MOLECULAR BIOLOGY

AND DIAGNOSTICS
UNOFFICIAL COMPILATION NOTES

SY 2020-2021 BY AIRAH MANZA

 MOLECULAR BIOLOGY AND DIAGNOSTICS
TOPIC 1: NUCLEIC ACIDS
Lecturer: Ms. Praise Selah Dagoc, RMT
INTENDED LEARNING OUTCOMES
▪ define molecular biology and molecular diagnostics
▪ discuss the scientific milestones that led to the discovery of the
DNA structure
▪ describe DNA and RNA: their composition, roles, and differences
▪ diagram the structure of nitrogen bases and nucleotides
▪ list and describe types of RNA
LECTURE OUTLINE
▪ introduction to mol bio and diagnostics
▪ nucleic acids
▪ DNA: molecular composition and structure
▪ RNA: molecular composition, structure, and types
INTRODUCTION TO MOLECULAR BIOLOGY AND DIAGNOSTICS
branch of biology that deals with the structure
molecular
and function of the macromolecules (e.g. nucleic
biology
acids and proteins) essential to life
molecular the application of molecular biology in medical
diagnostics testing
BRIEF HISTORY OF MOLECULAR BIOLOGY
Mendel’s Laws of Inheritance
it wasn’t a while after he came up with it that the
th
19 century
scientific field started to correlate the loss of
inheritance with DNA
1938 ‘molecular biology’ as a term was introduced
James Watson and Francis Crick discovered the
DNA’s double helical structure
significance:
▪ the discovery of the DNA’s double helix
opened up so many opportunities in
1953
molecular biology, not just in the discovery of
the structure of DNA itself
▪ opened so many advancements, not just in
the medical field but in other fields also (e.g.
agricultural, biotechnology)
biological science goes molecular
▪ so many advancements and discoveries were
1960s made
▪ the PCR (polymerase chain reaction) was also
discovered
molecular biology goes genomic
genomics:
▪ study of genes and their functions and
1980s
related techniques
▪ addresses all genes and their
interrelationships in order to identify their
combined influence on the growth and
development of an organism
the Human Genome Project was launched
▪ the project aims to map all the human genes
1990
or all the base pairs in the human genome
and was completed in April 2003
molecular biology goes post-genomic
post-genomic
▪ utilizes the sequence of information provided
by genomics, but then situates it in an
analysis of all the other entities and activities
2000s
involved in the mechanisms of transcription,
regulation, metabolism, and expression
▪ this does not only focus on the genes but also
the proteins and all the processes
surrounding it
▪ Swiss biochemist
Friedrich ▪ (1868) first to isolate DNA: he called it
Miescher nuclein because he isolated it from the
nucleus of blood cells, specifically the
WBCs
▪ based on his experiments, he noticed that
this component/molecule did not react
according to how he expected it to react
with protein chemical reactions so he
deduced that it was not protein
▪ Russian-American biochemist
▪ (1910) formulated the Tetranucleotide
Hypothesis
▪ coined the term “nucleotide”: he was the
first to use the term
TETRANUCLEOTIDE HYPOTHESIS
Phoebus Levene ▪ nucleic acid was a structure of repeating
tetramer (four monomers) that is why it’s
tetranucleotide
▪ however, the simplicity of the structure
implied to them that nucleic acids were
too uniform contribute to complex
genetic variation so, for them, it seemed
that this structure was just too simple to
contain genetic information
▪ hence, a lot of scientists back then
believed that it was the protein that
carried the genetic information so they
focused on protein as the probable
hereditary substance
TRANSFORMATION PRINCIPLE
▪ in the 1920s up to the 1940s, several scientists conducted
experiments using virulent and non-virulent strains of bacteria
and deduced through their experiments that DNA may be
causing the transfer of the virulent strain to the non-virulent
strain
▪ due to this finding, they attracted attention again on DNA as a
possible contending molecule for carrying genetic information
▪ Austro-Hungarian-American biochemist
▪ (1950) formulated the Chargaff’s Rules
(specifically 1959)
▪ his findings were fundamental in the
discovery of DNA structure, because only
he was able to deduce the amount of the
Erwin Chargaff nucleotides and nitrogen bases found
inside the DNA but it wasn’t until
Rosalind Franklin came into the picture
that the answer to DNA structure was
finally becoming clear
CHARGAFF’S RULES
▪ A, T, C, and G were not found in equal
quantities
▪ amounts of nitrogen bases varied among
species, but not between individuals of
the same species
▪ A=T, and G=C (amounts are
approximately or almost equal to each
other)
▪ she was an expert in a technology called
x-ray crystallography in which she used it
to determine the structure of DNA
Rosalind Franklin ▪ the photograph
(diffraction image)
of DNA: shows an
“x” image that gives
a clear clue to
Watson and Crick
that contrary to a previous study that
claimed that DNA was composed of three
strands, this photo was a big clue to them
to deduce that DNA must be composed of
two strands instead of three
▪ for years, scientists have been trying to determine the
structure of the DNA molecule and it was largely due to seeing
Franklin’s x-ray diffraction image of DNA along with Chargaff’s
rules that allowed Watson and Crick to come up with their 3D
model of the DNA double helix
▪ (1953) built the 3D model of DNA’s
double helical structure
James Watson ▪ for this discovery, Watson and Crick,
and Francis Crick along with Wilkins (Franklin’s assistant),
were awarded the Nobel Prize in 1962
o since Rosalind Franklin already died,
her assistant got the Nobel Prize
WITH LORRAINE M., ARA G., PATRICK Y. ,
GENEVIEVE R., & JOSHUA G.
AIRAH M.
 ▪ due to the amount of discoveries and NUCLEIC ACIDS PENTOSE SUGARS
previously published works of the ▪ so called because they were originally isolated from cell nuclei
scientists before them, they were able to and have acidic properties
connect the dots ▪ macromolecules containing carbon, hydrogen, oxygen, nitrogen,
▪ what differentiates the two from the and phosphorus
other scientists was that a lot of them a molecule that contains a very large
were focused on collecting the data of number of atoms (from that list of atoms
chemical experiments to come up with macromolecule
and elements, we can deduce that the
the structure of the DNA; on the other nucleic acid is a big molecule)
hand, although both of them were not as nucleotides building blocks of nucleic acids
knowledgeable or as skilled in the lab the two main naturally-occurring types of RNA DNA
experiments as the scientists, they nucleic acids ribose deoxyribose
approached the matter in a different DNA and RNA ▪ we also have artificial nucleic acids that has hydroxyl group in the
angle wherein they focused on building a only hydrogen in 2’carbon
are designed and synthesized by 2’Carbon
model of the DNA based on the findings
biochemists
of previous published works BASIC NUCLEOTIDE COMPONENTS
▪ since these works were already NUCLEIC ACIDS: NUCLEOTIDES The basic nucleotide component is composed of a nitrogenous
published, they have the right to COMPOSITION: base, pentose sugar and a phosphate group. So, based on the
interpret this data to build the 3D model ▪ nitrogenous base (pyrimidines and purines) image below, there is no oxygen attached to the 2’ carbon,
of DNA ▪ pentose sugar hence, this is your deoxyribose.
▪ although there were still controversy ▪ phosphate group
surrounding the discovery of the DNA
structure, it is undeniable that although I. NITROGENOUS BASE
they did not do the lab experiments pyrimidine purines
themselves, they were the ones who consist of fused 6-membered
managed to connect the dots between consist of 6-membered N-
and 5-memebered N-
various published works containing rings
containing rings
▪ through their careful analysis of these
studies, they were able to conclude that, PYRIMIDINE BASES
contrary to another recently released thymine cytosine uracil
study, DNA is composed of two in DNA in RNA
polynucleotide chains held together by
purine and pyrimidine bases through
hydrogen binding that the sugar in the
backbone was deoxyribose (instead of
ribose) that these two polynucleotide
chains ran antiparallel to each other
IMPLICATIONS OF WATSON AND CRICK’S DISCOVERY
▪ it revolutionized the field of biology into a global industry: it’s
not just used in the medical field but is also used in other fields
PURINE BASES
(e.g. zoology, biotechnology, agriculture, environmental
adenine guanine
science)
▪ it also enables scientists to access genetic information about
life that had not been previously available
o other examples of advancements through this discovery
are: genetically modified organisms (GMOs), cloning,
genome

WITH LORRAINE M., ARA G., PATRICK Y. ,

GENEVIEVE R., & JOSHUA G.
AIRAH M.
 DNA (DEOXYRIBONUCLEIC ACID) formation of hydrogen bonds between o made possible by the two antiparallel ssDNA polymers twisting
hybridization
▪ major function: Storage of genetic information for most two complementary strands of DNA around the same axis
organisms phosphodiester bond between the sugars and o this allows H bonds to form between A&T and C&G
▪ long, double-stranded polymeric (many monomers) molecule bonds phosphorous groups o as long as the bases are in complementary order, the strands
(dsDNA) How do we know which one is 5’ and which one is 3’? of the helix have a ladder-like structure with rungs (base pairs)
▪ predominantly exists in a right-handed double helix form also Remember OrgChem and BioChem in numbering Carbons. It is of consistent size
known as the alpha-helix based on the carbons found in the ribose or deoxyribose sugar. ▪ flexibility of the carbon-oxygen linkages in the phosphodiester
bond allows the ladder to twist forming a regular helix
COMPOSITION the deoxyribose has 5 carbons:
o planar base pairs are stacked on top of each other: no room for
1 nitrogenous bases: adenine, cytosine, guanine, thymine ▪ 1’ is attached to the nitrogenous base
water molecules in between
2 pentose sugar ▪ 2’ contains the hydroxyl group and a ribose for RNA, while in DNA,
▪ helical dsDNA is stable at pH 4-9
3 phosphate group it does not contain a hydroxyl group that is why it’s called
▪ melting point (Tm of the DNA)
deoxyribose since it only has hydrogen
Nitrogenous bases are attached to the deoxyribose sugar, where o temperature at which 50% of dsDNA is converted to ssDNA
nitrogenous bases attach to and forms a polymer with deoxyribose ▪ hence, to know if it is a ribose or a deoxyribose, just look at the 2’
(stability broken in the presence of high temperature or
sugars of other nucleotides through a phosphodiester bond. carbon if it contains an H (which is DNA) or an OH (which is RNA)
extreme pH or destabilizing agents)
▪ the 5th one (5’) is located outside the ring connected to the
o depends on the relative G-C vs. A-T base pair content
phosphate above it (left side) or below it (right side)
⇨ the 3 hydrogen bonds of G-C base pairs require more energy
5’ to 3’ 3’ to 5’ to disrupt than the 2 hydrogen bonds of A-T base pairs
top bottom top bottom ⇨ hence, the DNA with higher G-C base pairs will take longer
ends in 5’ ends in 3’ ends in 3’ ends in 5’ to melt since it will have a higher Tm compared to the DNA
NOTE: this is based on the left side, the right side will have the with more A-T base pairs
opposite ends of the left side “We knew that DNA was important. We knew it was an important
▪ polarity: 5’ -> 3’ molecule. And we knew that its shape was likely to be important.
▪ antiparallel strands But we didn’t realize just how important it would be. We didn’t
▪ complementary base pairing (A-T, C-G) realize that the shape would give us a clue to the replication
mechanism. And this turned out to be really an unexpected dividend
TWO TYPES OF BONDS HOLDING DNA TOGETHER
phosphodiester bonds hydrogen bonds from finding out what the shape was.”
phosphate group + ribose / connect the nitrogenous base - Francis Crick
deoxyribose pairs RNA: RIBONUCLEIC ACID
DNA ▪ has ribose sugar, containing a hydroxyl group at the 2’
▪ stable, only loses its normal conformational structure at extreme ▪ uracil substitutes with thymine instead of Adenine. (A-U, C-G)
heat, pH, or in the presence of destabilizing agents ▪ predominantly single-stranded but it’s not always 100% the case
▪ double stranded helix: most energetically favorable state for o exceptions such as through internal homologies, RNA can fold
DNA molecular structure and loop among themselves to take on a double stranded
DNA
please view the video in this part from 25:25 to 34:07 character important for their function
backbone bases o RNA can also pair with complementary single strands of DNA
backbone
steps of the ladder hydrophilic hydrophobic or another RNA to form a double helix
(sides of the ladder)
forms stable H bonds with
phosphate group and non-soluble in water at ▪ much shorter than DNA
nitrogenous bases surrounding water molecules
deoxyribose sugar neutral pH ▪ transient and less stable
in solution
o not just because of its ss structure but also due to its
purines pyrimidines o in vivo, we have water everywhere, so your backbone can form susceptibility to alkaline hydrolysis via the 2’ hydroxyl group of
adenine and guanine cytosine and thymine
hydrogen bonds with surrounding solutions due to their the ribose moiety
the “blue links” between the base pairs hydrophilic nature o because it has a hydroxyl group sa 2-5, naka”siwil” ra iyahang
are hydrogen bonds, which is a stable hydroxyl group which is why it easily gets hydrolyzed via
▪ for a DNA molecule to remain stable, the bases must not be in
hydrogen bonds bond that connects the nitrogenous bases alkaline hydrolysis
contact with water because it is hydrophobic, hence, its
(the bond can only be broken by high ▪ copied, or transcribed, from DNA
temperatures) placement is in the middle for protection

WITH LORRAINE M., ARA G., PATRICK Y. ,

GENEVIEVE R., & JOSHUA G.
AIRAH M.
 TYPES OF RNA REFERENCES
▪ largest component (80-90%) of cellular
ribosomal RNA RNA
(rRNA) ▪ important in the structural and functional
part of the ribosomes (protein synthesis)
▪ initial connection between the
information stored in DNA and the
messenger RNA translation apparatus that will produce the
(mRNA) protein products
▪ amount in the cell depends on its
requirement for its final product
▪ short, singe-stranded polynucleotides of
73-93 bases in length
transfer RNA
▪ key link between transcribing and
(tRNA)
translating RNA into protein
▪ at least one tRNA for each amino acid
small nuclear ▪ functions in splicing in eukaryotes
RNA (snRNA) ▪ stays in the nucleus after its transcription
COMPARISON OF KEY FEATURES OF DNA AND RNA
FEATURE DNA RNA
sugar* deoxyribose ribose
thymine-adenine uracil-adenine
base pairs
cytosine-guanine cytosine-guanine
double-stranded variable, determined
3D structure
alpha helix by base sequence
subject to base
stable
stability hydrolysis
degraded by DNase degraded by RNase
maintains genetic carries genetic
function information in information to
nucleus cytoplasm
*basis of the name differences between the two

STUDY QUESTIONS
1. What is the function of the DNA in the cell?
2. Compare the structure of the nitrogenous bases. How do purines
and pyrimidines differ?
3. Which of the ribose car bonds participate in the phosphodiester
bond?
4. Write the complementary sequence to the following:
5’ AGGTCACGTCTAGCTAGCTAGA 3’

