European Journal of Pharmacology 946 (2023) 175650

Contents lists available at ScienceDirect

European Journal of Pharmacology

journal homepage: www.elsevier.com/locate/ejphar

Losartan attenuates acetic acid enema-induced visceral hypersensitivity by

inhibiting the ACE1/Ang II/AT1 receptor axis in enteric glial cells
Yating Sun a, Xiaohui Liu b, Lianli Wang a, Laifu Li a, Xiaojing Quan a, Haitao Shi a, Ting Wang a,
Lin Mei a, Yindi Chen c, Yue Zhang a, Jingyao Li a, Ruiting Meng a, Jinhai Wang a, Fei Dai a, *
a
Department of Gastroenterology, Second Affifiliated Hospital of Xi’an Jiaotong University, Xi’an, China
b
Department of Bone and Joint Surgery, Second Affifiliated Hospital of Xi’an Jiaotong University, Xi’an, China
c
Department of Gastroenterology, Xi’an People’s Hospital, Xi’an, China

A R T I C L E I N F O A B S T R A C T

Keywords: Enteric glial cells (EGCs) play an important role in visceral hypersensitivity associated with irritable bowel syn­
Visceral hypersensitivity drome (IBS). Losartan (Los) is known to reduce pain; however, its function in IBS is unclear. The present study
Enteric glial cell aimed to investigate Los’s therapeutic effect on visceral hypersensitivity in IBS rats. Thirty rats were randomly
Irritable bowel syndrome
divided into control, acetic acid enema (AA), AA + Los low, medium and high dose groups in vivo. EGCs were
Losartan
treated with lipopolysaccharide (LPS) and Los in vitro. The molecular mechanisms were explored by assessing the
AT1 receptor
Inflammation expression of EGC activation markers, pain mediators, inflammatory factors and angiotensin-converting enzyme
1(ACE1)/angiotensin II (Ang II)/Ang II type 1 (AT1) receptor axis molecules in colon tissue and EGCs. The results
showed that the rats in the AA group showed significantly higher visceral hypersensitivity than the control rats,
which was alleviated by different doses of Los. The expression of GFAP, S100β, substance P (SP), calcitonin gene-
related peptide (CGRP), transient receptor potential vanilloid 1 (TRPV1), tumor necrosis factor (TNF), inter­
leukin-1β (IL-1β) and interleukin-6 (IL-6) was considerably increased in colonic tissues of AA group rats and LPS-
treated EGCs compared with control rats and EGCs, and reduced by Los. In addition, Los reversed ACE1/Ang II/
AT1 receptor axis upregulation in AA colon tissues and LPS-treated EGCs. These results show that Los inhibits
ACE1/Ang II/AT1 receptor axis upregulation by suppressing EGC activation, resulting in reduced expression of
pain mediators and inflammatory factors, thereby alleviating visceral hypersensitivity.

et al., 2016). This state of EGCs is referred to as the reactive EGC

phenotype. In addition, calcitonin gene-related peptide (CGRP) and
1. Introduction
transient receptor potential vanilloid 1 (TRPV1) are also closely asso­
ciated with visceral hypersensitivity in relation to IBS (Akbar et al.,
Visceral hypersensitivity is the main driver of abdominal pain in
2008; Shi et al., 2015).
relation to irritable bowel syndrome (IBS), which may be associated
Considerable evidence supports the concept of a local tissue or
with various factors (Pusceddu and Gareau, 2018; Sengupta, 2009).
cellular renin–angiotensin–aldosterone system (RAAS) (Karnik et al.,
Recently, considerable attention has been given to the role of enteric
2015; Obukhov et al., 2020). Some studies have shown that the local
glial cells (EGCs) and the secretory mediators of the enteric nervous
RAAS can be involved in inflammation and pain (Bali et al., 2014; Karnik
system (ENS) in the visceral hypersensitivity response to IBS.
et al., 2015). Ang II mainly binds with high affinity to Ang II type 1
EGCs are a prominent component of the ENS. Upon alteration of the
(AT1) receptor to generate inflammatory responses and reactive oxygen
gastrointestinal environment, EGCs are activated, calcium-binding
species (Xu et al., 2017) and participates in nociception (Hegazy et al.,
protein S100β and glial fibrillary acidic protein (GFAP) expression is
2020a). Ang II has been shown to co-localize with AT1 receptor, SP,
upregulated, and substance P (SP) is released and expressed to partici­
CGRP, and TRPV1 in the dorsal root ganglion (DRG) (Anand et al., 2015;
pate in visceral hypersensitivity (Grubišić and Gulbransen, 2017; Wang

* Corresponding author.
E-mail addresses: 18204311643@163.com (Y. Sun), liuxiaohuixjtuer@163.com (X. Liu), 15737939767@163.com (L. Wang), 1114502232@qq.com (L. Li),
quanxiaojing77@126.com (X. Quan), shihaitao7@xjtu.edu.cn (H. Shi), wttingzai@163.com (T. Wang), milly_meilin@outlook.com (L. Mei), 593825787@qq.com
(Y. Chen), zhangyue_zyzy@163.com (Y. Zhang), 893139621@qq.com (J. Li), 952463828@qq.com (R. Meng), Jinhaiwang@hotmail.com (J. Wang), daifei68@
xjtu.edu.cn (F. Dai).

https://doi.org/10.1016/j.ejphar.2023.175650
Received 31 October 2022; Received in revised form 2 March 2023; Accepted 7 March 2023
Available online 10 March 2023
0014-2999/© 2023 Elsevier B.V. All rights reserved.
Y. Sun et al.
Abbreviations:
EGC Enteric glial cells
IBS Irritable bowel syndrome
Ang Angiotensin
AT1 Ang II type 1
Los Losartan
VMR Visceral motor response
CRD Colorectal balloon dilation
LPS Lipopolysaccharide
ENS Enteric nervous system
IHC Immunohistochemistry
IF Immunofluorescence
qRT-PCR Quantitative real-time PCR
Patil et al., 2010), which provides strong evidence supporting the
involvement of Ang II binding to AT1 receptor in nociception. AT1 re­
ceptor activation in spinal dorsal horn neurons and astrocytes causes
activation of the mitogen-activated protein kinase (MAPK) pathway,
which is involved in spinal pain transmission (Nemoto, 2018; Ogata
et al., 2016). AT1 receptor blockers or angiotensin-converting enzyme 1
(ACE1) inhibitors, on the other hand, can prevent and relieve pain (Bali
et al., 2014; Marques-Lopes et al., 2009).
Losartan (Los) is a selective AT1 receptor blocker with significant
anti-inflammatory effects (Kalynovska et al., 2020; Yamamoto et al.,
2015). Whereas inflammation may contribute to the induction and
maintenance of pain, studies have shown that Los may attenuate colonic
injury by inhibiting pro-inflammatory cytokine production in the
colonic mucosa (Shi et al., 2016). Several studies have demonstrated the
presence of Ang II and AT1 receptor in the ENS, that Ang II excites
neurons in the myenteric and submucosal plexuses (Wang et al., 2005).
However, the role of the ACE1/Ang II/AT1 receptor axis in EGC acti­
vation and visceral hypersensitivity in IBS is unclear.
Therefore, we hypothesized that the ACE1/Ang II/AT1 receptor axis
may interact with EGCs to participate in IBS visceral hypersensitivity
and that Los may improve IBS visceral hypersensitivity by modulating
the ACE1/Ang II/AT1 receptor axis to inhibit EGC activation. We
explored the mechanism involving Los intervention in an acetic acid
enema-induced IBS rat model and lipopolysaccharide (LPS)-induced
EGCs in vitro experiments.
2. Materials and methods
2.1. Animals
Thirty male experimental clean-grade neonatal Sprague‒Dawley
rats were purchased from the Animal Experiment Center of Xi’an Jiao­
tong University and were housed in the same cage as their mothers until
day 21, at which point they were separated from their mothers. All
animals were housed in a specific-pathogen-free environment with a 12-
h light and 12-h dark cycle, and the animals had free access to food and
water. All animal experimental procedures were performed in accor­
dance with National Institutes of Health guidelines and approved by the
Ethics Committee of Xi’an Jiaotong University (No. 2017-127, approved
February 28, 2017).
2.2. Visceral hypersensitivity rat model and drug treatments
Thirty neonatal Sprague‒Dawley rats were randomly divided into
five groups: the control group (n = 6), acetic acid enema group (AA, n =
6), AA + Los (HY-17512A, MCE) low-dose group (AA + Los-L, n = 6),
AA + Los medium-dose group (AA + Los-M, n = 6), and AA + Los high-
dose treatment group (AA + Los-H, n = 6). The rats in the four treatment
2
European Journal of Pharmacology 946 (2023) 175650
GFAP Glial fibrillary acidic protein
SP Substance P
CGRP Calcitonin gene-related peptide
TRPV1 Transient receptor potential vanilloid 1
RAAS Renin-angiotensin-aldosterone system
ACE1 Angiotensin-converting enzyme 1
MAPK Mitogen-activated protein kinase
NF- κB Nuclear factor-κB
EMG Electromyography
AUC Area under the curve
IL-1β Interleukin-1β
IL-6 Interleukin-6
TNF Tumor necrosis factor
SD Standard deviation
groups were administered with 0.2–0.3 ml of 0.5% acetic acid (0.2 ml
during the 1st week and 0.3 ml during the 2 nd week after the start of
modelling) on the 8th-21st day of life by daily insertion of an epidural
catheter (1 mm in diameter) through the anus for 2–3 cm after lubri­
cation with paraffin oil to form a visceral hypersensitivity model. The
control group was perfused with equal amounts of saline. From day 22
until week 7, rats in all groups were left untreated, with a normal diet
and water intake, and at week 8, the Los intraperitoneal intervention
was started for the AA + Los-L group (10 mg/kg/d), the AA + Los-M
group (25 mg/kg/d) and the AA + Los-H group (50 mg/kg/d) with
reference to several common dosages of Los in previous studies (Aka­
zawa et al., 2021; Collister et al., 1996; Xiu et al., 2002). The remaining
two groups were given an equal volume of saline for 10 days of treat­
ment. During the experiment, the body weight of the rats was recorded
every 7 days.
2.3. Assessment of visceral sensation
Previous research has confirmed the visceral hypersensitivity of IBS
patients with increased sensitivity to CRD (Keszthelyi et al., 2012). In
this study, visceral sensation was assessed by extra-abdominal oblique
muscle electromyography (EMG) measurements after CRD (Nozu et al.,
2017). At the end of the Los intervention, pentobarbital (30 mg/kg,
intraperitoneal injection) was used to anaesthetize fasted Sprague‒
Dawley rats intraperitoneally for extra-abdominal oblique muscle elec­
trode implantation, and the free end of the electrode was fixed behind
the neck through a subcutaneous tunnel for EMG signal measurement.
EMG signals were recorded by a CRD instrument (BL420 Data Acquisi­
tion and Analysis System, Chengdu TME Technology Co., Ltd., China) 3
days after surgery, and the visceromotor response (VMR) was measured
in each group of rats. The volumes of balloon injection were 0 ml, 0.4 ml,
0.8 ml and 1.2 ml, and the recordings were repeated three times. The
VMR value was calculated using the area under the curve (AUC) at 20 s
during dilation minus the area at 20 s during the baseline period before
dilation.
2.4. Colonic tissue specimen collection
At the end of the visceral hypersensitivity test, the rats were anaes­
thetized with pentobarbital, and each group was given 250 ml of saline
for intracardiac perfusion. 5 cm colonic samples were collected from 8
cm proximal to the anus and divided into three parts. One section of the
colon tissue was fixed in 4% paraformaldehyde solution, dehydrated,
embedded in paraffin and sectioned for immunofluorescence (IF) and
immunohistochemistry (IHC) staining, and the other two sections were
rapidly frozen in liquid nitrogen and then transferred to a − 80 ◦ C freezer
for quantitative real-time PCR (qRT‒PCR) and Western blotting.
Y. Sun et al. European Journal of Pharmacology 946 (2023) 175650

