12 TH Study Material

NELLAI NADAR MATRIC HIGHER SECONDARY SCHOOL
XII STD ZOO/BIO-ZOO

STUDY MATERIAL FOR 1 TO 6 Chapters
By DEPARTMENT OF ZOOLOGY
2023-2024
TEXT BOOK EVALUATION QUESTIONS AND ANSWERS
CHAPTER 1 REPRODUCTION IN ORGANISMS
1. Name an organism where cell division is itself a mode of reproduction.

Amoeba, Euglena, Paramecium and Vorticella
2. Name the phenomenon where the female gamete directly develops into a new
organism with an avian example.
Parthenogenesis. (Eg) Turkey
3. What is parthenogenesis? Give two examples from animals.
Development of an egg into a complete individual without fertilization is known as
parthenogenesis. (Eg) Honey bees, Solenobia amd Aphis
4. Which type of reproduction is effective -Asexual or sexual and why?
Sexual Reproduction is effective.
Reasons:
➢ Sexual reproduction involves two parents and two types of gametes. (Sperm and
Ovum)
➢ Gametes are produced by meiosis.
➢ Organisms produced by sexual reproduction show variation,
➢ Variation is the raw material for evolution.
5. The unicellular organisms which reproduce by binary fission are considered immortal.
Justify.
In unicellular organisms during binary fission, the entire cell (organism) divides
completely to form two daughter cells which later on develop into adult and the process
goes on repeatedly during each division leading to immortality of cell (Organism). Hence
unicellular organisms like amoeba are “biologically immortal”.
6. Why is the offspring formed by asexual reproduction referred as a clone?

➢ The carbon copy of an individual is often called a clone. A clone means genetically
exact copy of an organism.
➢ Offsprings produced by Asexual reproduction are morphologically and
genotypically identical.
7. Give reasons for the following:
(a)Some organisms like honey bees are called parthenogenetic animals
➢ Development of an egg into a complete individual without fertilization is known
as parthenogenesis.
Nellai Nadar MHSS XII ZOOLOGY / BIO ZOOLOGY (Textual Evaluation Questions and Answers) Page 2
➢ In honeybees fertilized eggs (zygotes) develop into queen and workers, whereas
unfertilized eggs develop into drones (male). It is one of the types of
parthenogenesis called incomplete parthenogenesis.
➢ Therefore honey bees are called as parthenogenetic animals.
(b)A male honey bee has 16 chromosomes where as its female has 32 chromosomes.
➢ Chromosomal number of honey bees is 32.
➢ Gametes contains only 16 chromosomes as they are produced by meiosis.
➢ In honey bees unfertilized egg developed into males (drones), so they have ohly16
➢ chromosomes whereas fertilized eggs developed into females (queens and
workers), so they have 32 chromosomes.
8. Differentiate between the following:

(a) External and internal fertilization
External fertilization Internal fertilization
The fusion of male and female gametes The fusion of male and female gametes
takes place outside the body of the takes place within the body of the female
female organisms in the water medium is organisms.
called external fertilization.
(Eg) Sponges, fishes and amphibians (Eg) Reptiles, Aves and Mammals.
(b) Regeneration in lizard and Planaria
Regeneration in lizard Regeneration in Planaria

Regeneration in lizard is called Regeneration in Planaria is called
epimorphosis morphalaxis
Epimorphosis is the replacement of lost In morphalaxis whole body grows from a
body parts. small fragment
9. How is juvenile phase different from reproductive phase?
Juvenile phase Reproductive phase

Juvenile phase is the period of growth During reproductive phase
between the birth the organisms reproduce and their offsprings
of the individual upto reproductive reach maturity period.
maturity.
Juvenile phase is also called as vegetative Reproductive phase is also known as maturity
phase. phase.
10. What is the difference between syngamy and fertilization?
Syngamy Fertilization
It is the entire process of fusion of haploid It is process of fusion of haploid male
male and female pro nucleus to form diploid and female gamete to form diploid
nucleus. zygote.
Syngamy is classified into many types, such as Fertilization is of two types namely,
autogmy, exogamy,hologamy, paedogamy , external fertilization and internal
merogamy etc. fertilization.
Syngamy term is used to denote fusion of Fertilization term is used to denote
gametes occur mostly in invertebrates and fusion of gametes occur in higher
lower grade organisms. invertebrates and all vertebrates.
11. Explain the different kinds of syngamy in living organism
❖ Autogamy : Male and female gametes are produced by the same cell or same
organismand both the gametes fuse together to form a zygote e.g. Actinosphaerium and
Paramecium.
❖ Exogamy : the male and female gametes are produced by different parents and they
fuse toform a zygote. So it is biparental. e.g. Human – dioecious or unisexual animal.
❖ Hologamy : In lower organisms, organisms itself behave as gametes and the fusion of
such mature individuals is known as hologamy e.g. Trichonympha.
❖ Paedogamy - union of young individuals produced immediately after the division of the
adult parent cell by mitosis. Eg. Actinophrys.
❖ Merogamy - fusion of small sized and morphologically different gametes
(merogametes). Eg. Protozoa.
❖ Isogamy : it is the fusion of morphological and physiological identical
gametes(isogametes) Eg. Monocystis.
❖ Anisogamy – it is the fusion of dissimilar gametes is called anisogamy. Anisogamy occurs
in higher animals but it is usually known as fertilization instead of anisogamyor syngamy.
e.g. higher invertebrates and all vertebrates.
ADDTIUONAL QUESTIONS (2 or 3 mark questions)
1. Define the term reproduction.
Reproduction is the fundamental feature of all living organisms. It is a biological process by

which organisms produce their young ones.
2. Mention the two major types of reproduction.
Asexual reproduction and Sexual reproduction
3. Differentate asexual reproduction from sexual reproduction.
Asexual reproduction Sexual reproduction
Single parent involved Two parents involved
Gametes are not formed. Gametes are formed
Meiosis cell division does not occur Meiosis cell division occur during
gametogenesis
Fertilization does not occur Fertilization occurs
Off - springs are genetically identical with Off – springs show variation
the parent.
4. Mention the different types of asexual reproduction.
Fission, budding, fragmentation and regeneration.
5. What is Fission?
Fission is the division of the parent body into two or more identical daughter
individuals.
(Eg) Amoeba and plasmodium
6. Mention the various types of Fission?
Four types of fission are seen in animals.
They are binary fission, multiple fission, sporulation and strobilation.
7. What is Binary fission?
➢ It is a type of asexual reproduction in which the parent organism divides into two halves
and each half forms a daughter individual.
➢ The nucleus divides first amitotically or mitotically (karyokinesis), followed by the
➢ division of the cytoplasm (cytokinesis).
➢ The resultant offsprings are genetically identical to the parent.
8. What are the different types of Binary fission?

i) Simple irregular binary fission
ii) Transverse binary fission
iii) Longitudinal binary fission
iv) Oblique binary fission
9. Briefly explain about different types of binary fission with example.
a. Simple binary fissions:
❖ Simple binary fission is seen in irregular shaped organisms, Eg. Amoeba
❖ In this plane of division is hard to see.
❖ Vacuoles stop to function and disappear.
❖ The nucleoli disintegrate and the nucleus divides mitotically.
❖ The cell then constricts in the middle, and divides to forms two daughter cells.
b. Transverse binary fission
• In this plane of the division runs along the transverse axis of the organism.
e.g. Paramecium and Planaria.
• In Paramecium Macronucleus divides by amitosis
• Micronucleus divides by mitosis.
c. Longitudinal binary fission
• In this nucleus and the cytoplasm divides in the longitudinal axis of the organism.
• In flagellates, the basal granule is divided to forms a two flagellum. e.g. Vorticella
andEuglena.
d. Oblique binary fission
• In this the plane of division is oblique.
• It is seen in dinoflagellates. e.g. Ceratium
10.What is Encystment?
➢ It occurs during unfavorable conditions (increase or decrease in temperature, scarcity
of food)
➢ Amoeba withdraws its pseudopodia and secretes a three-layered, protective, chitinous
cyst wall around it and becomes inactive. This phenomenon is called encystment.
➢ When conditions become favourable, the encysted Amoeba divides by multiple fission
and produces many youmng ones.(pseudopodiospores)
11.What is Strobilation?
In some metazoan animals, a special type of transverse fission called strobilation occurs.
In the process of strobilation, several transverse fissions occur simultaneously giving rise
to a number of individuals which often do not separate immediately from each other
e.g. Aurelia.
12.What is Plasmotomy?
Plasmotomy is the division of multinucleated parent into many multinucleate daughter
individuals with the division of nuclei. Nuclear division occurs later to maintain normal
number of nuclei. Plasmotomy occurs in Opalina and Pelomyxa (Giant Amoeba).
13.What is budding?
Bud is a structure produced as an outgrowth by repeated cell division. Budding is a
type of asexual reproduction in which the parent body produces one or more buds
and each bud grows into a young one. The buds separate from the parent to lead a
normal life. (Eg) Sponges and hydra
14.What are the two types of budding?

➢ Exogenous budding
➢ Endogenous budding
15.What is gemmule?
In some sponges (Noctiluca) hundreds of buds are formed inside the cytoplasm and
many remain within the body of the parent. This is called endogenous budding.
The internal buds are called gemmules. A completely grown gemmule is a hard ball,
consisting of an internal mass of food-laden archaeocytes.
16.What is regeneration?
Regeneration is regrowth in the injured region.
17.What are the two types of regeneration?

Morphallaxis and Epimorphosis.
18.What is Morphallaxix? Give example.
In morphallaxis the whole body grows from a small fragment e.g. Hydra and
Planaria.
19.What is epimorphosis?
Epimorphosis is the replacement of lost body parts.
20.What are the two types of epimorphoisis?

Reparative and restorative regeneration.
➢ Reparative : In reparative regeneration, only certain damaged tissue can be
regenerated,
eg) human being (liver tissue)
➢ Restorative: In restorative regeneration severed body parts can develop.
e.g. star fish, tail of wall lizard.
21.What is conjugation?
➢ Conjugation is the temporary union of the two individuals of the same species.
➢ During their union both individuals, called the conjugants exchange certain amount of
nuclear material (DNA) and then get separated.
➢ Conjugation is common among ciliates, e.g. Paramecium, Vorticella and bacteria
(Prokaryotes).
22.Mention the three phases of life cycle of an animal.
➢ Juvenile phase - Vegetative phase
➢ Reproductive phase - Maturity phase
➢ Senescent phase -
23.How are breeding animals classified?

➢ Breeding animals are of two types: seasonal breeders and continuous breeders.
➢ Seasonal breeders reproduce at particular period of the year such as frogs, lizards, most
birds,
deers etc.,
➢ Continuous breeders continue to breed throughout their sexual maturity e.g.
honey bees, poultry, rabbit etc.,
24.What is senescent phase?

Senescent phase begins at the end of reproductive phase when degeneration sets in the
structure and functioning of the body.
25.Define the term parthenogenesis.

parthenogenesis.
26.What is Arrhenotoky :
In this type of parthenogenesis only males are produced by parthenogenesis.
E.g: honeybees
27.What is Thelytoky :
In this type of parthenogenesis only females are produced by parthenogenesis.
E.g: Solenobia
28.What is Amphitoky :
In this type parthenogenetic egg may develop into individuals of any sex.
E.g: Aphis.
29.Explain different types of parthenogenesis with example.

parthenogenesis
Parthenogenesis is of two main types namely, Natural Parthenogenesis and Artificial
Parthenogenesis.
Natural parthenogenesis.
In certain animals, parthenogenesis occurs regularly,constantly and naturally in their life cycle
and is known as natural parthenogenesis.
Natural parthenogenesis may be of two types, such complete and incomplete.
Complete parthenogenesis:
Parthenogenesis is the only form of reproduction in certain animals and there is
no biparental sexual reproduction. These are no male organisms and so, such individuals
are represented by females only.
Incomplete parthenogenesis:
Incomplete parthenogenesis is found in some animals in which both sexual reproduction and
parthenogenesis occurs. e.g. In honeybees; fertilized eggs (zygotes) develop into queen and
workers, whereas unfertilized eggs develop into drones (male).
Artificial parthenogenesis:
In artificial parthenogenesis the unfertilized egg (ovum) is induced to develop into a
complete individual by physical or chemical stimuli. e.g., Annelid and seaurchin eggs.
ADDITIONAL 5 MARK QUESTIONS:

30. Write a short note on binary fission.
31. Write a short note on budding
32. Write a short note on fragmentation.
33. Write a short note on regeneration.
34. Write a short note on three phases of life cycle of organisms.
CHAPTER -2 HUMAN REPRODUCTION
1. Mention the differences between spermiogenesis and spermatogenesis.
Spermiogenesis Spermatogenesis
The spermatids are transformed into mature Spermatogenesis is the sequence of
spermatozoa (sperms) by the process events in the seminiferous tubules of the
called spermiogenesis. testes that produce the male gametes, the
sperms.
FSH enhances the production of Androgen Spermatogenesis starts at the age of
Binding Protein (ABP) by the sertoli cells and Puberty and initiated by the increased level
helps in the of Gonadotropin Releasing
process of spermiogenesis. Hormone (GnRH) by the hypothalamus.
2. At what stage of development are the gametes formed in new born male and
female?
Male: Spermatogenesis starts at the age of puberty and is initiated due to the increase
in the release of Gonadotropin Releasing Hormone (GnRH) by the hypothalamus.
Female: During foetal development, certain cells in the germinal epithelium of the foetal
ovary divide by mitosis and produce millions of egg mother cells or oogonia. No more oogonia
are formed or added after birth.
3. Expand the acronyms

a. FSH – Follicle Stimulating Hormone
b. LH - Lutenizing Hormone
c. hCG – Human Chorionic Gonadotropin
d. hPL – Human Placental Lactogen
4. How is polyspermy avoided in humans?

