Journal of Physiology and Biochemistry

https://doi.org/10.1007/s13105-021-00818-9

ORIGINAL ARTICLE

Expression of miR-34a and miR-15b during the progression

of cervical cancer in a murine model expressing the HPV16 E7
oncoprotein
Rodolfo Ocadiz-Delgado 1 & Jose-Luis Cruz-Colin 1,2 & Elizabeth Alvarez-Rios 1 & Antonio Torres-Carrillo 1 &
Karina Hernandez-Mendoza 1 & Juan-Cristobal Conde-Pérezprina 1 & Guadalupe-Isabel Dominguez-Gomez 1,3 &
Enrique Garcia-Villa 1 & Paul F. Lambert 4 & Patricio Gariglio 1

Received: 18 June 2020 / Accepted: 20 April 2021

# University of Navarra 2021

Abstract
The high-risk human papillomavirus (HR-HPV) E7 oncoprotein appears to be a major determinant for cell immor-
talization and transformation altering critical processes such as cell proliferation, apoptosis, and immune response.
This oncoprotein plays an essential role in cervical carcinogenesis, but other cofactors such as long-term use of
hormonal contraceptives are necessary to modulate the risk of cervical cancer (CC). The role of HR-HPVs in the
alteration of microRNA (miRNA) levels in persistent viral infections currently remains unclear. The aim of this
study was to evaluate the miR-34a and miR-15b expression levels in the murine HPV16K14E7 (K14E7) transgenic
model after chronic estrogen (E2) treatment and their involvement in CC. Interestingly, results showed that, although
miR-34a expression is elevated by the HPVE7 oncogene, this expression was downregulated in the presence of both
the E7 oncoprotein and chronic E2 in cervical carcinoma. On the other hand, miR-15b expression was upregulated
along cervical carcinogenesis mainly by the effect of E2. These different changes in the expression levels of miR-34a
and miR-15b along cervical carcinogenesis conduced to low apoptosis levels, high cell proliferation and finally, to
cancerous cervical tissue development. In this work, we also determined the relative mRNA expression of Cyclin E2
(Ccne2), Cyclin A2 (Ccna2), and B cell lymphoma 2 (Bcl-2) (target genes of miR-34a and miR-15b); Sirtuin 1
(Sirt1), Cmyc, and Bax (miR-34a target genes); and p21/WAF1 (mir15b target gene) and the H-ras oncogene. Given
the modifications in the expression levels of miR-34a and miR-15b during the development of cervical cancer, it
will be useful to carry out further investigation to confirm them as molecular biomarkers of cancer.

Keywords Cervical cancer . microRNAs . 17β-Estradiol . HPVE7 oncoprotein . Transgenic . In situ RT-PCR

Key Points
-miR-34a is downregulated by HPVE7 oncoprotein and E2 in cervical
carcinoma
-miR-15b is upregulated in cervical carcinogenesis by E2
-miR-34a and miR-15b expression levels could be useful as cervical can-
cer biomarkers

* Patricio Gariglio 2
Department of Genomic Diagnostic, INMEGEN, Mexico
vidal@cinvestav.mx City, Mexico, Mexico
3
1
Subdirección de Investigación Clínica, INCan, Mexico City, Mexico,
Department of Genetics and Molecular Biology, Centro de Mexico
Investigación y de Estudios Avanzados del IPN, Av. IPN 2508, 4
Colonia San Pedro Zacatenco Delegación Gustavo A. Madero, McArdle Laboratory for Cancer Research, University of Wisconsin
07360 Mexico City, CP, Mexico Medical School, Madison, WI, USA