2.5. Cell culture Table 1

QRT-PCR primer pair sequences for Sprague‒Dawley rats.
Rat EGCs (CRL-2621, ATCC) were grown in medium supplemented Gene Primers, 5′ -3′
with 10% foetal bovine serum (FBS, Gibco), 100 U/mL penicillin and
GFAP Sense AAACAGAAGAGTGGTATCGG
100 μg/mL streptomycin (Gibco) and incubated at 5% CO2 and 37 ◦ C. Antisense TAGTCATTAGCCTCGTGCTT
The cells were treated with LPS (L2630, Sigma–Aldrich) or Los in vitro S100β Sense TTCAGGGAGAGAGGGTGACAA
experimental studies. Antisense CTTCCTGCTCTTTGATTTCCTCC
CGRP Sense CTTTCCTGGTTGTCAGCATCTT
Antisense AAGTTGTCCTTCACCACACCTC
2.6. Cell proliferation and viability assay SP Sense ATGAAAATCCTCGTGGCGGT
Antisense CAGCATCCCGTTTGCCCATT
Cell proliferation and viability were assessed using cell counting kit- TRPV1 Sense AAGGATGGAACAACGGGCTAG
Antisense TCCTGGTAGTGAAGATGTGGG
8 (CCK-8) (Dojindo, Japan). EGCs (CRL-2621, ATCC) were inoculated IL-1β Sense TGTGATGTTCCCATTAGAC
into 96-well plates at a density of 3*103 cells/well and treated with Antisense AATACCACTTGTTGGCTTA
different concentrations of Los (0, 10− 9, 10− 8, 10− 7, 10− 6, 10− 5, 10− 4, IL-6 Sense GGAAGTTGGGGTAGGAAGGA
and 10− 3 M), while a negative control was set up to observe the effects of Antisense TGTGATGTTCCCATTAGAC
TNF Sense CCCAATCTGTGTCCTTCTAACT
the drug on cell proliferation and viability. Based on the above results,
Sense CAGCGTCTCGTGTGTTTCT
the cellular proliferation and viability tests were performed on the cells Ang II Sense GAAGACCCTGCGAGATAAGC
after LPS (10 μg/ml) intervention with the appropriate range of Los Antisense ACTGGCTACACCTCTTGCCT
concentrations. AT1 R Sense CTCAAGCCTGTCTACGAAAATGAG
Antisense GTGAATGGTCCTTTGGTCGT
ACE1 Sense AGACTTGCCTGTGACCTTTC
2.7. Cell treatment Antisense CTGTGTAGATGCTTGGGTGTAG
β-actin Sense CCCGCGAGTACAACCTTCTTG
EGCs were inoculated uniformly into well plates and divided into the Antisense GTCATCCATGGCGAACTGGTG

control, LPS, Los, and LPS + Los groups. LPS and Los were dissolved with
phosphate buffered saline (PBS). Cells were starved for 12 h at 50% cell
density. The LPS group was given 10 μg/ml LPS-treated cells (LPS− 5),
the Los group was given 10− 6 M Los-treated cells (Los− 6), the LPS + Los
group was given cells pre-treated with 10− 6 M Los for 2 h followed by
LPS (10 μg/ml)-stimulated cells (LPS− 5+Los− 6), and the control group
was given equal amounts of PBS. Afterwards, the cells were incubated at
37 ◦ C (5% CO2) for 24 h, RNA was extracted for qRT‒PCR, and protein
was extracted after 48 h of incubation and the cell supernatant was
collected for Western blotting and Enzyme-linked immunosorbent assay
(ELISA) assays, respectively.
2.8. QRT-PCR
Abbreviation: GFAP, glial fibrillary acidic protein; CGRP, calcitonin gene-related
peptide; SP, substance P; TRPV1, transient receptor potential vanilloid 1; IL-1β,
interleukin-1β; IL-6, interleukin-6; TNF, tumor necrosis factor; Ang II, angio­
tensin II; AT1R, ang II type 1 receptor; ACE1, angiotensin-converting enzyme 1.
2.10. ELISA
To assess the levels of pain mediators and inflammatory factors
released by EGC after its activation, we collected cell supernatants after
48 h of cell treatment and measured SP and IL-6 levels in the cell su­
pernatants using a rat substance P ELISA assay kit (MLBio, China) and a
rat IL-6 ELISA assay kit (Quanzhou Ruixin Biotechnology, China),
respectively, according to the manufacturer’s instructions.

Total RNA was extracted from colonic tissue or cultured EGCs using
standard methods with RNAiso-Plus (9109, Takara Biotechnology) and
reverse transcribed using a cDNA kit (Genstar, cat# A223-10). The ob­
tained cDNA was analysed by qRT‒PCR using a Thermo Fisher Scientific
Applied Biosystems 7500/7500 Fast qRT‒PCR (QuantStudio™ Design &
Analysis SE Software) detection system and 2X Universal SYBR Green
Fast qPCR Mix (ABclonal, RK21203) as follows: denaturation (95 ◦ C, 3
min) for 1 cycle and annealing (95 ◦ C, 5 s) and extension (60 ◦ C, 32 s) for
45 cycles. All experiments were repeated 3 times, and the Ct values were
normalized according to the expression of β-actin. The primer sequences
used in this study are listed in Table 1.
2.9. Western blot
2.11. IHC staining
Paraffin-embedded tissue was cut into 4 μm slices for IHC staining.
All sections were routinely dewaxed, rehydrated, and treated with goat
serum to seal non-specific binding sites. Sections were incubated over­
night at 4 ◦ C with primary antibodies against each antigen: anti-GFAP
(1:2000, Proteintech) and anti-SP (1:100, Affinity). They were then
incubated with horseradish peroxidase-coupled secondary antibodies
(1:250) for 1 h at room temperature. Immunohistochemical staining of
colon tissue sections was performed according to the instructions for the
diaminobenzidine kit (ZLI-9018, ZSGB-BIO), and five random fields of
view were examined for each sample at 400× magnification. The results
were finally analysed using ImageJ software.