Once fertilization is accomplished, cortical granules from the cytoplasm of the ovum
form a barrier called the fertilisation membrane around the ovum preventing further
penetration of other sperms. Thus polyspermy is prevented.
5. What is colostrum? Write its significance.

The mammary glands secrete a yellowish fluid called colostrum during the initial few days
after parturition.
Significant:
➢ It has less lactose than milk and almost no fat, but it contains more proteins, vitamin A
and minerals.
➢ Colostrum is also rich in IgA antibodies.
➢ This helps to protect the infant’s digestive tract against bacterial infection.
➢ Breast milk is the ideal food for infants as it contains all the constituents in suitable
concentration and is easily digestible.
6. Placenta is an endocrine tissue. Justify.

➢ During pregnancy, the placenta acts as a temporary endocrine gland and produces
large quantities of human Chorionic Gonadotropin (hCG), human Chorionic
➢ Somatomammotropin (hCS) or human Placental Lactogen (hPL), oestrogens and
progesterone which are essential for a normal pregnancy.
➢ A hormone called relaxin is also secreted during the later phase of pregnancy
which helps in relaxation of the pelvic ligaments at the time of parturition.
7. Draw a labeled sketch of a spermatozoan.
8. What is inhibin? State its functions.

Inhibin is a hormone secreted by the Sertoli cells of the human testes.
Inhibin is involved in the negative feedback control of sperm production.
9. Mention the importance of the position of the testes in humans.
➢ The testes in human are located inside the scrotum,
➢ The scrotum is a sac of skin that hangs outside the abdominal cavity.
➢ Since viable sperms cannot be produced at normal body temperature, the
scrotum is placed outside the abdominal cavity to provide a temperature 2-3oC
lower than the normal internal body temperature. Thus, the scrotum acts as a
thermoregulator for spermatogenesis.
10.What is the composition of semen?

➢ Semen or seminal fluid is a milky white fluid which contains sperms and the seminal
plasma
➢ Seminal plasma containing fructose sugar, ascorbic acid, prostaglandins and a
coagulating enzyme called vesiculase. It also contains citrate, several enzymes and
prostate specific antigens.
11.Explain the process of fertilization and implantation of the fertilized ovum.

Fertilization:
➢ Fertilisation occurs when a haploid sperm fuses with a haploid ovum to form a fertilized
➢ egg or diploid zygote.
➢ The sperms deposited in the female reproductive tract undergo capacitation, which
is a biochemical event that enables the sperm to penetrate and fertilise the egg.
➢ Fertilisation occurs only if the ovum and sperms are transported simultaneously to the
ampullary isthmic junction of the fallopian tube.
➢ Multiple layers of granulosa (follicular) cells around the ovum form the corona radiate.
➢ The follicular cells are held together by an adhesive cementing substance called
hyaluronic acid.
➢ The acrosome of sperms contains a proteolytic enzyme called hyaluronidase.
➢ The acrosomal membrane disintegrates releasing the proteolytic enzyme,
hyaluronidase during sperm entry through the corona radiata and zona pellucida. This is
called acrosomal reaction.
➢ Once fertilization is accomplished, cortical granules from the cytoplasm of the ovum
form a barrier called the fertilisation membrane around the ovum preventing further
penetration of other sperms. Thus polyspermy is prevented.
Implantation:
➢ The first cleavage produces two identical cells called blastomeres. These produce 4 cells,
then 8 and so on. After 72 hours of fertilisation, cluster of 16 or more cells called the
morula
➢ The dividing embryo takes 4-5 days to move through the fallopian tube into the
uterine cavity and finally gets implanted in the uterine wall.
➢ At this point the embryo consists of a fluid filled hollow ball of about 100 cells, called the
blastocyst.
➢ The blastocyst is composed of a single layer of large flattened cells called trophoblast
and a small cluster of 20-30 rounded cells called the inner cell mass.
➢ The inner cell mass of the blastocyst develops into the embryo and becomes embedded
in the endometrium of the uterus. This process is called implantation and it results in
pregnancy.
12.Define gametogenesis.
Gametogenesis is the process of formation of gametes i.e., sperms and ovary from the
primary sex organs in all sexually reproducing organisms. Meiosis plays the most
significant role in the process of gametogenesis
13.Describe the structure of the human ovum with a neat labelled diagram.
• Human ovum is non-cleidoic, alecithal and microscopic in nature.
• Its cytoplasm called ooplasm contains a large nucleus called the germinal vesicle.
• The ovum is surrounded by three coverings namely an inner thin transparent
vitelline membrane, middle thick zona pellucida and outer thick coat of follicular
cells called corona radiata.
• Between the vitelline membrane and zona pellucida is a narrow perivitelline
space.
(For diagram Ref. Text Book)
14.Give a schematic representation of spermatogenesis and oogenesis in humans.
15.Explain the various phases of the menstrual cycle.
Menstrual cycle comprises of the following phases

1. Menstrual phase
2. Follicular or proliferative phase
3. Ovulatory phase
4. Luteal or secretory phase
1. Menstrual phase
• The cycle starts with the menstrual phase when menstrual flow occurs and lasts for 3-5
days.
• Menstrual flow is due to the breakdown of endometrial lining of the uterus, and its
blood
vessels due to decline in the level of progesterone and oestrogen.
• Menstruation occurs only if the released ovum is not fertilized. Absence of menstruation
may be an indicator of pregnancy.
• However it could also be due to stress, hormonal disorder and anaemia.
2. Follicular or proliferative phase
• The follicular phase extends from the 5th day of the cycle until the time of ovulation.
• During this phase, the primary follicle in the ovary grows to become a fully mature
Graafian follicle and simultaneously, the endometrium regenerates through
proliferation.
• These changes in the ovary and the uterus are induced by the secretion of
gonadotropins like FSH and LH, which increase gradually during the follicular phase. It
stimulates follicular development and secretion of oestrogen by the follicle cells.
3. Ovulatory phase
• Both LH and FSH attain peak level in the middle of the cycle (about the 14th day).
• Maximum secretion of LH during the mid cycle called LH surge induces the rupture of
the Graafian follicle.
• The release of the ovum (secondary oocyte) from the ovary wall into the peritoneal
cavity. This process is called as ovulation.
4. Luteal or secretory phase
• The remaining part of the Graafian follicle is transformed into a transitory endocrine
gland called corpus luteum.
• The corpus luteum secretes large amount of progesterone which is essential for the
maintenance of the endometrium.
• If fertilisation takes place, it paves way for the implantation of the fertilized ovum.
• The uterine wall secretes nutritious fluid in the uterus for the foetus. So, this phase is
also called as secretory phase.
• During pregnancy all events of menstrual cycle stop and there is no menstruation.
• In the absence of fertilisation, the corpus luteum degenerates completely and leaves a
scar tissue called corpus albicans. It also initiates the disintegration of the endometrium
leading to menstruation, marking the next cycle.
16.Explain the role of oxytocin and relaxin in parturition and lactation.

Relaxin:
➢ Relaxin is a hormone secreted by the placenta and also found in the corpus luteum.
➢ It promotes parturition by relaxing the pelvic joints and by dilatation of the cervix with
continued powerful contractions.
➢ It enhances the rupture of amnion and the flow of amniotic fluid out through the vagina,
followed by the foetus.
Oxytocin:
➢ Oxytocin secreted from the neurohypophysis which in turn brings about the powerful
contraction of the uterine muscles and leads to the expulsion of the baby through the
birth canal. This sequence of events is called as parturition or childbirth.
➢ Oxytocin causes the “Let-Down” reflexthe actual ejection of milk from the alveoli of the
mammary glands.
➢ During lactation, oxytocin also stimulates the recently emptied uterus to contract,
helping it to return to pre pregnancy size.
17.Identify the given image and label its parts marked as a, b, c and d. (for diagram refer
text book)
a. Vitelline membrane
b. Nucleus
c. Zona pellucid
d. Corona radiata
18. The following is the illustration of the sequence of ovarian events (a-i) in a human
female.
a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it
represted.
Figure that illustrates ovulation – F

Stage of oogenesis it represents – Meiosis I
b) Name the ovarian hormone and the pituitary hormone that have caused the above –
mentioned events.
Ovarian hormones – Oestrogen and Progesterone

Pituitary hormones – Follicle Stimulating Hormone & Lutenizing Hormone
c) Explain the changes that occur in the uterus simultaneously in anticipation.

➢ At the beginning of the menstrual cycle the endometrial lining of the uterus and its
blood vessel break due to decline of progesterone and oestogen
➢ The primary follicle develops into mature graafian follicle and endometrium regenerates
through proliferation by the secretion of FSH and LH.
➢ Ovulation occurs when the LH is at the peak.
➢ After ovulation the empty follicle converted into corpus luteum and secretes
progesterone and prepares the endometrium (uterus) to receive the egg if it is fertilized.
d) Write the difference between C and H.
C is secondary follicle H is corpus luteum

It is surrounded by many layers of granular It is the empty graafian follicle after release
follicular cells and contains ovum of(without) ovum.
It develops into mature graafian follicle It acts as transitory endocrine gland secretes
progesterone
Presence of theca layer Absences of theca layer
19. List the various menstrual disorders.

a) Amenorrhoea (Primary amenorrhoea & secondary amenorrhoea)
b) Polymenorrhoea
c) Dysmenorrhoea (Primary dysmenorrhoea Secondary dysmenorrhoea)
d) Menorrhagia.
e) Oligomenorrhoea
ADDITIONAL QUESTIONS: (2 /3 Mark)
1. List out the major functions of reproductive system.

➢ to produce the gametes namely sperms and ova
➢ to transport and sustain these gametes
➢ to nurture the developing offspring
➢ to produce hormones
2. Why scrotum called as thermoregulator ?

➢ Scrotum is a sac of skin that hangs outside the abdominal cavity.
➢ Scrotum is placed outside the abdominal cavity to provide a temperature 2-3oC
lowerthan the normal internal body temperature to produce viable sperm.
➢ Hence, the scrotum called as a thermoregulator for spermatogenesis.
3. What are sertoli cells? Write its significance. Or Name the two cells found in
seminiferous tubule and mention their role.
➢ The stratified epithelium of the seminiferous tubule is made of two types of cells namely
sertoli cells and spermatogonic cells.
➢ Sertoli cells are nurce cells.
➢ Sertoli cells are elongated and pyramidal and provide nourishment to the sperms till
maturation.
➢ spermatogonic cells are called male germ cells, they develop into male
gametes(sperms)after puberty.
4. What are Leydig cells? Write its significance.
➢ Interstitial cells of testes are called as Leydig cells.

➢ Leydig cells are embedded in the soft connective tissue surrounding the seminiferous
tubules.
➢ These cells are endocrine in nature and are characteristic features of the testes of
mammals.
➢ These cells secrete androgens namely the testosterone hormone which initiates the
process of spermatogenesis.
5. Define the term spermatogenesis.

Spermatogenesis is the sequence of events in the seminiferous tubules of the testes that
produce the male gametes, the sperms.
6. Define the term spermiogenesis.
The spermatids are transformed into mature spermatozoa (sperms) by the process called
spermiogenesis.
7. Define the term spermiation.

Sperms are finally released into the cavity of seminiferous tubules by a process called
spermiation.
8. What is nebenkern?
The middle piece possesses mitochondria spirally twisted around the axial filament
calledmitochondrial spiral or nebenkern.
Nebenkern - It produces energy in the form of ATP molecules for the movement ofsperms.
9. Define Menstrual cycle.