WITH LORRAINE M., ARA G., PATRICK Y. ,

GENEVIEVE R., & JOSHUA G.
AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS
TOPIC 2: CENTRAL DOGMA OF MOLBIO PART 1
(TRANSCRIPTION & TRANSLATION)
Lecturer: Sir Jerome Mantal CSE, MSCI (c)
Everyone one of us is a unique creation. Distinct uniqueness is based
on the genetic interplay within our body. We are defined solely by
either faulty or correct version of our genes that codes genetic
information. Genetically, you are who you are because of DNA built
from our parents. But the question is, how does DNA makes you,
you?
LEARNING OBJECTIVES
▪ Discuss the relationship between genes, proteins, and RNAs
▪ Describe the overview of transcription in both prokaryotic and
eukaryotic cells
▪ Explain the synthesis and processing of eukaryotic ribosomal, and
transfer RNAs
I. THE RELATIONSHIP BETWEEN GENES, PROTEINS, AND RNAs
▪ Archibald Garrod and inborn errors of metabolism
▪ George Beadle, Edward Tatum, and one gene one enzyme
hypothesis
▪ Establish a brief conclusion of the relationship between genes,
proteins, and RNAs
▪ Flow of information through the cell
ARCHIBALD GARROD (1857-1936)
▪ British physician
▪ in 1902, he was the first to suggest that
genes dictate phenotypes through enzymes
that catalyze specific chemical reactions in
the cell
▪ gained first meaningful insight into gene
function
▪ one of the diseases investigated by him was ALCAPTUNARIA
(a condition readily diagnosed because the urine becomes
dark upon exposure to air)
▪ he postulated that symptoms of an inherited disease reflect on
the ability to make particular enzymes
▪ he had discovered the relationship between a genetic defect,
a specific enzyme, and a specific metabolic condition
▪ he later referred these discoveries to such diseases as inborn
errors of metabolism
o these are inherited disorders caused by mutations in genes
coding for proteins that function in metabolism
o most are inherited as autosomal recessive (a genetic
condition that appears only in individuals who have received
two copies of an autosomal gene: one copy from each
parent)
o environmental, epigenetic, and microbiome factors and
additional genes are potential modifying factors in those
with inborne errors of metabolism that also includes the
defects in urea cycle
▪ with other early observations of basic importance in genetics,
Garrod’s findings went unappreciated for decades
GEORGE WELLS BEADLE (1903-1989);
EDWARD LAWRIE TATUM (1909-1975)
▪ the idea that genes direct the
production of enzymes was
ressurected in the 1940s by
these Beadle and Tatum of the
California Institute of
Technology
▪ Beadle and Tatum began
working with a bread mold, Neurospora crassa, which are
haploid species: their experiment’s goal is to observe a change
in the mutant’s phenotype and they needed to disable just one
allele of the protein coding gene required for a specific
metabolic activity
The Beadle-Tatum experiment for the isolation of genetic
mutants in Neurospora
They bombarded Neurospora with x-rays known to cause
mutations (②) and look among the survivors for mutant that
differed in their nutritional needs from the wild-type bread mold.
To screen for such mutations, irradiated spores were tested for
their ability to grow in a minimal medium that lacked the
essential compounds known to be synthesized by these
organisms. Eventually, the progeny about 100,000 irradiated
spores were tested. Out of these, dozens of mutants were
isolated. Each mutant has a gene defect that resulted in an
enzyme. They found out that deficiency that prevented cells from
catalyzing a particular metabolic reaction happens on their
experiments and the results were clear cut – a gene carries the
information for the construction of a particular enzyme – the
collected results taken together provided strong supoor tfor
working hypothesis they had posed earlier and these conclusions
became known as ONE GENE-ONE ENZYME HYPOTHESIS as they
stated that a function of a gene is to dictate the production of a
specific enzyme.
So, what’s the relationship between genes, proteins, and RNAs
based on the experiments of Garrod, Beadle, and Tatum’s?
Most important task of the cell is to synthesize proteins based on
the codes in DNA. Hence, their relationship lies on the process of
replication, transcription, and translation that are used by all cells
to maintain their genetic information and to convert the genetic
information encoded in DNA into gene products which are either
RNAs or proteins.
▪ with this idea in mind, it might be best to define a gene as a
segment of DNA that contains the information for either a single
polypeptide chain or one or more functional RNAs
AN OVERVIEW OF THE FLOW OF INFORMATION THROUGH THE
CELL: TRANSCRIPTION
Genes provide the instruction for making a specific protein. But, a
gene does not build a protein directly. The information present in
the segment of DNA is made available to the cell through formation
of an RNA molecule.
▪ the bridge between DNA and protein synthesis is the nucleic acid
RNA
▪ biologically speaking, RNA is chemically similar to DNA except
that it contains ribose instead of deoxyribose as its sugar and has
nitrogenous base uracil rather than thymine
▪ DNA information → formation of a molecule of RNA
▪ the synthesis of an RNA from a DNA template is called
transcription
o a process in which the information encoded in the four
deoxyribonucleotide letters of a DNA is rewritten or
transcribed into a similar language composed of four
ribonucleotide letters of RNA
▪ studies carried out in the 1950s uncovered the relationship
between genetic information and amino acid sequence but these
knowledge by itself provided no clue as to the mechanism by
which the specific polypeptide chain is generated
▪ there is an intermediate between a gene and its polypeptide and
this is called the messenger RNA
o discovery of mRNA was made in 1961 by Francois Jacob and
Jacques Monod
o assembled as a complementary copy of one of the two DNA
strands that make up a gene because its nucleated sequence is
actually complementary to that of the gene from which it is
transcribed
o the mRNA retains this same information for polypeptide
assembly as the gene itself is for this reason, an mRNA can also
be transcribed as a “sense” strand or a coding RNA
WITH TONI KATE, C., ELIAM S., & HANNAH P.
AIRAH M.

▪ from eukaryotic mRNAs which are not synthesized in their final or
mature form but are instead must be carved out or processed
from larger pre-mRNAs, the use of mRNA allows the cell to
separate information storage from information utilization
▪ while the gene remains stored away in the nucleus as part of a
huge stationary DNA molecule, its information can be imparted
to a much smaller mobile nucleic acid that passes into the
cytoplasm.
▪ once in the cytoplasm, the mRNA conserves as a template to
direct the incorporation of amino acids in a particular order coded
by the nucleotide sequence of DNA and mRNA.
▪ the use of mRNA also allows a cell to greatly amplify its synthetic
output
▪ one DNA molecule can serve as the template in the formation of
many mRNA molecules and each of which can be used in the
formation of a large number of polypeptide chain
AN OVERVIEW OF THE FLOW OF INFORMATION THROUGH
THE CELL: TRANSLATION
▪ proteins are synthesized in the cytoplasm by a complex process
called translation
▪ translation requires the participation of dozens of different
components including ribosomes (complex cytoplasmic
machines that can be programmed like a computer to translate
the information encoded by any mRNA)
▪ the RNAs of ribosomes are called ribosomal RNAs (or rRNAs)
o like mRNAs, each is transcribed from one of the DNA strands of
a gene rather than functioning in an informational capacity
o provide structural support and catalyzed the chemical
reactions in which amino acids are covalently linked to one
another
▪ transfer RNAs (or tRNAs) constitute the 3rd major class of the RNA
that is required during protein synthesis
o are required to translate the information in the mRNA
nucleotide code into the amino acid alphabet of a polypeptide
▪ both rRNAs and tRNAs owe their activity to their complex
secondary and tertiary structures
▪ unlike DNA which has a similar double stranded helical structure
regardless of source, many RNA fold into a complex three-
dimensional shape which is markedly different from one type of
RNA to another, thus, this gives us the idea that like proteins,
RNAs carry out a diverse array of functions because of their
different shapes
▪ as with proteins, the folding of RNA molecules follows certain
rules
▪ whereas protein folding is driven by the withdrawal of
hydrophobic residues into the interior, RNA folding is driven by
the formation of regions having complementary base pairs
▪ as seen in the image above, base paired regions typically form
double stranded stems or double helical stems which are
connected to single stranded loops
▪ unlike DNA which consists of exclusively of standard Watson-
Crick base pairing, RNAs often contain non-standard base pairs
and modify nitrogenous bases: these unorthodox regions of the
molecule serve as recognition sites for proteins and other RNAs
which promotes RNA folding and help stabilize the structures of
the molecule
▪ the importance of the complementary base pairing extends far
beyond tRNA and rRNA structure
▪ base pairing between the RNA molecules play a central role in the
most of the activities in which RNAs are engaged
LEARN SOURCE 1: (needs answers because Sir will collect them after
the discussion of Central Dogma Part II)
▪ How were Beadle and Tatum able to conclude that a gene
encoded a specific enzyme?
▪ Distinguish between the two-dimensional and three-dimensional
structure of RNAs.
II. AN OVERVIEW OF TRANSCRIPTION IN BOTH PROKARYOTIC
AND EUKARYOTIC CELLS
▪ Basic scientific principle of transcription
▪ Chain of elongation during transcription
▪ Transcription in bacteria
▪ Transcription and RNA processing in eukaryotic cells
PROKARYOTES EUKARYOTES
organisms made up of cells
are organisms made up of cells
that possess a membrane-
that lack a cell nucleus or any
bound nucleus that holds
membrane-encased
genetic material as well as
organelles
membrane-bound organelles
SALIENT FEATURES: TRANSCRIPTION
▪ transcription is the first step in gene expression: it involves
copying a gene’s DNA sequence to make an RNA molecule
▪ transcription is a process in which a DNA strand provides the
information for the synthesis of an RNA strand
▪ transcription is performed by enzymes called RNA polymerases,
which link nucleotides to form an RNA strand (using a DNA strand
as a template)
o the enzyme responsible for transcription in both prokaryotic
and eukaryotic cells are called DNA -dependent RNA
polymerases or simply known as RNA polymerases
o these enzymes are able to incorporate nucleotides one at a
time into a strand of RNA whose sequence is complementary
to one of the DNA strands which serve as a template
▪ transcription has three stages: initiation, elongation, and
termination
WITH TONI KATE, C., ELIAM S., & HANNAH P.
AIRAH M.

▪ the first step in the synthesis of an RNA is the association of a
polymerase with a DNA template
o this brings up a matter of more general interest namely the
specific interactions of two varying different macromolecules:
the proteins and the nucleic acids
▪ the sites of the DNA to which an RNA polymerase molecule binds
prior to initiating transcription is called the promoter
▪ cellular RNA polymerases are not capable of recognizing
promoters on their own but require the help of additional
proteins called transcription factors
▪ in addition to providing a binding site for the polymerase, the
promoter contains the information that determines which of the
two DNA strands is transcribed at the site at which transcription
begins
▪ in the images above, it represents that RNA polymerase that
catalyzes the highly favorable reaction in which RNA polymerase
moves along the template DNA strands towards its 5” end
▪ apparently, as the polymerase progresses, the DNA is temporarily
unwound and the polymerase assembles a complementary
strands of RNA that grown from its 5” terminus/terminals at a 3”
direction
▪ these highly favorable reaction can be summarized as follows:
this is called the Pyrophosphorolysis (not sure) reaction:
where:
n = no. of nucleotide residues in the RNA molecule
NTP = ribonucleoside triphosphate substrate
PPi = pyrophosphate
▪ the hydrolysis of pyrophosphate releases a large amount of free
energy and makes the nucleotide incorporation rxn essentially
irreversible
▪ as the polymerase moves along the DNA template, it incorporates
complementary nucleotides into the growing RNA chain
▪ the nucleotide is incorporated into the RNA strand if it is able to
form a proper base pair with the nucleotide in the DNA strand
being transcribed
▪ the figure shows that process where the incoming adenosine 5” TRANSCRIPTION IN BACTERIA
triphosphate pairs with the thymine-containing nucleotide of the
template
Chain of Elongation or Chain Elongation
▪ this results following an attack by the 3”-OH of the nucleotide at
the end of the growing strand of the 5”- a-phosphate of the
incoming nucleoside triphosphate
▪ the pyrophosphate release is subsequently cleaved, which drives
the rxn in the direction of polymerization
▪ the geometry of the base pairing between the nucleotide of the
template strand and the incoming nucleotide determines which
of the 4 possible nucleoside triphosphates is incorporated into
the growing RNA chain at each side
▪ RNA polymerases are capable of incorporating from about 20-50
nucleotides into a growing RNA molecule per second and many
genes in a cell are transcribed simultaneously by a 100 or more
polymerases
▪ the frequency at which a gene is transcribed is tightly regulated ▪ bacteria such as E. coli contain a single type of RNA polymerase
and can vary dramatically depending on a given gene and the (5 subunits tightly associated to form a core enzyme)
prevailing conditions ▪ if the core enzyme is purified from a bacteria cell and added to a
sol’n. of bacterial DNA molecules and ribonucleoside
the picture on the right is a triphosphate, the enzyme binds to the DNA and the synthesized
photomicrograph which shows RNA
the micrograph of the chain of ▪ the RNA molecules produced by a purified polymerase, however,
elongations in which, it happens are not the same as those found w/in cells because the core
that RNA polymerases are capable enzyme has attached to random sites in the DNA and these sites
of incorporating 22-50 nucleotides would have been normally been ignored in vivo.
▪ however, purified accessory polypeptide called sigma factor (σ) +
RNA polymerase before it attaches to the DNA, transcription
begins at selected locations and attachment of factor to the core
enzyme increases the enzyme’s affinity for promoter sites in DNA
and decreases its affinity for DNA in general
WITH TONI KATE, C., ELIAM S., & HANNAH P.
AIRAH M.
▪ as a result of these process, the complete enzyme is thought to
slide freely along the DNA until it recognizes and binds to a
suitable promoter region
▪ additionally to these concepts, these case of bacterial
transcription, bacterial promoters are located in the region of a
DNA strand just preceding the initiation site of RNA synthesis
The figure above shows the basic element of a promoter region in
the DNA of the bacterium E. coli.
▪ the nucleotide at which transcription is initiated is denoted as +1
(positive one) and the preceding nucleotide as -1 (negative one)
▪ those portions of the DNA preceding the initiation site, which are
toward the 3” end of the template, are said to be upstream from
the site
▪ those portions of the DNA succeeding it, which are towards the
5” end of the template, are said to be downstream from that site
▪ analysis of the DNA sequences just upstream from a large no. of
bacterial genes reveals that 2 short stretches of DNA are similar
from one gene to another
▪ one of the stretches is centered at approximately 35 bases
upstream from the initiation site and typically occurs as the
sequence, TTGACA
o TTGACA sequence, also known as 35 element which is called a
consensus sequence, indicates that it is the most common
version of a conserved sequence, but some variation occurs
from gene to another
▪ the 2nd conserved sequence is found approximately 10 bases
upstream from the initiation site and occurs at the consensus
sequence, TATAAT
▪ NOTE: a transcription is initiated at specific points in the
chromosome, but is also terminated when a specific nucleotide
sequence is reached
▪ in roughly half of the cases, a ring-shaped protein called RHO is
required for termination of bacterial transcription
o RHO encircles the newly synthesized RNA and moves along the
strand in a 5” to 3” direction to the polymerase, where it
separates the RNA transcript from the DNA to which it is bound
▪ in other cases, the polymerase stops transcription when it
reaches a terminator sequence
o a terminator sequence typically fold into an open loop that
causes the RNA polymerase to release the complete RNA chain
w/o requiring additional factors
TRANSCRIPTION AND RNA PROCESSING IN EUKARYOTIC CELLS
ROBERT G. ROEDGER at University of
Washington (1969)
o eukaryotic cells have 3 distinct
transcribing enzymes in their cells, each of
these enzymes are responsible for
synthesizing different group of RNAs
o plants have 2 additional polymerases that
are not essential for life
o NO prokaryote has been found with multiple RNA polymerases,
whereas the simplest eukaryote (e.g. yeast) have the same 3
nuclear types which are present in mammalian cells
o these differences in the no. of polymerases is another sharp
distinction between prokaryotic and eukaryotic cells
EUKARYOTIC NUCLEAR RNA POLYMERASES
Enzyme RNA Synthesized
RNA polymerase I larger rRNAs (28S, 18S, 5.8S)
mRNAs, most small nuclear RNAs
RNA polymerase II (snRNAs and snoRNAs),
Most microRNAs and, telomerase RNA
other small RNAs, including tRNAs, 5S,
RNA polymerase III
rRNA, and U6 snRNA
RNA polymerase IV,
V (Plants only)
siRNAs
this image shows RNA polymerase from the 3 domains of life:
▪ bacterial RNAP ▪ archaeal RNAP ▪ eukaryotic RNAP
the image is a comparison between prokaryotic and eukaryotic
polymerases structure:
▪ each subunit of an enzyme is denoted by a different color and
labelled according to conventional nomenclature for that enzyme
▪ homologous subunits are depicted by the same color and it is
evident that Archaeal and Eukaryotic enzymes are more similar in
structure toward one another than the Bacterial and Archaeal
enzymes
o this feature reflects the evolutionary relationship between
Archaea and Bacteria
▪ although the yeast enzyme shown in this image has a total of 12
subunits, 7 more than its bacterial counterpart, the fundamental
core structures of the 2 enzymes are virtually identical
o this is determined by looking at the green color, but it is
enlarged in high resolution so we can further see the regions
of the bacterial polymerase that are structurally homologous
the yeast enzymes and might be that we can magnify the large
channel that grips the downstream DNA, which might be
evident as well
ROGER KORNBERG
▪ Nobel Prize in Chemistry 2006
▪ molecular basis of eukaryotic transcription
▪ so, a major distinction between our understanding of
transcription in eukaryotes was greatly advanced in the 2001
publications of the X Ray crystallographic structures of the yeast
RNA polymerase 2 by Roger Kornberg and colleagues at Stanford
University
o as a result of these studies and those of other laboratories in
subsequent years, we now know a great deal about the
mechanism of action of RNA polymerases as they move along
the DNA, transcribing a complementary strand of RNA
▪ major distinction between transcription in prokaryotes and
eukaryotes is the requirement in eukaryotes for a large variety of
accessory proteins or transcription factors
▪ these proteins play a role in virtually every aspect of the
transcription process from the binding of the polymerase to the
DNA template, to the initiation of transcription, to its elongation
and termination
THREE MAJOR TYPES OF EUKARYOTIC RNAs
mRNAs, rRNAs, and tRNAs
▪ derived from precursor RNA molecules that are considerably
longer than the final product
▪ so the initial precursor RNA is and it's called the primary transcript
or pre-RNA
or pre-RNA initial precursor RNA
equivalent in length to the full length of
the DNA transcript
do not exist within the cells as naked RNA,
but, become associated with proteins
primary transcript
even as they are synthesized
typically have a fleeting existence meaning
it is being processed into smaller
functional RNAs by a series of cut and
paste reactions
transcribed segment of DNA from which a
transcription unit
primary transcript is transcribed
requires a variety of small RNA's that has
RNA processing 90-300 nucleotides long and their
associated for proteins
WITH TONI KATE, C., ELIAM S., & HANNAH P.
AIRAH M.
activities associated with the transcription and processing of each SYNTHESIZING THE rRNA PRECURSOR
of the major eukaryotic RNAs
most precursor Messenger RNAs have
non-coding introns that intervene exons,
and introns must be removed and axons
ligated together to form a mature m-RNA
pre-mRNA splicing allows an additional layer of genetic
complexity as alternative splicing of exons
into the final mRNA that can control
transcript abundance and protein isoform
production