Protein was extracted from rat colon tissue or EGCs by lysis in pre-
chilled RIPA lysis buffer containing 1 mM PMSF and phosphatase in­
hibitor. After electrophoresis and membrane transfer, the membranes
were closed at room temperature in 0.5% skim milk powder (P0216,
Beyotime) for 2 h and incubated overnight at 4 ◦ C with anti-GFAP
(1:5000, 4B2E10, Proteintech), anti-SP (1:1000, DF7522, Affinity),
anti-ACE1 (1:500, 24743-1-AP, Proteintech) and anti-GAPDH (1:10000,
60004-1-Ig, Proteintech), followed by 1 h of incubation at room tem­
perature with a 1:5000 dilution of horseradish peroxidase-coupled sec­
ondary antibody, and the bands were visualized using
electrochemiluminescent solution (Millipore) exposure on a BioRad
imaging system. The relative expression of each protein was determined
using ImageJ software for quantitative analysis and GAPDH as an in­
ternal reference.
2.12. IF staining
2.12.1. Tissue double IF staining
All sections were routinely dewaxed, rehydrated, permeabilized with
0.2% Triton X-100 for 10 min and then closed in PBS containing 5% goat
serum for 30 min. The expression of AT1 receptor in colon tissue EGCs
was detected by double IF staining. EGC cells were labelled with anti-
GFAP, and sections were incubated overnight at 4 ◦ C with anti-GFAP
(1:50, sc-33673, Santa Cruz Biotechnology) and anti-AT1 receptor
(1:50, Proteintech). Then, the cells were incubated with fluor488-
coupled secondary antibody (Immunoway, 1:250) and fluro568-
coupled secondary antibody (Immunoway, 1:250) for 2 h at room
temperature protected from light. Finally, the slices were stained with
DAPI for 7 min and sealed with an anti-fluorescence quencher.

3
Y. Sun et al.
2.12.2. Cellular IF staining
Cells were inoculated into 24-well plates and treated for 24 h ac­
cording to the protocol described above. Then, the cells were fixed with
4% paraformaldehyde, permeabilized and blocked as described previ­
ously, followed by incubation with anti-AT1 receptor (1:50, Pro­
teintech) at 4 ◦ C overnight. The cells were then incubated with fluro568-
coupled secondary antibody (Immunoway, 1:250) protected from light
and finally stained with DAPI and sealed with anti-fluorescence
quencher.
Tissue sections and cell crawls were observed and photographed
under a fluorescence microscope (Nikon, Japan) and analysed for fluo­
rescence intensity using ImageJ software.
2.13. Statistical analysis
Data are presented as the mean ± standard deviation (SD). One-way
or two-way analysis of variance (ANOVA) was used to compare data
between groups. GraphPad Prism 8.0 was used for statistical analysis. P
values < 0.05 were considered statistically significant.
3. Results
3.1. Los ameliorated the VMR of viscerally hypersensitive rats
The body weights of the rats were similar among groups before the
4
European Journal of Pharmacology 946 (2023) 175650
start of the enema (week 0), with no significant differences. The body
weight of the control rats was slightly higher than that of the rats in the
other 4 groups at the beginning of the first week of the acetic acid enema
treatment (p < 0.05), and the body weight of the control rats was still
slightly higher than that of the rats in the other 4 groups at 2–8 weeks,
but there was no statistically significant difference, suggesting that the
growth of rats was slightly and transiently affected during the initial
acetic acid enema, but the effect was not evident after the rats reached
adulthood. Additionally, Los treatment had no significant effect on the
growth of rats (Fig. 1A).
Assessment of the VMR revealed that with an increasing balloon
injection volume, the EMG wave amplitude and density increased
significantly in the AA group compared to the control group, with sta­
tistically significant differences between the two groups at 0.8 ml and
1.2 ml CRD (p < 0.001), suggesting successful modelling and that acetic
acid treatment in neonatal rats produces persistent visceral hypersen­
sitivity (Fig. 1B and C). After 10 days of intervention at each dosage of
Los, compared with those of the AA group, the EMG wave amplitude and
density of the AA + Los-L, AA + Los-M and AA + Los-H groups at 0.8 ml
(p AA+Los-L < 0.05, p AA+Los-M < 0.001, p AA+Los-H < 0.01) and 1.2 ml (p
AA+Los-L < 0.05, p AA+Los-M / AA+Los-H < 0.001) CRD were significantly
reduced, and the VMR reduction in the AA + Los-M group was signifi­
cantly larger than that in the AA + Los-L group at 1.2 ml CRD (p < 0.05)
(Fig. 1B and C).
Fig. 1. Effects of Los on the body weight and VMR of
viscerally hypersensitive rats. (A) Weekly changes in
the body weight of rats in each group from week 0 of
enema treatment. (B) Quantitative analysis of the ef­
fect of Los on the VMR of rats with different volumes
(0 ml, 0.4 ml, 0.8 ml, and 1.2 ml) of CRD in viscerally
hypersensitive rats. (C) Typical representative EMG
images of the effect of Los on the VMR under different
volumes (0 ml, 0.4 ml, 0.8 ml, and 1.2 ml) of CRD in
viscerally hypersensitive rats. Data are expressed as
the mean ± SD, n = 6. ns, p > 0.05; *p < 0.05, **p <
0.01 and ***p < 0.001 for Control vs. AA; #p < 0.05,
##
p < 0.01 and ###p < 0.001 for AA vs. AA + Los-L
or AA + Los-M or AA + Los –H; Δp < 0.05 AA + Los-L
vs. AA + Los-M. AA, acetic acid enema; Los-L, los­
artan low-dose; Los-M, losartan medium-dose; Los-H,
losartan high-dose; CRD, colorectal balloon dilation;
VMR, visceral motor response.
Y. Sun et al.
3.2. Los reduced the mRNA expression of colonic inflammatory factors in
viscerally hypersensitive rats
To determine whether the visceral hypersensitivity in adult rats was
due to colonic inflammation after neonatal AA enema, we performed
qRT‒PCR to assess the mRNA expression levels of the colonic tissue
inflammatory factors IL-1β, IL-6 and TNF. The mRNA expression levels
of TNF (p < 0.01) and IL-1β (p < 0.001) were significantly higher in the
colonic tissue of rats with visceral hypersensitivity than in the control
group rats, and IL-6 (p > 0.05) mRNA expression was slightly higher, but
there was no statistically significant difference. Different doses of Los
treatment all reduced TNF (p AA+Los-L / AA+Los-M < 0.05, p AA+Los-H <
0.01), IL-1β (p AA+Los-L / AA+Los-M / AA+Los-H < 0.001), and IL-6 (p AA+Los-L
< 0.05, p AA+Los-M / AA+Los-H > 0.05) mRNA expression (Fig. 2). This
result suggested an inflammatory response in the colonic tissue of
viscerally hypersensitive rats and that Los could alleviate visceral hy­
persensitivity by attenuating the inflammatory response in colonic
tissue.
3.3. Los decreased the expression of SP, CGRP, TRPV1, GFAP, and
S100β in viscerally hypersensitive rats
To investigate whether Los ameliorates the VMR in viscerally hy­
persensitive rats by reducing the expression of pain mediators in colonic
tissues, we detected and evaluated the relevant molecules using qRT‒
PCR, Western blotting and IHC. The relative expression of SP mRNA,
CGRP mRNA and TRPV1 mRNA was significantly higher in the colon
tissue of the AA group than in the control group (p SP / CGRP /
TRPV1<0.001) (Fig. 3A), and the IHC (p < 0.001) (Fig. 3C and D) and
Western blot (p < 0.001) (Fig. 3E and F) results showed that SP protein
expression was also significantly increased. SP mRNA (p AA+Los-L < 0.01,
p AA+Los-M / AA+Los-H < 0.05), CGRP mRNA (p AA+Los-L / AA+Los-M / AA+Los-
H < 0.001) and TRPV1 mRNA (p AA+Los-M < 0.01, p AA+Los-L / AA+Los-H <
0.001) expression was significantly decreased in colonic tissues
following different doses of Los treatment compared with the AA group
(Fig. 3A), while IHC (p AA+Los-L / AA+Los-M / AA+Los-H < 0.001) (Fig. 3C and
D) and Western blot (p AA+Los-M < 0.05, p AA+Los-H < 0.01) (Fig. 3E and F)
showed that SP protein expression was also significantly reduced.
To investigate whether the above effects were associated with EGC
activation, we evaluated the changes in GFAP mRNA and S100β mRNA
expression in the colonic tissues of rats in each group. The relative
expression of GFAP mRNA (p < 0.001) and S100β mRNA (p < 0.001)
Fig. 2. Los reduced the mRNA expression of colonic inflammatory factors in viscerally hypersensitive rats. Analysis of the mRNA expression of the inflammatory
factors TNF, IL-1β, and IL-6 in the colonic tissues of rats in each group. Data are expressed as the mean ± SD, n = 6. ns, p > 0.05; **p < 0.01 and ***p < 0.001 for
Control vs. AA; #p < 0.05, ##p < 0.01 and ###p < 0.001 for AA vs. AA + Los-L or AA + Los-M or AA + Los-H. AA, acetic acid enema; Los-L, losartan low-dose; Los-M,
losartan medium-dose; Los-H, losartan high-dose; TNF, tumor necrosis factor; IL-1β, interleukin-1β; IL-6, interleukin-6.
5
European Journal of Pharmacology 946 (2023) 175650
was significantly higher in the AA group than in the control group
(Fig. 3B), and IHC (p < 0.001) (Fig. 3C and D) and Western blotting (p <
0.001) (Fig. 3E and F) showed that GFAP protein expression was also
significantly increased. GFAP mRNA (p AA+Los-L < 0.05, p AA+Los-M <
0.001, p AA+Los-H < 0.01) and S100β mRNA (p AA+Los-L / AA+Los-M / AA+Los-
H < 0.001) expression was decreased in colonic tissues after different
doses of Los treatment compared with the AA group (Fig. 3B), and IHC (p
AA+Los-L < 0.05, p AA+Los-M / AA+Los-H < 0.001) (Fig. 3C and D) and
Western blot (p AA+Los-L < 0.05, p AA+Los-M / AA+Los-H < 0.001) (Fig. 3E
and F) showed that GFAP protein expression was also significantly
reduced, suggesting that the involvement of Los in regulating visceral
hypersensitivity is associated with inhibition of EGC activation.
3.4. AT1 receptor was co-localized and up-regulated with GFAP in the
colonic tissues of viscerally hypersensitive rats
To clarify the expression of RAAS components in colonic tissues, we
showed by IF double-labelling that AT1 receptor was expressed in all
layers of the colon but mainly in the mucosal layer, submucosal plexus
and intermuscular plexus and co-localized with GFAP, and both were
increased in the AA group compared with the control group (Fig. 4A).
Western blot analysis showed that the expression of ACE1 was increased
in the colon tissue of the AA group compared with the control group (p
< 0.05), and the expression of ACE1 in the colon tissue was decreased
after different doses of Los intervention compared with the AA group
(Fig. 4B and C) (p AA+Los-M / AA+Los-H < 0.05), but there was no statis­
tically significant difference between the AA + Los-L and AA groups (p
> 0.05), suggesting that Los improves visceral hypersensitivity by
modulating colonic tissue RAAS components.
3.5. Los protected EGC proliferation and viability against LPS treatment
in vitro
First, we compared the effects of different concentrations of Los
(10− 9 M to 10− 3 M) on EGC proliferation and viability (Fig. 5A). Los
treatment of EGCs for 24 h had no significant effect on EGC proliferation
and viability at 10− 9 M to 10− 4 M (p > 0.05), while it significantly
inhibited EGC proliferation at 10− 3 M (p < 0.001). At 48 h, Los had no
significant effect on EGC proliferation and viability at low concentra­
tions (10− 9 M to 10− 6 M) (p > 0.05), while it significantly inhibited
these variables at 10− 5 M to 10− 3 M (p −105 < 0.01, p −104 −/ 310 < 0.001).
Next, we examined the effects of different concentrations of Los
Y. Sun et al. European Journal of Pharmacology 946 (2023) 175650