The menstrual or ovarian cycle occurs approximately once in every 28/29 days
during the reproductive life of the female from menarche (puberty) to menopause except
during pregnancy. The cycle of events starting from one menstrual period till the next one is
called the menstrual cycle
10.Define Menopause.
Menopause is the phase in a women’s life when ovulation and menstruation stops.
The average age of menopause is 45-50 years. It indicates the permanent cessation of the
primary functions of the ovaries.
11.Why are menstrual cycles absent during pregnancy?

High level of progesterone and estrogens during pregnancy suppress the gonadotropin swhich
is required for the development of new follicles. Therefore, a new cycle cannot be initiated.
12.What is Mozygotic twins?

Monozygotic (Identical) twins are produced when a single fertilized egg splits into two during
the first cleavage. They are of the same sex,look alike and share the same genes.
13.What is Dizygotic twins?

Dizygotic (Fraternal) twins are produced when two separate eggs are fertilised by two
separate sperms. The twins may be of the same sex or different sex and are non-identical.
14.What is Siamese?
Siamese (United) twins are the conjoined twins who are joined during birth.
20. What is the role of placenta during pregnancy?
a) Provide nutrient to embryo
b) Supply of O2 to embryo
c) Removal of CO2 produced by the embroyo
d) Produces several hormones
15.Mention the accessory glands of male reproductive system.

➢ paired seminal vesicles
➢ paired bulbourethral glands also called Cowper’s gland
➢ a single prostate gland.
➢ The secretion of these glands is collectively called semen or seminal fluid.
16.List out the functions of seminal fluid.

➢ The seminal fluid acts as a transport medium,
➢ provides nutrients,
➢ contains chemicals that protect and activate the sperms and also
➢ facilitate the movement of sperms.
17.Mention the extra embryonic membranes write down their functions.

Extra embryonic membranes: Amnion, yolk sac, allantois and chorion
Function:
These membranes collectively protect the embryo from dessication, mechanical shock and
help in the absorption of nutrients and exchange of gases
➢ The amnion is a double layered translucent membrane filled with the amniotic fluid. It
provides a buoyant environment to protect the developing embryo from injury,
regulates the temperature of the foetus and provides a medium in which the foetus can
move.
➢ The yolk sac forms a part of the gut and is the source of the earliest blood cells and
blood vessels.
➢ The allantois forms a small out pocketing of embryonic tissue at the caudal end of the
yolk sac. It is the structural base for the umbilical cord that links the embryo to the
placenta and ultimately it becomes part of the urinary bladder.
➢ The chorion is the outermost membrane which encloses the embryo and all other
membranes and also helps in the formation of the placenta.
ADDITIONAL QUESTIONS: (5 Mark)
1. List out and define the various events of reproduction.

• Gametogenesis: Formation of gametes by spermatogenesis and oogenesis.
• Insemination: Transfer of sperms by the male into the female genital tract.
• Fertilisation: Fusion of male and female gametes to form zygote, called fertilisation.
• Cleavage: Rapid mitotic divisions of the zygote which convert the single celled zygote into a
multicellular structure called blastocyst.
• Implantation: Attachment of blastocyst to the uterine wall.
• Placentation: Formation of placenta which is the intimate connection between
foetus and uterine wall of the mother for exchange of nutrients.
• Gastrulation: Process by which blastocyst is changed into a gastrula with three primary germ
layers
• Organogenesis: Formation of specific tissues, organs and organ systems from three germ
layers.
• Parturition: Expulsion of the foetus from the mother’s womb.
2. List out the various menstrual disorders. Explain Menstrual disorders

✓ Absence of menstruation is called amenorrhoea.
✓ If menarche does not appear till the age of 18, it is called primary amenorrhoea.
✓ Absence of menstruation for over three consecutive months is secondary amenorrhoea.
✓ Polymenorrhoea is a term used to describe a menstrual cycle that is shorter than 21
days.
✓ It may be due to hyperactivity of the anterior pituitary gland.
✓ Chronic pelvic inflammation by certain sexually transmitted diseases (STD) such
aschlamydiasis or gonorrhoea can cause inflammation in the uterus causing
polymenorrhoea.
✓ Pain associated with menstruation is called dysmenorrhoea. There are two types
ofdysmenorrhoea viz primary and secondary dysmenorrhoea.
✓ Primary dysmenorrhoea is pain or cramps during menstrual period caused by secretion
of prostagland in the uterus.
✓ Secondary dysmenorrhoea is caused by a disorder in the reproductive system
likeendometriosis or uterine fibroids.
✓ Heavy and prolonged menstrual period that disrupts a woman’s normal activities is
referredto as menorrhagia.
✓ Menorrhagia may be due to hormonal imbalance, ovarian dysfunction, uterine fibroids
and mayalso be due to cancer of the ovary, uterus or cervix.
✓ Oligomenorrhoea is a condition with infrequent menstrual periods. It occurs in women
of child bearing age.
3. Describe the structure of male gamete. (spermatozoa)
➢ The human sperm is a microscopic, flagellated and motile gamete.

➢ The whole body of the sperm is enveloped by plasma membrane.
➢ It is composed of a head, neck, middle piece and a tail.
Head:
➢ The head comprises of two parts namely acrosome and nucleus.
➢ Acrosome is a small cap like pointed structure present at the tip of the nucleus and is
formed mainly from the Golgi body of the spermatid. It contains hyaluronidase, a
➢ proteolytic enzyme, popularly known as sperm lysin which helps to penetrate the ovum
during fertilisation.
➢ The nucleus is flat and oval.
Neck:
➢ The neck is very short and is present between the head and the middle piece.
➢ It contains the proximal centriole towards the nucleus which plays a role in the first
division of the zygote and the distal centriole gives rise to the axial filament of the
sperm.
Middle piece:
➢ The middle piece possesses mitochondria spirally twisted around the axial filament
➢ called mitochondrial spiral or nebenkern. It produces energy in the form of ATP
➢ molecules for the movement of sperms.
Tail:
➢ The tail is the longest part of the sperm and is slender and tapering.
➢ It is formed of a central axial filament or axoneme and an outer protoplasmic sheath.
The lashing movements of the tail push the sperm forward. For diagram refer text book)
Possible long answer type questions:
1. Describe the structure of male primary sex organ (testes).

2. Describe the structure of female primary sex organ (ovary)
3. Describe the structure of Fallopian tube in female reproductive system.
4. Describe the structure of uterus.
5. Write short note on mammary gland.
CHAPTER 3 REPRODUCTIVE HEALTH
1. Select the correct term from the bracket and complete the given branching tree
Periodic abstinence
Natural methods
B
Coitus interruptus
A
Condoms, vaults, Caps etc
Birth control
methods Oral
contraceptives Pills
Surgical methods Vasectomy

C
IUDs D
(Barriers, Lactational amenorrhoea, CuT, Tubectomy)
(A) Barriers
(B) Lactational amenorrhoea
(C) Tubectomy
(D) CuT
2. Correct the following statements

a) Transfer of an ovum collected from donor into the fallopian tube is called ZIFT.
b) Transfering of an embryo with more than 8 blastomeres into uterus is called GIFT.
c) Multiload 375 is a hormone releasing IUD.
Correct answer:
a) Transfer of an ovum collected from donor into the fallopian tube is called GIFT (Gamete
Intra Fallopian Transfer).
b) Transfering of an embryo with more than 8 blastomeres into uterus is called IUT(Intra
Uterine Transfer)
c) Multiload 375 is a copper releasing IUD
3. Which method do you suggest the couple to have a baby, if the male partner fails to
inseminate the female or due to very low sperm count in the ejaculate?
Ans: Intra – Uterine Insemination (IUI)
4. . Expand the following
a) ZIFT - Zygote intra - fallo–ian transfer
b) ICSI - Intra- cytoplasmic sperm injection
5. What are the strategies to be implemented in India to attain total reproductive health?
• Creating awareness and providing medical assistance to build a healthy society.
• Introducing sex education in schools to provide information about adolescence and
adolescence related changes.
• Educating couples and those in the marriageable age groups about the available birth
control methods and family planning norms.
• Creating awareness about care for pregnant women, post-natal care of mother and
child and the importance of breast feeding.
• Encouraging and supporting governmental and non-governmental agencies to identify
new methods and/or to improve upon the existing methods of birth control.
6. Differentiate foeticide and infanticide.

Foeticide Infanticide.
Female foeticide refers to ‘aborting the Female infanticide refers to ‘killing the
female in the mother’s womb’ female child after her birth’.
It is legal under certain conditions. It is against law under any condition.
7. How are STDs transmitted?

• Normally STI are transmitted from person to person during intimate sexual contact with
an infected partner.
• Infections like Hepatitis-B and HIV are transmitted sexually as well as by sharing of
infusion needles, surgical instruments, etc with infected people, blood transfusion or
from infected mother to baby.
8. Write the preventive measures of STDs.

a. Avoid sex with unknown partner/ multiple partners
b. use condoms
c. In case of doubt, consult a doctor for diagnosis and get complete treatment.
9. The procedure of GIFT involves the transfer of female gametes into the fallopain
tube, can gametes be transferred to the uterus to achieve the same result? Explain.
No, gametes cannot be transferred to the uterus to achieve the same result.
Reason:
Fertilization can occur only in the fallopian tube not in the uterus. So, gametes should be
transferred to fallopian tube not into the uterus to achieve pregnancy.
10.Amniocentesis, the foetal sex determination test, is banned in our country, Is it
necessary? comment.
➢ Yes it is necessary.
➢ Amniocentesis is a prenatal technique used to detect any chromosomal abnormalities in
the foetus and it is being often misused to determine the sex of the foetus.
➢ Once the sex of the foetus is known, there may be a chance of female foeticide.
➢ Therefore it is banned in our country.
11.Open Book Assessment

‘ Healthy reproduction, legally checked birth control measures and proper family
planning programmes are essential for the survival of mankind’ Justify.
➢ Reproductive health represents a society with people having physically and functionally
➢ normal reproductive organs.
➢ Healthy people have healthier babies and are able to care for their family, and
contribute more to the society and community. Hence, health is a community issue.
➢ Increased health facilities and better living conditions have enhanced longevity.
➢ According to a recent report from the UN, India’s population has already reached 1.26
billion and is expected to become the largest country in population size, surpassing
China around 2022.
➢ Population explosion may cause scarcity of food, water, space, lack of employment,
spread of diseases etc.
➢ To overcome the problem of population explosion, birth control is the only available
solution. People should be motivated to have smaller families by using various
contraceptive devices.
12. Describe the major STDs and their symptoms.
Major STDs and their symptoms

Bacterial STD Symptoms
1. Gonorrhoea Affects the urethra, rectum and throat and in females the cervix also get affected.
Pain and pus discharge in the genital tract and burning sensation during urination.
2. Syphilis Primary stage - Formation of painless ulcer on the external genitalia.

Secondary stage -Skin lesions, rashes, swollen joints,fever and hair loss.
Tertiary stage
Appearance of chronic ulcers on nose,lower legs and palate. Loss of
movement,mental disorder, visual impairment, heart problems, gummas (soft
non-cancerous growths) etc
3. Chlamydiasis Trachoma , affects the cells of the columnar epithelium in the urinogenital tract,
respiratory tract and conjunctiva.
4. Lymphogranuloma Cutaneous or mucosal genital damage, urithritis and endocervicitis.
venereum Locally harmful ulcerations and genital elephantiasis.
Viral STD Symptoms

1. Genital herpes Sores in and around the vulva, vagina,urethra in female or sores on or aroundthe
penis in male.
Pain during urination, bleeding between periods.
Swelling in the groin nodes.
2. Genital warts Hard outgrowths (Tumour) on the external genitalia, cervix and
perianal region.
3. Hepatitis-B Fatigue, jaundice, fever, rash and stomach pain.