LEARN SOURCE 2: (needs answers because Sir will collect them after ▪ this micrograph shows numerous genes for ribosomal RNA
the discussion of Central Dogma Part II) situated one after the other along a single DNA molecule, thus
▪ What is the role of a promoter in gene expression? Where are the revealing the tandem arrangement of the repeated rRNA genes
promoters for bacterial polymerases located? ▪ We can interpret this photograph to provide a great deal of
▪ Describe the steps during initiation of transcription in bacteria. information about the process of rRNA transcription
What is the role of the sigma factor? What is the role of ▪ each of the 100 or so fibrils emerging from the DNA as a branch
pyrophosphate hydrolysis? of a Christmas tree is a nascent rRNA transcript which are caught
in the act of elongation
▪ How do the number of RNA polymerases distinguish prokarytoes
▪ with clear observations on the photograph, we can see as
and eukaryotes? What is the relationship between a pre-RNA and
somewhat dark coil lines at the center of the nascent rRNA, it is
a mature RNA? actually a dark granule at the base of each fibril and is the RNA
SNTHESIS AND PROCESSING OF EUKARYOTIC RIBOSOMAL AND polymerase I which is synthesizing that transc-figure with higher
TRANSFER RNAs magnification
▪ Macromolecular composition of a mammalian ribosome
▪ Synthesizing the rRNA precursor
▪ Processing rRNA precursor
A eukaryotic cell may contain millions of ribosomes and each
consisting of several molecules of rRNA together with dozens of ▪ the bulk of a nucleus is composed of nascent ribosomal subunits
ribosomal proteins. The composition of a mammalian ribosome is that give the nucleolus its granular appearance which can be seen
shown in the image below. in the above figure
▪ ribosomes are so numerous that more than 80% of the RNA in ▪ there are three distinct nucleolar regions that can be
most cells consist of Ribosomal RNA distinguished morphologically from the electron micrograph
▪ to furnish the cell with such a number of transcripts, the DNA above
sequences encoding rRNA are normally repeated 100x ▪ the bulk of nucleolus consist of a:
DNA sequences that encode rRNA Granular contains ribosomal subunits in various
typically clustered in one or a few regions of the to visualize it clearly, here is an image with higher magnification
component (gc) stages of assembly
rDNA genome (fibrils have different sizes or lengths)
embedded with the granular regions
the human genome has 5 rDNA clusters, each on a Surrounded by the dense fibrillar ▪ length of the fibrils increase gradually from one end of the
different chromosome Fibrillar center(fc) component (dfc) Christmas tree trunk to the other
According to one model, the FC RNA molecules of fewer nucleotides that are
non-dividing cell
contains the DNA that codes for rRNA shorter fibrils attached to polymerase bound to the DNA
clusters of rDNA are
Dense fibrillar contains the nascent pre-RNA closer to the transcription initiation site
gathered as one or more
component (dfc) transcripts and associated proteins the longer the fibrils, the closer the transcript
irregularly shaped nuclear longer fibrils
interphase according to this model, transcriptions is to completion
structures called nucleoli
of the pre-rRNA precursors take place at length of the DNA between the shortest and longest fibrils
(singular, nucleolus) that
the border between the fc and the dfc corresponds to a single transcription unit
function in producing
ribosomes
WITH TONI KATE, C., ELIAM S., & HANNAH P.

AIRAH M.
 PROCESSING THE rRNA PRECURSOR
How are rRNA precursors being processed?
▪ eukaryotes have four distinct ribosomal RNAs: three in the large
subunit + one in the small subunit in humans:
o large subunit contains a 28S, 5.8S and a 5S RNA molecule
o small subunit contains an 18S RNA molecule
▪ three of these rRNAs (the 28S, 18S, and 5.8S) are carved by
various nucleases from a single primary transcript (pre-rRNA)
▪ 5s rRNA is synthesized from a separate RNA precursor outside the
nucleolus
Pre-rRNA
2 peculiarities as compared with other RNA transcripts:
▪ large number of methylated nucleotides
▪ pseudouridine residues
By the time the human pre-rRNA precursor is first cleaved:
▪ over 100 methyl groups has been added to ribose groups in the
molecule
▪ approximately 95 of its uridine residues has been enzymatically
converted to pseudouridine (seen in image below)
▪ all of this modifications or after these nucleotides are
incorporated into the nascent RNA that is post transcriptionally
and altered nucleotides are located at specific positions and are
clustered within portions of the molecule that have been
conserved among organisms
▪ all of the nucleotides in the pre-rRNA that are altered remain as
part of the final project while unaltered sections are discarded
during processing
the role of the snoRNAs in the process of RNA precursors:
▪ the nucleolus contains a large population of small ribonucleic
acids, molecules called snoRNAs which are involved in the
modification and processing of pre-ribosomal RNAs
▪ the processing of the pre-rRNA is accomplished with the help of
a large number of small nucleolar RNAs that are packaged with
particular proteins to form particles called small nucleolar
ribonucleoproteins
▪ to date, about 80 different snoRNAs have been found in the yeast
Saccharomyces cerevisiae and almost twice as many in human
cells. So the first RNP particle to attach to a pre-rRNA transcript
contains the U3 snoRNA
o U3 snoRNA is an unassociated protein required for the
processing of pre-ribosomal RNA, an assembly of pre-
ribosomes
o there are two major snoRNA containing complexes:
⇨ the monoparticle contains U3 snoRNA and the core(?) box
C/D snoRNA which are associated proteins and
⇨ early pre-ribosome associated complex contains the
monoparticle and additional factors that we refer to as pre-
ribosome associated proteins
o this huge component of the rRNA processing machinery can be
seen as a ball bound to the outer end of each fibril where it
catalyzes the removal of the 5’ end of the transcript
SYNTHESIS AND PROCESSING OF THE 5S rRNA
▪ a 5S rRNA is about 120 nucleotides long and is present as part of
the large ribosomal unit of both prokaryotes and eukaryotes
▪ in eukaryotes, 5S rRNA molecules are encoded by a large number
of identical genes that are separate from the other rRNA genes
and are located outside the nucleolus
▪ following its synthesis, the 5S rRNA is transported to the
nucleolus to join the other components involved in the assembly
of the ribosomal subunits
▪ these 5S rRNA genes are transcribed by the RNA polymerase III (is
unusual among the three polymerases that it can bind a promoter
site located within the transcribed portion of the target gene)
▪ the internal position of the promoter was first clearly
demonstrated by introducing modified 5S rRNA genes into the
host cells and determining the ability of that DNA to serve as
template for the host polymerase III
TRANSFER RNAs
▪ plant and animal cells (have approx 50 different species of
transfer RNA)
o each of these are encoded by a repeated DNA sequence
o degree of repetition varies with the organisms like yeast
cells have a total of about 275 tRNA genes, fruit flies about
150, and humans about 1300
▪ transfer RNAs are synthesized from genes that are found in
small clusters scattered around the genome
o these single scattered typically contains multiple copies of
different tRNA genes
o conversely, the DNA sequence encoding of given tRNAs
typically found in more than one cluster
o the DNA within a cluster or tDNA consist largely of non-
transcribed spacers(?) sequences, with the RNA encoding
sequences situated at irregular intervals in tandemly
repeated arrangements
▪ tRNAs are transcribed by RNA polymerase III (similar to 5S
rRNAs)
o the promoter sequence lies within the coding section of the
gene, rather than being stopped at its 5‘ plank(?)
o the primary transcript of a tRNA molecule is larger than the
final product and pieces on both the 5 and 3 sides of the
precursors tRNA must be trimmed away
▪ ribonuclease P (an endonuclease; is an enzyme involved in the
pre-tRNA processing)
o present in both bacterial and eukaryotic cells
o consist of both RNA and DNA + protein subunits
CENTRAL DOGMA OF MOLBIO PART II
(for the next video)
▪ Synthesis and Processing of Eukaryotic Messenger RNAs
▪ The Processing of Eukaryotic Messenger RNAs
▪ Basic of Small Regulatory RNAs and RNA silencing pathways
▪ Encoding Genetic Information
▪ Decoding the Codons: The Role of Transfer RNAs
▪ Translating Genetic Information (Initiation, Elongation,
Termination)
WITH TONI KATE, C., ELIAM S., & HANNAH P.
AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS
TOPIC 2: CENTRAL DOGMA OF MOLBIO PART II
Lecturer: Sir Jerome Mantal, CSE, Msci (c)
Heads up! The phrases in blue font are the ones in the ppt, the others are
Sir’s side notes.
Last meeting, we discussed about:
▪ The relationship of genes and proteins with the help of Garrod’s concept
of inborn error of metabolisms, Beadle-Tatum experiment as well on
mutated bread mold strains called Neurospora which later known as one
gene one enzyme experiment, and this hypothesis was modified into one
gene-one polypeptide
▪ The basic principle of the flow of information through the cell from DNA
to proteins which requires two major stages - the transcription and
translation - and all different molecular preference and principle in
transcription and translation in both prokaryotic and eukaryotic
organisms
LEARNING OBJECTIVES:
▪ Discuss synthesis and processing of eukaryotic messenger RNAs
▪ Discuss RNA silencing pathways
▪ Explain encoding genetic information
▪ Examine translating genetic information process
SYNTHESIS AND PROCESSING OF EUKARYOTIC MESSENGER RNAs
▪ The precursor of mRNAs are represented by diverse RNAs called
heterogeneous nuclear RNAs (hnRNAs)
o Found only in the nucleus
o Have large molecular weights
o Are degraded after a very short time
When eukaryotic cells are incubated for a short period in uridine or
phosphate and immediately killed, most of the radioactivity is incorporated
into RNA molecules that have the following properties:
▪ have large molecular weights (up to 50,000 nucleotides)
▪ as a group, they are also represented by RNAs of diverse nucleotide
sequence (these are classified as heterogeneous nucleotide sequences)
▪ are only found in the nucleus
▪ Because of those aforementioned properties, these RNAs are referred to
as heterogeneous nuclear RNAs (hnRNAs) and they are indicated by the
red radioactivity line in this figure. As you can see in the figure, the larger
the RNA, the farther it travels through centrifugation and closer to the
button of the tube it ultimately lies.
▪ In the absorbance, which are indicated by the blue lines, shows that the ▪ as you can see in this figure, a eukaryotic promoter commonly includes a
total amount of RNA in different regions of the centrifuge tube, whereas TATA box. About 25 nucleotides upstream position from the
the red lines indicate the corresponding radioactivity, so it is evidently transcriptional starting point
further that the most of the newly synthesized RNA is very large, much ▪ the TATA box is indicated in the blue shading and eukaryotic promoters
larger than the stable 18s and 28ns RNAs: these large RNAs are the contain a second conserved core promoter element called the initiator
hnRNAs (INR) shown in pink shades which include the site where the transcription
▪ when the cells that have been incubated in uridine of full speed for a brief is initiated
pause, placed into unlabeled medium and we chased it for several hours
before they are killed and then we already extracted the RNA, the amount
of radioactivity in the large nuclear RNA drops sharply and appears
instead in much smaller mRNA is found in the cytoplasm
o therefore it is evident from these scrubs that neither the hnRNA nor
the mnRNA in the cell: if they did, there would be a greater
correspondence between the blue and red lines
▪ even though the mRNAs constitute only a small percentage of the total
RNA of most eukaryotic cells, they also constitute a large percentage of
the RNA that is being synthesized by the cell at any given moment
▪ the reason that there is little or no evidence of the hnRNAs and mRNAs in
the optical density plots that these RNAs are degraded after relatively
brief amperes of time
THE MACHINERY FOR mRNA TRANSCRIPTION
▪ RNA polymerase II is assisted by general transcription factors (GTFs) to
form a pre-initiation complex (PIC)
▪ the critical portion of the promoter lies 24-32 bases upstream from the
initiation site, and contains the TATA box
▪ the pre-initiation complex of GTFs and polymerase assemble at the TATA
▪ in continuation of the previous figure, so the first step in assembly of the
box
preinitiation complexes binding of a protein called TATA binding protein
▪ in line with those previous discussion, all eukaryotic mRNA precursors are
(TBP) that recognizes the TATA box of these promoters
synthesized by RNA polymerase two which an enzyme composed of a
▪ in several transcriptions factors, one must recognize the TATA box and
dozen different subunit that is remarkably conserved from yeast to
bind to the DNA before RNA polymerase II can bind in the correct position
mammals.
and orientation
▪ RNA polymerase II, on the other hand, binds the promoter with the
▪ while TBP binds TATA or other subunits of the transcription factors to the
cooperation of a number of general transcriptions factors or known as
complex behind two other regions of the DNA which include the elements
GTFS to form a preinitiation complex
that lie downstream of the transcription starting site
▪ general or basal transcription factors simply assist in the binding of RNA
o binding of TF2, this sets the stage for the assembly of the complete
polymerase to the promoter
preinitiation complex, which is thought to concur in a stepwise
▪ a critical portion of the promoter of such gene lies between 24-32 bases
manner.
upstream from the site at which the transcription is initiated
▪ the presence of these three GTFs or the TVP of TF2D, TF2A, and TF2B
▪ these region often contains a consensus sequence that is either identical
bound to the promoter provides a platform for the subsequent binding of
or very similar to the oligonucleotide 5’ TA TAA to three prime N and is
the huge multi-subunit RNA polymerase with its attach TF2F
known as the TATA box
▪ once the RNA polymerase TF2F is in position, another pair of GTFs, we
o is called a TATA box because it is a nucleotide sequence containing
have the TF2E and TF2H join the complex and transform the polymerase
thymine, adenine, thymine, adenine
into an active transcribing machine
▪ in general, you just need to remember that three basic processes include:
a. there must be a eukaryotic promoter commonly includes a TATA box
upstream position from the transcriptional starting point
b. several transcription factors need to recognize these TATA box and
bind to the DNA before binding of RNA polymerase two in the correct
orientation
c. the process needs additional transcription factors bind to DNA along
with RNA polymerase II forming transcription initiation complex: that's
the time that RNA polymerase starts to unwind the DNA molecules and
RNA synthesis begins at the start point of the template strand
WITH ARIC JOSE, M.
AIRAH M.
 SPLIT GENES: AN UNEXPECTED FINDING
▪ the difference between hnRNA and mRNA provided early clues about RNA
processing
▪ eukaryotic genes contain intervening sequences which are missing from
matures mRNAs
▪ the presence of genes with intervening sequences are called split genes
▪ a remarkable stage of RNA processing in the eukaryotic nucleus is RNA
splicing, where large portions of the RNA molecules are removed and the
remaining portions are connected (the ‘cut and paste’ job is similar to
editing a movie)
▪ almost as soon as hnRNAs were discovered, it was proposed that these
groups of rapidly labeled nuclear RNAs were precursors to cytoplasmic
MRNAs
o the major sticking point was the difference in size between the two
RNA populations since the hnRNAs were several times the size of the
mRNAs
o early studies on the processing of ribosomal RNA had shown that
mature RNAs were carved from larger precursors
▪ recall that large segments were removed from both the 5’ and the 3’ sites
of various RNA intermediates to yield the final mature RNA products
▪ the first observations of major importance were made during the analysis
of the description of the adenovirus genome
o an adenovirus genome as we all know is a pathogen capable of
infecting a variety of mammalian cells
▪ a portion of the adenovirus genome was isolated and is located at the top
and the continuous sequence blocks labeled XY and Z appear in a
continuous arrangement in the mature mRNA that code from a variety of
polypeptides such as the hexon protein
▪ the conversion of the primary transcript to the mRNA involves the
removal or excision of the intervening sequences or introns, which starts
with I1 to I3, and ligation of the remaining portions to produce a
continuous RNA molecule, which are found on the bottom, and the
regions of DNA between these blocks referred to as intervening
sequences that starts with I1 to I3 in this figure and are somehow missing
the the corresponding mRNA
o so, it could have been argued that the presence of intervening
sequences is peculiarity of viral genomes but the basic observations
was soon extended to cellular genes themselves
INTRONS EXONS ▪ to the surprise of the researchers, the presence of the extra genes cause
the parts of the split gene that the petals to lose their pigmentation rather than become more or directly
the intervening sequences
contributes to the mature mRNA pigmented, as expected
▪ the discovery of genes with introns led to investigate how these genes
were able to produce mRNAs lacking these sequences
▪ intervening sequences were soon found in other genes and it became
apparent that the presence of genes with intervening sequences called
split genes is the rule, not the exception
▪ those parts of a split chain that contributes to do the mature RNA
products are called exons whereas at the intervening sequences are
called introns
▪ split genes are widespread among eukaryotes and although the entrance
of simpler eukaryotes tend to be fewer in number and smaller in size than
those of more complex plants and animals, still introns are found in all
types of genes that includes those that encodes tRNAs, rRNAs, and
mRNAs
▪ the discovery of genes with introns immediately raised the question as to
how such genes were able to produce messenger RNAs lacking these
sequences
o one likely possibility was that cells produce a primary transcript that
▪ subsequent studies indicated that under these experimental conditions
corresponds to the entire transcription unit and that those portions of
both the added genes on their normal counterparts within the genome
the RNA corresponding to the entrance in the DNA are somehow
were being transcribed, but the resulting mRNAs were somehow
removed
degraded
o if this were the case, then the segments corresponding to the introns
o the phenomenon became known as post transcriptional gene
should be present in the primary transcript: such an explanation would
silencing (PPGS)
also provide reason hnRNA molecules are so much larger than mRNA
▪ Andrew Fire of Carnage Institute of Washington on Craig Mello from the
molecules they ultimately produce
University of Massachusetts and their colleagues conducted and
▪ RNA polymerase II assembles a primary transcript that is complementary
experiment on the nematode C. elegans
to the DNA of the entire transcription unit
▪ they injected these worms with several different preparations of RNA
▪ electron microscopic examination of transcriptionally active genes
hoping to stop production of a particular muscle protein
indicates that RNA transcripts become associated with proteins and larger
particles while they are still in the process of being synthesized PREP. CONTAINS DEFINITION
o these particles, which mostly consists of proteins and an RNA having the sequence of the
ribonucleoproteins, include the agents responsible for converting a 1 sense RNA mrRNA that encoded V protein
primary transcript into a mature messenger being targeted
▪ this conversion process the addition of a 5’-cup and 3’-poly A tail to the an RNA having the complementary
2 antisense RNA
ends of the transcript and removal of any intervening introns sequence of the mRNA in question
▪ once the processing is completed, so the mRNA which consists of mRNA contains both the sense and
3 double stranded RNA
and associated proteins, is ready for exports from the nucleus antisense bound to one another
RNA SILENCING PATHWAYS ▪ neither of the single stranded RNAs had much of an effect but the double
stranded RNAs was very effective in stopping the production of the
results in the destruction of some mRNAs
unencoded or encoded protein
is produced with a double-stranded RNA shares the
▪ Fire and Mallo described the phenomenon as RNA interference (RNAI)
RNA same sequence as the target mRNA
interference an important biological mechanism in the regulation
(RNAi) of gene expression and the idea that RNA molecules
are directly involved in the regulation of gene
expression began with a puzzling observation
▪ the petals of a petunia plant are normally light purple
▪ in 1990, 2 groups of investigators reported on an attempt to deepen the
color of the flowers by introducing extra copies of a gene encoding
pigment producing enzyme
WITH ARIC JOSE, M.
AIRAH M.
 ▪ in the preceding sequence, the adenine, guanine, and cytosine would ▪ if one looks for the codon boxes for a specific amino acid, they tend to be
the steps involved in RNAi include: specify an amino acid as well as the guanine, cytosine, and adenine would clustered within a particular portion of the chart
▪ dsRNA is cleaved into small specify the next amino acids or the cytosine, adenine, and uracil the next ▪ CLUSTERING reflects the similarity in codons that specify the same amino
interfering RNAs (siRNAs) by an ▪ in contrast, if the code is non overlapping, then each nucleotide along the acid
enzyme called Dicer mRNA would be part of one and only one code ▪ as a result of the similarity in codon sequence, a spontaneous mutation,
▪ the small dsRNAs are loaded into ▪ however, if the code isn't overlapping and each nucleotide is part of only causing single base changes in a gene often will not produce a change in
a complex named RISC that one code, and the only one amino acid replacement would be expected, the amino acid sequence of the corresponding protein
binds siRNA to a target RNA that means that these and other data indicated that the code is non-
SYNONYMOUS NON-SYNONYMOUS
What are the steps involved in RNA overlapping
a change of nucleotide sequence
interference? a change that causes an amino
IDENTIFIYING THE CODONS that does not affect the amino acid
▪ first, we have the double acid substitution
▪ codon assignment was determined by transcription of artificial mRNAs sequence
stranded RNA which is also ▪ the first two codon bases for a particular amino acid are invariant, where ▪ the safeguard aspect of the code goes beyond its degeneracy, and codon
known as the sRNA that binds to as the third base may vary assignments are such that similar in amino acids tend to be specified by
the protein called Dicer and it
▪ by the year 1961, the general properties of the code were known but not similar codons
cleaves the double stranded
one of the coding assignments of the specific triplets had been discovered o e.g. codons of the various hydrophobic amino acids are clustered in the
RNA into smaller fragments
▪ during the time, most geneticist thought it would take many years to first 2 columns of the chart
▪ one of the RNA strands is loaded
into a RISC complex and links the decipher the entire code, TRANSLATING GENETIC INFORMATION
complex to the mRNA strands by a breakthrough was made by Marshall Nirenberg and Heinrich Maffei who ▪ protein synthesis (translation) is the most complex activity of the cell
base pairing: these mRNA is used an enzyme polynucleotide phosphorylase to synthesize their own TRANSLATION IS DIVIDED INTO:
cleaved undestroyed and no artificial genetic messages and then determine what kind of protein they initiation elongation termination
protein can be synthesized encoded
▪ nucleic acids and proteins are like 2 languages written with different types
▪ the first message they tested was a polyribonucleotide consisting
▪ RNA interference as being studied largely in plants and nematode worms of letters, and this is the reason protein synthesis is referred to as
▪ in fact, it is generally accepted that vertebrates do not utilize RNA exclusively of uridine and the message was called poly U
TRANSLATION
▪ when poly U was added to a test tube containing bacterial extract with all
interference as defense against viruses and relying instead on a well- ▪ translation requires that information encoded in the nucleotide sequence
20 amino acids and the materials necessary for protein synthesis (e.g.
developed immune system of an mRNA be decoded and used to direct the sequential assembly of
ribose and various soluble factors)
▪ when a double stranded RNA is added to mammalian cells growing in amino acids into a polypeptide chain
▪ the system followed the artificial messenger’s instructions and
culture or injected directly into the body of a mammal rather than ▪ the interaction between successive coordinates in the mRNA and specific
manufactured(?) a polypeptide
stopping the translation of a specific protein, it usually initiates global aa-tRNAs leads to the synthesis of a polypeptide with an ordered
▪ the assembled polypeptide was analyzed and found to be
response that inhibits protein synthesis in general sequence of amino acids
polyphenylalanine, a polymer of the amino acid phenylalanine ▪ PROTEIN SYNTHESIS OR TRANSLATION may be the most complex
ENCODING GENETIC INFORMATION ▪ Nirenberg and Maffei has thus shown that the codon UUU (uracil-uracil-
synthetic activity in the cell and assembly of protein requires all the
▪ information stored in a gene is present in the form of a genetic code uracil) specifies phenylalanine and over the next four years, the pursuit
various tRNAs with their attach amino acids, ribosomes, including the
THE PROPERTIES OF THE GENETIC CODE was joined by a number of labs and synthetic mRNAs were constructed to
mRNAs, and numerous proteins having different functions, cations, and
the codons for amino acids are non-pverlapping triplets of test the amino acid specification for all 64 possible codons
GTP
1
nucleotides ▪ the complexity is not surprising considering that protein synthesis
it is degenerate, some of the amino acids are specified by more than requires the incorporation of 20 different amino acids in the precise
2
one codon sequence dictated by a coded message within the language that uses
▪ once the structure of DNA had been revealed in 1953, it became evident different characters
that the sequence of amino acids in polypeptide was specified by the
1 INITIATION
sequence of nucleotides in the DNA of a gene
▪ translation begins at the initiation codon, AUG, which then puts the
▪ it seemed very unlikely that DNA could serve as direct physical template ribosome in the proper reading frame
for the assembly of a protein, so instead it was presumed that the ▪ the small ribosomal subunit identifies the correct AUG codon
information stored in the nucleotide sequence was present in some type ▪ initiation requires proteins called initiation factors or Ifs (elFs in
of genetic code eukaryotes)
▪ with the discovery of messenger RNA as an intermediate in the flow of ▪ once it attaches to a mRNA, a ribosome moves along the mRNA from
information from DNA to protein, attention turned into the manner in one codon to the next that is in a consecutive block of three
which a sequence written in the ribonucleotide alphabet might code for nucleotides
a sequence in an alphabet consisting of amino acids ▪ to ensure that the proper triplets are read, the ribosomes attaches to
▪ if the code is overlapping, the ribosome would also move along the the mRNA at a precise site during the initiation codon which is
mRNA-1 nucleotide at the time, recognizing a new code and with each specified as AUG
the examination of the codon chart in the figure indicates that the amino
move acid assignments are distinctly non-random