Fig. 3. Los reduced pain mediators and EGC activation markers in the colons of viscerally hypersensitive rats. (A) Analysis of the mRNA expression of the pain
mediators SP, CGRP, and TRPV1 in each group of rats. (B) Analysis of the mRNA expression of the EGC activation markers GFAP and S100β in each group. (C)
Representative images (400× magnification, scale bar = 50 μm) of IHC for SP (indicated in brown) and GFAP (indicated in brown) in each group of rats. (D) The
mean optical density of SP and GFAP (mean density: IOD/area) was analysed using ImageJ. (E) Representative images of SP and GFAP protein expression detected by
Western blot. (F) Quantitative analysis of Western blot results for SP and GFAP. The results are presented as the mean ± SD, n = 6. ***p < 0.001 for Control vs. AA;
#
p < 0.05, ##p < 0.01 and ###p < 0.001 for AA vs. AA + Los-L or AA + Los-M or AA + Los-H. AA, acetic acid enema; Los-L, losartan low-dose; Los-M, losartan
medium-dose; Los-H, losartan high-dose; SP, substance P; CGRP, calcitonin gene-related peptide; TRPV1, transient receptor potential vanilloid 1; GFAP, glial
fibrillary acidic protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

(10− 7 M to 10− 5 M) on the proliferation and viability of LPS (10 ug/ml)-
treated cells (Fig. 5B). The proliferation and viability of EGCs were
partially inhibited by LPS treatment at 24 h (p < 0.05) and significantly
inhibited at 48 h and 72 h (p < 0.001). In contrast, Los inhibited this
adverse effect, and both 10− 7 M and 10− 5 M concentrations had a pro­
tective effect on EGC proliferation and viability at 24 h (p < 0.05), while
10− 6 M also showed partial protection, but the difference was not sta­
tistically significant (p = 0.105). At 48 h, all three concentrations from
10− 7 M to 10− 5 M had a significant protective effect on EGC prolifera­
tion and viability (p < 0.001), and there were no significant differences
between the three concentrations (p > 0.05). At 72 h, all three con­
centrations from 10− 7 M to 10− 5 M had a significant protective effect on
EGC proliferation and viability, and both 10− 7 M and 10− 6 M were
significantly better than 10− 5 M (p −vs.
7
5 − 5
6
10 10< 0.001, p vs.
10 10< 0.001). Based
− 6
on this, a concentration of 10 M was used for the subsequent experi­
mental study in this study.
3.6. Los inhibited the activation of EGCs induced by LPS
As mentioned previously, EGC activation plays an important role in
IBS visceral hypersensitivity. To investigate whether Los can reduce EGC
activation, we performed qRT‒PCR, revealing that EGCs were signifi­
cantly activated by LPS treatment, and the mRNA expression of its
activation markers GFAP and S100β was significantly increased (p <
0.001), while the expression of both was significantly decreased after
pre-treatment with Los (p < 0.001) (Fig. 6A). Subsequently, we further
verified by Western blot that Los significantly reduced the expression
level of GFAP protein induced by LPS activation of EGCs (p < 0.01)
(Fig. 6B and C).
3.7. Los reduced LPS-induced pain mediators production and release
following EGC activation
Pain mediators play an important role in visceral hypersensitivity in
relation to IBS, and to investigate whether Los could reduce the pro­
duction of pain mediators in EGCs, we performed relevant validation

6
Y. Sun et al. European Journal of Pharmacology 946 (2023) 175650

Fig. 4. Localization and expression of AT1 receptor

and ACE1 in the colonic tissues of viscerally hyper­
sensitive rats. (A) Representative images of GFAP and
AT1 receptor IF co-localization in colon tissues of the
control and AA groups (green fluorescence indicates
GFAP-positive cells, red fluorescence indicates AT1
receptor-positive cells; 200 × magnification; scale
bar = 100 μm). (B) Representative image of Western
blot to detect ACE1 protein expression. (C) Quanti­
tative analysis of Western blot results for ACE1. The
results are presented as the mean ± SD, n = 6. *p <
0.05 for Control vs. AA; #p < 0.05 for AA vs. AA +
Los-M or AA + Los-H. AA, acetic acid enema; Los-L,
losartan low-dose; Los-M, losartan medium-dose;
Los-H, losartan high-dose; SP, substance P; GFAP,
glial fibrillary acidic protein; AT1R, ang II type 1 re­
ceptor; DAPI, 4′ ,6-diamidino-2′ -phenylindole; ACE1,
angiotensin-converting enzyme 1; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase.

Fig. 5. Los protected cell proliferation and viability

against LPS treatment in vitro. (A) CCK-8 analysis was
used to detect the effect of different concentrations
(10− 9 M to 10− 3 M) of Los on EGC proliferation and
viability at 24 h and 48 h. (B) Proliferation and
viability analysis of EGCs pre-treated with 10− 7, 10− 6
and 10− 5 M Los for 2 h, followed by LPS (10 μg/ml)
treatment of EGCs for 24 h, 48 h and 72 h, respec­
tively. Data are presented as the mean ± SD, n = 3.
ns, p > 0.05; **p < 0.01 and ***p < 0.001 for Control
vs. Los; &&p < 0.01 and &&&p < 0.001 for Control vs.
LPS− 5; ∇p < 0.05 and ∇∇∇p < 0.001 for LPS− 5 vs.
LPS− 5+Los− 7; ###p < 0.001 for LPS− 5 vs.
LPS− 5+Los− 6; up < 0.05 and uuup <0.001 for LPS− 5
vs. LPS− 5+Los− 5. LPS, lipopolysaccharide; Los,
losartan.

Fig. 6. Los (10− 6 M) inhibited LPS-induced (10 μg/ml) EGC activation. (A) Analysis of the mRNA expression of GFAP and S100β in each group of EGCs. (B)
Representative image of GFAP protein expression detected by Western blot. (C) Quantitative analysis of the Western blot results for GFAP. Data are presented as the
mean ± SD, n = 3. **p < 0.01 and ***p < 0.001 for Control vs. LPS− 5; ##p < 0.01 and ###p < 0.001 for LPS− 5 vs. Los− 6 or LPS− 5+Los− 6. LPS, lipopolysaccharide;
Los, losartan; GFAP, glial fibrillary acidic protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

using qRT‒PCR, Western blotting and ELISA. The results suggested that the protein level, the results showed that LPS treatment significantly
at the mRNA level, both CGRP mRNA and TRPV1 mRNA were signifi­ increased SP protein expression (p < 0.001) and release (p < 0.001), and
cantly increased in EGCs post-LPS treatment (p < 0.001), and Los Los inhibited its expression (p < 0.01) (Fig. 7B and C) and release (p <
significantly decreased the expression of both (p < 0.001) (Fig. 7A). At 0.01) (Fig. 7D).