Liver cirrhosis and liver failure occur in
the later stage.
4. AIDS Enlarged lymph nodes, prolonged fever, prolonged diarrhoea, weight reduction,
night sweating.
Fungal STD Symptoms
1.Candidiasis Attacks mouth, throat, intestinal tract and vagina.
Vaginal itching or soreness, abnormal vaginal discharge and pain during urination.
Protozoan STD Symptoms
1. Trichomoniasis Vaginitis , greenish yellow vaginal discharge, itching and burning sensation,
urethritis, epididymitis andprostatitis
13. Explain the various barrier methods to control human polpulation
Barrier methods In these methods, the bovum and sperm are prevented from meeting so that
fertilization does not occur.
a. Chemical barrier:
Foaming tablets, melting suppositories, jellies and creams are used as chemical agents that
inactivate the sperms in the vagina.
b. Mechanical barrier:
➢ Condoms are a thin sheath used to cover the penis in male whereas in female it is used
to cover vagina and cervix just before coitus so as to prevent the entry of ejaculated
semen into the female reproductive tract.
➢ This can prevent conception. Condoms are made of polyurethane, latex and lambskin.
➢ Diaphragms, cervical caps and vaults are made of rubber and are inserted into the
female reproductive tract to cover the cervix before coitus in order to prevent the
sperms from entering the uterus.
c. Hormonal barrier:
It prevents the ovaries from releasing the ova and thickens the cervical fluid which keeps the
sperm away from ovum.
Oral contraceptives:
➢ Pills are used to prevent ovulation by inhibiting the secretion of FSH and LH hormones.
➢ A combined pill is the most commonly used birth control pill.
➢ It contains synthetic progesterone and estrogen hormones. Saheli, contraceptive pill by
Central Drug Research Institute (CDRI) in Lucknow,
➢ India contains a non-steroidal preparation called centchroman.
d. Intrauterine Devices (IUDs):
➢ Intrauterine devices are inserted by medical experts in the uterus through the vagina.
➢ These devices are available as copper releasing IUDs, hormone releasing IUDs and non-
medicated IUDs.
➢ IUDs increase phagocytosis of sperm within the uterus.
➢ IUDs are the ideal contraceptives for females who want to delay pregnancy.
➢ It is one of the popular methods of contraception in India and has a success rate of 95 to
99%.
Copper releasing IUDs differ from each other by the amount of copper.
Copper IUDs such as Cu T-380 A, Nova T, Cu 7, Cu T 380 Ag, Multiload 375, etc. release free
copper and copper salts into the uterus and suppress sperm motility.
They can remain in the uterus for five to ten years.
Hormone-releasing IUDs such as Progestasert and LNG – 20 are often called as intrauterine
systems (IUS). They increasethe viscosity of the cervical mucus and thereby prevent sperms
from entering the cervix.
Non-medicated IUDs are made of plastic or stainless steel. Lippes loop is a double S-shaped
plastic device.
ADDITIONAL QUESTIONS: (2/3 mark)

1. Expand:
RCH –Reproductive and Child Health Care
UNDP’s GII – United Nations’s Developmental Programme Gender Inequality Index.
PCPNDT Act – Pre conception and Pre –Natal Diagnastic Technique Act
POCSO Act – Prevention of Children from Sexual Offences
2. Objective of PCPNDT Act:
➢ To ban the identification of sex
➢ To Prevent the use of prenatal diagnostic techniques for selective abortion.
➢ To ensure survival, provision of better nutrition and education
➢ To ensure protection and empowerment of girls by eliminating the differences in the sex
ratio , infant mortality rate
➢ Improving their nutritional and educational status.
3. Mention any two slogans for motivating to control population growth in Tamilnadu.
Naam iruvar namakku iruvar (we two, ours two)
Naam iruvar namakku oruvar (we two, ours one)
4. What is birth control?

The voluntary use of contraceptive procedures to prevent fertilization or prevent
implantation of a fertilized egg in the uterus is termed as birth control.
5. Mention the two contraceptive methods.

➢ Temporary contraceptive methods
➢ Permanent contraceptive methods
6. Mention the various temporary contraceptive methods.
Natural method
a) Periodic abstinence ( rhythm method)
b) Continuous abstinence
c) Coitus interruptus
d) Lactational amenorrhoea
Barrier methods
a) Chemical barrier
b) Mechanical barrier
c) Hormonal barrier
d) Intra uterine devices
Mention the permanent birth control measure and its types.
Surgical sterilization methods
a) Tubectomy
b) Vasectomy
7. Give examples for sexually transmitted diseases.
Hepatitis, AIDS, Syphilis, Genetal warts, Genetal herps etc.
8. Write a short note on MTP (Medical Termination of Pregnancy)
➢ Medical method of abortion is a voluntary or intentional termination of pregnancy in a
non-surgical or non-invasive way.
➢ Early medical termination is extremely safe upto 12 weeks (the first trimester) of
pregnancy and generally has no impact on a women’s fertility.
➢ Abortion during the second trimester is more risky as the foetus becomes intimately
associated with the maternal tissue.
9. What is ART? (Assisted reproductive technology )
A collection of procedures, which includes the handling of gametes and/or embryos
outside the body to achieve a pregnancy, is known as Assisted Reproductive Technology.
It increases the chance of pregnancy in infertile couples.
10.Mention the various methods included in ART.
ART includes
IUI -intra-uterine insemination,
IVF - in vitro fertilization,
ET - Embryo transfer,
ZIFT - Zygote intra-fallopian transfer
GIFT - Gamete intrafallopian transfer
ICSI - Intra-cytoplasmic sperm injection,
Preimplantation genetic diagnosis, oocyte and sperm donation and surrogacy.
11.What is IUI ? (Intra-uterine insemination)
➢ This is a procedure to treat infertile men with low sperm count.
➢ The semen is collected either from the husband or from a healthy donor and is
introduced into the uterus through the vagina by a catheter after stimulating the ovaries
to produce more ova.
➢ The sperms swim towards the fallopian tubes to fertilize the egg, resulting in normal
pregnancy.
12.What is ZIFT? (Zygote intra-fallopian transfer)

As in IVF, the zygote upto 8 blastomere stage is transferred to the fallopian tube by
laparoscopy.
The zygote continues its natural divisions and migrates towards the uterus where it gets
implanted.
13.What is IUT? (Intra uterine transfer )

Embryo with more than 8 blastomeres is inserted into uterus to complete its further
development.
14. What is GIFT? (Gamete intra-fallopian transfer )

➢ Transfer of an ovum collected from a donor into the fallopian tube.
➢ In this the eggs are collected from the ovaries and placed with the sperms in one of the
fallopian tubes.
➢ The zygote travels toward the uterus and gets implanted in the inner lining of the
uterus.
15.Intra-cytoplasmic sperm injection (ICSI)

➢ In this method only one sperm is injected into the focal point of the egg to fertilize.
➢ The sperm is carefully injected into the cytoplasmof the egg. Fertilization occurs in 75 -
85% of eggs injected with the sperms.
➢ The zygote is allowed to divide to form an 8 celled blastomere and then transferred to
the uterus to develop a protective pregnancy.
16.Amniocentesis
➢ Amniocentesis involves taking a small sample of the amniotic fluid that surrounds the
foetus to diagnose for chromosomal abnormalities
➢ Amniocentesis is generally performed in a pregnant woman between the 15th and 20th
weeks of pregnancy by inserting a long, thin needle through the abdomen into the
amniotic sac to withdraw a small sample of amniotic fluid.
➢ The amniotic fluid contains cells shed from the foetus.
17.Chorionic villus sampling (CVS)
CVS is a prenatal test that involves taking a sample of the placental tissue to test for
chromosomal abnormalities.
18.What do you mean by Surrogacy

➢ Surrogacy is a method of assisted reproduction or agreement whereby a woman agrees
to carry a pregnancy for another person, who will become the newborn child's parent
after birth.
➢ Through in vitro fertilization (IVF), embryos are created in a lab and are transferred into
the surrogate mother's uterus.
➢ Azoospermia is defined as the absence of spermatozoa in the ejaculate semen on at
least two occasions and is observed approximately in 1% of the population.
19.How is Male infertility prevented?

Micro-testicular sperm extraction (TESE)
➢ Microsurgical sperm retrieval from the testicle involves a small midline incision in the
scrotum, through which one or both testicles can be seen.
➢ Under the microscope, the seminiferous tubules are dilated and small amount of
testicular tissue in areas of active sperm production are removed and improved for
sperm yield compared to traditional biopsy techniques.
20.What is Ultrasound scanning? How is it useful to detect foetal disorders.

➢ Ultrasound has no known risks other than mild discomfort due to pressure from the
transducer on the abdomen or vagina.
➢ No radiation is used during this procedure.
➢ Ultrasonography is usually performed in the first trimester for dating, determination of
the number of foetuses, and for assessment of early pregnancy complications.
ADDITIONAL QUESTIONS: (5mark)

1. What is natural birth control method? Describe various natural birth control methods.
Natural method is used to prevent meeting of sperm with ovum. i.e., Rhythm method
(safe period), coitus interruptus, continuous abstinence and lactational amenorrhoea.
a. Periodic abstinence/rhythm method:

Ovulation occurs at about the 14th day of the menstrual cycle. Ovum survives for about two
days and sperm remains alive for about 72 hours in the female reproductive tract. Coitus is to
be avoided during this time.
b. Continuous abstinence:
It is the simplest and most reliable way to avoid pregnancy is not to have coitus for a defined
period that facilitates conception.
c. Coitus interruptus :
It is the oldest family planning method. The male partner withdraws his penis before
ejaculation, thereby preventing deposition of semen into the vagina.
d. Lactational amenorrhoea:
Menstrual cycles resume as early as 6 to 8 weeks from parturition. However, the reappearance
of normal ovarian cycles may be delayed for six months during breastfeeding.
This delay in ovarian cycles is called lactational amenorrhoea. It serves as a natural, but an
unreliable form of birth control.
2. What is permanent birth control method? Describe the two types of permanent birth
control method.
Permanent birth control methods areadopted by the individuals who do not want
to have any more children.
Surgical sterilisation methods are the permanent contraception methods advised for
male and female partners to prevent any more pregnancies.
It blocks the transport of the gametes and prevents conception.
Tubectomy:
Tubectomy is the surgical sterilisation in women.
In this procedure, a small portion of both fallopian tubes are cut and tied up through a small
incision in the abdomen or through vagina.
This prevents fertilization as well as the entry of the egg into the uterus.
Vasectomy:
Vasectomy is the surgical procedure for male sterilisation.
In this procedure, both vas deferens are cut and tied through a small incision on the scrotum
to prevent the entry of sperm into the urethra.
Vasectomy prevents sperm from heading off to penis as the discharge has no sperms in it.
Possible 5 mark questions:

3. Describe the cause, symptoms, diagnosis and preventive measures of cervical cancer.
4. List out the various causes infertility.
5. In vitro fertilization (IVF) or Test tube baby
CHAPTER 4 PRINCIPALS OF INHERITANCE AND VARIATION
1. What is haplodiploidy?
Haplodiploidy in Honeybees
➢ In this system, the sex of the offspring is determined by the number of sets of
chromosomes the organism receives.
➢ Fertilized eggs develop into females (Queen or Worker) and unfertilized eggs
develop into males (drones) by parthenogenesis.
➢ It means that the males have half the number of chromosomes (haploid) and the
females have double the number (diploid), hence this type of sex determination
is called haplodiploidy.
(Eg) Hymenopteran insects such as honeybees, ants and wasps.
2. Distinguish between heterogametic and homogametic sex determination systems.

Heterogametic sex determination systems Homogametic sex determination systems
In this system individuals have homomorphic In this system individuals have
sex chromosomes heteromorphic sex chromosomes
Produce only one type of gametes. Produce two types of gametes.
(Eg) Human male with XY chromosomes (Eg) Human female with XX chromosomes
3. What is Lyonisation?
➢ The condensed X chromosome is called Barr body.
➢ Mary Lyon suggested that Barr bodies represented an inactive chromosome,
which in females become coiled into a heterochromatin, a condensed and visible
form of chromatin. This is called Lyon’s hypothesis or Lyonisation.
➢ The number of Barr body follow N-1 rule.
4. What is criss-cross inheritance?

➢ Inheritance of X linked characters from grandfather to grandson through carrier
daughter is called criss cross inheritance.
➢ It is also called Zig-Zag inheritance
5. Why are sex linked recessive characters more common in the male human beings?
➢ Sex linked inherited traits are more common in males than females because,
males are hemizygous and therefore express the trait when they inherit one
mutant allele.
➢ The X–linked genes have no corresponding alleles in the Y chromosome.
➢ The Y linked genes have no corresponding allele in X chromosome.
➢ The Y linked genes inherit along with Y chromosome and they phenotypically
express only in the male sex.
6. What are holandric genes?
➢ Sex linked inherited traits are more common in males than females because,
males are hemizygous and therefore express the trait when they inherit one
mutant allele.
➢ The X–linked genes have no corresponding alleles in the Y chromosome.
➢ The Y linked genes have no corresponding allele in X chromosome.
➢ The Y linked genes inherit along with Y chromosome and they phenotypically
express only in the male sex.
7. Mention the symptoms of Phenylketonuria.
➢ Severe mental retardation,
➢ Light pigmentation of skin and hair.
➢ Phenylpyruvic acid is excreted in the urine.
8. Mention the symptoms of Down’s syndrome.

➢ Severe mental retardation, defective development of the central nervous system,
➢ Increased separation between the eyes,
➢ Flattened nose,
➢ Ears are malformed,
➢ Mouth is constantly open and the tongue protrudes.
9. Explain the genetic basis of ABO blood grouping in man.