Introduction
High-risk human papillomaviruses (HR-HPVs) have been
identified in almost all cervical cancers (CC) worldwide
(95%) [1, 2]. The principal mechanism used by HR-HPVs to
induce carcinogenesis is through the induction of the E6 and
E7 oncoproteins that inactivate the function of the p53 and
retinoblastoma (RB) tumor suppressor proteins, respectively
[3]. The E7 protein is considered the major determinant for
cell immortalization and transformation inducing an aberrant
S-phase entry through the inactivation of RB and related pock-
et proteins (p107 and p130), the inhibition of the cyclin-
dependent kinase inhibitors p21 (WAF1) and p27 (KIP1),
the activation of cyclin A/CDK2, cyclin E and E2F1, as well
as the interaction with several target proteins such as AP1,
TBP, C-MYC, pCAF, SMAD-1 to 4, SRC-1 and SIVA-1
[4] that may facilitate cellular transformation [5, 6]. Also,
the HR-HPV E7 protein can repress the activity of E2F6 (a
component of polycomb group complexes involved in chro-
matin silencing) and induce KDM6B [7], thereby causing epi-
genetic reprogramming and subverting critical cellular de-
fense mechanisms. This may result in extended S-phase com-
petence and genomic instability in E7-expressing cells [7, 8].
However, other additional factors (long-term use of hormonal
contraceptives, multiparity, vitamin A deficiency) are neces-
sary to the progression of CC. For example, CC arise in more
than 90% of HPV16E7 transgenic mice (K14E7 transgenic
female mice) only when they are chronically treated with
17β-estradiol (E2) for 6 months [3, 27, this work]. HR-HPV
E7/E2-induced CC observed in the K14E7 mouse model is
quite similar in various aspects to human cervical cancer in-
cluding the multiple stages of carcinogenesis, and histopatho-
logical features and the expression of various CC markers
[9–11].
In recent years, there has been increasing interest in finding
new biomarkers for early diagnosis of several diseases includ-
ing CC. According to this, microRNAs (miRNAs) hold the
greatest possibilities to be a group of useful molecules.
miRNAs are small non-coding RNA molecules involved in
the negative regulation of gene expression and have been
studied in relation to several biological conditions; in fact,
variations in their expression levels have been associated with
several pathologies, including cancer [12]. For example, it is
well known that mirRNA-15b (miR-15b) is upregulated in
several cancers. MiR-15b appears to represent a particular
important miRNA in cancer, and it has been associated with
poor prognosis and elevated cervical tumorigenesis [13].
Previous studies reported that miR-34 family expression is
dysregulated in cervical cancer [14]. Of particular interest is
miR-34a, which has been recognized as a tumor suppressor,
being downregulated in cancer [14, 15].
Our study was aimed to ascertain the possibility that miR-
34a and miR-15b are involved in the development of cervical
Ocadiz-Delgado et al.
lesions and that their expression levels could be altered not
only by E7 but also by E2. We demonstrated that, although
miR-34a expression is elevated by the HPV16E7 oncogene,
this expression was downregulated when both the E7
oncoprotein and chronic E2 treatment are present. Besides,
downregulation of miR-34a coincides with the increment of
H-ras oncogene expression and low apoptosis levels in can-
cerous cervical tissue. We found that the miR-15b expression
was upregulated during cervical carcinogenesis. In addition to
these changes in the miRNA expression profile, we observed
low apoptosis levels, high cell proliferation, and finally, the
development of cervical cancer. The expression profile of
these miRNAs could be useful as possible biomarkers in hu-
man cervical samples.
Materials and methods
Generation of K14E7 transgenic mice
The generation and characterization of K14E7 transgenic
mice have been well described previously [9, 16, 17].
K14E7 transgenic mice were maintained in the FVB/n (NT)
inbred strain as transgenic heterozygotes. Animals were
housed according to the American Physiological Society’s
Guiding Principles in the Care and Use of Animals and to
the National Institutes of Health guide for the care and use
of Laboratory animals (NIH Publications No. 8023, revised
1978) guidelines. All mouse procedures were approved by the
Research Unit for Laboratory Animal Care Committee
(UPEAL-CINVESTAV-IPN, Mexico; NOM-062-ZOO-
1999). [18]
Hormonal treatment
One-month virgin female transgenic and non-transgenic
(NT) mice were anesthetized with isoflurane, implanted
in the dorsal skin (s.c.) with continuous release pellets
delivering 0.05 mg 17β-estradiol (E 2 ) over 60 days
(Innovative Research of America, Sarasota, FL). Groups
comprising 6 animals each were treated with hormone for
1, 3, or 6 months (2-, 4-, and 7-month-old E2-treated NT
and K14E7 mice) [9, 11]. Additional groups of 2, 4, and
7-month-old untreated-NT and -K14E7 mice were includ-
ed as controls (12 animals/group). Six animals from each
experimental group were used for DNA and RNA purifi-
cation. Six additional animals of the 7-month-old groups
were used for tissue procurement, paraffin-embedding,
and subsequent immunohistochemical and in situ RT-
PCR analyses. The animals in each group showed similar
phenotypic and histological characteristics.
Expression of miR-34a and miR-15b during the progression of cervical cancer in a murine model expressing...

Tissue procurement and histopathological analysis Table 1 Sequences of primers used for both in situ RT-PCR* and real-
time quantitative PCR†

The entire reproductive tract was paraffin-embedded, sec- Gene Primer sequence
tioned, and evaluated by an expert pathologist as described 5′ → 3′
elsewhere [16].
p21/Waf1 Forward ttcagagcccaggcaccatg
Reverse gggacccagggctcaggtaga
Immunohistochemistry and in situ RT-PCR Gapdh Forward cattggcaatgagcggttc
Reverse ggtagtttcgtggatgccaca
Protein detection was performed using the Mouse/Rabbit Ccne2 Forward agccgtttacaagctaagcaa
PolyDetector HRP/DAB Detection System (Bio SB, USA) Reverse tggcctgaattatctgggtttc
[16]. Tissue sections were probed using primary antibodies Ccna2 Forward aagagaatgtcaaccccgaaaaa
against PCNA, p21/WAF1, or H-RAS (Santa Cruz Reverse acccgtcgagtcttgagctt
Biotechnology, USA). In situ RT-PCR was performed as pre- Bcl-2 Forward tcctaacggagaagtaagag
Reverse gaatctgtttgctctcatac
viously described [16]. Negative controls for in situ PCR and
Sirt1 Forward tgattggcaccgatcctcg
in situ RT-PCR included reactions without one of the primers,
Reverse ccacagcgtcatatcatccag
omitting the reverse transcription reaction and HPVE7-
H-ras Forward ctgtcctgacaccaggctc
negative tissues (not shown). In situ mRNA quantification Reverse catccctggactggcct
was validated by simultaneous RT-qPCR assays (data not C-myc Forward aaaacgacaagaggcggacac
shown). Photomicrographs were obtained using a DFC290 Reverse gcttgtgctcgtctgcttgaa
HD digital camera (Leica Microsystems, USA). The images Bax Forward acaggggcctttttgctacag
were digitally processed in order to equalize the bright and Reverse tgccacccggaagaagacctc
contrast of images using the PhotoImpact software (Ulead
*Amplification conditions for in situ RT-PCR were: 94 °C, 30 s; 60 °C,
PhotoImpact SE ver. 3.02; Ulead Systems, USA). Digital 30 s; 72 °C, 30 s; 18 cycles
analysis of all captured images was performed as previously †
Amplification conditions for real-time quantitative PCR were: 95 °C, 30
described [16]. s; 60 °C, 60 s; 72 °C, 30 s; 40 cycles