7
Y. Sun et al.
Fig. 7. Los (10− 6 M) reduced the expression of pain mediators following LPS (10 μg/ml)-induced EGC activation. (A) Analysis of the mRNA expression of CGRP and
TRPV1 in each group of EGCs. (B) Representative image of SP protein expression detected by Western blot. (C) Quantitative analysis of SP by Western blot. (D) The
concentration of SP in each group of cell supernatant by ELISA. Data are presented as the mean ± SD, n = 3. ***p < 0.001 for Control vs. LPS− 5; ##p < 0.01 and ###p
< 0.001 for LPS− 5 vs. Los− 6 or LPS− 5+Los− 6. LPS, lipopolysaccharide; Los, losartan; GFAP, glial fibrillary acidic protein; TRPV1, transient receptor potential vanilloid
1; CGRP, calcitonin gene-related peptide; SP, substance P; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
3.8. Los inhibited LPS-induced upregulation of the ACE1/Ang II/AT1
receptor axis post-EGC activation
To investigate whether Los regulates IBS visceral hypersensitivity by
affecting the changes in RAAS components in EGCs, we verified the
results by qRT‒PCR, IF and Western blotting. The results suggested that
at the mRNA level, the expression levels of ACE1 mRNA, Ang II mRNA
and AT1 receptor mRNA in EGCs post-LPS treatment were significantly
increased (p < 0.001), while Los treatment significantly decreased the
expression of the above molecules (p Ang II < 0.05, p ACE1 / AT1 receptor <
0.001) (Fig. 8A). At the protein level, by IF, we also found that LPS
significantly increased the expression level of AT1 receptor in EGCs (p <
0.001), while Los treatment reversed this effect (p < 0.001) (Fig. 8B and
C). By Western blotting, we further confirmed that LPS treatment
significantly increased ACE1 protein expression (p < 0.01), while this
effect could be inhibited by Los (p < 0.05) (Fig. 8D and E).
3.9. Los reduced LPS-induced inflammatory factors expression and
release post-EGC activation
Inflammation is closely related to IBS-related visceral hypersensi­
tivity; therefore, we finally explored whether Los could reduce the
production and release of inflammatory factors in EGCs. We found that
both TNF mRNA and IL-6 mRNA were significantly increased in EGCs
post-LPS treatment (p TNF < 0.001, p IL-6 < 0.01) by qRT‒PCR assay, and
Los significantly reduced the expression of both (p < 0.001) (Fig. 9A).
Further by ELISA of the cell supernatant, we found that IL-6 release was
also significantly increased after EGCs activation (p < 0.001), which was
inhibited by Los (p < 0.001) (Fig. 9B). These results suggest that Los
improves IBS-related visceral hypersensitivity by reducing the produc­
tion and release of inflammatory factors after the activation of EGCs.
4. Discussion
The acetic acid enema-induced colonic hypo-inflammation model is
often used to explore the visceral hypersensitivity associated with IBS.
The present study shows for the first time that Los administration re­
duces visceral hypersensitivity in IBS rats, which may be caused by in­
hibition of EGC activation in colonic tissues. In combination with
cellular experiments, it was hypothesized that acetic acid enema
induced visceral hypersensitivity in relation to IBS, EGC activation and
RAAS activation and increased Ang II secretion in EGCs and binding to
AT1 receptor, resulting in the release of pro-inflammatory cytokines
such as TNF, IL-1β and IL-6 from EGCs and thus aggravating EGC acti­
vation. At the same time, EGC activation leads to overexpression of the
pain mediators SP, TRPV1, and CGRP, causing visceral hypersensitivity
in association with IBS.
8
European Journal of Pharmacology 946 (2023) 175650
Some researchers have proposed that infusion of dilute acetic acid in
rats during 8–21 days after birth produces sustained visceral hypersen­
sitivity with little apparent injury or inflammation (Qian et al., 2009).
The same modelling method was used in this study. Since there are sex
differences in visceral hypersensitivity in IBS (Mayer et al., 2004), we
used only male rats to avoid such differences. After adulthood, rats with
acetic acid enema exhibited significantly increased sensitivity to CRD
compared to that of the control group, which is consistent with previous
findings (Qian et al., 2009), suggesting that the visceral hypersensitivity
model of IBS rats was successfully constructed. While different doses of
Los could reduce visceral hypersensitivity in IBS rats, we further
explored the potential mechanism.
Abnormal activation of EGCs is associated with visceral sensitivity
and intestinal barrier function (Long et al., 2018; Meira De-Faria et al.,
2021). One study found increased expression of pro-inflammatory cy­
tokines such as IL-1β and TNF when treating intestinal epithelial cells
with reactive EGC-conditioned medium, which may lead to leaky gut
microenvironment. Furthermore, the reactive EGC phenotype may also
increase DNA breaks through increased inflammation and reactive ox­
ygen species production (Kimono et al., 2019), leading to programmed
cell death of EGC (Macchioni et al., 2017), which ultimately leads to
abnormal sensory function from malfunctioning intestinal neurons
(Bassotti et al., 2018). In the present study, we found that Los reduced
the expression of GFAP and S100β as well as SP, TRPV1 and CGRP in
colonic tissues of viscerally hypersensitive rats, suggesting that Los may
alleviate visceral hypersensitivity in IBS rats by inhibiting the activation
of EGCs and thus reducing the secretion of pain mediators. This phe­
nomenon was further confirmed in in vitro experiments. In addition, we
found that cell proliferation viability was significantly inhibited after
LPS treatment of EGC, especially at 48h and 72h, while Los significantly
suppressed this adverse effect. Some previous studies have shown that
LPS stimulates glial cells to proliferate responsively (de Almeida et al.,
2020), while others have shown that LPS inhibits their proliferation and
induces apoptosis (Letournel-Boulland et al., 1994; Wang et al., 2018;
Xu et al., 2008). It is speculated that the differences between the results
of different studies may be due to differences in the time and dose of
intervention.
There is growing evidence that the binding of Ang II to AT1 receptor
is involved in the regulation of pain (Marques-Lopes et al., 2009). Ang II
has been found to act selectively on non-peptidergic C-fibre neurons,
CGRP + nerve endings and myelinated fibres (Benitez et al., 2020). It
was found that CGRP + neurons in the DRG express AT1 receptors in an
inflammatory environment and that the number of CGRP + neurons was
significantly reduced after Los administration (Benitez et al., 2020). In
the present experiments, we found that AT1 receptors were co-localized
and positively correlated with GFAP in rat colonic tissues, while ACE1
expression levels were significantly increased in colonic tissues of
Y. Sun et al. European Journal of Pharmacology 946 (2023) 175650

Fig. 8. Los (10− 6 M) reduced the expression of RAAS-related molecules following LPS-induced (10 μg/ml) EGC activation. (A) Analysis of the mRNA expression of
Ang II, AT1 receptor, and ACE1 in each group of EGCs. (B) Representative IF images of AT1 receptor expression in each group of EGCs (red fluorescence indicates
AT1 receptor-positive cells; 200 × magnification; scale bar = 100 μm). (C) The mean fluorescence density of AT1 receptor-positive staining was analysed using
ImageJ software. (D) Representative image of Western blot used to detect ACE1 protein expression. (E) Quantitative analysis of Western blot results for ACE1. Data
are presented as the mean ± SD, n = 3. **p < 0.01 and ***p < 0.001 for Control vs. LPS− 5; #p < 0.05, ##p < 0.01 and ###p < 0.001 for LPS− 5 vs. Los− 6 or
LPS− 5+Los− 6. LPS, lipopolysaccharide; Los, losartan; ACE1, angiotensin-converting enzyme 1; Ang II, angiotensin II; AT1R, ang II type 1 receptor; DAPI, 4′ ,6-dia­
midino-2′ -phenylindole; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