WITH ARIC JOSE, M.

AIRAH M.
▪ binding to this codon automatically puts the ribosome in proper ▪ in bacteria, the initial methionine mirrors a formyl group making it a THE ROLE OF THE RIBOSOME (in translation)
reading frame so that it correctly reads the entire message from that N-Formylmethionine which is subsequently removed enzymatically ▪ ribosomes have three sites for the association of tRNAs:
point on. from the majority of newly synthesized proteins o the A (aminoacyl site)
▪ in the first step of translation, a small ribosomal subunit binds to both ▪ cells possess the two distinct methionyl tRNAs: o the P (peptidyl site)
mRNA and specific initiator tRNA, which carries amino acid and o one used to initiate protein synthesis, o the E (exit) site which receives each tRNA in successive steps of the
methionine o a different one to incorporate methionyl residues into the interior elongation cycle as described in the following section
▪ in the bacterial cells, the Shine-Dalgarno sequence guides the small of a polypeptide ▪ ribosomes receive each tRNA in successive steps of the elongation
ribosomal unit to the correct initiation codon ▪ the initiator, aa-tRNA, is positioned by the IF2 initiation factor within cycle
▪ in eukaryotes, the smallest ribosomal subunit recognizes the 5’ end of the P site of the ribosome, where the anticodon loop of the tRNA binds ▪ ribosomes are molecular machines similar in some aspects to the
the message and finds the first AUG triplet by scanning to the AUG codon of the mRNA and thus IF1 and IF3 are released molecular motor
▪ as seen in the figure, mRNA does not ▪ during translation a ribosome undergoes a repetitive cycle of
bind an intact ribosome but to the mechanical changes that is driven with energy released by GTP
small and large subunits in separate hydrolysis
stages ▪ unlike myosin or carnosine(?) which simply move along a physical
▪ the first major step of initiation is track, ribosomes move along a mRNA tape which contains encoded
the binding of the small ribosomal information
subunit to the first AUG sequence or ▪ ribosomes, in other words, are programmable machines that means
one of the first in the message which the information stored in the mRNA determines the sequence of
serves us the initiation codon. amino acid tRNAs(?) that the ribosomes accepts during translation
▪ bacterial mRNA processes a specific ▪ another feature that distinguishes ribosomes from many other cellular
sequence of nucleotides called machines is the importance of their component RNAs
Shine-Dalgarno sequence that ▪ ribosomal RNAs playing major roles in selecting tRNAs ensuring:
recites to 5 to 10 nucleotides before o accurate translation
the initiation codon o binding protein factors and
▪ this Shine-Dalgarno sequence is ▪ eukaryotic ribosomes contain larger rRNAs and additional proteins o polymerizing amino acids
complementary to a sequence of ▪ eukaryotic mRNAs as well possess specialized features (e.g. 5’ cups and 2 ELONGATION
nucleotides near the 3’ end of the 3’ tails) (steps in the elongation in
16s rRNA of the small ribosomal unit ▪ not surprisingly, the initiation of translation in eukaryotes is quite bacteria)
▪ several of the steps outlined in the different and more complex than the corresponding process in ▪ the elongation cycle is the
figure require the help of soluble bacteria process of adding each
proteins called initiation factors ▪ it is an important step at which control over gene expression is exerted subsequent amino acid to the
which are designated as an IFs in the ▪ eukaryotic cells require at least 12 initiation factors compromising a growing poplypeptide chain
bacteria and elFs in eukaryotes total of more than 25 polypeptide chains and, as indicated in this o with the charged amino
▪ bacterial cell on the other hand requires the 3 initiation factors which diagram, several of these elFs (e.g. elF1, elF1A, elF5, elF3) bind to the acid in the P site, the next
are the: IF1, IF2 and IF3 which are attached to the 30s subunit 40S subunit for binding to the mRNA aminoacyl-tRNA binds to
▪ the initiator of tRNA link to a methionine also binds to the 40S subunit the vacant P site
promote attachment of the 3s subunit to the mRNA prior to its interaction with the mRNA o several elongation factors
IF1 and may prevent aa-tRNA entering the wrong site of ▪ in addition, the initiator tRNA enters the P site of the subunit in are required
the ribosome association of the elF2-GTP ▪ peptidyl transferase catalyze
a GTP binding protein required for the attachment of ▪ once these events have occurred, the small ribosomal subunit with its
IF2 the peptide bond formation
the first aminoacyl rather than the RNA associated initiation factors uncharged tRNA that includes together to between amino acids
may prevent the large 15s (or 50? can’t hear form 43S pre-initiation complex is already to find the 5’ end of the ▪ in the elongation stage of
properly) subunit from joining prematurely to the mRNA which bares the methyl guanosine cap.
IF3 translation, amino acids are
30th subunit and also facilitate the entry of the ▪ in other word, class one, which are called the 43S complex contains added one by one to the
appropriate initiator aa-tRNA the 40S ribosomal subunit bound to several initiation factors or elFs previous amino acids at the C-
BRINGING THE FIRST AA-TRNA INTO THE RIBOSOME and the initiator tRNA whereas the other contains the mRNA bound to terminus of the growing chain
▪ AUG codes for methionine so it is always the first amino acid to be a separate group of initiation factors: these union is mediated by ▪ each addition involves several
incorporated into the polypeptide chain interaction between elF3 on the 43S complex and elF4G on the mRNA proteins called elongation
▪ there are two different methionyl-tRNAs: one for initiation and one for complex factors and with the charge
the residues in the polypeptide ▪ elF1 and elF1A are thought to induce a conformational change in the initiator tRNA in place with
▪ after the initiator tRNA is bound, the large subunit of the ribosome small server ribosomal subunit that opens a latch to accommodate the the P-site, the ribosome is
joins the complex entry of the mRNA available for the entry of the
▪ if one examines the codon assignments, it can be seen that AUG is ▪ once the 43S complex has bound to the 5’ end of the mRNA, it comes second aminoacyl tRNA into
more than just an initiation codon and it is also the only codon for along the message until it reaches the appropriate AUG initiation the vacant A-site which is the
methionine codon first step in the elongation
▪ in fact, methionine is always the first amino acid to be incorporated at ▪ first step in elongation: before the 2nd aminoacyl tRNA can effectively
the end terminus of a nascent polypeptide chain bind to the exposed mRNA codon in the A-site, it must combine first
with a protein elongation factor bound to GTP, and this particular
WITH ARIC JOSE, M.