RNA isolation, synthesis of cDNA, and quantification

of mRNAs by real-time quantitative PCR
Total RNA was isolated from cervical tissue obtained from 2-,
4-, and 7-month-old estrogen treated- and untreated-
transgenic and non-transgenic mice using TRIzol reagent ac-
cording to the manufacturer’s instructions (Ambion, Life
Technologies, USA). Three micrograms of total RNA was
reverse transcribed in a 20-μl reaction consisted of 4 μl of
5X first strand buffer [250 mM Tris-HCl (pH 8.3), 375 mM
KCl, and 15 mM MgCl2], 0.5 mM dNTPs (final concentra-
tion), 5 mM dithiothreitol, 15 U RNase Inhibitor (Thermo
Scientific, USA), 2.5 μg oligo(dT) 12 -1 8 and 200 U
SuperScript II Reverse Transcriptase, following the manufac-
turer’s specifications (Thermo Scientific, USA). The relative
quantification of selected mRNAs [Cyclin E2 (Ccne2), Cyclin
A2 (Ccna2), and B cell lymphoma 2 (Bcl-2) (target genes of
miR-34a and miR-15b); Sirtuin 1 (Sirt1), Cmyc and Bax (miR-
34a target genes); p21/WAF1 (mir15b target gene) and the H-
ras oncogene] by real-time PCR was performed using a 7300
Real Time PCR System (Applied Biosystems, USA) as de-
scribed previously [11]. Oligonucleotide primers were de-
signed to be intron spanning and were purchased from IDT,
USA (Table 1). Sequences were obtained from the GenBank
database. The amplification of each template was performed
in triplicate in one PCR run. Gapdh mRNA level was deter-
mined as a housekeeping endogenous control.
Quantification of miR-34a and miR-15b by real-time
quantitative PCR
To detect the levels of mature miR-34a and miR-15b in mu-
rine cervical tissue, 1–10 ng of total RNA were reverse tran-
scribed to cDNA with specific reverse transcription primers
using the TaqMan® MicroRNA reverse transcription kit
(Applied Biosystems, Foster City, CA, USA). Stem-loop re-
al-time PCR was used to establish miRNA levels by the
TaqMan® MicroRNA assays (miR-34a (ID 000426), and
miR-15b (ID 000390); Applied Biosystems). Real-time quan-
titative-polymerase chain reactions (RTqPCR) were per-
formed using a StepOne Real Time PCR System (Applied
Biosystems) following the manufacturer’s specifications.
Relative expression levels were normalized to the expression
of endogenous control snoRNA202 (ID 001232; Applied
Biosystems). The data obtained in RTqPCR assays was ana-
lyzed using the equation described by Livak et al. [19]:
amount of target = 2−ΔΔCT.
Validation of the 2−ΔΔCt method
Validation of the method was performed as previously report-
ed [11] and according to the Applied Biosystems User
Bulletin No. 2 (P/N 4303859).