9
Y. Sun et al.
visceral hypersensitive rats compared to control rats, which combined
with increased expression of ACE1, AngII and AT1R in activated EGCs in
in vitro experiments, suggesting the presence of AT1 receptor expression
in colonic tissue EGCs of visceral hypersensitive rats and upregulation of
the ACE1/Ang II/AT1 receptor axis. One study revealing that the
ACE1/Ang II/AT1 receptor axis is highly expressed in inflammatory
bowel disease colon tissue (Jacobs et al., 2019), and that low inflam­
mation is also present in IBS colon tissue (Grabauskas et al., 2022) seems
to provide evidence supporting the possible involvement of colonic local
RAAS in the development of IBS. Pain mediators and inflammatory
factor signals in the gut wall are sensed by extrinsic, primary afferent
neurons with cell bodies in the DRG. The signals are transduced via
secondary neurons in the spinal cord to different somatosensory areas in
the brain and are processed by the central nervous system to produce the
corresponding sensations (Vermeulen et al., 2014). Sensitization of ion
channels such as TRPV1 in submucosal neurons of the colon that
perceive toxic stimuli by bioactive substances released within the gut
wall and the release of pain mediators such as CGRP and SP can lead to
visceral hypersensitivity (Anand et al., 2007; Tang et al., 2022, 2022van
Wanrooij et al., 2014; Wouters et al., 2016). In the present study, we
found that Los decreased the expression of ACE1 as well as pain medi­
ators TRPV1, CGRP and SP in colonic tissue of visceral hypersensitive
rats and EGC, and it is reasonable to speculate that Los may attenuate
visceral afferent nerve sensitivity by inhibiting AT1 receptors to reduce
visceral hypersensitivity.
Inflammation can induce and sustain pain development, and the
release of inflammatory factors and chemokines may sensitize periph­
eral nerves and participate in pain development, with these substances
being further released by the glial cells themselves (Ebersberger, 2018).
It has been shown that in a rat model of nerve crush and transection, AT1
receptor blockers can improve nerve healing and thus relieve neuro­
pathic pain by inhibiting the production of IL-1β and caspase-3 (Yuksel
et al., 2015). The MAPK and NF-κBp65 pathways are two classical in­
flammatory pathways. ACE1/Ang II/AT1 receptor axis activation is
usually accompanied by activation of the MAPK pathway (Wenzel et al.,
2001), and MAPK pathway activation induces and exacerbates inflam­
matory responses and pain development (Ji et al., 2009; PARK et al.,
2009). Los has been found to reduce tissue inflammatory damage by
decreasing MAPK and NF-κBp65 activation in a variety of inflammatory
injury-related models (Abdel-Latif et al., 2020; Wang et al., 2019). Los
can also have an analgesic effect on neuropathic pain by inhibiting
MAPK and NF-κBp65 activation and the production of inflammatory
factors such as TNF and IL-6 (Hegazy et al., 2020b; Kalynovska et al.,
2020). Many studies have suggested that inflammatory factors such as
TNF, IL-1β, and IL-6 are significantly increased in colorectal tissues of
IBS rats (Gwee et al., 2003; Lee et al., 2017), and the hyperinflammatory
state can activate EGCs to further secrete inflammatory factors (Stoffels
et al., 2014), sensitizing the ENS and ultimately promoting visceral
10
European Journal of Pharmacology 946 (2023) 175650
Fig. 9. Los (10− 6 M) reduced the level of inflamma­
tory factors after LPS-induced (10 μg/ml) EGC acti­
vation. (A) Analysis of mRNA expression of the
inflammatory factors TNF and IL-6 in each group of
EGCs. (B) The concentration of IL-6 in each group of
cell supernatant by ELISA. Data are presented as the
mean ± SD, n = 3. **p < 0.01 and ***p < 0.001 for
Control vs. LPS− 5; ##p < 0.01 and ###p < 0.001 for
LPS− 5 vs. Los− 6 or LPS− 5+Los− 6. LPS, lipopolysac­
charide; Los, losartan; TNF, tumor necrosis factor; IL-
6, interleukin-6.
hypersensitivity in relation to IBS. In addition, it was found that in­
flammatory cytokines activate p38 MAPK, leading to increased expres­
sion of injurious ion channels and transport to peripheral nerves, leading
to long-term afferent nerve sensitization and inflammatory pain (Ji
et al., 2002; Linley et al., 2010). In contrast, Los attenuates oxidative
stress and reduces neuroinflammation and cell death (Abdul-Muneer
et al., 2018). In this study, Los inhibited the elevation of IL-1β, IL-6 and
TNF in colonic tissues of viscerally hypersensitive rats and EGCs.
Therefore, we speculate that Los attenuates the inflammatory response
and inhibits EGC activation by blocking the ACE1/Ang II/AT1 receptor
axis and consequently reduces visceral hypersensitivity in IBS rats,
which may involve inhibition of MAPK and NF-κBp65 pathways. Su­
pernatants from mucosal biopsies of IBS patients were found to sensitize
colon-injurious DRG neurons (Valdez-Morales et al., 2013; Wouters
et al., 2016), and blocking AT1 receptor attenuates the inflammatory
response to DRG (Kalynovska et al., 2020; Kim et al., 2019). Therefore,
losartan may alleviate visceral hypersensitivity by attenuating the in­
flammatory response in the central nervous system.
We verified the protective effect of Los on visceral hypersensitivity in
IBS rats by in vivo treatment with different doses of Los and in vitro ex­
periments. However, there are still shortcomings in this study. In the
present experiment, rats were treated with 10, 25, and 50 mg/kg/d, the
usual doses of Los in previous studies, and although all three doses
showed protective effects, they did not exhibit a significant dose-
dependence, presumably related to the complex visceral hypersensitiv­
ity mechanism of IBS and insufficient sample size. Since the mechanism
of visceral hypersensitivity associated with IBS is complex, including
neuroendocrine mediators, intestinal flora and mucosal hypo-
inflammation, the results of this study are limited to the rat model of
acetic acid enema and need to be further validated in other IBS models
and different species, including clinical specimens.
5. Conclusion
The present study shows for the first time that the ACE1/Ang II/AT1
receptor axis is upregulated in the colon tissue EGCs of rats with IBS-
related visceral hypersensitivity and that Los significantly ameliorates
the visceral hypersensitivity induced by acetic acid enema, possibly by
mediating AT1 receptor on colon tissue EGCs. Therefore, inhibition of
the ACE1/Ang II/AT1 receptor axis may be an effective therapeutic
target for alleviating visceral hypersensitivity in relation to IBS, which
provides a new therapeutic strategy for the clinical treatment of IBS.
Ethics statement
The animal study was reviewed and approved by the Ethics Com­
mittee of Xi’an Jiaotong University.
Y. Sun et al.
Funding
The research was funded by National Natural Science Foundation of
China (NSFC: 81770540).
CRediT authorship contribution statement
Yating Sun: Conceptualization, Data curation, Formal analysis,
Investigation, Writing – original draft. Xiaohui Liu: Investigation,
Methodology, Validation, Writing – original draft. Lianli Wang: Inves­
tigation, Validation, Software. Laifu Li: Investigation, Data curation.
Xiaojing Quan: Formal analysis, Visualization. Haitao Shi: Conceptu­
alization, Supervision. Ting Wang: Conceptualization, Visualization.
Lin Mei: Methodology, Software. Yindi Chen: Supervision. Yue Zhang:
Methodology. Jingyao Li: Visualization. Ruiting Meng: Validation.
Jinhai Wang: Writing – review & editing. Fei Dai: Conceptualization,
Supervision, Writing – review & editing, Funding acquisition.
Declaration of competing interest
The authors declare that the research was conducted in the absence
of any commercial or financial relationships that could be construed as a
potential conflict of interest.
Data availability
Data will be made available on request.
Acknowledgements
Special thanks to the Brain Science Research Center of the First
Affiliated Hospital of Xi’an Jiaotong University for providing us with
EGC (ATCC).
References
Abdel-Latif, G.A., Elwahab, A.H.A., Hasan, R.A., ElMongy, N.F., Ramzy, M.M., Louka, M.
L., Schaalan, M.F., 2020. A novel protective role of sacubitril/valsartan in
cyclophosphamide induced lung injury in rats: impact of miRNA-150-3p on NF-κB/