AIRAH M.
 elongation factor is called eF2 or eF-Tu in bacteria & eF1A in
eukaryotes
o eF-Tu is required to deliver aminoacyl tRNAs to the A-site of the
ribosome
▪ although any aminoacyl tRNA to GTP complex can enter the site, only
one whose anticodon is complementary to the mRNA codon situated
in the A-site will trigger the necessary conformational changes within
the ribosome that caused the tRNA to remain bound to the mRNA in
the decoding center
▪ once the proper aminoacyl tRNA Tu-GTP is bound to the mRNA codon,
the GTP is hydrolyzed and the two GDP complex released leaving the
newly arrived aa-tRNA situated in the ribosomes A-site
▪ regeneration of Tu-GTP from the release Tu-GDP requires another
elongation factors which is the eF-Ts
▪ second step: involves the formation of a peptide bond between the
these(?) two amino acids
▪ peptide bond formation is accomplished as the amide nitrogen of the
aa-tRNA in the A-site carries out a nucleophilic attack on the carbonyl
carbon of the amino acid bound to the tRNA of the P-site which
displays the P-site tRNA
▪ as a result of these reactions, the tRNA bound to the second codon in
the A-site has an attached dipeptide, whereas the tRNA in the P-site is
isolated
▪ the peptide bond formation occurs spontaneously without the input
of external energy and the reaction is catalyzed by peptidyl
transferase, which is an enzyme or has a component of the large
subunit of the ribosome
▪ last step: involves in these processes the formation of the first peptide
bonds leaves one end of the tRNA molecule of the A-site which is still
attached to its complementary codon on the mRNA and the other end
of the molecule is attached to the dipeptide
▪ TRANSLOCATION in general is accompanied by the movement of the
dipeptidyl tRNA from the A-site to the P-site of the ribosomes and the
one that is mentioned a while ago which is the acetylated tRNA from
the P-site to the E-site
o as these movements occur, both of these tRNAs remains hydrogen
bonded to their codons in the mRNA
▪ an intermediate stage in the translocation process has been visualized
by cryo-electron microscopy which shows the tRNAs occupying
partially translocated hybrid states
o in these hybrid states, the anticodon ends of the tRNAs still reside
in the A & P - sites of the small subunits while the acceptor ends of
the tRNAs have moved into the P and E-sites of the large subunit
▪ the tRNAs in general are said to occupy the A/P and P/E hybrid sites
respectively
(continuation)
▪ the ribosome moves three nucleotides (one codon) along the mRNA in
the 5’ to 3’ direction during translocation
▪ translocation is driven by conformational changes in an elongation
factor (EF-G or eEF2)
▪ mutations that add or delete nucleotides that affect translocation are
called frameshift mutations, and produce an abnormal sequence of
amino acids
3 TERMINATION
▪ the final stage of translation
▪ termination occurs at one of the three stop codons: UAA, UAG, or
UGA; requires release factors which recognize stop codons
▪ elongation continues until a stop codon of the mRNA which is the A
site
▪ nucleotide base triplets: UAA, UAG, UGA (written from 5’ to 3’)
o they do not actually code for amino acids but they act as signals to
stop translation
▪ release factor: a protein shape like an aminoacyl tRNA, binds directly
to stop codon in the A site and the release factors causes the addition
of water molecule instead of an amino acid to the polypeptide chain
because water molecules are abundant in the cytosol
▪ this reaction breaks or hydrolyses the bond between the completed
polypeptide and the tRNA in the P site which releases the polypeptide
through the exit panel of the ribosome’s large subunit
▪ the remainder of the translation assembly then comes apart in a multi-
step process which aided by other protein factors and break down of
the translation assembly requires the hydrolysis of two or more GTP
molecules
TWO GROUPS OF RELEASE FACTORS
Class I RFS Class II RFS
the GTP binding proteins or the
recognize the stop codon in the
G proteins whose roles are not
A site
well understood
IN BACTERIA (2 classes) IN EUKARYOTES (1 class)
Class I RFS
subclassified into RF1 that
1RF and ERF1:
recognizes UAA and UAG stop
recognizes all three stop codons
codon and RF2 which recognizes
UAA and UGA stop codons
Class I RFS enter the A site of the ribosome
▪ once in the A site, a conserved tripeptide at one end of the release
factor is thought to interact with the stop codon in the A site and to
trigger a crucial conformational change affecting several nucleotides
of the mRNA of the small ribosomal subunits
▪ The ester bond linking the nascent polypeptide to tRNA is hydrolyzed
and the completed polypeptide is released
o at this point, hydrolysis of the GTP bound to the Class II RF which
are the RF3 or the ERF3 which leads to the release of the Class I RF
of the ribosome’s A site
▪ the final steps in the translation includes the release of the deacylated
tRNA from the P site which causes the dissociation of the mRNA from
the ribosome and the disassembly of the ribosome into its large and
small subunits in preparation for another round of translation
▪ these final steps require a number of proteins and are quite different
in eukaryotes and bacteria because in bacterial cells, these proteins
include EF-G or IF-3 and RRF which are the ribosome recycling factor
which promotes ribosomal subunit separation
WITH ARIC JOSE, M.
AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS IV. DEFENSE
TOPIC 3: PROTEINS FUNCTIONS OF PROTEINS ANTIBODIES: combat bacteria and viruses (and other foreign invaders)
Lecturer: Ms. Mia Gwen Baltazar, MS-PH (c) I. METABOLISM
LEARNING OUTCOMES ENZYMES: biological catalysts which speed up chemical reactions
Students should be able to:
▪ define proteins and its functions
▪ analyze the amino acids and its characteristics
▪ classify the amino acids based on polarity
▪ know the 4 structures of proteins
INTRODUCTION TO MOLECULAR BIOLOGY AND DIAGNOSTICS
Both RNA and DNA have four base
pairs. In order to interpret the
results of nucleic acids correctly, it
is important to understand the DIGESTIVE ENZYMES (aid in hydrolysis)
movement of genetic information: lipase aid in the transport and processing of dietary lipids
from DNA to RNA to protein (as helps breakdown the large starch molecules into
dictated by the genetic code). amylase
smaller molecules
lactase essential to complete digestion of whole milk
DNA RNA
protease break down proteins into smaller peptides
adenine : thymine adenine : uracil
cytosine : guanine cytosine : guanine MOLECULAR BIOLOGY V. REGULATION
synthesizes the long chain of polymers or nucleic HORMONES
polymerase
acids intercellular
catalyze two large molecules by joining a new influence metabolism
ligase messengers
chemical bond regulates the amount of glucose in the blood and
insulin
II. SUPPORT in cells
STRUCTURAL PROTEINS human growth its presence determines the height of an
keratin hair and nails hormone individual
collagen supports ligaments, tendons, and skin RECEPTOR PROTEINS
silk cocoons and spider webs ▪ built into the membranes of nerve cells
III. TRANSPORT ▪ detect chemical signals (neurotransmitters) released by other nerve cells
▪ CHANNEL AND CARRIER PROTEINS in the cell membrane (1st image)
o allows substances to enter and exit the cell AMINO ACIDS
▪ proteins are polymers of amino acids
▪ each amino acid has characteristic biochemical properties determined by
the nature of its amino acid side chain
▪ amino acids are synthesized in vivo by stereospecific enzymes so that
naturally occurring proteins are made of amino acids with L-
stereochemistry
▪ the central asymmetric carbon atom of the
amino acid is attached to a:
are present in all living things and include many essentials o carboxyl group o a hydrogen atom
and biological compounds (e.g. enzymes, hormones, o an amino group o the side chain
antibodies) ▪ TRANSPORT MOLECULES in blood (2nd image)
o hemoglobin: transports oxygen in the blood ▪ proline: differs from the rest of the amino acids in that its side chain is
most structurally and functionally diverse group of
cyclic (with the amino group
biomolecules
FUNCTIONS: attached to the end carbon of
▪ metabolism ▪ regulation the side chain, making a 5-
PROTEINS ▪ support ▪ motion carbon rim)
▪ transport ▪ the side chains are grouped
NOTES: according to their chemical
▪ the enzymes, transport, defense, and regulatory characteristics
proteins are usually globular in nature, making them ▪ the properties of amino acids
soluble and allowing them to diffuse freely across that make up a protein determine:
membranes ▪ shape ▪ biochemical nature
▪ structural and motility proteins are insoluble

AIRAH M.
▪ a single protein can have separated domains with different properties negatively charged aspartic acid Asp, D PROTEINS
o e.g. transmembrane proteins: have several stretches? of hydrophobic (acidic) glutamic acid Glu, E ▪ are polypeptides that can reach sizes of more than a thousand amino
amino acids positioned in the lipid membrane of the cell and they arginine Arg, R acids in length
positively charged
might also have hydrophilic or charged extracellular domains histidine His, H ▪ the information stored in the sequence of nucleotides in DNA is
(basic)
⇨ in the image above, transmembrane proteins have hydrophobic lysine Lys, K transcribed and translated into an amino acid sequence
domains and the hydrophilic domains exposed to the intracellular ▪ constitute the most abundant macromolecules in cells
an extracellular spaces ▪ proteome: collection of proteins encoded in all of an organism’s DNA
⇨ the biochemical nature of these proteins results from their dinstinct o proteome of humans is possibly 10x larger than its size
amino acid compositions ▪ the exact number of proteins is difficult to assess (this is because a single
gene can give rise to more than one protein through alternate splicing and
other post-transcriptional or post-translational modifications
▪ at pH 7: most of the carboxyl groups of the amino acids are ionized, and
the amino groups are not STRUCTURE OF PROTEINS
▪ the ionization can switch between the amino and carboxyl groups, making PRIMARY STRUCTURE
the amino acids zwitterions at physiological pH
▪ at certain pH levels, amino acids will become completely positively or
negatively charged: these are the pK values of each amino acid
▪ on the right side, an amino acid is positively charged at pK1 and negatively
charged at pK2
▪ at the pH where the positive and negative charges are balanced is the pI, ▪ the sequence of amino acids in a protein determines the nature and
hence, the molecule is neutral activity of that protein
▪ each amino acid will have this characteristic of pI: the pI of a peptide or ▪ read by convention from the amino terminal end to the carboxy
protein is determined by the terminal end
ionization state (or the ▪ there are minor changes in this structure that can alter proteins
positive and negative dramatically (this is because the amino acids most often cooperate
charges) of the side chain of with one another to bring about the protein structure and function
its constituent amino acid o the single amino acid substitution that produces HbS in sickle cell
▪ the amino and carboxyl anemia is a well known example
terminal groups of the amino o replacement of a soluble glutamine residue with a hydrophobic
acids are joined in a carbon- valine at the 6th beta chain residue changes
o … the nature of the protein so that it packs abberantly in corpuscles
carbon-nitrogen (-C-C-N-)
and just quickly alter cell shape
substituted amide linkage
SECONDARY STRUCTURE
(peptide bond) to form the
Amino acids are grouped as follows: protein backbone
▪ nonpolar ▪ negatively charged polar ▪ the amino acids join together
▪ uncharged polar ▪ positively charged polar by a peptide bond (make a
CLASSIFICATION OF AMINO ACIDS BASED ON dipeptide?)
POLARITY OF THEIR SIDE CHAINS ▪ peptides with additional units are (depending on how many units are
CLASSIFICATION AMINO ACID ABBREVIATIONS attached to each other):
▪ interactions between amino acid side chains fold a protein into
alanine Ala, A o tri- o tetra- o pentapeptides
predictable configurations
isoleucine Ile, I ▪ at one end of the peptide will be amino group (the amino-terminal or NH2 ▪ these include: ordered beta or beta-pleated sheets and less-ordered
nonpolar leucine Leu, L end); at the opposite terminus of the peptide will be a carboxyl group (the alpha helices, or random coils
(has no separation of methionine Met, M carboxy- terminal, or COOH end) (e.g. 5’-3’ direction of the nucleic acids) ▪ the ribbonlike structure in the picture are composed of chains of
charge) phenylalanine Phe, F ▪ peptide chains grow from the amino to the carboxy terminus amino acids hydrogen bonded to their side chains
tryptophan Trp, W ▪ are folded and arranged into a tertiary structure
valine Val, V TERTIARY STRUCTURE
asparagine Asn, N
cysteine Cys, C
polar glutamine Gln, Q
(separation of electric glycine Gly, G
charge leading to a proline Pro, P
molecule) serine Ser, S
threonine Thr, T ▪ also important for protein function
tyrosine Tyr, Y ▪ involves more folding and bonding of the secondary structure

AIRAH M.
▪ if a protein loses its tertiary structure or is denatured, mutations in
DNA that substitute different amino acids in the primary structure can
also alter tertiary structure
▪ denatured or improperly folded proteins are not functional, hence,
proteins can also be denatured by heat (e.g. albumin in egg white) or
by conformations forced on innocuous peptides by infectious prions
▪ aggregation of prion-inaucca of aberrantly folded proteins cause
transmissible spongiform encephalopathies (e.g. Creutzfeldt-Jakob
disease, bovine spongiform encephalitis [mad cow disease])
QUATERNARY STRUCTRURE

▪ two proteins bound together to function form a dimer, three form a

trimer, and four form a tetramer
▪ proteins that work together in this way are called oligomers
▪ each component protein being a monomer
▪ where clusters of more than one polypeptide chain linked together to
form a giant molecule

AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS
TOPIC 4: GENE DOMENCLATURE AND DNA LIBRARIES
Lecturer: Ms. Catherine Malaca
▪ is the scientific naming of genes, the units of heredity
in living organisms
▪ guidelines for humane gene nomenclature were first
published in 1979
gene
▪ with the recent publications of the complete human
nomenclature
genome sequence there is an estimated total of
26000-40000 genes
▪ as of today, that is still continuous since there are
still a lot of genes and species discovered
HISTORY
▪ at first, there is no universally set of rules for naming the genes, alleles,
proteins, products, and associated phenotypes
▪ at first, it was very simple: individual geneticists would develop their own
way or their own symbols for recording or keeping track of their work
▪ a geneticist who spent the earlier part of his
carrier researching fruit flies at Columbia
Thomas Hunt University
▪ during his study, he found a single mutant fly
Morgan
with white eyes which he named it “White”
▪ during the time of Morgan’s study and
discovery at 1910, no one really knew how
genetic information was passed down from
one generation to the next
▪ the term “gene” had only come into use a year
before and the idea that the chromosomes
had anything to do with the process was not
generally accepted by the scientific ?reality?
▪ all of that changed the year later in 1911 with
Morgan’s student, Alfred Sturtevant
▪ a student of Thomas Hunt Morgan
▪ he was able to construct the very first gene
map in which he suggested that chromosomes
were really the carriers of the gene and that
each gene has a specific linear location within
the chromosomes
▪ the subject that he used in his gene map was
the mutant fly from his professor’s study
Alfred Sturtevant
which is why he also named the gene map as
“White”
▪ since then, the world of genes and gene
nomenclature has grown exponentially: a lot
of organizations started popping out with a
goal to name every gene of certain species
▪ one of those organizations is the HUGO Gene
Nomenclature Committee (HGNC) which has
taken the challenge of sorting the 20,000
human gene names currently in use and
assigning each gene a unique symbol
o mission of the organization was very
straightforward: it is to give unique and
meaningful names to human genes
▪ committee chair or the head of the HGNC
▪ plan of the organization: to persuade the
whole scientific community to agree on a
single unique name and abbreviation for each
human gene
o the scientific community is very hard to
Dr. Sue Povey persuade because everyone has their own
opinions, beliefs, and keeps looking for a
certain strong fact that should support any
claim
▪ a lot of scientists criticized their work because
of the confusion especially when same genes
appear as an ortholog across more than one
species: also became a problem
▪ when the organization was just starting, there
were a lot of holes in their naming, but as time
passes, they were able to fix it and was able to
provide a guideline on how human genome
can be named
▪ a lot of organization based their gene naming
for other species on the guidelines of HGNC
▪ as of this day, the naming process for different genes is still continuing for
different kind of species since a lot are still discovered on a daily basis
There are also certain situations where symbol for chromosome region
▪ which is why one of the philosophy of HGNC that was carried all
should be assigned:
throughout the scientific community that does the gene nomenclature is
that:
THE PHILOSOPHY OF HGNC
“that gene nomenclature should evolve with new technology [or new
scientific founding] rather than be restrictive as sometimes occurs when
historical and single gene nomenclature systems are applied”
▪ up to this day, their guidelines are being used by everyone and are
continuing to do so
▪ if there are new findings, the scientific community will adapt to it as well
GENERA GUIDELINES ACCORDING TO HGNC
each approved gene symbol must be unique [there shouldn’t be two
1 5
gene symbols identical to each other]
symbols are short-form representations (or abbreviations) of the
2 a chromosome region that is transcribed but untranslated functional
descriptive gene name [should only be short and easy to remember]
3 symbols should only contain Latin letters and Arabic numerals
4 symbols should not contain punctuation
5 symbols should not end in “G” for gene
symbols do not contain any reference to species, for example, “H/h”
6 1
for human
CRTIERIA FOR SYMBOL ASSIGNMENT
GENE
▪ a DNA segment that contributes to phenotype/function
▪ in the absence of demonstrated function a gene may be characterized
by sequence, transcription or homology
▪ the overwhelming majority of ?objects? that is named by HGNC is
under this criteria
LOCUS
• “locus” is not a synonym for gene but refers to a map position
• a more precise definition was given by the rules and guideline by the
International Committee on Standardized Nomenclature for Mice
• ICSNM definition: a locus is a point in the genome, identified by a
marker, which can be mapped by some means
o it doesn’t necessarily correspond to a gene
o it could be, for example, an anonymous non-coding DNA segment
or a cytogenetic feature
• a single gene has several loci within it and these markers may be
separated in genetic or physical mapping experiment
▪ in such state, it is useful to define these different loci through symbols,
but normally, the gene name should be used to designate the gene
itself as usually it will convey most of the information rather than
specific loci
CHROMOSOME REGION
• defined as a genomic region that has been associated with a particular
syndrome or phenotype, particularly when there is a possibility that
several genes within it may be involved in the phenotype
• designation of such region maybe requested by the scientific
community but it is still under the approval of HGNC
o an example of that would be the Angelman Syndrome Chromosome
Region (ANCR) and the Cat Eye Syndrome Chromosome Region
(CECR)
a chromosome region clearly defines a phenotype shown to be
1
inherited predominantly with each specie
the chromosome region is from an identified gene contributing to a
2
complex trait shown by linkage of association with known marker
if a chromosome region is a cloned segment of a DNA with sufficient
structural, functional, and expression data to identify them as
3 transcribed entities
▪ the symbol assigned to the cloned segment should be unique to
the original segment of the DNA
4 if a chromosome region is a non-functional copy of the gene
if the chromosome region is encoded by the opposite strand that
overlaps the known gene
▪ if there is a known gene already that has an encoded chromosomal
region, certain symbols should be assigned to it as well
6
DNA segment
GENERAL RULES
are designated by upper case Latin letters or by a combination of
upper-case letters and Arabic numerals, with the exception of the
C# or F# symbols
symbols should be short; should not attempt to represent all known
2
information about a gene
symbols should be inoffensive and should not spell words or match
abbreviations that would cause problems with a database searching
3
▪ you shouldn’t use an abbreviation that could spell out cursed
words or words that could have a derogatory meaning to it
4 should be no longer that six characters in length
new symbols must not duplicate existing approved gene symbols in
5 either human (Genew: human gene nomenclature database) or the
mouse (MGD) databases
AIRAH M.
 GREEK-TO-LATIN ALPHABET CONVERSION sequences which can be combined to form a number of a yeast YEAST Saccharomyces cerevisiae
LATIN UPPER-CASE different larger product, then, a coding sequence may be yeast SCHPO Schizosaccharomyces pombe
GREEK SYMBOL GREEK
CONVERSION assigned to the symbol zebrafish BRARE Brachydanio rerio
Α α alpha A tissue specificity or molecular weight should be avoided as they are
only limited to use as a description [should not be included in the GENE NAMES: GUIDELINES
Β β beta B 8 still mandated by HGNC
Γ γ gamma G gene name]; where necessary this may be included in the gene
name gene names should be brief and specific and should convey the
Δ δ delta D
some letters or combination of letters are used as prefixes or character or function of the gene
Ε ε epsilon E
9 suffixes in a symbol to give a specific meaning and their use for 1 ▪ but, it should not attempt to describe everything that is known
Ζ ζ zeta Z
other meanings should be avoided about the gene; just the most predominant character of that gene
Η η eta H oncogenes are given symbols corresponding to the homologous is already enough
Θ θ theta Q 10
retroviral oncogene, but without the “v-“ or “c-“prefixes the first letter of the symbol should be the same as that of the name
Ι ι iota I 2
in order to facilitate alphabetical listing and grouping
Κ κ kappa K CHARACTERIS RESERVED FOR SPECIFIC USAGE
gene names are written using American spelling [go back to 8th gene
CHARACTER MEANING 3
Λ λ lambda L symbol assignment regulation: tissue specificity]
AS antisense
Μ μ mu M gene names should no include terms such as nephew, cousin, sister,
AP associated/accessory protein 4
Ν ν nu N etc. to describe familial relationships with other genes
BP binding protein
Ξ ξ xi X
C catalytic GENE NAMES: REGULATIONS
Ο ο omicron O
CR chromosome/critical region the following gene name syntax should be used:
Π π pi P C#orf# chromosome # open reading frame #
Ρ ρ rho R names start with a lowercase letter unless it is a person’s name
D domain containing
describing a disease/phenotype
Σ σ sigma S FAM family with sequence similarity 1
▪ e.g. Allan-Herndon-Dudley Syndrome (AHDS): the first name is
Τ τ tau T N or NH inhibitor capitalized
Υ υ upsilon Y IP interacting protein descriptive modifiers should follow the main part of the name,
Φ φ phi F IT intronic transcript separated by commas
Χ χ chi C LG ligand 2 ▪ e.g. a certain gene solubility is needed to describe the gene to be
Ψ ψ psi U L like separated from other types of gene
Ω ω omega W LOH loss of heterozygosity ▪ e.g. ACO I “aconitase I, soluble”
MT or M mitochrondrial where a complete alternative name (or names) is being included as
GENE SYMBOLS ASSIGNMENT: REGULATIONS OS opposite strand 3 part of the name, this should be in parentheses
the initial character of the symbol should always be a letter. OT overlapping transcript ▪ e.g. IDS “iduronate 2-sulfatase (Huntersyndrome)”
1 subsequent character may be other letters, or if necessary, Arabic P or PSQ pseudogene names of other species must be placed in parentheses at the end
numerals Q quantitative trait ▪ e.g. LNFG ”lunatic fringe homolog (Drosophila)”
4
all characters of the symbol should be written on the same line; no R receptor ▪ e.g. ANLN ”anillin, actin binding protein (scraps, homolog,
2 Drosophilia)”
superscripts or subscripts may be used RG regulator
no roman numerals may be used. roman numbers in previously # gene family GENE FAMILIES
3
used symbols should be changed to their Arabic equivalents @ gene cluster regulations assigned by HGNC
Greek letters are not used in gene symbols. all Greek letters should
4 COMMON SPECIEIS ABBREVIATIONS FROM URL hierarchical symbols for both structural and functional gene
be changed to letters in the Latin alphabet 1
http://www.expasy.ch/cgi-bin/speclist families should be used where possible
a Greek letter prefixing a gene name must be changed to its Latin
COMMON NAME ABBREVIATION SPECIES gene family members should eb designated by Arabic numerals
alphabet equivalent and placed at the end of the gene symbol [this
cat FELSI Felis silvestris catus placed immediately after the gene stems symbol, without any
will allow the alphabetical ordering of the gene listing with similar
5 chicken CHICK Gallus gallus space between the letters and numbers used
properties e.g. galactosidase alpha (GLA) and galactosidase beta
chimp PANTR Pan troglodytes ▪ e.g. GPR-1, GPR-2, GPR-3: three G protein coupled receptor genes
(GLB)] if you search throughout the data base for galactosidase, it
dog CANFA Canis familiaris ▪ however, (or occasionally) only if they exist historically, single
will be in order: from the alpha up until the last substrate specificity
fruit fly DROME Drosophila melanogaster letters suffixes may be used to designate these different genes
no punctuations may be used, with the exception of the HLA,
human HUMAN Homo sapiens o e.g. LDH-A, LDH-B, and LDH-C: three lactate hydrogenase genes
immunoglobulin, and T-cell receptor gene symbols
2 ▪ there are also some gene families that are very large which may
▪ the HLA symbols are assigned by the who nomenclature mouse MOUSE Mus musculus
include a variety of numbers and letter combination to indicate
6 committee for factors of the HLA system via the IMGT/HLA orangutan PONPY Pongo pygmaeus
their phylogenic relationship
database pig PIG Sus scrofa
▪ when these symbols are in need of a number-letter combination,
▪ which is why only these three genes are exempted from the “no puffer fish FUGRU Fugu rubripes this will also be under the approval of HGNC
punctuation” regulation puffer fish TETFL Tetraodon fluviatilis ▪ consecutive symbols approved by the HGNC will take precedence
gene symbols will not usually be assigned to alternative transcripts rabbit RABIT Oryctolagus cuniculus over the published, although this will be a matter for discussion
7 ▪ however, if a community working on a group of genes that has a rat RAT Rattus norvegicus with the eventual scientific community
need of nomenclature where there are multiple small coding worm CAEEL Caenorhabditis elegans