Statistical analysis
The Mann–Whitney U test was used to determine differences
of miR-34a and miR-15b levels in the experimental groups.
GraphPad Prism Version 6.01 statistical software (GraphPad
Software, Inc. USA) was used. A result was considered sta-
tistically significant when the analysis yielded a p of <0.05.
Results
The E7 oncoprotein and 17β-estradiol affect miR-34a
and miR-15b expression during cervical carcinogene-
sis in the cervix of K14E7 transgenic mice
Given that in the transgenic model of cervical cancer (K14E7
mice) chronic exposure to 17β-estradiol (E2) is important for
tumor development, we investigated in mice cervical tissue
the individual and combined effect of E2 and the HPV16 E7
oncoprotein on the expression of the tumor suppressor miR-
34a and the microRNA-15b. Reverse transcription quantita-
tive polymerase chain reaction (RTqPCR) analysis of
miRNAs from cervical tissue obtained from 2-, 4-, and 7-
month-old E2-treated and untreated NT and K14E7 mice.
Analyses showed that the expression level of miR-34a was
significantly lower (2.2-fold; p<0.05) in 7-month-old E2-treat-
ed K14E7 mice as compared to non-transgenic mice (NT)
(Fig. 1A). Interestingly, miR-34a expression was increased
Fig. 1 miR-34a and miR-15b expression levels in cervical carcinogene-
sis. Cervix of E2-treated 2-, 4-, and 7-month-old K14E7 mice was ana-
lyzed and compared with untreated control mice. miR-34a and miR-15b
expression was measured in cervix of the K14E7 carcinogenesis model
and normalized using snoRNA202 as internal control as described in
Ocadiz-Delgado et al.
in 7-month-old NT+E2 mice (2.33-fold) and 7-month-old
K14E7-E2 mice (1.7-fold) in comparison with untreated
non-transgenic mice of the same age (p<0.05) (Fig. 1A).
Thus, only in 7-month-old mice, both HPV16E7 oncoprotein
and E2 clearly reduce miR-34a expression. In contrast to miR-
34a, the levels of miR-15 bare significantly high in cervical
tissue containing E7 and E2 after 6 months of hormonal treat-
ment. When compared to NT mice, the miR-15b expression in
NT+E2 (2.5-fold) and K14E7 +E2 7-month-old mice was sig-
nificantly increased (7.1-fold) (Fig. 1B). In cervix of
K14E7mice without E2 treatment, the miR-15b expression
levels were significantly decreased (6.9-fold; p<0.05; Fig.
1B) in comparison with K14E7+E2 7-month-old mice. In ad-
dition, results showed that miR-15b had an increase in their
expression levels in NT-E2 and K14E7+E2mice at 4- and 7-
month-old as compared with NT-E2 mice (Fig. 1B). These
data show that in 7-month-old mice the presence of both, E2
and the E7 oncoprotein, decreased the levels of miR-34a while
increased those of miR-15b.
Expression of miRNAs target genes in the K14E7
cervical cancer murine model
We used RTqPCR to determine the expression levels of
Ccne2, Ccna2, Bcl-2 and Sirt1 (Fig. 2). In addition, we
employed in situ RT-PCR to determine tissue localization of
H-ras, C-myc, p21/Waf1, Bcl-2, and Bax genes in different
cervical areas allow comparing epithelia with stroma (Fig.
“Materials and methods.” Bars represent the mean. Error bars represent
standard deviation (SD).** Statistically significant (p< 0.05). NT-E2:
untreated-non-transgenic mice; NT+E2: estrogen treated-NT mice;
K14E7-E2: untreated K14E7 mice; K14E7+E2: E2-treated K14E7 mice.
Groups comprising 6-12 animals each were included
Expression of miR-34a and miR-15b during the progression of cervical cancer in a murine model expressing...

Fig. 2 Expression levels of

selected miR-34a targets. miR-
34a targets expression levels were
determined in cervix of the
K14E7 carcinogenesis model (A)
Ccne2; (B) Ccna2; (C) Bcl-2; and
(D) Sirt1. Bars represent the
mean. Error bars represent stan-
dard deviation (SD). Expression
levels were normalized using
Gapdh as internal control. **
Statistically significant (p< 0.05).
NT-E2: untreated-Non-
Transgenic mice; NT+E2: estro-
gen treated-NT mice; K14E7-E2:
untreated K14E7 mice; K14E7+
E2: E2-treated K14E7 mice.
Groups comprising 6-12 animals
each were included

3A). It has been reported both, in vitro and in vivo, that miR-
34a is involved in the negative regulation of Ccne2, Ccna2,
Bcl-2, Sirt1, and C-myc [12, 14]. Employing the K14E7 mod-
el, we explored whether the E2 and E7-induced miR-34a
downregulation could be related to changes in the mRNA
levels of these genes. Interestingly, we observed that Ccne2,
Ccna2, Bcl-2, Sirt1, and C-myc mRNA levels were upregu-
lated not only in NT+E2 and K14E7-E2 but also mainly in
K14E7+E2 mice as compared with NT-E2 control mice, along
cervical carcinogenesis (2-, 4-, and 7-month-old mice) (Figs. 2
and 3). On the other hand, we performed RTqPCR to deter-
mine if high miR-15b levels are related to decreased expres-
sion of Bax mRNA in the cervical cancer murine model. As
shown in Fig. 3B, it is interesting to highlight that, while Bax
expression is downregulated (2.02-fold; p< 0.05), the expres-
sion of miR-15b was upregulated in 7-month-old K14E7+E2
mice as compared with NT-E2 mice (Fig. 1B). We finally
determined that the increase in miR-15b expression levels
occurs at the same time as the overexpression of E2F-
regulated genes such as Ccna2 (Fig. 2).
Discussion
In the present study, using the K14E7 transgenic mouse model
[9, 17], we aimed to investigate whether or not the miR-34a
and miR-15b expression levels are associated with cervical
carcinogenesis and their possible correlation with 17β-
estradiol (E2) level. Squamous epithelial neoplasia in these
animals progresses from low-grade squamous intraepithelial
lesion (K14E7+E2, 2-month-old mice) to high-grade cervical
dysplasia (K14E7+E2, 4-month-old mice) and ultimately in-
vasive cervical malignancies after 6-month exposure to a
chronic low-dose of E2, mimicking malignant progression in
women [9]. We have determined that E2 leads not only to
increased proliferation but also to lower apoptotic levels in
the K14E7 CC transgenic mice model demonstrated by the
immunohistochemical determination of Cleaved-PARP and
Cleaved Caspase 3 levels as compared with estrous-phase,
non-transgenic mice (not shown) [9, 16, 17].
Estrogens (E2) play an essential role in the development of
various tissues and in the maintenance of numerous physio-
logical processes stimulating growth and inhibiting apoptosis
through estrogen-receptor-mediated mechanisms in many cell
types [20, 21]; it has also been well documented that E2 plays
a critical role in breast and other gynecological cancers
[21–23]. Among HR-HPV-infected women, an association
between oral contraceptive intake and the risk of developing
CC has been described [24]. The carcinogenic effects of E2
have been in large part attributed to its ability to increase the
expression and transient activation of cellular oncogenes
[21–23, 25, 26]. The E2-induced damage effect could increase
in the presence of HPV16E7 because this oncoprotein causes
a delay in repair of DNA damage [26]; in addition, the E7
 Ocadiz-Delgado et al.