➢ Bernstein in 1925 discovered that the inheritance of different blood groups in
human beings is determined by a number of multiple allelic series.
➢ The three autosomal alleles located on chromosome 9 are concerned with the
determination of blood group in any person.
➢ The gene controlling blood type has been labeled as ‘L’ (after the name of the
discoverer, Landsteiner) or I (from isoagglutination).
➢ The I gene exists in three allelic forms, IA, IB and IO. IA specifies A antigen. IB
allele determines B antigen and IO allele specifies no antigen.
➢ Individuals who possess these antigens in their fluids such as the saliva are called
secretors.
➢ Each allele (IA and IB) produces a transferase enzyme. IA allele produces N-acetyl
galactose transferase and can add N-acetyl galactosamine (NAG) and IB allele
encodes for the enzyme galactose transferase that adds galactose to the
precursor (i.e. H substances) In the case of IO/IO allele no terminal transferase
enzyme is produced and therefore called “null” allele and hence cannot add NAG
or galactose to the precursor.
➢ From the phenotypic combinations it is evident that the alleles IA and IB are
dominant to IO, but co-dominant to each other (IA=IB).
➢ Their dominance hierarchy can be given as (IA=IB> IO). A child receives one of
three alleles from each parent, giving rise to six possible genotypes and four
possible blood types (phenotypes). The genotypes are IAIA, IA IO, IBIB, IB IO, IAIB
and IO IO.
10.How is sex determination in human beings?

➢ Genes determining sex in human beings are located on two sex chromosomes, called
allosomes.
➢ In mammals, sex determination is associated with chromosomal differences between
the two sexes, typically XX females and XY males.
➢ 23 pairs of human chromosomes include 22 pairs of autosomes (44A) and one pair of
sex chromosomes (XX or XY).
➢ Females are homogametic producing only one type of gametes (egg), each containing
one X chromosome while the males are heterogametic producing two types of sperms
with X and Y chromosomes.
11.What is male heterogamety?

In this method of sex determination the males are heterogametic producing dissimilar
gametes while females are homogametic producing similar gametes. It is of two kinds
XX-XO type and XX-XY type.
12.Brief about female heterogamety?
➢ In this method of sex determination, the homogametic male possesses two ‘X’
chromosomes as in certain insects and certain vertebrates like fishes, reptiles and birds
producing a single type of gamete; while females produce dissimilar gametes.
➢ The female sex consists of a single ‘X’ chromosome or one ‘X’ and one ‘Y’ chromosome.
Thus the females are heterogametic and produce two types of eggs. To avoid confusion
with the XX-XO and XX-XY types of sex
➢ determination, the alphabets ‘Z’ and ‘W’ are used here instead of X and Y respectively.
➢ Heterogametic females are of two types, ZO-ZZ type and ZW-ZZ type.
13.Give an account of genetic control of Rh factor.

Fisher and Race hypothesis:
➢ Rh factor involves three different pairs of alleles located on three different closely
linked loci on the chromosome pair.
➢ This system is more commonly in use today, and uses the 'Cde' nomenclature.
➢ Three pairs of Rh alleles (Cc, Dd and Ee) occur at 3 different loci on homologous
chromosome pair-1. The possible genotypes will be one C or c, one D or d, one E
or e from each chromosome. For e.g. CDE/cde; CdE/cDe; cde/cde; CDe/CdE etc.,
➢ All genotypes carrying a dominant ‘D’ allele will produce Rh+positive phenotype
and double recessive genotype ‘dd’ will give rise to Rhnegative phenotype.
Wiener Hypothesis
➢ Wiener proposed the existence of eight alleles (R1, R2, R0, Rz, r, r1, r11, ry) at a
single Rh locus.
➢ All genotypes carrying a dominant ‘R allele’ (R1, R2 ,R0 ,Rz) will produce
Rh+positive’ phenotype and double recessive genotypes (rr, rr1, rr11, rry) will give
rise to Rh-negative phenotype.
14. Explain the mode of sex determination in honeybees.
Haplodiploidy in Honeybees
➢ In hymenopteran insects such as honeybees, ants and wasps a mechanism of sex
determination called haplodiploidy mechanism of sex determination is common.
➢ In this system, the sex of the offspring is determined by the number of sets of
chromosomes it receives. Fertilized eggs develop into females (Queen or Worker)
and unfertilized eggs develop into males (drones) by parthenogenesis.
➢ It means that the males have half the number of chromosomes
➢ (haploid) and the females have double the number (diploid), hence the name
haplodiplody for this system of sex determination.
15.What are the application of Karyptyping?

• It helps in gender identification.
• It is used to detect the chromosomal aberrations like deletion, duplication,
translocation,
nondisjunction of chromosomes.
• It helps to identify the abnormalities of chromosomes like aneuploidy.
• It is also used in predicting the evolutionary relationships between species.
• Genetic diseases in human beings can be detected by this technique.
16.Explain the inheritance of sex linked characters in human being.

Red-green colour blindness or daltonism, haemophilia and Duchenne’s muscular
dystrophy are examples of X-linked gene inheritance in humans.
Haemophilia
➢ Haemophilia is commonly known as bleeder’s disease, which is more common in
men than women.
➢ This hereditary disease was first reported by John Cotto in 1803.
➢ Haemophilia is caused by a recessive X-linked gene.
➢ A person with a recessive gene for haemophilia lacks a normal clotting substance
➢ (thromboplastin) in blood, hence minor injuries cause continuous bleeding,
leading to death.
➢ The females are carriers of the disease and would transmit the disease to 50% of
their sons even if the male parent is normal.
➢ Haemophilia follows the characteristic criss - cross pattern of inheritance.
Colour blindness
➢ In human beings a dominant X – linked gene is necessary for the formation of
colour sensitive cells, the cones.
➢ The recessive form of this gene is incapable of producing colour sensitive cone
cells.
➢ Homozygous recessivefemales (XcXc) and hemizygous recessive males (XcY) are
unable to distinguish red and green colour.
➢ The inheritance of colour blindness can be studied in the following two types of
marriages.
(i) Marriage between colour blind man and normal visioned woman
➢ A marriage between a colour blind man and a normal visioned woman will
producenormal visioned male and female individuals in F1 generation but the
females are carriers.
➢ The marriage between a F1 normal visioned carrier woman and a normal visioned
male will produce one normal visioned female, one carrier female, one normal
visioned male and one colour blind male.
➢ Colour blind trait is inherited from the male parent to his grandson through
carrier daughter, which is an example of criss-cross pattern of inheritance
ii) Marriage between normal visioned man and colour blind woman
➢ If a colour blind woman (XcXc) marries a normal visioned male (X+Y), all F1 sons
will be colourblind and daughters will be normal visioned but are carriers.
➢ Marriage between F1 carrier female with a colour blind male will produce normal
visioned carrier daughter, colourblind daughter, normal visioned son and a
colourblind son in the F2 generation
17.Differentiate Intersexes from Supersexes.

Intersexes
➢ Organisms having physical characteristics intermediate between a true male and
true female is called intersex.
➢ Intersex drosophila is produced when the X/A is =0.67
Supersexes
➢ Meta males and metafemales are called as super sex.
➢ They are weak and sterile organisms in which the sex ratio is disturbed .
➢ Metamales in drosophila is produced when the X/A ratio is = 0.33
➢ Metafemales in drosophila is produced when the X/Aratio is =1.5
18. Discuss the genic balance mechanism of sex determination with reference to
Drosophila.
Genic balance in Drosophila
➢ Genic balance mechanisms of sex determination in Drosophila was first studied by C.B.
Bridges.
➢ In Drosophila, the presence of Y chromosome is essential for the fertility of male sex,
but does not determine the male sex.
➢ The gene for femaleness is located on the X chromosome and those for maleness are
located on the autosomes.
➢ When geneticist C.B. Bridges, working with Drosophila, crossed a triploid (3n) female
with a normal male, he observed many combinations of autosomes and sex
chromosomes in the offspring.
➢ From his results Bridges in 1921 suggested that sex in Drosophila is determined by the
balance between the genes for femaleness located on the ‘X’ chromosomes and those
for maleness located on the ‘autosomes’ .
➢ Hence the sex of an individual is determined by the ratio of its X chromosome to that of
its autosome sets. This ratio is termed sex index and is expressed as:
Change in this ratio leads to a changed sex phenotype. The results obtained from a cross
between triploid female Drosophila (3A:3X) with a diploid male (2A: XY) is shown below.
Bridges classical cross of a triploid (3A+XXX) female fly and a diploid (2A+XY) male fly
When the X : A ratio is
➢ as in a normal female, or greater than 1.00, the organism is a female.
➢ When this ratio is 0.50 as in a normal male or less than 0.50 the organism is a male.
➢ At 0.67, the organism is an intersex. Metamales (X/A = 0.33) and metafemales
(X/A=1.50) are usually very weak and sterile.
19.What is extrachromosomal inheritance?
➢ Certain characters are controlled by non-nuclear genomes found in chloroplast,
mitochondria, and plasmids.
➢ These characters do not reveal Mendelian pattern of inheritance.
➢ The cytoplasmic extranuclear genes have a characteristic pattern of inheritance which
do not resemble the genes of nuclear chromosomes and is known as extra chromosomal
or extra nuclear or cytoplasmic inheritance.
➢ It exhibit maternal influence.
➢ In extra nuclear inheritance, male and female parents contribute equally their nuclear
genes to the progeny but do not make equal contribution of extra chromosomal genes
hence, the crosses can yield different or non. Mendelian results.
Examples:
Shell coiling in Limnaea and kappa particle in Paramecium.
20.Comment on the methods of Eugenics.
Methods of Eugenics
(i) Constructive method or Positive eugenics
(ii) Restrictive method or Negative eugenics
(i) Positive eugenics:
Positive eugenics attempts to increase consistently better or desirable germplasm and
to preserve the best germplasm of the society. The desirable traits can be increased by
adopting the following measures:
(i) Early marriage of those having desirable traits
(ii) Subsiding the fit and establishing sperm and egg banks of precious germplasm
(iii) Educating the basic principles of genetics and eugenics
(iv) Improvement of environmental conditions
(v) Promotion of genetic research
(ii) Negative eugenics:
Negative Eugenics attempts to eliminate the defective germplasm of the society by
adopting the following measures:
(i) Sexual separation of the defectives
(ii) Sterilization of the defectives
(iii) Control of immigration and
(iv) Regulation of marriages
ADDITIONAL QUESTIONS:
1.Define the term Multiple alleles or Multiple allelism.

A gene can mutate several times producing several alternative forms. When three or more
alleles of a gene that control a particular trait occupy the same locus on the homologous
chromosome of an organism, they are called multiple alleles and their inheritance is called
multiple allelism.
2.Who are called secretors?

➢ Individuals who possess antigens A and B in their fluids such as the saliva are called
secretors.
➢ The secretors (antigens found in the body fluids) can be detected in tears, saliva, urine,
semen, gastric juice and in the milk of animals.
3. Why Rh antigen is called so?

➢ Rh factor was discovered in the blood of rhesus monkey, Macaca rhesus and later in
human beings.
➢ The term ‘Rh factor’ refers to “immunogenic D antigen of the Rh blood group system.
4. Write short note on Rh factor.

➢ An individual having D antigen are Rh D positive (Rh+) and those without D antigen are
Rh D negative (Rh-)”.
➢ Rhesus factor in the blood is inherited as a dominant trait.
➢ Naturally occurring Anti D antibodies are absent in the plasma of any normal individual.
➢ However if an Rh- (Rh negative) person is exposed to Rh+ (Rh positive) blood cells
(erythrocytes) for the first time, anti D antibodies are formed in the blood of that
individual.
➢ On the other hand, when an Rh positive person receives Rh negative blood no effect is
seen.
5. Write a short note on Erthroblaastosis foetalis.

