide-binding domain of
Plasmodium falciparum rab6 in the GDP-bound form. Acta Crystallogr.
D Biol. Crystallogr. 56, 937 –944.
Chavrier, P., Parton, R.G., Hauri, H.P., Simons, K., Zerial, M., 1990.
Localisation of low molecular weight GTP binding proteins to exocytic
and endocytic compartments. Cell 62, 317–329.
de Castro, F.A., Ward, G.E., Jambou, R., Attal, G., Mayau, G.,
Jaureguiberry, C., et al., 1996. Identification of a family of Rab G-
proteins in Plasmodium falciparum and a detailed characterisation of
PfRab6. Mol. Biochem. Parasitol. 80, 77–88.
Echard, A., Opdam, F.J., de Leeuw, H.J., Jollivet, F., Savelkoul, P.,
Hendriks, W., et al., 2000. Alternative splicing of the human Rab6A
gene generates two close but functionally different isoforms. Mol. Biol.
Cell 11, 3819–3833.
Erdman, R.A., Shellenberger, K.E., Overmeyer, J.H., Maltese, W.A., 2000.
Rab24 is an atypical member of the Rab GTPase family. Deficient
GTPase activity, GDP dissociation inhibitor interaction, and prenyla-
tion of Rab24 expressed in cultured cells. J. Biol. Chem. 275,
3848–3856.
Gardner, M.J., Tettelin, H., Carucci, D.J., Cummings, L.M., Aravind, L.,
Koonin, E.V., et al., 1998. Chromosome 2 sequence of the human
malaria parasite Plasmodium falciparum. Science 282, 1126– 1132.
Gardner, M.J., Hall, N., Fung, E., White, O., Berriman, M., Hyman, R.W.,
et al., 2002. Genome sequence of the human malaria parasite
Plasmodium falciparum. Nature 419, 498–511.
Gotte, M., Lazar, T., Yoo, J.S., Scheglmann, D., Gallwitz, D., 2000. The
full complement of yeast Ypt/Rab-GTPases and their involvement in
exo- and endocytic trafficking. Subcell. Biochem. 34, 133– 173.
Hall, N., Pain, A., Berriman, M., Churcher, C., Harris, B., Harris, D., et al.,
2002. Sequence of Plasmodium falciparum chromosomes 1. 3–9 and
13. Nature 419, 527–531.
Hyman, R.W., Fung, E., Conway, A., Kurdi, O., Mao, J., Miranda, M., et al.,
2002. Sequence of Plasmodium falciparum chromosome 12. Nature
419, 534 –537.
Langsley, G., Chakrabarti, D., 1996. Plasmodium falciparum: the small
GTPase rab11. Exp. Parasitol. 83, 250 –251.
Mallard, F., Tang, B.L., Galli, T., Tenza, D., Saint-Pol, A., Yue, X.,
25
Antony, C., Hong, W., Goud, B., Johannes, L., 2002. Early/recycling
endosomes-to-TGN transport involves two SNARE complexes and a
Rab6 isoform. J. Cell Biol. 156, 653 –664.
McCaffrey, M.W., Bielli, A., Cantalupo, G., Mora, S., Roberti, V., Santillo,
M., et al., 2001. Rab4 affects both recycling and degradative endosomal
trafficking. FEBS Lett. 495, 21–30.
Miyake, S., Yamamoto, M., 1990. Identification of ras-related, YPT family
genes in Schizosaccharomyces pombe. EMBO J. 9, 1417–1422.
Ostermeier, C., Brunger, A.T., 1999. Structural basis of Rab effector
specificity: crystal structure of the small G protein Rab3A complexed
with the effector domain of rabphilin-3A. Cell 96, 363 –374.
Pereira-Leal, J.B., Seabra, M.C., 2000. The mammalian Rab family of
small GTPases: definition of family and subfamily sequence motifs
suggests a mechanism for functional specificity in the Ras superfamily.
J. Mol. Biol. 301, 1077–1087.
Pereira-Leal, J.B., Seabra, M.C., 2001. Evolution of the Rab family of small
GTP-binding proteins. J. Mol. Biol. 313, 889–901.
Sali, A., Blundell, T.L., 1993. Comparative protein modelling by
satisfaction of spatial restraints. J. Mol. Biol. 234, 779 –815.
Saraste, J., Lahtinen, U., Goud, B., 1995. Localisation of the small GTP-
binding protein Rab1p to early compartments of the secretory pathway..
J. Cell Sci. 108, 1541– 1552.
Segev, N., Botstein, D., 1987. The ras-like yeast YPT1 gene is itself
essential for growth, sporulation, and starvation response. Mol. Cell
Biol. 7, 2367– 2377.
Spielmann, T., Beck, H.P., 2000. Analysis of stage-specific transcription in
Plasmodium falciparum reveals a set of genes exclusively transcribed in
ring stage parasites. Mol. Biochem. Parasitol. 111, 453 –458.
Templeton, T.J., Fujioka, H., Aikawa, M., Parker, K.C., Kaslow, D.C.,
1997. Plasmodium falciparum Pfs40, renamed Pf39, is localized to an
intracellular membrane-bound compartment and is not sexual stage-
specific. Mol. Biochem. Parasitol. 90, 359–365.
Tisdale, E.J., Balch, W.E., 1996. Rab2 is essential for the maturation of pre-
Golgi intermediates. J. Biol. Chem. 271, 29372–29379.
Ullrich, O., Reinsch, S., Urbé, S., Zerial, M., Parton, R.G., 1996. Rab11
regulates recycling through the pericentriolar recycling endosome.
J. Cell Biol. 135, 913–924.
Ward, G.E., Tilney, L.G., Langsley, G., 1997. Rab GTPases and the unusual
secretory pathway of Plasmodium. Parasitol. Today 13, 57– 62.
Zerial, M., McBride, H., 2001. Rab proteins as membrane organizers. Nat.
Rev. Mol. Cell. Biol. 2, 107–117.
Yeramian, E., Bonnefoy, S., Langsley, G., 2002. Physics-based gene
identification: Proof of concept for Plasmodium falciparum. Bioinfor-
matics 18, 190–193.