oncoprotein can induce chromosomal abnormalities [27], [10]. It has been described that E7 functions deregulate the cell
which may be the “initiating” step in the K14E7 mouse model cycle, including E7 binding and consequent destruction of
 Expression of miR-34a and miR-15b during the progression of cervical cancer in a murine model expressing...
ƒFig. 3 In situ mRNA expression levels of a panel of genes involved in
cell proliferation and/or apoptosis. (A) In situ mRNA detection of H-ras,
C-myc, p21/Waf1, Bcl-2, and Bax in the cervix of E2-treated 7-month-old
K14E7 mice comparing with the other 3 mice groups employed as con-
trols. Signal was mainly cytoplasmic (indicated by empty arrows). BM,
basal membrane. Magnification: ×20. (B) Relative expression levels of
H-ras, C-myc, p21/Waf1, Bcl-2 and Bax genes in the cervix of untreated
and 17β-estradiol (E2) treated NT and K14E7 transgenic mice. In situ
RT-PCR relative signal was digitally quantified. Data represent the mean
of at least three independent experiments and five areas of each tissue. All
data were normalized to Gapdh constitutive expression and validated by
RT-qPCR (not shown). **: statistically significant (p< 0.05). NT-E2:
untreated-NT mice; NT+E2: E2 treated-NT mice; K14E7-E2: untreated
K14E7 mice; K14E7+E2: E2-treated K14E7 mice. Groups comprising 6-
12 animals each were included
pRB, p107, and p130 [3, 6, 10, 28], activation of PKB/AKT
signaling, epigenetic reprogramming [7], and abrogation of
both p53 and transforming growth factor β inhibitory signal-
ing [28].
miR-34a was reported as a tumor suppressor in multiple
types of cancer and found to inhibit cancer stem cell (CSC)
self-renewal and invasion, promoting their sensitivity to both
chemo- and radiotherapy. Here, we observed in the K14E7
murine model the downregulation of miR-34a compared to
controls (NT -E2 mice). We also found thatE7 or E2 by them-
selves showed an increase in miR-34a expression levels in
early stages of carcinogenesis (2-month-old mice). Probably,
tumor suppressor miR-34a is trying to avoid CC development
and its level increased when E7 or E2 are present independent-
ly, but when these factors are both acting together, it seems
that E7 oncoprotein synergized with E2 to downregulate the
expression of this important miRNA as the malignant trans-
formation of the murine cervix progresses (see Fig. 1A; 4- and
7-month-old mice). These results suggest that HPV16 E7
oncoprotein and E2 reduce miR-34a expression in vivo.
Many different miR-34a target genes, such as Ccne2,
Ccna2, Bcl-2, Sirt1, and C-myc, have been reported [15].
We have determined that the HPV16 E7 oncoprotein alone
or in conjunction with E2 increased the mRNA expression
of these miR-34a target oncogenes along carcinogenesis
(2-, 4-, and 7-month-old), in part due to the E7-mediated
RB inactivation and subsequent release of E2F transcrip-
tion factor. Interestingly, in 7-month-old NT mice, the ex-
pression of miR-34 was increased by treatment with E2
(NT +E2) while in the presence of E7 expression, miR-34
decreased showing the lowest expression at 7 months of
age with E2-treatment, suggesting a synergism between E7
expression and E2 in the K14E7 +E2 mouse model (Fig. 1).
In addition, our results showed, in 7-month-old E2-treated
K14E7 mice, a significant positive correlation between low
miR-34a levels and the augmented mRNA expression
levels of these oncogenes, suggesting that in vivo the syn-
ergism between E 2 and the HPV16E7 oncoprotein
downregulates miR-34a and, interestingly, upregulates
miR-34a target genes. As compared with NT-E2 mice,
miR-34a target genes were strongly augmented mainly in
K14E7+E2 after 6 months of treatment (Fig. 2); this effect
is attributed to the E7 oncoprotein and E2 together. It is
important to comment that although in early stages of car-
cinogenesis (K14E7+E2 mice2-months of age), the inverse
relationship between miRNA/target gene is not fulfilled, in
the K14E7 mice treated with E2 at 7-month-old (mice that
develop CC), it is notable that miR-34 expression de-
creases significantly and, at the same time, the expression
levels of cyclins E and A, as well as Bcl-2, were increased.
These data suggest that, in young mice, the organism
seems to be avoiding the early effects of oncoprotein E7
and the proliferative stimulation induced by E2.
MiR-15b is broadly expressed at a low level in most mam-
malian tissues but was found overexpressed in chronic lym-
phocytic leukemia (CLL) and various other malignancies [13,
29]. In this work, we demonstrate that miR-15b expression
increased gradually from early stages of cervical cancer main-
ly by E2 (K14E7+E2, 2-month-old mice) to cervical carcino-
ma (K14E7+E2, 7-month-old mice) (Fig. 1B). One possible
explanation of this behavior is that the expression of miR-15b
is upregulated by the E2F transcription factor [30]. miR-15b
expression has been highly correlated with cell cycle E2F-
induced genes Ccna2 (cyclin A2) and Ccnb1 (cyclin B1)
[29]. Indeed, Bueno et al. [31] showed that miR-15b is in-
duced by E2F transcription factors in mouse embryonic fibro-
blasts; binding sites for E2F1 and E2F3 were identified in the
promoter of miR-15b. This induction coincides with our re-
sults in where not only E7 is blocking pRb and releasing E2F,
but also E2 might be increasing the activity of this central
transcription factor [29]. In the murine model, we expected
to observe after chronic E2 treatment an increase in the expres-
sion levels of miR-15b. This increase was observed mainly in
4-month-old and more evident in 7-month-old transgenic
mice (Fig. 1). Interestingly, at 2 months of age, miR-15b ex-
pression was downregulated. This is an unexpected result be-
cause at this early age in K14E7 transgenic mice pRb is inac-
tive and E2F probably released in the cervical epithelium [9,
17] and in consequence, miR-15b expression should be up-
regulated, unless the tumor suppressor NDRG2 (a member of
N-myc downstream regulated gene) is upregulated early in
cervical carcinogenesis. Supporting this hypothesis is the ob-
servation that miR-15b expression was significantly upregu-
lated in NDRG2-suppresed HeLa cells [32].
On the other hand, and as expected, we found that in the
K14E7+E2 model, E2F-activated genes such as C-myc and
Ccna2 showed high mRNA levels (Figs. 2 and 3). In addition,
we have detected high expression levels of the Bcl-2 oncogene
and downregulation of Bax mRNA levels, the latter being a
recognized target of miR-15b. This condition (high Bcl-2/Bax
ratio) correlates with the upregulation of miR-15b in 7-month-