AIRAH M.
 many genes receive approved symbols and names that are non-ideal HOMOLOGS GENES IDENTIFIED FROM SEQUENCE INFORMATION
when considered in the light of subsequent information genes or proteins that are similar due to their shared ancestor or ▪ a gene of unknown function
▪ in the case of individual genes a change to the name s only made common origin ▪ encoded at the same genomic locus (with
if the original name is seriously misleading ORTHOLOGS PARALOGS overlapping exons) as another gene should have
▪ however, group of scientists working on particular gene families two genes in the same genome its own symbol
3 often coordinate with a revised nomenclature when more two genes in two different species that are a product of a gene ▪ if the new gene regulates the first gene, it may
information about a certain gene is available that share a common ancestor duplication event of the original be assigned a symbol of the first gene with a
▪ upon passing certain findings, they would provide a temporary gene antisense suffix “AS” for “antisense” such as:
symbol which is also still under the approval of HGNC occurs because of occurs because of o IGF2-AS: insulin-like growth factor 2
▪ when they will be able to discover more information about a speciation event gene duplication event antisense
certain gene, the nomenclature will also change as well e.g. the alpha-chain gene in frog, e.g. mouse a-chain gene and ▪ the gene symbol should not be written
ANONYMOUS FAMILIES human, and mouse mouse b-chain gene backwards
▪ series of genes can be shown to be related by sequence similarity but o the suffix AS should always be at the let part
HOMOLOGY ANALOGY
otherwise cannot be describe by homology or function they can be of the gene if it is an antisense
similarity in characteristics resulting the similarity of characteristics
assigned anonymous and temporary family symbols ▪ genes of unknown function on the opposite
from shared ancestry (e.g. between two species that are
▪ these criteria are not exclusive but merely a convenient starting point on strand that have no proven regulatory function
homologous organs, sequences, not closely related; attributable opposite strand
which to base an appropriate symbol ▪ should be assigned the suffix “OS” for “
chromosomes, proteins) to convergent evolution
o in which along the way when they discover more information about opposite strand”
similar due to inheritance similar due to other factors
▪ these may be assigned symbols that are unique
this certain family, they can assign it with a proper name already
and relevant to the scientific community
o the temporary name for gene family is called anonymous family
▪ the approved name should contain
▪ the symbol will always include a letter designation for subfamily, with the untranslated “untranslated RNA” (found at the last of the
final character indicating gene number functional RNAs gene name) such as:
HOMOLOGOUS GENES o ?Shanteen?: in which the name assigned to it
H-19, imprinted maternally expressed
untranslated RNA
▪ is a gene inherited in two species ▪ the designation of the suffix “L” for “like” has
by a common ancestor been used in the past for related sequences
▪ while homologous genes can be identified by cross-hybridization studies
HOMOLOGOUS GENES: GUIDELINES ▪ where genes are identified by database
similar in sequence, they are not
human homologs of genes first identified in other species should searching and where no other functional
necessarily homologous related (-like)
not be designated by a symbol beginning with H or h for human information is available
sequences
▪ when a gene or series of genes that has been defined in one ▪ there are some sequence similarities with a
specie is not human, it is ?understandable? that in the future, a known gene
1 homologous gene will be also identified in humans ▪ they are designated with the symbol of the
ORTHOLOGOUS PARALOGS known gene followed by an “L” for “like”
▪ that is why it is recommended that the designated symbol should
are genes in different species are gene copies created by a ▪ e.g. aminoacylate 1-like (ACY1-L)
be reserved for the human locus
evolved from a common ancestral duplication event within the same ▪ genes predicted from EST clusters or from
▪ we recommend that this should be done in other species for
gene genome genomic sequence with EST evidence, but
genes first identified in human
often develop different functions showing no structural or functional homology,
when necessary to distinguish the species of origin for homologous
due to missing selective pressure are regarded as putative
kept the same function genes with the same gene symbol, the letter-based code for
on one copy of the duplicated 2 ▪ these are designated by the chromosome of
different species already established by SWISS-PROT should be
gene genes of origin, the letters “orf” for “open reading
used
VIDEO: Homolog vs paralog vs ortholog bs analog in 4 minutes | Genetics the agreement between human and mouse gene nomenclature for unknown function frame” and a number in a series
for beginners (https://www.youtube.com/watch?v=TiKbMw_bKEk) many homologous genes should be continued and extended to o e.g. C2orf1: chromosome 2 open reading
other vertebrate species where possible frame 1
▪ human homolog gene ?huh? a prokaryote specie to sometimes ▪ orf is in lower case to prevent confusion
3 with other species: it is usually followed by a capitalized “L” to between the letter O and the numerical 0 which
represent the word “like”, and a number when there is more in some cases, is part of the chromosome
than one human homolog ▪ pseudogenes are sequences that are generally
▪ the original organism is placed at the end of the gene at the name untranscribed and which have high homology to
of the parenthesis identified genes
▪ however, it has recently been shown that in
pseudogenes
different organisms or tissues, functional
activation may occur
▪ therefore, the previous policy of assigning the
gene symbol of structural gene followed by a

AIRAH M.
 letter ”P” and a number will only be approved ⑤ Once we create the genomic library, we can screen the
on a case-by-case basis library to detect that specific gene that we want to isolate
▪ if there would be a pseudogene symbol and study.
assignment, it would be under the approval of
The petri dish is spotted to contain the different genes of the
HGNC
organism. A radioactively-labeled DNA probe is than added
GENOMIC REARRANGEMENTS AND FEATURES to the dish and washed. The probe will only hybridize with
GENE RECOMBINATION the DNA of interest.
▪ when there has been recombination between two or more separate ⑥ The hybridized fragment can then be readily detected via
genes, generating a new locus, the gene symbol should remain short autoradiography.
but reflect the tow (or more) initial gene symbols
▪ the name may be as descriptive as necessary Explanation (for each step):
▪ for the symbol, it should consist of the initial gene symbols STEP ①
▪ for the gene name, you could be as transcriptive as it is necessary Let's suppose in a single beaker, we have a solution that contains that
▪ e.g. POMPZP3 “POM (POM121 homolog, rat) and ZP3 fusion” complete genome. For simplification purposes we have a genome in this
SYMBOL STATUS diagram that only consists of five different genes: the dark green gene, the
each gene record in the GENEW database has on of five states: red gene, the light green gene, the dark purple gene, and the light purple
gene. We take and add the restriction enzymes into that mixture. These
gene symbols in progress, meaning, there is still no
PENDING restriction enzymes cleave our genome into different fragments and these
approved assigned symbol to that gene
different fragments will contain the different gene so, we basically break our
APPROVED official gene symbols that are publicly available
GENOMIC DNA LIBRARIES cDNA LIBRARIES genome into these five fragments.
official gene symbols that are not publicly available;
RESERVED these will be release after a maximum period of six VIDEO: Building and Screening Genomic Libraries STEP ②
months (https://www.youtube.com/watch?v=2ikPiR0-rnc) Let's suppose that these five fragments all different size so some are large,
▪ previous symbols for genes that now have different Let's suppose that we have the entire genome of some organism: the entire some are small. In the next step, we can use gel electrophoresis to basically
approved symbols separate the different fragments based on size (up to a size value of 15 Kb
SYMBOL DNA molecule that contains all the different types of genes that are found
▪ this will happen if a new information about the gene
WITHDRAWN within that organism. If we want to isolate and study a specific type of gene, where KB is kilobases). We run our gel electrophoresis and those fragments
is discovered and a more suitable gene symbol or
let's say a single gene within that particular genome, how exactly can we go that end up at the bottom are the smallest while the fragments that end up
gene name was assigned
about doing that? How can we find that gene isolate that gene and then at the top are the largest. Each one of these fragments contains some type
▪ symbols that refer to a gene that has since been
ENTRY shown not to exist make many copies so that we can actually study an experiment with that of genes. Now, we essentially have these five beakers and in each one of
WITHDRAWN ▪ meaning that the certain gene symbol is not existing gene? Given the genome of an organism, how can we isolate a specific gene these beakers, we have a single type of gene.
anymore because it is probably replaced by a new one of interest? One approach is to create a genomic library for that particular Now, the problem is we only have one of the genes, but to actually work
genome and then to screen that library for that specific gene so that we can with them, we have to have many copies of that gene. So, in the next few
DNA LIBRARIES
isolate and make copies of that gene. steps, what we actually want to do is we want to amplify, make many copies,
▪ is a collection of DNA fragments that have been cloned into vectors so
that researchers can identify and isolate the DNA fragments that interest ① A sample containing the complete genome in solution of each one of these genes. One way to do this is to use a plasmid but the
them for further study is missed with many restriction enzymes. These enzymes way we're going to do in this lecture is by using a different type of vector
▪ there are basically two kinds of libraries: cleave the large DNA molecule into smaller gene known as the λ phage [a bacteria phage that infects bacterial cells such as E.
o genomic DNA o cDNA libraries fragments. coli cells]. We can use the λ phage to basically infect the bacterial cells,
wherein the bacterial cells can then replicate that DNA of interest.
GENOMIC DNA LIBRARIES cDNA LIBRARIES ② Cleaving procedures a collection of gene fragments that
▪ is a collection of DNA ▪ are made with cloned, reverse- differ in size. Fragments that are 15Kb can now be separated STEP ③
fragments that make up transcribed mRNA, and therefore by gel electrophoresis. We basically take cohesive ends, and we add the cohesive ends onto the
the full-length genome of lack DNA sequences corresponding edges of these DNA molecules. For example, we take this light purple DNA
③ Cohesive ends are added on both ends of the gene molecule that we isolated in step ② and we add these cohesive ends onto
an organism to genomic regions that are not
▪ created by isolating DNA expressed, such as introns and 5’ and fragments and they are inserted into λ phage DNA the end of the DNA molecule. We then insert it into a λ DNA phage molecule.
from cells and them 3’ noncoding regions molecules. These We essentially extract a λ DNA phage molecule from the λ phage and we cut
amplifying it using DNA ▪ cDNA libraries generally contain recombinant DNA that molecule with restriction enzymes and then we insert that DNA
cloning technology much smaller fragments than fragments are then fragment into the λ DNA phage molecule. This (focus on the colorful
▪ contain large fragments of genomic DNA libraries, and are placed into λ phages. horizontal lines in the picture) is basically what we produce. This orange
DNA in either usually cloned into plasmid vectors section is basically part of that λ phage DNA molecule and this molecule has
bacteriophages or bacterial ▪ compared to genomic DNA libraries ④ Each λ phage containing a particular fragment is allowed to infect E. coli been inserted into that λ phage. We can then follow that with each one of
or pi-derived artificial which contain the whole DNA bacterial cells. These cells these molecules, we can create the following five recombinant DNA
chromosomes (BACs and genome of a specie, the cDNA replicate the DNA fragments
PACs) libraries only contain specific molecules, and now we can take these recombinant DNA molecules and
many times and eventually lyse. place them in the bacteria phages that are now ready to infect our bacterial
regions/parts of the DNA
We can collect their fragments to create the genomic library.
WATCH THE VIDS PLEASE!