➢ Rh incompatability has great significance in child birth.
➢ If a woman is Rh negative and the man is Rh positive, the foetus may be Rh positive
having inherited the factor from its father. The Rh negative mother becomes sensitized
by carrying Rh positive foetus within her body.
➢ Due to damage of blood vessels, during child birth, the mother’s immune system
recognizes the Rh antigens and gets sensitized.
➢ The sensitized mother produces Rh antibodies.
➢ The antibodies are IgG type which are small and can cross placenta and enter the foetal
circulation. By the time the mother gets sensitized and produce anti ‘D’ antibodies, the
child is delivered.
➢ Usually no effects are associated with exposure of the mother to Rh positive antigen
during the first child birth,
➢ Subsequent Rh positive children carried by the same mother, may be exposed to
antibodies produced by the mother against Rh antigen, which are carried across the
placenta into the foetal blood circulation.
➢ This causes haemolysis of foetal RBCs resulting in haemolytic jaundice and anaemia.
➢ This condition is known as Erythoblastosis foetalis or Haemolytic disease of the new
born (HDN).
6. Write down the preventive measures for Erthroblaastosis foetalis.
➢ If the mother is Rh negative and foetus is Rh positive, anti D antibodies should be
administered to the mother at 28th and 34th week of gestation as a prophylactic
measure.
➢ If the Rh negative mother delivers Rh positive child then anti D antibodies should be
administered to the mother soon after delivery.
➢ This develops passive immunity and prevents the formation of anti D antibodies in the
mothers blood by destroying the Rh foetal RBC before the mother’ immune system is
sensitized.
➢ This has to be done whenever the woman attains pregnancy.
7. What is Gynandromorphs?
➢ These individuals have parts of their body expressing male characters and other parts of
the body expressing female characters.
➢ The organism is made up of tissues of male and female genotype and represents a
mosaic pattern.
8. What is Barr body?
➢ 1949, Barr and Bertram first observed a condensed body in the nerve cells of female cat
which was absent in the male.
➢ This condensed body was called sex chromatin by them and was later referred as Barr
body.
➢ Mary Lyon suggested that Barr bodies represented an inactive chromosome, which in
females becomes tightly coiled into a heterochromatin, a condensed and visible form of
chromatin (Lyon’s hypothesis).
➢ The number of Barr bodies observed in cell was one less than the number of X-
Chromosome.
9. What is Karyotyping?
Karyotyping is a technique through which a complete set of chromosomes is separated from a
cell and the chromosomes are arranged in pairs.
10.What is ideogram?
An idiogram refers to a diagrammatic representation of chromosomes.
11.Define the term pedigree.

Pedigree is a “family tree”, drawn with standard genetic symbols, showing the inheritance
pathway for specific phenotypic characters.
12.What is pedigree analysis?

Pedigree analysis is the study of traits as they have appeared in a given family line for several
past generations.
13.How is Albinism caused and what are the symptoms?

Albinism is an inborn error of metabolism, caused due to an autosomal recessive gene.
Melanin pigment is responsible for skin colour.
Absence of melanin results in a condition called albinism.
In an albino, melanocytes are present in normal numbers in their skin, hair,
iris, etc., , but lack melanin pigment.
Cause of Albinism:
These people do not have tyrosinase enzyme system, which is required for the conversion of
dihydroxyphenyl alanine (DOPA) into melanin pigment inside the melanocytes.
14.What is Huntington’s chorea? How it affects?

It is inherited as an autosomal dominant lethal gene in man.
Symptoms:
involuntary jerking of the body and
progressive degeneration of the nervous system,
gradual mental and physical deterioration.
The patients with this disease usually die between the age of 35 and 40.
15.How is Klinfelter’s syndrome / XXY male caused? Write its symptoms.
The presence of an additional copy of the X chromosome resulting in a karyotype of 47,XXY.
Persons with this syndrome have 47 chromosomes (44AA+XXY).
Symptoms:
➢ They are usually sterile males,
➢ tall, obese, with long limbs,
➢ high pitched voice,
➢ under developed genitalia and have feeble breast (gynaecomastia) development.
16.How is Turner’s syndrome / X0 Female caused? Write its symptoms.

Loss of a X chromosome resulting in a karyotype of 45,X.
Persons with this syndrome have 45 chromosomes(44AA+XO)
Symptoms:
➢ They are sterile females.
➢ Low stature,
➢ webbed neck,
➢ under developed breast,
➢ rudimentary gonads lack of menstrual cycle during puberty.
17.Define the term “Eugenics”.

Application of the laws of genetics for the improvement of human race is called
eugenics. The term eugenics means “well born” and was coined by Francis Galton in
1885.
18.Define the term “Euphenics”.
➢ The symptomatic treatment of genetic disease of man is called Euphenics or Medical
➢ engineering.
➢ In 1960 Joshua Lederberg coined the term Euphenics. It means normal appearing.
➢ It deals with the control of several inherited human diseases especially the inborn errors
of metabolism. Eg. Phenylketonuria (PKU)
19.Define the term “Euthenicss”.
➢ The science of improvement of existing human race by improving the environmental
conditions is called euthenics.
➢ It can be achieved by subjecting them to better nutrition,
better unpolluted ecological conditions, better education and sufficient medical
facilities.
20.Write a short note on inheritance of Y - linked genes.
➢ Genes in the non-homologous region of the Y-chromosome are inherited directly
from male to male.
➢ In humans, the Y-linked or holandric genes for hypertrichosis (excessive development of
hairs on pinna of the ear) are transmitted directly from father to son, because males
inherit the Y chromosome from the father.
➢ Female inherits only X chromosome from the father and are not affected.
CHAPTER -5 MOLECULAR GENETIC

1. Give reasons: Genetic code is ‘universal’.
The genetic code is universal. It means that all known living systems use nucleic acids and the
same three base codons (triplet codon) direct the synthesis of protein from amino acids. For
example, the mRNA (UUU) codon codes for phenylalanine in all cells of all organisms.
2. Name the parts marked ‘A’ and ‘B’ in the given transcription unit:
A-Promoter
B – Coding strand
3. Differentiate - Leading stand and lagging strand
Leading strand Lagging strand

The process of DNA replication is The process of DNA replication is
continuous without gap in one strand discontinuous in another strand(coding
(template strand), such strand is known as strand), such strand is known as lagging
leading strand. strand.
It does not require DNA ligase for its DNA ligase is required for joining the small
growth. fragments of DNA. (Okazaki fragments)
The direction of polymerization 5’ 3’ The direction of polymerization 3’ 5’

Only a single RNA primer is required. More number of RNA primer is required.
It is rapid process It is slow process
4. Differentiate - Template strand and coding strand.
Template strand Coding strand

The direction of template strand is 5’ 3’ The direction of coding strand is 3’ 5’
It is transcribed into mRNA Not transcribed into mRNA

It is discarded after transcription.
Contains the complementary nucleotide Contains the same nucleotide sequences as
sequence as the mRNA in the mRNA except thymine.
Contains the same nucleotide sequence as Contains the complementary sequence as

the tRNA the tRNA
Contains codon Contains anti codon
5. Mention any two ways in which single nucleotide polymorphism (SNPs) identified in
human genome can bring revolutionary change in biological and medical science.
➢ Identification of‘SNIPS’ is helpful in finding chromosomal locations for disease
associated sequences and tracing human history.
➢ The mapping of human chromosomes is possible to examine a person’s DNA and to
identify genetic abnormalities.
➢ This is extremely useful in diagnosing diseases and to provide genetic counselling to
those planning to have children.
➢ It provides clues to understand human biology, learning about non-human organisms,
➢ DNA sequences can lead to an understanding of their natural capabilities that can be
applied towards solving challenges in healthcare, agriculture, energy production and
environmental remediation.
➢ A new era of molecular medicine, characterized by looking into the most fundamental
causes of disease than treating the symptoms will be an important advantage.
6. State any three goals of the human genome project.

➢ Identify all the genes (approximately 30000) in human DNA.
➢ Determine the sequence of the three billion chemical base pairs that makeup the
human DNA.
➢ To store this information in databases.
➢ Improve tools for data analysis.
➢ Transfer related technologies to other sectors, such as industries.
➢ Address the ethical, legal and social issues (ELSI) that may arise from the project.
7. In E.coli, three enzymes β- galactosidase, permease and transacetylase are produced
in the presence of lactose. Explain why the enzymes are not synthesized in the
absence of lactose.
The enzymes are not synthesized in the absence of lactose because,
➢ The cell uses normal energy source glucose, in the absence of lactose.
➢ ‘i’ gene transcribes a repressor mRNA and after its translation, a repressor protein
is produced.
➢ It binds to the operator region of the operon and prevents transcription as a
result β – galactosidase and other enzymes are not produced.
➢ Lactose acts as an inducer and interacts with the repressor to inactivate it.
8. Distinguish between structural gene, regulatory gene and operator gene.
Structural gene Regulatory gene Operator gene

It is connected with It controls the functioning It determine the functioning of
transcription of operator structural genes
The structural gene codes It produces a repressor or The operators are present
for proteins, rRNA and apo repressor for between the promoters and
tRNA required by the cell. blocking the operator structural genes. The
gene. repressor protein binds to the
operator region of the operon.
Moderately longer gene Longer gene Smaller gene
I t functions only when It functions through the Operator gene functions only
receives complementary formation of an mRNA of when it is not blocked by
nucleotides and RNA repressor. repressor.
Polymerase.
9. A low level of expression of lac operon occurs at all the time. Justify the statement.
A low level of lac operon occurs due to the presence of formation of permeases. They are
necessary for the transport of lactose from medium to cells. Due to absence of lactose, it will
not act as inducer.
10. Why the human genome project is called a mega project?
➢ The international human genome project was launched in the year 1990.
➢ It was a mega project and took 13 years to complete.
➢ The human genome is about 25 times larger than the genome of any organism
sequenced to date and is the first vertebrate genome to be completed.
➢ Human genome is said to have approximately 3×109 bp.
➢ HGP was closely associated with the rapid development of a new area in biology called
bioinformatics.
11.From their examination of the structure of DNA, What did Watson and Crick infer
about the probable mechanism of DNA replication, coding capability and mutation?
➢ Watson and Crick explain the Semi – conservative model of DNA replication
➢ DNA replication takes place during S phase
➢ During replication, each DNA molecule gives rise to two DNA strands, identical to
each other and parent.
Hypothesis of DNA replication:
Conservative replicatiuon
Dispersive replication
Semi conservative replication
Semi conservative replication:
➢ It was proposed by Watson and Crick in 1953
➢ It is based on the DNA model.
➢ In semi conservative replication, the two polynucleaotide strands of DNA
molecule unwind and start separating at one end.
➢ During this process, covalent hydrogen bonds between nitrogenous bases are
broken.
➢ The separated single strand then acts as template for the synthesis of a new
stand.
➢ At the end of each replication, each daughter double helix carries one
polynucleotide strand from the parent and other strand is newly synthesized
➢ Any error in replication leads to mutation.
12.Why tRNA is called an adapter molecule?

The transfer RNA, (tRNA) molecule of a cell acts as a vehicle that picks up the amino acids
scattered through the cytoplasm and also reads specific codes of mRNA molecules. Hence it is
called an adapter molecule.
13. What are the three structural differences between RNA and DNA?
RNA DNA
It is single standard structure It is double standard structure
It contains Ribose sugar It contains deoxyribose sugar
It contains Uracil as one of the It contains Uracil as one of the
nitrogenous bases. nitrogenous bases.
14.Name the anticodon required to recognize the following codons:

AAU, CGA, UAU, and GCA.
Codons: AAU, CGA, UAU, and GCA.
Anti codons: UUA, GCA, AUA, CGU
15. a) Identify the figure given below – mechanism of replication showing a replication fork
b) Redraw the structure as a replicating fork and label the parts
c) Write the source of energy for this replication and name the enzyme involved in this
process.
Source of energy for this replication – Deoxy nucleotide triphosphate.
enzyme involved in DNA replication:
➢ In prokaryotes, replication process requires three types of DNA polymerases (DNA
polymerase I, II, and III).
➢ DNA polymerase III is the main enzyme involved in DNA replication.
➢ DNA polymerase I (also known as Kornberg enzyme) and DNA polymerase II are involved
in DNA repair mechanism.
➢ Eukaryotes have five types of DNA polymerases that catalyses the polymerization.
➢ DNA helicase for unwinding the double stranded DNA molecule.
➢ DNA ligase to join the DNA frgment.
d) Mention the differences in the synthesis of protein, based on the polarity of the two
template strands.
➢ For protein synthesis mRNA brings information from DNA.
➢ The type of protein synthesized depends on the sequence of codon in mRNA
➢ From DNA segment only one strand is transcribed as mRNA.
➢ mRNA base sequence is complementary to the template strand only.
➢ Synthesis of protein is based on the sequence of the template strand of DNA with
polarity 3’ 5’
16. If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.
Sequence of Mrna:5’ACGUACGUACGUACGUACGUACGUACG3’
17. How is the two stage process of protein synthesis advantageous?

In eukaryotes transcription take place in membrane bound nucleus.
Translation takes place in cytoplasm (outside of nucleus)
This two stages of protein synthesis enables eukaryotes to regulate gene expression in much
more efficient way, and also contributing to the richness of eukaryotic form and functions.
18. Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only?
Would they have got the same result if they use radiolabelled carbon and nitrogen?
Generally proteins contain sulphur but not phosphorus.