old K14E7+E2 (7.1-fold; p< 0.05) as compared with NT-E2
control mice (Fig. 1B). The high Bcl-2/Bax ratio probably con-
tributes to the reduction in apoptotic index observed in cervical
tissues from E2-treated K14E7 transgenic mice, according to a
previous report [10]. These results suggest that the elevated
miR-15b expression levels are strongly correlated with Bcl-2/
Bax ratio in the cervix of the K14E7 murine cancer model.
Previous works have demonstrated that HR-HPV E6 and
E7 oncogenes can induce cancer development modulating
tissue microenvironment as well as the bi-directionality in
the communication between HPV-infected epithelia and the
surrounding microenvironment through the release of
exosomes containing anti-apoptotic proteins, miRNAs and
E6/E7 transcripts, suggesting transferable oncogenic effect
[33–35]. It is possible that altered miRNA levels in stroma
induce gene expression changes in epithelia and vice versa.
The decreased expression level of miR-34a and increased
expression of miR-15b, induced byHPV16 E7 oncoprotein
and E2, might represent an important step towards the devel-
opment of CC, diminishing apoptotic levels and increasing
cell proliferation in the cervix. These findings not only pro-
vide insight into the interplay between estrogens and miRNAs
in an oncogenic background in cervical tissue but also open up
new early diagnostic and prognostic perspectives of CC in-
cluding therapy follow-up. MiR-34a and miR-15b expression
levels should be further investigated as possible predictive/
prognostic biomarkers in human cervical samples.
Acknowledgements We are grateful to Mr. Lauro Macías, Dr. Jorge
Fernández-Hernández, Dr. Ricardo Gaxiola-Centeno, Dr. Benjamin
Chávez-Álvarez, and Dr. Rafael Leyva-Muñoz (CINVESTAV-IPN,
México) for excellent technical support.
Availability of data and material Not applicable
Code availability Not applicable
Author contribution All authors contributed to the study conception and
design. Rodolfo Ocadiz-Delgado, Patricio Gariglio, Elizabeth Alvarez-
Rios, and Enrique García-Villa contributed to data collection and analy-
sis. Material preparation and experimental procedures were performed by
Rodolfo Ocadiz-Delgado, Jose-Luis Cruz-Colin, Antonio Torres-
Carrillo, Karina Hernandez-Mendoza, Juan-Cristobal Conde-Pérezprina
and Guadalupe-Isabel Dominguez-Gomez. The first draft of the manu-
script was written by Rodolfo Ocadiz-Delgado, Paul F Lambert and
Patricio Gariglio. All authors commented on previous versions of the
manuscript. All authors read and approved the final manuscript. The
authors declare that all data were generated in-house and that no paper
mill was used.
Funding This work was supported by Consejo Nacional de Ciencia y
Tecnologia (CONACyT-Mexico; grant number: 0201904).
Declarations
Conflict of interest The authors declare no competing interests.
Ocadiz-Delgado et al.
Ethics approval All mouse procedures were approved by the Research
Unit for Laboratory Animal Care Committee (UPEAL-CINVESTAV-
IPN, Mexico; NOM-062-ZOO-1999).
Consent to participate Not applicable
Consent for publication Not applicable
References
1. Bosch FX, Burchell AN, Schiffman M, Giuliano AR, de Sanjose S,
Bruni L, Tortolero-Luna G, Kjaer SK, Muñoz N (2015)
Epidemiology and natural history of human papillomavirus infec-
tions and type-specific implications in cervical neoplasia. Vaccine
19(10):K1–K16
2. Zur Hausen H (2009) Papillomaviruses in the causation of human
cancers - a brief historical account. Virology 20:260–265
3. Yugawa T, Kiyono T (2009) Molecular mechanisms of cervical
carcinogenesis by high-risk human papillomaviruses: novel func-