MAPK signaling trajectories. SCI REP-UK 10, 13045. https://doi.org/10.1038/
s41598-020-69810-5.
Abdul-Muneer, P.M., Bhowmick, S., Briski, N., 2018. Angiotensin II causes neuronal
damage in stretch-injured neurons: protective effects of losartan, an angiotensin T1
receptor blocker. Mol. Neurobiol. 55, 5901–5912. https://doi.org/10.1007/s12035-
017-0812-z.
Akazawa, Y., Fujioka, T., Ide, H., Yazaki, K., Honjo, O., Sun, M., Friedberg, M.K., 2021.
Impaired right and left ventricular function and relaxation induced by pulmonary
regurgitation are not reversed by tardive antifibrosis treatment. Am J Physiol-Heart
C 321, H38–H51. https://doi.org/10.1152/ajpheart.00467.2020.
Akbar, A., Yiangou, Y., Facer, P., Walters, J.R.F., Anand, P., Ghosh, S., 2008. Increased
capsaicin receptor TRPV1-expressing sensory fibres in irritable bowel syndrome and
their correlation with abdominal pain. Gut 57, 923. https://doi.org/10.1136/
gut.2007.138982.
Anand, P., Aziz, Q., Willert, R., Van Oudenhove, L., 2007. Peripheral and central
mechanisms of visceral sensitization in man. Neuro Gastroenterol. Motil. 19, 29–46.
https://doi.org/10.1111/j.1365-2982.2006.00873.x.
Anand, U., Yiangou, Y., Sinisi, M., Fox, M., MacQuillan, A., Quick, T., Korchev, Y.E.,
Bountra, C., McCarthy, T., Anand, P., 2015. Mechanisms underlying clinical efficacy
of angiotensin II type 2 receptor (AT2R) antagonist EMA401 in neuropathic pain:
clinical tissue and in vitro studies. Mol. Pain 11, s12915–s12990. https://doi.org/
10.1186/s12990-015-0038-x.
Bali, A., Singh, N., Jaggi, A.S., 2014. Renin–angiotensin system in pain: existing in a
double life? J RENIN-ANGIO-ALDO S 15, 329–340. https://doi.org/10.1177/
1470320313503694.
Bassotti, G., Macchioni, L., Corazzi, L., Marconi, P., Fettucciari, K., 2018. Clostridium
difficile-related postinfectious IBS: a case of enteroglial microbiological stalking
and/or the solution of a conundrum? Cell. Mol. Life Sci. 75, 1145–1149. https://doi.
org/10.1007/s00018-017-2736-1.
Benitez, S.G., Seltzer, A.M., Messina, D.N., Foscolo, M.R., Patterson, S.I., Acosta, C.G.,
2020. Cutaneous inflammation differentially regulates the expression and function
of Angiotensin-II types 1 and 2 receptors in rat primary sensory neurons.
J. Neurochem. 152, 675–696. https://doi.org/10.1111/jnc.14848.
Collister, J.P., Hornfeldt, B.J., Osborn, J.W., 1996. Hypotensive response to losartan in
normal rats. Hypertension 27, 598–606. https://doi.org/10.1161/01.HYP.27.3.598.
11
European Journal of Pharmacology 946 (2023) 175650
de Almeida, M., Souza, C., Dourado, N.S., Da, S.A., Ferreira, R.S., David, J.M., David, J.
P., Costa, M., Da, S.V., Butt, A.M., Costa, S.L., 2020. Phytoestrogen agathisflavone
ameliorates neuroinflammation-induced by LPS and IL-1β and protects neurons in
cocultures of glia/neurons. Biomolecules 10. https://doi.org/10.3390/
biom10040562.
Ebersberger, A., 2018. The analgesic potential of cytokine neutralization with
biologicals. Eur. J. Pharmacol. 835, 19–30. https://doi.org/10.1016/j.
ejphar.2018.07.040.
Grabauskas, G., Gao, J., Wu, X., Zhou, S.Y., Turgeon, D.K., Owyang, C., 2022. Gut
microbiota alter visceral pain sensation and inflammation via modulation of
synthesis of resolvin D1 in colonic tuft cells. Gastroenterology. https://doi.org/
10.1053/j.gastro.2022.07.053.
Grubišić, V., Gulbransen, B.D., 2017. Enteric glia: the most alimentary of all glia.
J. Physiol. 595, 557–570. https://doi.org/10.1113/JP271021.
Gwee, K., Collins, S.M., Read, N.W., Rajnakova, A., Deng, Y., Graham, J.C.,
McKendrick, M.W., Moochhala, S.M., 2003. Increased rectal mucosal expression of
interleukin 1β in recently acquired post-infectious irritable bowel syndrome. Gut 52,
523. https://doi.org/10.1136/gut.52.4.523.
Hegazy, N., Rezq, S., Fahmy, A., 2020a. Renin-angiotensin system blockade modulates
both the peripheral and central components of neuropathic pain in rats: role of
calcitonin gene–related peptide, substance P and nitric oxide. Basic Clin Pharmacol
127, 451–460. https://doi.org/10.1111/bcpt.13453.
Hegazy, N., Rezq, S., Fahmy, A., 2020b. Mechanisms involved in superiority of
angiotensin receptor blockade over ACE inhibition in attenuating neuropathic pain
induced in rats. Neurotherapeutics 17, 1031–1047. https://doi.org/10.1007/
s13311-020-00912-8.
Jacobs, J.D., Wagner, T., Gulotta, G., Liao, C., Li, Y.C., Bissonnette, M., Pekow, J., 2019.
Impact of angiotensin II signaling blockade on clinical outcomes in patients with
inflammatory bowel disease. Digest. Dis. Sci. 64, 1938–1944. https://doi.org/
10.1007/s10620-019-5474-4.
Ji, R., Gereau, R.W., Malcangio, M., Strichartz, G.R., 2009. MAP kinase and pain. Brain
Res. Rev. 60, 135–148. https://doi.org/10.1016/j.brainresrev.2008.12.011.
Ji, R., Samad, T.A., Jin, S., Schmoll, R., Woolf, C.J., 2002. p38 MAPK activation by NGF
in primary sensory neurons after inflammation increases TRPV1 levels and maintains
heat hyperalgesia. Neuron 36, 57–68. https://doi.org/10.1016/S0896-6273(02)
00908-X.
Kalynovska, N., Diallo, M., Sotakova-Kasparova, D., Palecek, J., 2020. Losartan
attenuates neuroinflammation and neuropathic pain in paclitaxel-induced peripheral
neuropathy. J. Cell Mol. Med. 24, 7949–7958. https://doi.org/10.1111/
jcmm.15427.
Karnik, S.S., Unal, H., Kemp, J.R., Tirupula, K.C., Eguchi, S., Vanderheyden, P.M.L.,
Thomas, W.G., Ohlstein, E.H., 2015. International union of basic and clinical
pharmacology. XCIX. Angiotensin receptors: interpreters of pathophysiological
angiotensinergic stimuli. Pharmacol. Rev. 67, 754. https://doi.org/10.1124/
pr.114.010454.
Keszthelyi, D., Troost, F.J., Masclee, A.A., 2012. Irritable Bowel Syndrome: methods,
Mechanisms, and Pathophysiology. Methods to assess visceral hypersensitivity in
irritable bowel syndrome. Am J PhysioL-Gastr l 303, G141–G154. https://doi.org/
10.1152/ajpgi.00060.2012.
Kim, E., Hwang, S., Kim, H., Abdi, S., Kim, H.K., 2019. Losartan, an angiotensin II type 1
receptor antagonist, alleviates mechanical hyperalgesia in a rat model of
chemotherapy-induced neuropathic pain by inhibiting inflammatory cytokines in the
dorsal root ganglia. Mol. Neurobiol. 56, 7408–7419. https://doi.org/10.1007/
s12035-019-1616-0.
Kimono, D., Sarkar, S., Albadrani, M., Seth, R., Bose, D., Mondal, A., Li, Y., Kar, A.N.,
Nagarkatti, M., Nagarkatti, P., Sullivan, K., Janulewicz, P., Lasley, S., Horner, R.,
Klimas, N., Chatterjee, S., 2019. Dysbiosis-associated enteric glial cell immune-
activation and redox imbalance modulate tight junction protein expression in gulf
war illness pathology. Front. Physiol. 10, 1229. https://doi.org/10.3389/
fphys.2019.01229. eCollection 2019.
Lee, J.Y., Kim, N., Nam, R.H., Sohn, S.H., Lee, S.M., Choi, D., Yoon, H., Kim, Y.S., Lee, H.
S., Lee, D.H., 2017. Probiotics reduce repeated water avoidance stress-induced
colonic microinflammation in Wistar rats in a sex-specific manner. PLoS One 12,
e188992. https://doi.org/10.1371/journal.pone.0188992.
Letournel-Boulland, M.L., Fages, C., Rolland, B., Tardy, M., 1994. Lipopolysaccharides
(LPS), up-regulate the IL-1-mRNA and down-regulate the glial fibrillary acidic
protein (GFAP) and glutamine synthetase (GS)-mRNAs in astroglial primary cultures.
Eur. Cytokine Netw. 5, 51–56.
Linley, J.E., Rose, K., Ooi, L., Gamper, N., 2010. Understanding inflammatory pain: ion
channels contributing to acute and chronic nociception. Pflueg. Arch. Eur. J. Physiol.
459, 657–669. https://doi.org/10.1007/s00424-010-0784-6.
Long, X., Li, M., Li, L.X., Sun, Y.Y., Zhang, W.X., Zhao, D.Y., Li, Y.Q., 2018. Butyrate
promotes visceral hypersensitivity in an IBS-like model via enteric glial cell-derived
nerve growth factor. Neuro Gastroenterol. Motil. 30, e13227 https://doi.org/
10.1111/nmo.13227.
Macchioni, L., Davidescu, M., Fettucciari, K., Petricciuolo, M., Gatticchi, L., Gioè, D.,
Villanacci, V., Bellini, M., Marconi, P., Roberti, R., Bassotti, G., Corazzi, L., 2017.
Enteric glial cells counteract Clostridium difficile Toxin B through a NADPH
oxidase/ROS/JNK/caspase-3 axis, without involving mitochondrial pathways. SCI
REP-UK 7, 45569. https://doi.org/10.1038/srep45569.
Marques-Lopes, J., Pinto, M., Pinho, D., Morato, M., Patinha, D., Albino-Teixeira, A.,
Tavares, I., 2009. Microinjection of angiotensin II in the caudal ventrolateral
medulla induces hyperalgesia. Neuroscience 158, 1301–1310. https://doi.org/