Nucleic acids contain phosphorus but not sulphur. Hence Hershy and Chase used radioactive
isotopes of sulphur 35S and phosphorus 32P to keep separate track of viral protein and nucleic
acid to observe whether it was DNA or protein that enter bacteria in the culture medium.
No they would have not got the same result if they used radiolabelled carbon and nitrogen
because carbon is present in all organic compounds and nitrogen is present in all nucleic acids
and proteins.
19.Explain the formation of a nucleosome.

➢ In eukaryotes, this organization is much more complex.
➢ Chromatin is formed by a series of repeating units called nucleosomes.
➢ Kornberg proposed a model for the nucleosome, in which 2 molecules of the four
histone proteins
➢ H2A, H2B, H3 and H4 are organized to form a unit of eight molecules called histone
➢ octamere.
➢ The negatively charged DNA is wrapped around the positively charged histone octamere
to form a structure called nucleosome.
➢ A typical nucleosome contains 200 bp of DNA helix. The histone octameres are in close
contact and DNA is coiled on the outside of nucleosome.
➢ Neighbouring nucleosomes are connected by linker DNA (H1) that is exposed to
enzymes.
➢ The DNAmakes two complete turns around the histone octameres and the two turns are
sealed off by an H1 molecule.
➢ Chromatin lacking H1 has a beads-on-a-string appearance in which DNA enters and
leaves the nucleosomes at random places.
➢ H1 of one nucleosome can interact with H1 of the neighbouring nucleosomes resulting
in the further folding of the fibre.
➢ The chromatin fiber in interphase nuclei andmitotic chromosomes have a diameter that
vary between 200-300 nm and represents inactive chromatin.
➢ 30 nm fibre arises from the folding of nucleosome, chains into a solenoid structure
having six nucleosomes per turn.
➢ This structure is stabilized by interaction between different H1 molecules. DNA is a
solenoid and packed about 40 folds.
➢ The hierarchical nature of chromosome structure is illustrated in additional set of
proteins are required for packing of chromatin at higher level and are referred to as
non-histone chromosomal proteins (NHC).
➢ In a typical nucleus, some regions of chromatin are loosely packed (lightly stained) and
are referred to as euchromatin.
➢ The chromatin that is tightly packed (stained darkly) is called heterochromatin.
➢ Euchromatin is transcriptionally active and heterochromatin is transcriptionally inactive.
20.It is established that RNA is the first genetic material. Justify giving reasons.
➢ A typical cell contains about ten times as much RNA as DNA. The high RNA content is
mainly due to the variety of roles played by RNA in the cell.
➢ Fraenkel-Conrat and Singer (1957) first demonstrated that RNA is the genetic material in
RNA containing viruses like TMV (Tobacco Mosaic Virus) and
➢ they separated RNA from the protein of TMV viruses.
➢ Three molecular biologists in the early 1980’s (Leslie Orgel, Francis Brick and Carl
Woese) independently proposed the ‘RNA world’ as the first stage in the evolution of
life, a stage when RNA catalysed all molecules necessary for survival and replication.
➢ The term ‘RNA world’ first used by Walter Gilbert in 1986, hypothesizes RNA as the first
genetic material on earth.
➢ There is now enough evidence to suggest that essential life processes (such as
metabolism, translation, splicing etc.,) evolved around RNA.
➢ RNA has the ability to act as both genetic material and catalyst. There are several
biochemical reactions in living systems that are catalysed by RNA.
➢ This catalytic RNA is known as ribozyme. But, RNA being a catalyst was reactive and
hence unstable. This led to evolution of a more stable form of DNA, with certain
chemical modifications.
➢ Since DNA is a double stranded molecule having complementary strand, it has resisted
changes by evolving a process of repair.
➢ Some RNA molecules function as gene regulators by binding to DNA and affect gene
expression. Some viruses use RNA as the genetic material.
➢ Andrew Fire and Craig Mellow (recipients of Nobel Prize in 2006) were of the opinion
that RNA is an active ingredient in the chemistry of life.
CHAPTER-6 EVOLUTION
1. List out the major gases seems to be found in the primitive earth.
Ammonia, Methane, Hydrogen and Water vapour
2. Explain the three major categories in which fossilization occur?

Fossilization occur under the following three main categories. They are
i) Actual remains:
➢ This is the most common method of fossilization.
➢ The original hard parts such as bones, teeth or shells are preserved as such in the earth’s
atmosphere.
➢ When marine animals die, their hard parts such as bones, shells, etc., are covered with
sediments and are protected from further deterioration.
➢ They get preserved as such as they are in vast ocean; the salinity in them prevents
decay.
➢ The sediments become hardened to form definite layers or strata.
ii) Petrifaction :
➢ In petrifaction, when animals die the original portion of their body may be
Replaced, molecule for molecule by minerals and the original substance being lost
through disintegration.
➢ The principle minerals involved in this type fossilization are iron pyrites, silica, calcium
carbonate and bicarbonates of calcium and magnesium.
iii) Natural moulds and casts:
➢ Even after disintegration, the body of an animal might leave indelible (permanent)
impression on the soft mud which later becomes hardened into stones. Such
impressions are called moulds.
➢ The cavities of the moulds may get filled up by hard minerals and get fossilized, which
are called casts.
3. Differentiate between divergent evolution and convergent evolution with one example
for each.
Divergent evolution Convergent evolution
Divergent evolution refers to origin of two or Convergent evolution refers to origin of two
more species with different characteristic or more species with similar characteristic
features diverged from a common ancestor. features from different ancestors.
Structures which are similar in origin and Structures which are different in origin and
internal structures but perform different structural pattern but perform similar
functions are called homologous structures function are called analogous organs which
which leads to divergent evolution. leads to convergent evolution
Eg) Wings of insects, birds and bats. Darwin’s finches and Australian marsupials.
4. How does Hardy-Weinberg’s expression (p2+2pq+q2=1) explain that genetic

equilibrium is maintained in a population?
List any four factors that can disturb the genetic equilibrium.
(i)Hardy-Weinberg Equilibrium:
➢ Hardy of UK and Weinberg of Germany stated that the allele frequencies in a population
are stable and are constant from generation to generation in the absence of gene flow,
genetic drift, mutation, recombination and natural selection.
➢ If a population is in a state of Hardy Weinberg equilibrium, the frequencies of alleles and
genotypes or sets of alleles in that population will remain same over generations.
➢ Evolution is a change in the allele frequencies in a population over time. Hence
population in Hardy Weinberg is not evolving.
➢ Suppose we have a large population of beetles, (infinitely large) and appear in two
colours dark grey (black) and light grey, and their colour is determined by ‘A’ gene. ‘AA’
and ‘Aa’ beetles are dark grey and ‘aa’ beetles are light grey.
➢ In a population let’s say that ‘A’ allele has frequency (p) of 0.3 and ‘a’ allele has a
frequency (q ) of 0.7.
Then p+q=1.
Hardy Weinberg equation = (p + q)2 = p2 + 2pq + q2
➢ If a population is in Hardy Weinberg equilibrium, the genotype frequency can be
estimated by Hardy Weinberg equation as follow
(p + q)2 = p2 + 2pq + q2 here
p2 = frequency of AA
2pq= frequency of Aa
q2= frequency of aa
p = 0.3, q = 0.7 then,
p2 = (0.3)2 = 0.09 = 9 % AA
2pq = 2(0.3) (0.7) = 0.42 = 42 % Aa
q2 = (0.7)2 0.49 = 49 % aa
➢ Hence the beetle population appears to be in Hardy- Weinberg equilibrium.
➢ When the beetles in Hardy- Weinberg equilibrium reproduce, the allele and genotype
frequency in the next generation would be: Let’s assume that the frequency of ‘A’ and
‘a’ allele in the pool of gametes that make the next generation would be the same, then
there would be no variation in the progeny.
➢ The genotype frequencies of the parent appears in the next generation. (i.e. 9% AA,
42% Aa and 49% aa). If we assume that the beetles mate randomly (selection of male
gamete and female gamete in the pool of gametes), the probability of getting the
offspring genotype depends on the genotype of the combining parental gametes.
Four factors that can disturb the genetic equilibrium.

➢ Gene flow, genetic drift, mutation, recombination and natural selection.
5. Explain how mutations, natural selection and genetic drift affect Hardy Weinberg
equilibrium.
➢ Hardy and Weinberg stated that the allele frequencies in a population are
stable and are constant from generation to generation in the absence of gene flow,
genetic drift, mutation, recombination and natural selection.
➢ If a population is in a state of Hardy Weinberg equilibrium, the frequencies of alleles and
genotypes or sets of alleles in that population will remain same over generations. Hence
population in Hardy Weinberg is not evolving.
➢ Mutations, natural selection and genetic drift are the factors which affect Hardy
Weinberg equilibrium.
Natural selection:
➢ Microevolution (evolution on a small scale) refers to the changes in allele
frequencies within a population.
➢ Allele frequencies in a population may change due to four fundamental forces of
evolution such as natural selection, genetic drift, mutation and gene flow.
➢ It occurs when one allele (or combination of alleles of differences) makes an organism
more or less fit to survive and reproduce in a given environment.
➢ If an allele reduces fitness, its frequencies tend to drop from one generation to the next.
➢ The evolutionary path of a given gene i.e., how its allele's change in frequency in the
population across generation, may result from several evolutionary mechanisms acting
at once.
➢ For example, one gene’s allele frequencies might be modified by both gene flow and
genetic drift, for another gene, mutation may produce a new allele, that is favoured by
natural selection.
Genetic drift:
➢ Genetic drift is a mechanism of evolution in which allele frequencies of a population
change over generation due to chance (sampling error).
➢ Genetic drift occurs in all population sizes, but its effects are strong in a small population
It may result in a loss of some alleles (including beneficial ones) and fixation of other
alleles.
➢ Genetic drift can have major effects, when the population is reduced in size by natural
disaster due to bottle neck effect or when a small group of population splits from the
main population to form a new colony due to founder’s effect.
Mutation
➢ Although mutation is the original source of all genetic variation, mutation rate for most
organisms is low.
➢ Hence new mutations on an allele frequency from one generation to the next is usually
not large.
6. How did Darwin explain fitness of organisms?

➢ Darwin explains fitness of organisms through his Natural Selection Theory.
➢ He proved that fittest organisms can survive and leave more progenies than the unfit
ones through natural selection.
➢ Darwin’s theory was based on several facts, observations and influences.
They are as follows
(a)Over production (or) prodigality of production

➢ All living organisms increase their population in larger number.
➢ For example, Salmon fish produces about 28 million eggs during breeding season and if
all of them hatch, the seas would be filled with salmon in few generations.
➢ Elephant, the slowest breeder that can produce six young ones in its life time can
produce 6 million descendants at the end of 750 years in the absence of any check.
(b)Struggle for existence
➢ Organisms struggle for food, space and mate.
➢ As these become a limiting factor, competition exists among the members of the
population.
Darwin denoted struggle for existence in three ways –
• Intra specific struggle between the same species for food, space and mate.
• Inter specific struggle with different species for food and space.
• Struggle with the environment to cope with the climatic variations, flood,
earthquakes, drought, etc.,
(c)Universal occurrence of variations
➢ No two individuals are alike. There are variations even in identical twins.
➢ Even the children born of the same parents differ in colour, height, behavior, etc.,
➢ The useful variations found in an organism help them to overcome struggle and such
variations are passed on to the next generation.
(d)Origin of species by Natural Selection
➢ According to Darwin, nature is the most powerful selective force.
➢ He compared origin of species by natural selection to a small
➢ isolated group.
➢ Darwin believed that the struggle for existence resulted in the survival of the fittest.
Such organisms become better adapted to the changed environment.
7.Mention the main objections to Darwinism.