tions of E6 and E7 oncoproteins. Rev Med Virol 19:97–113
4. Shin MK, Balsitis S, Brake T, Lambert PF (2009) Human papillo-
mavirus E7 oncoprotein overrides the tumor suppressor activity of
p21Cip1 in cervical carcinogenesis. Cancer Res 15:5656–5663
5. Hwang SG, Lee D, Kim J, Seo T, Choe J (2002) Human papillo-
mavirus type 16 E7 binds to E2F1 and activates E2F1-driven tran-
scription in a retinoblastoma protein-independent manner. J Biol
Chem 25:2923–2930
6. Münger K, Basile JR, Duensing S, Eichten A, Gonzalez SL, Grace
M, Zacny VL (2001) Biological activities and molecular targets of
the human papillomavirus E7 oncoprotein. Oncogene 26:7888–
7898
7. McLaughlin-Drubin ME, Crum CP, Münger K (2011) Human pap-
illomavirus E7 oncoprotein induces KDM6A and KDM6B histone
demethylase expression and causes epigenetic reprogramming.
Proc Natl Acad Sci U S A 108:2130–2135
8. McLaughlin-Drubin ME, Huh KW, Münger K (2008) Human pap-
illomavirus type 16 E7 oncoprotein associates with E2F6. J Virol
82:8695–8705
9. Brake T, Connor JP, Petereit DG, Lambert PF (2003) Comparative
analysis of cervical cancer in women and in a human
papillomavirus-transgenic mouse model: identification of
minichromosome maintenance protein 7 as an informative bio-
marker for human cervical cancer. Cancer Res 1:8173–8180
10. Brake T, Lambert PF (2005) Estrogen contributes to the onset,
persistence, and malignant progression of cervical cancer in a hu-
man papillomavirus-transgenic mouse model. Proc Natl Acad Sci U
S A 102:2490–2495
11. Munguía-Moreno JA, Díaz-Chavéz J, García-Villa E, Albino-
Sanchez ME, Mendoza-Villanueva D, Ocadiz-Delgado R,
Bonilla-Delgado J, Marín-Flores A, Cortés-Malagón EM,
Alvarez-Rios E, Hidalgo-Miranda A, Üren A, Çelik H, Lambert
PF, Gariglio P (2018) Early synergistic interactions between the
HPV16-E7 oncoprotein and 17β-oestradiol for repressing the ex-
pression of Granzyme B in a cervical cancer model. Int J Oncol 53:
579–591
12. González-Quintana V, Palma-Berré L, Campos-Parra AD, López-
Urrutia E, Peralta-Zaragoza O, Vazquez-Romo R, Pérez-Plasencia
C (2016) MicroRNAs are involved in cervical cancer development,
progression, clinical outcome and improvement treatment response.
Oncol Rep 35:3–12
13. Wen F, Xu JZ, Wang XR (2017) Increased expression of miR-15b
is associated with clinicopathological features and poor prognosis
in cervical carcinoma. Arch Gynecol Obstet 295(3):743–749
Expression of miR-34a and miR-15b during the progression of cervical cancer in a murine model expressing...
14. Zhang L, Liao Y, Tang L (2019) MicroRNA-34 family: a potential
tumor suppressor and therapeutic candidate in cancer. J Exp Clin
Cancer Res 38:53
15. Li XJ, Ren ZJ, Tang JH (2014) MicroRNA-34a: a potential thera-
peutic target in human cancer. Cell Death Dis 5:e1327
16. Ocadiz-Delgado R, Castañeda-Saucedo E, Indra AK, Hernandez-
Pando R, Flores-Guizar P, Cruz-Colin JL, Recillas-Targa F, Perez-
Ishiwara G, Covarrubias L, Gariglio P (2012) RXRα deletion and
E6E7 oncogene expression are sufficient to induce cervical malig-
nant lesions in vivo. Cancer Lett 28:226–236
17. Song S, Liem A, Miller JA, Lambert PF (2000) Human papilloma-
virus types 16 E6 and E7 contribute differently to carcinogenesis.
Virology 15:141–150
18. Edlich F (2018) BCL-2 proteins and apoptosis: recent insights and
unknowns. Biochem Biophys Res Commun 500:26–34
19. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expres-
sion data using real-time quantitative PCR and the 2(-Delta Delta
C(T)) Method. Methods 25:402–408
20. Charpentier AH, Bednarek AK, Daniel RL, Hawkins KA, Laflin
KJ, Gaddis S, MacLeod MC, Aldaz CM (2000) Effects of estrogen