10.1016/j.neuroscience.2008.11.044.
Y. Sun et al.
Mayer, E.A., Berman, S., Chang, L., Naliboff, B.D., 2004. Sex-based differences in
gastrointestinal pain. Eur. J. Pain 8, 451–463. https://doi.org/10.1016/j.
ejpain.2004.01.006.
Meira De-Faria, F., Casado-Bedmar, M., Mårten Lindqvist, C., Jones, M.P., Walter, S.A.,
Keita, Å.V., 2021. Altered interaction between enteric glial cells and mast cells in the
colon of women with irritable bowel syndrome. Neuro Gastroenterol. Motil. 33,
e14130 https://doi.org/10.1111/nmo.14130.
Nemoto, W., 2018. Behavioral and molecular pharmacological study of the role of
angiotensin II in spinal pain transmission. Yakugaku Zasshi 138, 1235–1240.
https://doi.org/10.1248/yakushi.18-00124.
Nozu, T., Miyagishi, S., Nozu, R., Takakusaki, K., Okumura, T., 2017. Repeated water
avoidance stress induces visceral hypersensitivity: role of interleukin-1, interleukin-
6, and peripheral corticotropin-releasing factor. J Gastroen Hepatol. 32, 1958–1965.
https://doi.org/10.1111/jgh.13787.
Obukhov, A.G., Stevens, B.R., Prasad, R., Li Calzi, S., Boulton, M.E., Raizada, M.K.,
Oudit, G.Y., Grant, M.B., 2020. SARS-CoV-2 infections and ACE2: clinical outcomes
linked with increased morbidity and mortality in individuals with diabetes. Diabetes
69, 1875–1886. https://doi.org/10.2337/dbi20-0019.
Ogata, Y., Nemoto, W., Nakagawasai, O., Yamagata, R., Tadano, T., Tan-No, K., 2016.
Involvement of spinal angiotensin II system in streptozotocin-induced diabetic
neuropathic pain in mice. Mol. Pharmacol. 90, 205. https://doi.org/10.1124/
mol.116.104133.
Park, H.S., Kim, S.R., Lee, Y.C., 2009. Impact of oxidative stress on lung diseases.
Respirology 14, 27–38. https://doi.org/10.1111/j.1440-1843.2008.01447.x.
Patil, J., Schwab, A., Nussberger, J., Schaffner, T., Saavedra, J.M., Imboden, H., 2010.
Intraneuronal angiotensinergic system in rat and human dorsal root ganglia. Regul.
Pept. 162, 90–98. https://doi.org/10.1016/j.regpep.2010.03.004.
Pusceddu, M.M., Gareau, M.G., 2018. Visceral pain: gut microbiota, a new hope?
J. Biomed. Sci. 25, 73. https://doi.org/10.1186/s12929-018-0476-7.
Qian, A., Liu, X., Yao, W., Wang, H., Sun, J., Zhou, L., Yuan, Y., 2009. Voltage-gated
potassium channels in IB4-positive colonic sensory neurons mediate visceral
hypersensitivity in the rat. Off. J. Am. College Gastroenterol. ¦ ACG 104, 2014–2027.
https://doi.org/10.1038/ajg.2009.227.
Sengupta, J.N., 2009. Visceral pain: the neurophysiological mechanism. In: Canning, B.
J., Spina, D. (Eds.), Sensory Nerves. Springer Berlin Heidelberg, Berlin, Heidelberg,
pp. 31–74. https://doi.org/10.1007/978-3-540-79090-7_2.
Shi, H., Liu, C., Ding, L., Zheng, Y., Fei, X., Lu, L., Zhou, X., Yuan, J., Xie, J., 2015.
Alterations in serotonin, transient receptor potential channels and protease-activated
receptors in rats with irritable bowel syndrome attenuated by Shugan decoction.
World J. Gastroenterol.: WJG 21, 4852. https://doi.org/10.3748/wjg.v21.i16.4852.
Shi, Y., Liu, T., He, L., Dougherty, U., Chen, L., Adhikari, S., Alpert, L., Zhou, G., Liu, W.,
Wang, J., Deb, D.K., Hart, J., Liu, S.Q., Kwon, J., Pekow, J., Rubin, D.T., Zhao, Q.,
Bissonnette, M., Li, Y.C., 2016. Activation of the renin-angiotensin system promotes
colitis development. SCI REP-UK 6, 27552. https://doi.org/10.1038/srep27552.
Stoffels, B., Hupa, K.J., Snoek, S.A., van Bree, S., Stein, K., Schwandt, T., Vilz, T.O.,
Lysson, M., Veer, C.V., Kummer, M.P., Hornung, V., Kalff, J.C., de Jonge, W.J.,
Wehner, S., 2014. Postoperative ileus involves interleukin-1 receptor signaling in
enteric glia. Gastroenterology 146, 176–187. https://doi.org/10.1053/j.
gastro.2013.09.030.
Tang, H.Y., Chen, X.Q., Wang, H., Chu, H.R., Zhu, C.F., Huang, S., Zhang, M.T., Shen, G.
M., 2022. Acupuncture relieves the visceral pain of diarrhea-predominant irritable
bowel syndrome rats by regulating P2X4 expression. Am. J. Transl. Res. 14,
5563–5573.
Valdez-Morales, E.E., Overington, J., Guerrero-Alba, R., Ochoa-Cortes, F., Ibeakanma, C.
O., Spreadbury, I., Bunnett, N.W., Beyak, M., Vanner, S.J., 2013. Sensitization of
peripheral sensory nerves by mediators from colonic biopsies of diarrhea-
12
European Journal of Pharmacology 946 (2023) 175650
predominant irritable bowel syndrome patients: a role for PAR2. Am. J.
Gastroenterol. 108, 1634–1643. https://doi.org/10.1038/ajg.2013.241.
van Wanrooij, S.J., Wouters, M.M., Van Oudenhove, L., Vanbrabant, W., Mondelaers, S.,
Kollmann, P., Kreutz, F., Schemann, M., Boeckxstaens, G.E., 2014. Sensitivity testing
in irritable bowel syndrome with rectal capsaicin stimulations: role of TRPV1
upregulation and sensitization in visceral hypersensitivity? Am. J. Gastroenterol.
109, 99–109. https://doi.org/10.1038/ajg.2013.371.
Vermeulen, W., De Man, J.G., Pelckmans, P.A., De Winter, B.Y., 2014. Neuroanatomy of
lower gastrointestinal pain disorders. World J. Gastroenterol. 20, 1005–1020.
https://doi.org/10.3748/wjg.v20.i4.1005.
Wang, G., Wang, X., Hu, H., Fang, X., Liu, S., Gao, N., Xia, Y., Wood, J.D., 2005.
Angiotensin receptors and actions in Guinea pig enteric nervous system. Am J
PhysioL-Gastr l 289, G614–G626. https://doi.org/10.1152/ajpgi.00119.2005.
Wang, P., Du, C., Chen, F., Li, C., Yu, Y., Han, T., Akhtar, S., Zuo, X., Tan, X., Li, Y., 2016.
BDNF contributes to IBS-like colonic hypersensitivity via activating the enteroglia-
nerve unit. SCI REP-UK 6, 20320. https://doi.org/10.1038/srep20320.
Wang, S., Zhang, H., Geng, B., Xie, Q., Li, W., Deng, Y., Shi, W., Pan, Y., Kang, X.,
Wang, J., 2018. 2-arachidonyl glycerol modulates astrocytic glutamine synthetase
via p38 and ERK1/2 pathways. J. Neuroinflamm. 15, 220. https://doi.org/10.1186/
s12974-018-1254-x.
Wang, X., Chen, X., Huang, W., Zhang, P., Guo, Y., Körner, H., Wu, H., Wei, W., 2019.
Losartan suppresses the inflammatory response in collagen-induced arthritis by
inhibiting the MAPK and NF-κB pathways in B and T cells. Inflammopharmacology
27, 487–502. https://doi.org/10.1007/s10787-018-0545-2.
Wenzel, S., Taimor, G., Piper, H.M., Schlüeter, K., 2001. Redox-sensitve intermediates
mediate angiotensin II-induced p38 MAP kinase activation, AP-1 binding activity,
and TGF-β expression in adult ventricular cardiomyocytes. Faseb. J. 15, 1–23.
https://doi.org/10.1096/fj.00-0827fje.
Wouters, M.M., Balemans, D., Van Wanrooy, S., Dooley, J., Cibert-Goton, V., Alpizar, Y.
A., Valdez-Morales, E.E., Nasser, Y., Van Veldhoven, P.P., Vanbrabant, W., Van der
Merwe, S., Mols, R., Ghesquière, B., Cirillo, C., Kortekaas, I., Carmeliet, P.,
Peetermans, W.E., Vermeire, S., Rutgeerts, P., Augustijns, P., Hellings, P.W.,
Belmans, A., Vanner, S., Bulmer, D.C., Talavera, K., Vanden Berghe, P., Liston, A.,
Boeckxstaens, G.E., 2016. Histamine receptor H1–mediated sensitization of TRPV1
mediates visceral hypersensitivity and symptoms in patients with irritable bowel
syndrome. Gastroenterology 150, 875–887. https://doi.org/10.1053/j.
gastro.2015.12.034.
Xiu, J.C., Wu, P., Xu, J.P., Guo, Z., Lai, W., Zhang, Y., Li, S., Li, J., Liu, Y., 2002. Effects of
long-term enalapril and losartan therapy of heart failure on cardiovascular
aldosterone. J. Endocrinol. Invest. 25, 463–468. https://doi.org/10.1007/
BF03344039.
Xu, X., Kim, J.A., Zuo, Z., 2008. Isoflurane preconditioning reduces mouse microglial
activation and injury induced by lipopolysaccharide and interferon-γ. Neuroscience
154, 1002–1008. https://doi.org/10.1016/j.neuroscience.2008.04.013.
Xu, X., Wang, H., Xing, C., Gu, Y., Liu, S., Xu, H., Hu, M., Song, L., 2017. IRE1α/XBP1s
branch of UPR links HIF1α activation to mediate ANGII-dependent endothelial
dysfunction under particulate matter (PM) 2.5 exposure. SCI REP-UK 7, 1–16.
https://doi.org/10.1038/s41598-017-13156-y.
Yamamoto, S., Zhong, J., Yancey, P.G., Zuo, Y., Linton, M.F., Fazio, S., Yang, H.,
Narita, I., Kon, V., 2015. Atherosclerosis following renal injury is ameliorated by
pioglitazone and losartan via macrophage phenotype. Atherosclerosis 242, 56–64.
https://doi.org/10.1016/j.atherosclerosis.2015.06.055.
Yuksel, T.N., Halici, Z., Demir, R., Cakir, M., Calikoglu, C., Ozdemir, G., Unal, D., 2015.
Investigation of the effect of telmisartan on experimentally induced peripheral nerve
injury in rats. Int. J. Neurosci. 125, 464–473. https://doi.org/10.3109/
00207454.2014.948115.