Objections to Darwinism
• Darwin failed to explain the mechanism of variation.
• Darwinism explains the survival of the fittest but not the arrival of the fittest.
• He focused on small fluctuating variations that are mostly non-heritable.
• He did not distinguish between somatic and germinal variations.
• He could not explain the occurrence of vestigial organs, over specialization of
some organs like large tusks in extinct mammoths, oversized antlers in the
extinct Irish deer, etc.,
6. Taking the example of Peppered moth, explain the action of natural selection.
What do you call the above phenomenon?
(i) Natural selection:
➢ Natural selection can be explained clearly through industrial melanism.
➢ Industrial melanism is a classical case of Natural selection exhibited by the peppered
moth, Biston betularia.
➢ These were available in two colours, white and black.
➢ Before industrialization peppered moth both white and black coloured were common in
England.
➢ Pre-industrialization witnessed white coloured background of the wall of the buildings
hence the white coloured moths escaped from their predators.
➢ Post industrialization, the tree trunks became dark due to smoke and soot let out from
the industries. The black moths camouflaged on the dark bark of the trees and the
white moths were easily identified by their predators. Hence the dark coloured moth
population was selected and their number increased when compared to the white
moths.
➢ Nature offered positive selection pressure to the black coloured moths. The above proof
shows that in a population, organisms that can adapt will survive and produce more
progenies resulting in increase in population through natural selection.
(ii) phenomenon - Industrial Melanism
7. Darwin's finches and Australian marsupials are suitable examples of adaptive radiation –
Justify the statement.
Adaptive radiation:
The evolutionary process which produces new species diverged from a single ancestral form
becomes adapted to newly invaded habitats is called adaptive radiation.
Examples: Darwin’s finches and Australian Marsupials
Darwin’s finches
➢ The common ancestor of Darwin’s finches arrived on the Galapagos about 2 million
years ago.
➢ During that time, Darwin's finches have evolved into 14 recognized species differing in
body size, beak shape and feeding behavior.
➢ Changes in the size and form of the beak have enabled different species to utilize
different food resources such as insects, seeds, nectar from cactus flowers and blood
from iguanas, all driven by Natural selection.
➢ Genetic variation in the ALX1 gene in the DNA of Darwin finches is associated with
variation in the beak shape.
➢ Mild mutation in the ALX1 gene leads to phenotypic change in the shape of the beak of
the Darwin finches.
Australian Marsupials:
➢ Marsupials in Australia and placental mammals in North America are two
subclasses of mammals they have adapted in similar way to a particular food resource,
locomotory skill or climate.
➢ They were separated from the common ancestor more than 100 million year ago and
each lineage continued to evolve independently.
➢ Despite temporal and geographical separation, marsupials in Australia and placental
mammals in North America have produced varieties of species living in similar habitats
with similar ways of life.
➢ Their overall resemblance in shape, locomotory mode, feeding and foraging are
superimposed upon different modes of reproduction.
➢ This feature reflects their distinctive evolutionary relationships. Over 200 species of
marsupials live in Australia along with many fewer species of placental mammals.
➢ The marsupials have undergone adaptive radiation to occupy the diverse habitats in
Australia, just as the placental mammals have radiated across North America.
10. Who disproved Lamarck’s Theory of acquired characters? How?
(i) Disproved - August Weismann.
(ii) The main objection to Lamarckism
➢ He disproved Lamarckism by conduction of experiments on mice for twenty generations
by cutting their tails and breeding them. All mice born were with tail.
➢ Weismann proved that change in the somatoplasm will not be transferred to the next
generation but changes in the germplasm will be inherited.
11. How does Mutation theory of De Vries differ from Lamarck and Darwin’s view in
the origin of new species.
➢ Hugo de Vries believed that Mutations are random and directionless, but Darwinian
variations are smell and directional.
➢ According to de Vries, sudden and large variations were responsible for the origin of
new species whereas Lamarck and Darwin believed in gradual accumulation of all
variations as the causative factors in the origin of new species
12. Explain stabilizing, directional and disruptive selection with examples.

i. Stabilising Selection (centipetal selection):
➢ This type of selection operates in a stable environment.
➢ The organisms with average phenotypes survive whereas the extreme individuals from
both the ends are eliminated.
➢ There is no speciation but the phenotypic stability is maintained within the population
over generation.
➢ For example, measurements of sparrows that survived the storm clustered around the
mean, and the sparrows that failed to survive the storm clustered around the extremes
of the variation showing stabilizing selection.
ii. Directional Selection:
➢ The environment which undergoes gradual change is subjected to directional selection.
➢ This type of selection removes the individuals from one end towards the other end of
phenotypic distribution.
➢ For example, size differences between male and female sparrows. Both male and
female look alike externally but differ in body weight. Females show directional
selection in relation to body weight.
iii. Disruptive Selection (centrifugal selection):
➢ When homogenous environment changes into heterogenous environment this type of
selection is operational.
➢ The organisms of both the extreme phenotypes are selected whereas individuals with
average phenotype are eliminated.
➢ This results in splitting of the population into sub population/species. This is a rare form
of selection but leads to formation of two or more different species. It is also called
adaptive radiation.
➢ e.g. Darwin's finches beak size in relation to seed size inhabiting Galapagos islands. (For
diagram refer text book)
13. Rearrange the descent in human Evolution
Austrolopithecus → Homo erectus → Homo sapiens → Ramapithecus → Homo
habilis.
Ramapithecus → Austrolopithecus → Homohabilis →Homo erectus → Homo sapiens
14. How does Neanderthal man differ from the modern man in appearance?
➢ Neanderthal human was found in Neander Valley, Germany with a brain size of 1400 cc
and lived between 34,000 - 1,00,000 years ago.
➢ They differ from the modern human in having
i. Semierect posture,
ii. Flat cranium,
iii. Sloping forehead,
iv. Thin large orbits,
v. Heavy brow ridges,
vi. Protruding jaws and no chin.
vii. They used animal hides to protect their bodies,
viii. Knew the use of fire
ix. Buried their dead.
x. They did not practice agriculture and animal domestication.
15. Define isolating mechanism and explain its types with suitable examples.
Isolation is the separation of the members of a single population into sub populations so
that genetic integrity of the subpopulation can be maintained.
i. Ecological isolation or habitat isolation– the members of the same population may be
separated from one another by a differences in their habitat.
For example Rana areolata occupies burrows and breeds in grassy shallow ponds whereas
Rana grylio breeds in deep waters.
ii. Seasonal isolation – In this type of isolation, difference in the breeding seasons prevents
interbreeding. E.g. Toad, Bufo americanus breeds much early in the spring; whereas Bufo
fowleri breeds very late in the season.
iii. Sexual or ethological isolation/ Behavioural isolation – Prevents mating due to the
difference in their sexual behavior. The species are not separated from one another either in
time or in space. The mating calls of two closely related species of frogs, Hyla versicolor (grey
tree frog) and Hyla femoralis (pine wood tree frog) are different which prevents interbreeding.
iv. Morphological isolation or mechanical isolation – This type of isolation is due to the
differences in their external genitalia that is seen in two different species. The size difference
between the toad species Bufo quercicus and Bufo valliceps, prevents their interbreeding.
v. Physiological isolation –Though mating may occur, the gametes are prevented from
fertilization due to mechanical or physiological factors.
E.g. The sperms of Drosophila virilis survive only for about a day when introduced into the
sperm receptacle of Drosophila americana while the sperms of Drosophila americana live for a
longer time.
vi. Cytological isolation – Fertilization does not take place due to the differences in the
chromosome numbers between the two species, the bull frog (Rana catesbiana) and gopher
frog (Rana areolata).
vii. Hybrid inviability – In this type, the sperm enters the egg, fertilization occurs and the
embryo develops into the adult but it dies before reaching maturity. In certain fishes, frogs,
beetles, even if fertilization takes place between two species, due to genetic incompatibility
they do not leave any surviving offspring.
viii. Hybrid sterility – In this type, hybrids are formed due to inter specific crosses but they are
sterile due to the failure of the chromosomes to segregate normally during meiosis, example
Mule (inter specific cross between a horse and a donkey).
ix. Hybrid breakdown – F1 Hybrids are viable and fertile, but F2 hybrids may be inviable or
sterile.
16. Define speciation according to A.E. Emerson and explain its types giving suitable examples.
➢ A.E. Emerson defines species as a ‘genetically distinctive, reproductively isolated natural

population’.
➢ Speciation is a fundamental process in evolution.
Sympatric speciation/ Reproductive isolation
It is a mode of speciation through which new species form from a single ancestral
species while both species continue to inhabit the same geographical region. Two or more
species are involved. New species formed due to genetic modification in the ancestor that
is naturally selected can no longer breed with the parent population. Sexual isolation is
strongest.
A well studied example is the adaptation of Apple maggots that feed on apples in North
America. When the Apple trees were imported to North America, Apple maggot
flies(Rhagoletis pomonella), a parasitic insect that normally laid its eggs in the fruits of wild
hawthorns until one subset of population began to lay its eggs in the fruit of domesticated
apple trees (Malus domestica) that grew in the same area. This small group of apple maggoit
flie selected a different host species from the rest of the population and its offsprings become
accustomed to domesticated apples.
Allopatric speciation/ Geographical speciation

It is a mode of speciation that occurs when biological populations of similar
species become isolated from each other that prevents gene flow. One species becomes
two species due to geographical barriers hence new species is evolved e.g. Darwin's
finches. The barriers are land separation,migration or mountain formation. When
barriers occur between species, change in ecological conditions and environment leads
to adaptations that produce differences. If there are no adaptations, they will not
survive. Sexual isolation is weakest.
17.Give an account on the major causes for the extinction of a particular species on earth.
Causes for extinction of a species may be natural or due to human intervention
Natural causes:
Environmental events: Occurrence of natural; disaster such as floods, volcanic eruptions, etc,
can wipe out entire species
Biological events: Non availability of food, spread of infectious diseases can wipe out a species
at large.
Human activities:
Man is destroying forests in a large scale. Many species are being reduced due to lack of
habitat .
Modern technology has a major impact on nesting and breeding of many birds.
Over exploitation of species for commercial purpose may interfere with food chains and
causes food scarcity for other species.
It leads to reduction in population of a particular species.
18.Explain the three level of impact of extinction of species.

The impact of extinction can conveniently be considered at three levels.
Species extinction:
Species extinction eliminates an entire species, by an environmental event (flood etc.,) or by
biological event (disease or non availability of food resource half or more).
Mass extinction:
Mass extinction eliminates half or more species in a region or ecosystem, as might
occur following a volcanic eruption. Five major mass extinction that occurred since
the Cambrian period. This mass extinction is often referred to as K-T extinction.
Global extinction:
Global extinction eliminates most of the species on a large scale or larger taxonomic groups in
the continent or the Earth. Snow ball Earth and extinction following elevation in CO2 levels are
example. Extinction events opens up new habitats and so can facilitate the radiation of
organisms that survived the mass extinction.
***************

12 TH Study Material

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

12 TH Study Material

Uploaded by

Copyright:

Available Formats

NELLAI NADAR MATRIC HIGHER SECONDARY SCHOOL

XII STD ZOO/BIO-ZOO

CHAPTER 1 REPRODUCTION IN ORGANISMS

1. Name an organism where cell division is itself a mode of reproduction.

6. Why is the offspring formed by asexual reproduction referred as a clone?

8. Differentiate between the following:

(b) Regeneration in lizard and Planaria

Regeneration in lizard Regeneration in Planaria

9. How is juvenile phase different from reproductive phase?

Juvenile phase Reproductive phase

11. Explain the different kinds of syngamy in living organism

Reproduction is the fundamental feature of all living organisms. It is a biological process by

8. What are the different types of Binary fission?

14.What are the two types of budding?

17.What are the two types of regeneration?

20.What are the two types of epimorphoisis?

23.How are breeding animals classified?

24.What is senescent phase?

25.Define the term parthenogenesis.

29.Explain different types of parthenogenesis with example.

ADDITIONAL 5 MARK QUESTIONS:

1. Mention the differences between spermiogenesis and spermatogenesis.

3. Expand the acronyms

4. How is polyspermy avoided in humans?

5. What is colostrum? Write its significance.

6. Placenta is an endocrine tissue. Justify.

7. Draw a labeled sketch of a spermatozoan.

8. What is inhibin? State its functions.

10.What is the composition of semen?

11.Explain the process of fertilization and implantation of the fertilized ovum.

Menstrual cycle comprises of the following phases

16.Explain the role of oxytocin and relaxin in parturition and lactation.

Figure that illustrates ovulation – F

Ovarian hormones – Oestrogen and Progesterone

c) Explain the changes that occur in the uterus simultaneously in anticipation.

C is secondary follicle H is corpus luteum

19. List the various menstrual disorders.

1. List out the major functions of reproductive system.

2. Why scrotum called as thermoregulator ?

4. What are Leydig cells? Write its significance.

➢ Interstitial cells of testes are called as Leydig cells.

5. Define the term spermatogenesis.

7. Define the term spermiation.

9. Define Menstrual cycle.

11.Why are menstrual cycles absent during pregnancy?

12.What is Mozygotic twins?

13.What is Dizygotic twins?

15.Mention the accessory glands of male reproductive system.

16.List out the functions of seminal fluid.

17.Mention the extra embryonic membranes write down their functions.

1. List out and define the various events of reproduction.

2. List out the various menstrual disorders. Explain Menstrual disorders

3. Describe the structure of male gamete. (spermatozoa)

➢ The human sperm is a microscopic, flagellated and motile gamete.

Possible long answer type questions:

1. Describe the structure of male primary sex organ (testes).

Surgical methods Vasectomy

(Barriers, Lactational amenorrhoea, CuT, Tubectomy)

2. Correct the following statements

6. Differentiate foeticide and infanticide.

7. How are STDs transmitted?

8. Write the preventive measures of STDs.