on global gene expression: identification of novel targets of estro-
gen action. Cancer Res 1:5977–5983
21. Leitman DC, Paruthiyil S, Yuan C, Herber CB, Olshansky M,
Tagliaferri M, Cohen I, Speed TP (2012) Tissue-specific regulation
of genes by estrogen receptors. Semin Reprod Med 30:14–22
22. Lewis-Wambi JS, Jordan VC (2009) Estrogen regulation of apo-
ptosis: how can one hormone stimulate and inhibit? Breast Cancer
Res 11:206
23. Moreno V, Bosch FX, Muñoz N, Meijer CJ, Shah KV,
Walboomers JM, Herrero R, Franceschi S, International Agency
for Research on Cancer. Multicentric Cervical Cancer Study Group
(2003) The role of steroid contraceptive hormones in the pathogen-
esis of invasive cervical cancer: a review. Int J Gynecol Cancer 13:
103–110
24. Moreno V, Bosch FX, Muñoz N, Meijer CJLM, Shah KV,
Walboomers JMM, Herrero R, Franceschi S (2002) Effect of oral
contraceptives on risk of cervical cancer in women with human
papillomavirus infection: the IARC multicentric case-control study.
Lancet 359:1085–1092
25. Mesia-Vela S, Sanchez RI, Li JJ, Li SA, Conney AH, Kauffman FC
(2002) Catechol estrogen formation in liver microsomes from fe-
male ACI and Sprague-Dawley rats: comparison of 2- and 4-
hydroxylation revisited. Carcinogenesis 23:1369–1372
26. Park JW, Nickel KP, Torres AD, Lee D, Lambert PF, Kimple RJ
(2014) Human papillomavirus type 16 E7 oncoprotein causes a
delay in repair of DNA damage. Radiother Oncol 113:337–344
27. Duensing S, Münger K (2004) Mechanisms of genomic instability
in human cancer: insights from studies with human papillomavirus
oncoproteins. Int J Cancer 20:157–162
28. Wallace NA, Galloway DA (2014) Manipulation of cellular DNA
damage repair machinery facilitates propagation of human papillo-
maviruses. Semin Cancer Biol 26:30–42
29. Zhao C, Wang G, Zhu Y, Li X, Yan F, Zhang C, Huang X, Zhang Y
(2016) Aberrant regulation of miR-15b in human malignant tumors
and its effects on the hallmarks of cancer. Tumour Biol 37:177–183
30. Ji WB, Liu X, Luo Y, Zhang WZ (2016) High expression of miR-
15b predicts poor prognosis for hepatocellular carcinoma after cu-
rative hepatectomy. Oncol Rep 36:1901–1908
31. Bueno MJ, Gómez de Cedrón M, Laresgoiti U, Fernández-Piqueras
J, Zubiaga AM, Malumbres M (2010) Multiple E2F-induced
microRNAs prevent replicative stress in response to mitogenic sig-
naling. Mol Cell Biol 30:2983–2995
32. Liu J, Yang L, Zhang J, Zhang J, Chen Y, Li K, Li Y, Li Y, Yao L,
Guo G (2012) Knock-down of NDRG2 sensitizes cervical cancer
Hela cells to cisplatin through suppressing Bcl-2 expression. BMC
Cancer 12:370
33. Cortés-Malagón EM, Bonilla-Delgado J, Díaz-Chávez J, Hidalgo-
Miranda A, Romero-Cordoba S, Uren A, Celik H, McCormick M,
Munguía-Moreno JA, Ibarra-Sierra E, Escobar-Herrera J, Lambert
PF, Mendoza-Villanueva D, Bermudez-Cruz RM, Gariglio P
(2013) Gene expression profile regulated by the HPV16 E7
oncoprotein and estradiol in cervical tissue. Virology 447(1-2):
155–165
34. Honegger A, Schilling D, Bastian S, Sponagel J, Kuryshev V,
Sültmann H, Scheffner M, Hoppe-Seyler K, Hoppe-Seyler F
(2015) Dependence of intracellular and exosomal microRNAs on
viral E6/E7 oncogene expression in HPV-positive tumor cells.
PLoSPathog 11:e1004712
35. Spurgeon ME, den Boon JA, Horswill M, Barthakur S, Forouzan
O, Rader JS, Beebe DJ, Roopra A, Ahlquist P, Lambert PF (2017)
Human papillomavirus oncogenes reprogram the cervical cancer
microenvironment independently of and synergistically with estro-
gen. Proc Natl Acad Sci U S A 114(43):E9076–E9085
Publisher’s note Springer Nature remains neutral with regard to jurisdic-
tional claims in published maps and institutional affiliations.