AIRAH M.
cells. Now, we have this army of these unique λ phages that each contain
their own unique recombinant DNA molecule.
STEP ④
We can actually take a bacteria phage, we can infect the bacterial cells (E.
coli cells) with these different types of λ phages. Essentially, those bacterial
cells will reproduce and will lyse, producing many copies of these different
types of fragment DNA molecules. At the end, we essentially have these five
beakers and in each one of them, we have many copies of these λ phages
that each contain a specific type of DNA fragment. For instance, in beaker
#1, we have many copies of the 1st λ phage. In the 2nd beaker, we have copies
of the 2nd λ phage (so on and so forth with the next beakers and λ phages).
The great thing about these λ phages is they can live on essentially forever
and we can use them at any time to infect other bacterial cells and produce
even more copies of that particular DNA fragment. So, we have now created
our GENOMIC LIBRARY which is a collection of all the different types of
genes found in that particular DNA molecule of that organism. For the
organism that contains this genome, we have only five genes, hence, we
have these five beakers that each contain a specific type of gene molecule
within that λ phage.
STEP ⑤
Now, we actually want to screen that genomic library to find that specific
gene of interest. Once we create the genomic library, we can screen the
library to the detect that specific gene that we want to isolate and study. We
take the petri dish where we basically spot the petri dish with these bacterial
cells that are not infected. We then infect each one of these spots with each
one of these types of λ phages. This λ phage for this spot is basically infected
with this λ phage (in the 1st beaker). This spot is infected with this λ phage
(in the 2nd beaker) and so forth.
STEP ⑥
We go back into the lab where we synthesize a specific type of DNA probe.
We create a radioactively-labeled DNA probe that has a complementary DNA
sequence to that DNA fragment that were looking for. What we do is we add
the radioactively-labeled DNA probe onto each one of these spots. Only that
spot that contains that DNA fragment that we are looking for will create a
hybrid with that radioactively-labeled DNA molecule. Then, we can take or
transfer the results onto a polymer sheet and then we can take that polymer
sheet and essentially expose it to the process of autoradiography. This will
tell us exactly where that hybrid has formed. For instance, at the antibiotics
pyramid, we know that within this spot (pink/red spot), we have that DNA
molecule that we actually want to amplify. Now, we can extract and isolate
that DNA molecule, we can amplify it, in a process known as the polymerase
chain reaction (PCR). Hence, we now have many copies of that specific gene
of interest so that we can study, experiment, and do many different types of
things with it.
This is the process by which we can form genomic libraries and then screen
the genomic libraries for specific genes of interest.
VIDEO: cDNA Library Question: Can we somehow create a eukaryotic gene that does not contain
(https://www.youtube.com/watch?v=lXOVdIFPyjs) these intron sections here? Because we somehow can take this eukaryotic
One of the major differences between prokaryotic DNA and eukaryotic DNA DNA and remove these introns, just simply splice together the blue sections.
is that eukaryotic DNA consists of introns and exons while prokaryotic DNA Then we'll form a gene that doesn't contain these useless intron sections and
only contains exons. Remember, an INTRON is a segment on that DNA that then we take that gene, place it into that bacterial cell, and that bacterial cell
does not code for any useful protein. What happens inside eukaryotic cells won't have to worry about removing these introns and so, it can easily form
is when transcription takes place, we form a pre-mRNA molecule that that eukaryotic protein. This process is called building a complimentary DNA
contains introns and exons but, then what happens inside the eukaryotic cell library.
is we have a process that takes place that removes those introns from the A cDNA library is a library that of eukaryotic genes in which we have
mRNA to form an mRNA molecule that only consists of the exons. This is a removed all these different introns. To see how we can build a cDNA library,
fully functional and mRNA molecule that can now be used to form proteins. let's take a look at the following five steps.
If we are to use bacterial cells to form different types of eukaryotic proteins
from eukaryotic genes, we have to first remove these introns from the genes
of those the genes of those eukaryotic DNA molecules.
▪ Eukaryotic genes contain non-coding segments called introns. When
eukaryotic genes are transcribed, the pre-mRNA formed also contains
those intron segments.
▪ Bacterial cells, which are often used to make copies of eukaryotic
proteins, do not have the proper cell machinery to process the introns.
Therefore, if we place a gene that contains introns into a bacterial cell,
that cell will not be able to build the protein corresponding to that gene.
What happens inside the eukaryotic cells is these intron segments are
removed because the eukaryotic cells contain the proper proteins and the
proper machinery inside the cell to actually carry out the process. But, this
does not exist inside prokaryotic cells (e.g. bacterial cells) which is a problem
because if we take a eukaryotic gene – so, let's suppose this is eukaryotic
DNA molecule and this colored portion is the gene within that eukaryotic
DNA molecule that codes for some particular protein.
STEP ①
The question is, can we take this eukaryotic DNA, place it inside that Let’s suppose we take this same eukaryotic DNA molecule that contains
prokaryotic bacterial cell in this form, and expect that bacterial cell to be able these introns and these exons. This is our DNA library shown here (seen on
to actually form any useful protein from this particular DNA? the image, the eukaryotic DNA). We have these introns and exons, and this
The answer is NO. This is because once we take this molecule and place it is our eukaryotic gene. The first step is to allow that eukaryotic cell to
inside that bacterial cell, we have these intron sections shown in orange and transcribe this DNA molecule into the single-stranded pre-mRNA molecule
these exons sections shown in blue, and when this is found inside that (“pre” simply means it has not yet been processed by that eukaryotic cell).
bacterial cell, the bacterial cell will be able to use special types of proteins to Instead of taking out the pre-mRNA molecule, let's keep the pre-mRNA
transcribe the DNA into this pre mRNA but it will not be able to take out molecule inside that eukaryotic cell. What that means is this eukaryotic cell
these RNA sections - these intron sections - from this mRNA. This is because will use the pre-mRNA molecule because it is a eukaryotic cell, it has the
proper machinery to remove these introns and basically combine these
it's only these blue sections that are necessary to form that particular protein
exons. We basically take the pre-mRNA, we remove these orange sections,
and because the bacterial cell has no way of removing these orange sections
and splicing together the blue sections, that bacterial cell will not be able to we modify the mRNA in other ways
form any useful protein. STEP ②
For example, we add a poly a tail and then we finalize, and we form that fully
▪ The bacterial cell cannot remove the introns and therefore cannot
processed mRNA molecule that only consists of these exon sections and not
synthesize the protein from that particular eukaryotic gene.
of these intron sections.
▪ Can we fix this problem? More precisely, can be build a library of genes
for some given eukaryotic organism that has all the introns removed?
AIRAH M.
STEP ③
Once we form the fully processed mRNA molecule that no longer contains
those intron sections, we now take and mix it with a special enzyme known
as reverse transcriptase which uses the mRNA molecule to form the DNA
molecule. We take this mRNA, mix it with reverse transcriptase, and we form
a DNA molecule that is complementary to that mRNA molecule that has
been fully processed and which no longer contains those introns. Because
this DNA is complementary to the mRNA, this complimentary DNA will no
longer contain these intron (orange) sections. It will only contain the
sequence of nucleotides that corresponds to these exons sections.
STEP ④
Now, we heat this double-stranded molecule and we separate the mRNA
and the DNA. Remember that this DNA is complementary to this mRNA and
so, if we take this DNA molecule and we place it inside a eukaryotic cell, it
will be able to use this complimentary DNA molecule to synthesize the
proteins because it won't have to worry about those introns since those
introns were removed in this process inside the eukaryotic cell.
STEP ⑤
Because single-stranded DNA molecules are less stable than double-
stranded DNA molecules, what we have to do is we have to take the single
stranded DNA molecule, mix it with DNA polymerase to form the more stable
double stranded complementary DNA molecule. This process is done with a
single eukaryotic gene, but we can carry out with many different types of
genes within that eukaryotic organism.

At the end, what we end up producing is this library of genes for that
particular eukaryotic organism and inside every single gene, every single
DNA molecule, we essentially removed all these are all these introns and
only kept the exons. Now, if we take any one of the genes within the cDNA
library and place it inside the eukaryotic bacterial cell, that bacterial cell will
easily be able to take that DNA molecule, the gene create the mRNA
molecule that is already fully processed because the complementary DNA
molecule is complementary to that fully process and mRNA molecule. By
using that fully processed mRNA molecule because there are no introns, that
bacterial cell can easily create eukaryotic protein of interest that
corresponds to that particular gene that came from that cDNA library.

AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS based on the weight of the patient (weight = LIVE ATTENUATED (LAV) SUBUNIT (PURIFIED ANTIGEN)
TOPIC 5: VACCINE STUDIES how much post-prophylactic rabies vaccine ▪ Acellular pertussis (aP)
▪ Tuberculosis (BCG)
Lecturer: Dr. Alessandra Kamille P. Mallari, MD, DPSP they are given) ▪ Haemophilus influenzae type B
▪ Oral polio vaccine (OPV)
o it is not 1 vial per 1 person, you may not use (Hib)
Currently, in the timeline of our pandemic, vaccines have been a hot topic ▪ Measles
the entire bottle ▪ Pneumococcal (PCV-7, PCV-10,
lately. As we all know, we have started vaccinating medical health workers ▪ Rotavirus
▪ include a variety of substances (Thiomersal, PCV-13)
and the rest of the frontliners in the Philippines. ▪ Yellow fever
Formaldehyde, or phenol derivatives) ▪ Hepatitis B (HepB)
VACCINES 101 INACTIVATED (KILLED ANTIGEN) TOXOID (INACTIVATED TOXINS)
World Health Organizations HOW DOES VACCINE WORK?
▪ Whole-cell pertussis (wP) ▪ Tetanus toxoid (TT)
▪ Vaccination is one of the great public health achievements of human Vaccines contain the same antigens that are found on the pathogen that ▪ Inactivated polio virus (IPV) ▪ Diphtheria toxoid
history. causes the associated disease. But, exposure to the antigen in the vaccine is mRNA VIRAL VECTOR VACCINE
▪ Vaccines used in national immunization programmes (NIPs) are controlled. By priming the immune system through vaccination, when the
considered safe and effective when used correctly. vaccinated individual is later exposed to the life pathogen in the *descriptions for the types of vaccines are found on the last page*
▪ Vaccines are, however, not risk-free and adverse events will occasionally environment, the immune system can destroy them before they can cause
ROUTE OF ADMINISTRATION
occur following vaccination. Public trust in vaccine safety is key to the disease.
success of vaccination programmes.
The goal of all vaccines is to elicit an immune response against an antigen so
WHY ARE VACCINES SO SPECIAL? that when the individual is again exposed to the antigen, a much stronger
▪ Vaccines promote health: unlike many other health interventions, they secondary immune response will result.
help healthy people stay healthy, removing a major obstacle to human
Vaccines produce a natural infection with less complications. You have the
development.
immunity in the center. When you have a natural infection, this infection will
▪ Vaccines have an expansive reach: they protect individuals, communities,
trigger an immune system response by which the vaccine produces a long-
and entire populations (the eradication of smallpox is a case in point).
o one good example is the eradication of smallpox in the 1980-1990s due term protection immunity that would normally follow recovery from
to the development of vaccines naturally occurring infections. Basically, you are just priming yourself to
▪ Vaccines have rapid impact: the impact of most vaccines on communities produce antibodies against a particular substance that you have not been
exposed with or you have not been developed antibodies for.
and populations is almost immediate.
o example: between 200 and 2008, vaccinations has reduced the global What is advantageous here is that vaccination causes less adverse disease or INTRAMUSCULAR (IM) INJECTION SUBCUTANEOUS (SC) INJECTION
deaths of measles by 78% (from 750,000 down to 164,000 deaths per the vaccinee does not endure the illness and there is a lower risk of adverse ▪ most common
year) reaction that greatly outweighs the risk of complications by natural ▪ administers the vaccine into the
▪ Vaccines save lives and costs: recently, a panel of distinguished administers the vaccine into the
infection. muscle mass
economists put expanded immunization coverage for children in fourth subcutaneous layer above the
▪ vaccines containing adjuvants
place on a list of 30 cost-effective ways of advancing global welfare. muscle and below the skin
should be injected IM to reduce
WHAT ARE THE COMPONENTS OF VACCINES? adverse local effects
INTRADERMAL (ID) INJECTION ORAL/INTRANASAL SPRAY
INGREDIENTS THAT PROVIDE IMMUNITY ▪ administers the vaccine in the vaccine makes immunization
ANTIGENS ADJUVANTS topmost layer of the skin easier by eliminating the need for
▪ are the components derived ▪ vaccine adjuvants accelerate, ▪ BSG is the only vaccine with a needle and syringe (e.g Polio
from the structure of disease- enhance, and prolong the this route vaccine given to babies)
causing organisms, which are immune responses triggered by
recognized as “foreign” by the antigens: the vaccine components HOW ARE VACCINES BEING DEVELOPED?
immune system and trigger a that elicit pathogen-specific
protective immune response to immune responses
the vaccine ▪ most common example adjuvant
TYPES OF VACCINES
▪ the types of vaccines are used in vaccines is aluminum
dependent on what kind of which contain most of our Vaccine manufacturers strive to develop vaccines that: Research Development → Pre-Clinical → Phase 1 → Phase 2 → Phase 3 →
antigen that particular vaccine vaccines ▪ are effective in preventing or reducing severity of infectious disease Submission to FDA → Phase 4
is being used ▪ provide durable, long-term protection against the disease
What does EUA mean? Emergency Use Authorization
▪ achieve immunity with a minimal number of doses
INGREDIENTS THAT PROLONG SHELF LIFE AND KEEPS THEM SAFE ▪ provide the maximum number of antigens that confer the broadest SHORT RECAP
PRESERVATIVES STABILIZERS protection against infection Vaccines work by mimicking the body’s immune system to build up defense
▪ are added to multidose vaccines to prevent ▪ used to help the ▪ cause no or mild adverse events against infectious bacteria or virus without causing disease. So, the parts of
bacterial and fungal growth vaccine maintain ▪ are stable at extremes of storage conditions over a prolonged period of the infectious organism that the immune system recognizes are foreign the
o for example: rabies vaccine its effectiveness time body and are called antigens.
o the most prophylactic rabies vaccine is a during storage ▪ are available for general use through mass production
multidose vial: one container can be used by ▪ are affordable to populations at risk for infectious disease
different people because in most prophylactic
There is a balance that must be strived in the development of vaccines. The
rabies vaccination, the computation there is
table shows the types of vaccines that are currently used.
w/ HARVEY L., ANJ C.,
HANNAH P., & PATRICK Y.
AIRAH M.
 IT STARTS IN THE LAB
1 RESEARCH AND DISCOVERY STAGE
▪ scientists develop a rationale for vaccine - how the infectious organism
causes disease
o Do they need the vaccine? How infectious/deadly is the organism?
▪ research to test their idea for a vaccine candidate: sometimes this
testing occurs in animals
▪ when findings are thought to have practical application, the research
moves forward
o in this stage, they will think of an organism, and ask the following
main questions: “Do we need a vaccine for this?” or “How often do
this come about in the community?” or “How transmissible is it?”
or “How deadly is this?”
o like in basic research, you always start with your research question
RESEARCH MOVES FORWARD
2 PRE-CLINICAL
▪ before a vaccine can be tested in people, a company or researcher
performs additional laboratory research and testing in animals to
obtain information about how the vaccine works and whether it’s
likely to be safe and work well in humans
o usually, animal testing happens during this stage
TESTING THE VACCINE IN PEOPLE
when the company/researcher is ready to begin studies in humans they:
▪ they compile the results & other information -- assessment of
preclinical data
o they compile results of their laboratory and other pre-clinical
testing
▪ assessment on the product itself; quality and safety & the technology
to manufacture
o also compiling information pertaining to the manufacturing
technology and quality of vaccine
o these are submitted to the Food and Drug Administration in the
form of an Investigational New Drug Application
o FDA will evaluate or assess the data that they are given--whether
these are conducted according to good laboratory practices and will
also conduct assessment of the product if it is safe (What is the
technology that manufactured it?) and is it reasonably safe to move
forward in testing people
▪ studies conducted in people are known as the CLINICAL
DEVELOPMENT STAGE—or the stage called “CLINICAL TRIALS”
▪ in Clinical Trials, it is divided into 4 stages-- this is where we start now
to give the vaccine to individuals (this covers 3 phases)
▪ the phases of the studies may progress sequentially, but it is also not
uncommon for the phases of development to overlap
3a PHASE 1 Clinical Trial
▪ emphasis during this phase is on safety and generally includes about
20-100 volunteers who haven’t been exposed to the disease being
studied and who are generally otherwise healthy
▪ determine whether there are adverse reactions with increasing doses
and, if possible, to gain early information about how well the vaccine
works to induce an immune response in people
o technically, in the first stage, the main role of the researcher or the
investigator is to know if the vaccine is safe
o in order to know what happens when you give them to an
individual: whether it will cause an adverse reaction or not
o that’s why they are given to a small & healthy population, without
a disease
3b PHASE 2 Clinical Trial
▪ tested on more people, where various dosages are tested on 100’s of
people with typically varying health statuses and from different
demographic groups, in randomized-controlled studies
o in this phase, the goal here is that they are now finding what is the
correct dosage of that particular vaccine where they can obtain a
very good immune response
o they are grouped in 200’s: Group A is given 1 ml, then Group B is
given 2 mL
o both of these groups also will have different dosing, different
timing, how many days or how many weeks they will give the
second dose, or do you even need a second dose? (main function
of Phase 2)
▪ provide additional safety information: common short term-side
effects and risks include control groups
o since you are testing it on a larger scale, more people would be
exposed so you have a good idea now what are the common side
effects (e.g. pain, fever, allergies, and any other risks)
o will also include CONTROL GROUPS: groups wherein you will give
them a placebo vaccine, they will take the vaccine but technically
you’re not giving anything to them but instead, it’s just water
3c PHASE 3 Clinical Trial
▪ where the vaccine is administered to thousands of people to generate
information on effectiveness and additional safety data
▪ include additional information about immune responses and
compare: 1 who receive the vaccine and 2 in negative control groups
(e.g. placebo)
▪ provide additional information regarding the vaccine’s safety,
particularly less common side effects
o kind of similar to Phase 2 but this will be more focused on
information on its effectiveness and additional safety data
ASSESSMENT OF MANUFACTURING
if it has passed the Phase 1-3 Clinical Trials, the research is now submitted
to FDA and they will also be assessing pertaining to the manufacturing of
the vaccine & the facility where it is made
▪ vaccine manufacturing is complex
▪ LOT: process of making the candidate vaccine in Phase 3 studies in
batches (helps ramp up production)
o when they create or manufacture vaccines, they will group it in LOT
numbers, it helps the manufacturer ramp up the commercial scale
▪ FDA requires data to support manufacturing processes, facilities,
characterization and lot-to-lot consistency
SEEKING APPROVAL
4 SUBMISSION TO THE FDA
the vaccine company will seek the approval of the FDA
when seeking FDA approval, this is when you hear “FDA Approved”
▪ permission to distribute and market a vaccine in the US (Doc got data
from the US FDA, that’s why it’s US instead of PH)
▪ evaluates data to determine whether the safety and the effectiveness
of the vaccine has been demonstrated and whether the manufacturing
facility information is complete
o by then, FDA will now decide whether the analysis of the benefits
and risks for the intended population who will receive the vaccine
▪ once everything is okay, FDA approves license for use
MONITORING SAFETY AND EFFECTIVENESS
5 PHASE 4
▪ ongoing surveillance of vaccines after FDA-approval to identify
uncommon adverse events or long-term complications
o although Phase 1-3 are studied in certain individuals, some of them
might not develop adverse reactions/events
▪ PHASE 4 Studies: when FDA require post-marketing studies to further
assess known or potential serious risks
▪ Lot Release
o a mechanism which provides FDA with real-time system to
continuously monitor product quality
o manufacturers are not permitted to distribute a specific lot of
vaccine until the FDA releases it
⇥ It is important that when you see drugs, reagents, or vaccines,
there should be a LOT number. This is because when the FDA
approves that LOT number that means that batch that was made
is safe to use as sometimes, it might not be consistent when
manufacturing these products.
⇥ if a serious/adverse event happens to a particular batch/LOT
number, they can recall that entire LOT number simultaneously
(they can easily identify which ones are bad if ever one will be
bad)
EMERGENCY USE AUTHORIZATION
▪ WHAT: vaccine development may be atypical or expedited
o governments, organizations, or other pharmaceutical companies
coalesce together to develop a strategy for prioritizing and
speeding development of vaccines or treatments
▪ WHEN: public health emergencies - pandemic
o recognizing the urgent need for a safe and effective vaccine after it
utilizes its various authorities and expertise to facilitate the
expenditures, development and availability of safe and effective
vaccines.
▪ FDA will undertake a comprehensive evaluation of this information
submitted by a vaccine manufacturer
o they must also determine that the known and potential benefits
outweigh the known and potential risks of the vaccine
▪ EUA request for a COVD-19 vaccine can be submitted to FDA based on
a final analysis of a Phase 3 clinical efficacy trial or an interim analysis
of such trial (e.g. an analysis performed before the planned end of the
trial once the data have met the pre-specified success criteria for the
study’s primary efficacy endpoint)
o unlike the usual process, vaccine to be approved by the FDA in cases
of EUA (to expedite processes), what they did is they usually overlap
(clinical trials 1 and 2 both happen at the same time) and when the
w/ HARVEY L., ANJ C.,
HANNAH P., & PATRICK Y.
AIRAH M.
 manufacturer releases an interim analysis of the Phase 3 trial, they
can go ahead and give emergency use authorization
⇥ licensing, manufacturing, and other paperwork details are
skipped as long as clinical trials deem the vaccine safe, EUA may
be approved by FDA
⇨ EUA applicable only during times of crises or pandemic
⇨ vaccines cannot be marketed/sold for commercial purposes
⇨ guidelines should be followed for the usage
SAFETY OF VACCINES GRANTED EUA
▪ must include all safety data accumulated from Phase 1 and 2 studies
with expectation that Phase 3 data will include a follow-up of at least
2 months
o e.g. Pfizer was granted EUA in the middle of Phase 3 clinical trial
▪ after completion of the vaccine regimen, FDA will include phase 3
safety database of >3,000 recipients
▪ also a requirement for EUA
o evaluation of the chemistry, manufacturing, and control
information for the vaccine
HOW ARE THESE MANAGED IN A SHORT PERIOD OF TIME?
▪ Adaptive Trial Designs are developed:
o these clinical study designs aim to expedite clinical trial decisions
based on preliminary results derived from earlier trials and in some
cases, from the same trial (dinali’an/rushed)
o using this approach can facilitate efficient clinical development
o the goal of these designs is to reduce the size and duration of the
trial and demonstrate an effect if one exists
o performed with close attention to statistical rigor
DEVELOPMENT IN THE COVID-19 VACCINE
descriptions of the image:
▪ in phase 1, there is academic research
▪ since COVID-19 has been well studied, the academic research has been
skipped (there is no discussion whether we need the vaccine or not
since we are currently in the pandemic)
▪ to reduce the time, the clinical trials are combined while building the
manufacturing factory so by the time that they finish the Phase 3
clinical trial, they are ready to mass produce the vaccine
▪ in contrast to a normal development where factories are built when
clinical trials are completed and approved
▪ based on FDA, there are thousands of vaccine research being
submitted but only 10% are accepted for human consumption
SARS-CoV-2 VIRUS AND ITS VACCINE Fortunately, we already have a head start on the first phase of vaccine
development: research. SARS-CoV-2 has been extensively studied during the
Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2)
start of the pandemic. When they identified the virus, they started
▪ causes coronavirus disease 2019 (COVID-19)
researching immediately for vaccine development. These are the companies
▪ positive-sense single stranded RNA virus
that currently have clinical trials underway:
▪ zoonotic origin: genetically similar to bat coronavirus (suggesting it
emerged from a bat-borne virus)
▪ how it spreads: respiratory droplets produced by coughs and sneezes
▪ R0 estimate around 5.7
o one infected individual can infect about 5-6 individuals at a time
o trivia time/add on info about R0:
⇥ R0, pronounced “R naught,” is a mathematical term that indicates
how contagious an infectious disease is
⇥ is also referred to as the reproduction number
⇥ as an infection is transmitted to new people, it reproduces itself
⇥ R0 tells you the average number of people who will contract a
contagious disease from one person with that disease
⇥ it specifically applies to a population of people who were previously
free of infection and haven’t been vaccinated
⇥ for example, if a disease has an R0 of 18, a person who has the
disease will transmit it to an average of 18 other people
⇨ that replication will continue if no one has been vaccinated
against the disease or is already immune to it in their community
▪ enters cells: angiotensin converting enzyme 2 (ACE 2)
STRUCTURAL
COMPONENT OF
SARS-COV:
▪ 50-200 nm in dm ▪ dozens of vaccines are starting clinical trials and use the experimental
mRNA and DNA technology which provides the body with instructions on
to produce its own antibodies against the virus
▪ the vaccine development process typically takes a decade long
o Varicella = 28 years
o Rotavirus and Human papillomavirus = 15 years
o SARS-CoV-2 = 18 months
image from NY times
4 STRUCTURAL PROTEINS (lol semen mnemonic)
important because these are the antigens identified and being tested in your
RT-PCR testing
spike protein (which is outside): responsible for attachment
S
and fuse with the membrane of the host cell (S1/S2)
E envelope protein
M membrane protein
N nucleocapsid protein: holds the RNA genome
w/ HARVEY L., ANJ C.,
HANNAH P., & PATRICK Y.
AIRAH M.
 WHAT ARE THE VACCINES CURRENTLY AVAILABLE?
in our country that are being used or to be used
▪ EUA is different for each country
o In the US there are only 3: Pfizer, Moderna, and Jannsen
o PH: Sinovac, AstraZeneca, and Pfizer
SARS-CoV-2 VACCINE (VERO CELL), INACTIVATED [CORONAVAC]
NAME: CoronaVac
COMPANY: SINOVAC
EFFICACY: 50% in Brazil and 91.4 in Turkey
▪ type of vaccine: killed virus
o grew coronavirus: monkey kidney cells + beta-propiolactone
(disables/kills the coronaviruses) = inactivation of the virus
o adjuvant added: aluminum-based compounds
▪ since it is dead/killed, it can be injected in the arm without risking
COVID
o once inside the body, some of the inactivated viruses are
swallowed up by the immune system and an immune response will
be printed (?)
PH FDA RECOMMENDATIONS
▪ used only to prevent COVID-19 in clinically healthy individuals ages 18
to 59 years
▪ does not support the use of SARS-CoV-2 Vaccine (Vero Cell),
inactivated CoronaVac on health care workers exposed to COVID-19
patients as it has a low efficacy of 50.4% in this group
▪ 0.5ml (600SU) of inactivated SARS-CoV-2 inactivated antigen
▪ 2nd dose given after 4 weeks
Emergency Use authorization (EUA) for SARS-CoV-2 vaccine (Vero Cell)
inactivated (Corona Vac), Sinovac Life Sciences Co. Ltd
The details of the SARS-CoV-2 vaccine (Vero Cell) (these are monkey
kidney cells) Inactivated (Corna Vac) are as follows
▪ Product Name: SARS-CoV-2 vaccine (Vero Cell) Inactivated (Corna Vac)
▪ Dosage Strength and Form: 600SU/0.5mL suspension for injection
(IM)
▪ Pharmacological category: Vaccine
▪ Storage: Store at 2 to 8C. Protect from light. Do not freeze
▪ Shelf Life: 6 months
▪ Packaging: Vial (box of 40’s)
▪ Manufacturer: Sinovac Life Sciences Co,. Ltd.
▪ Indication: This product is suitable for clinically healthy people aged
18 to 59 years susceptible to the virus. Vaccination of this product
stimulates the body to induce immunity against SARS-CoV-2 virus for
the prevention of disease caused by SARS-CoV-2 virus. This product is
not recommended for use on healthcare works with exposure to
COVID-19 Patients.
PFIZER-BIONTECH COVID-19 VACCINE
▪ Name: BNT162b2
▪ Generic Tozinameran Brand: Comirnaty
▪ Company: Pfizer-BioNTech
▪ mRNA Vaccine
▪ Dosing 2, 0.3ml doses 21 days apart
▪ Storage: -70°C ± 10°C for up to 10 days unopened.
The pFizer vaccine uses the previously discussed mRNA vaccine where in
genetic material that are self read (??) to make protein is injected directly
into the body. This mRNA will be translated inside our cells, and our cells
are taught to produce spike protein antigens. It will be then presented
outside the cell and will be able to identify or recognize the spike protein
antigen found in COVID-19. That’s how they develop their immune
response. To protect the mRNA they are covered in a lipid molecule.
Because of their fragility, the mRNA molecule will quickly fall apart at
room temperature. Pfizer vaccines are the most pernicious?? vaccine.
The reason why 3rd World Countries are having trouble procuring this
vaccine is because it's very unstable. They would need an ultra-low
freezer of about negative 80C for them to store their vaccines and once
they are acquired, they must be given directly. The problem here is
because of the temperature in the Philippines, it might compromise the
effectiveness of the vaccine. It is too warm for the vaccine.
Pfizer-BioNTech COVID-19 Vaccine General Information (CDC)
▪ Vaccine: Pfizer-BioNTech COVID-19 Vaccine
▪ Diluent: 0.9% Sodium Chloride (normal saline, preservative free)
(that's why it only lasts 10 days because it is preservative free, the
advantage is that it does not contain any chemicals, but the downside
is that it should be consumed immediately)
▪ Discard vial when there is not enough vaccine to obtain a complete
dose. Do not combine residual vaccine from multiple vials to obtain a
dose.
▪ Vaccine must be mixed with diluent before administration
▪ Multidose Vial: 6 doses per vial
▪ Dosage: 0.3ml
▪ Age Indication: 16 years of age and older
▪ Schedule: 2 dose series separated by 21 days
▪ A series started with Pfizer-BioNTech COVID-19 Vaccine should be
completed with this product
▪ Administer: Intramuscular injection (IM) in the deltoid muscle.
PH FDA RECOMMENDATIONS:
▪ Each vial must be diluted with 1.8 ml of sterile 0.9% chloride injection,
USP prior to the use to reconstitute the vaccine. The dosing regimen
is two doses of 0.3ml each. Second dose should be given after three
weeks from the first dose only to prevent COVID-19 in individuals ages
16 and older.
▪ Preliminary data suggest high vaccine efficacy in preventing COVID-19
following receipt of two doses of mRNA COVID-19 vaccine (pfizer-
bioNtech: 95,0% (95% CL: 90.3%, 97.6%); Moderna 94.1% (95% CL:
89.3%, 96.8%)
Emergency Use Authorization (EUA) for Pfizer-BioNTech COVID-19
Vaccine Suspension for IM injection
This applies to the application for the issuance of Emergency Use
authorization for Pfizer-BioNTech COVID-19 Vaccine Suspension for IM
injection.
▪ Product Name: Pfizer-BioNTech COVID-19 Vaccine (BNT162b2)
▪ Dosage Strength and Form: 30 mcg suspension for Intramuscular
Injection
▪ Pharmacologic Category: Vaccine
▪ Storage: Prior to dilution, store at -80C to -60c
▪ Packaging: 15 and 195 multiple dose vials (after dilution each vial
contains 6 doses of 0.3mL
▪ Manufacturer: Pfizer Manufacturing Belgium NV- Puurs, Belgium,
Phjarmacia and Upjohn Company ::C. Kalamazoo, Michigan, USA
▪ Indication: For active immunization for the prevention of COVID - 19
caused by SARS-COV-2 in individuals 16 years of age and older
COVID-19 VACCINE {ChAdOx1-S [recombinant])
(COVID-19 VACCINE ASTRAZENECA)
▪ Name: ChAdOx1 nCoV-19 or AZD 1222
▪ Generic: Tozinameran Brand: Comirnaty
▪ Company: AstraZeneca
▪ Vector Based vaccine that uses Modified
Chimpanzee adenovirus (ChAdOx1)
▪ Dosing: 2, 0.5mL between 4 - 12 weeks
(more stable than the Pfizer)
▪ Storage: at least six months when refrigerated at 38 to 46°F (2-8°C)
What happens here is that adenoviruses are commonly found viruses
that cause flu and cold-like symptoms. What the astraZeneca did is that
w/ HARVEY L., ANJ C.,
HANNAH P., & PATRICK Y.
AIRAH M.
they used a modified version of the Chimpanzee adenovirus called ▪ Company: Moderna
(ChAdOx1). It can enter the cell but cannot replicate inside the cell. After ▪ Efficacy 94.1%
the vaccine is injected into the arm of the person, the adenovirus will ▪ Dosing Information:
latch on to the surface of the cell and the cell will engulf it. Once the o Multidose vial: 10 doses per vial
adenovirus is inside the cell, it releases the DNA that is stored, and the o Dosage: 0.5ml
DNA virus will push itself to store the DNA into the nucleus. The ▪ Do not mix with a diluent, discard vial
adenovirus is engineered in such a way that it cannot make copies of when there is not enough vaccine to
itself (it cannot reproduce). But the gene for the coronavirus spike obtain complete dose. Do not
protein can be readily read by the cell and copied into a molecule called combine residual vaccine from multiple vials to obtain a dose.
your mRNA. It is similar with Pfizer that it uses the mRNA, it’s just ▪ Age indication:
AstraZeneca uses an organism as the carrier (adenovirus). o 18 years of age and older
▪ Schedule:
o 2 dose series separated by 28 days
o a series started with COVID 19 vaccine Moderna should be
completed with this product
▪ Administration: IM injection in the deltoid muscle.

VACCINE TRACKER OVERVIEW

GENETIC VACCINES

PH FDA RECOMMENDATIONS
▪ used only to prevent COVID-19 in individuals ages 18 and older
▪ consists of two separate doses of 0.5ml each
▪ the second dose should administered between 4 and 12 weeks after
the first Dose
Emergency Use Authorization for COVID-19 Vaccine (ChAdOx1) S1
Recombinant Vaccine (ChAdOx1-S [recombinant]) (COVID-19 Vaccine
AstraZeneca)
▪ This applies to the application issuance of Emergency Use
Authorization (EUA) for COVID-19 Vaccine (ChAdOx1) S1 Recombinant
Vaccine (ChAdOx1=Sl(recombinant) (COVID-19 Vaccine AstraZeneca.
The details of the COVID-19 Vaccine AstraZeneca are as follows
▪ Product Name: COVID-19 Vaccine (ChAdOx1) S1 Recombinant Vaccine
(ChAdOx1-S [recombinant]) (COVID-19 Vaccine AstraZeneca)
▪ Dosage Strength and form: 0.5ml Solution for Injection (IM)
▪ Pharmacologic Category: Vaccine
▪ Storage: Store in a refrigerator 2 to 8 degrees C. Do not freeze, Keep
vials in outer carton to protect from light
▪ Packaging: 5ml of Solution in a 10-dose vial (clear type 1 glass) with
stopper (elastomeric with aluminum overseal) with a plastic flip off
cap. Packs of 10 vials. 4ml of solution in an 8-dose vial (clear type 1
glass) with stopper (elastomeric with aluminum overseal) with a
plastic flip off cap. Packs of 10 vials.
▪ Manufacturer: Catalent Anagi S.R.L Anagi (FR) Italy
▪ Indication: For active immunization of individuals greater than or
equal 1o 18 years old for the prevention of coronavirus disease 2019
(COVID 19)
MODERNA COVID-19 VACCINE
▪ Name: mRNA-1273 (similar to Pfizer) (stable up to 6 months when
shipped and stored at negative 20°C) (more stable than Pfizer because
it contains a stabilizer and a preservative) (Pfizer, Moderna, and Jansse
are the only FDA approved?? [she cut in the middle])
JANSSEN COVID-19 VACCINE (JOHNSON & JOHNSON)
▪ Name: JNJ-78436735 or Ad26.COV2.S (this is a vaccine based on the
virus’ genetic instruction to build a spike protein) (somewhat the same
as Pfizer)
▪ Company: Jansse by Johnson and Johnson
▪ Efficacy: up to 74%
▪ DNA based vaccine. Its advantage against RNA based vaccine is that
DNA is not as fragile as RNA and can be refrigerated up to 3 months at
2-8°C (ref temp.) (this is the difficulty with Moderna and Pfizer VIRAL VECTOR VACCINES
products because they must be stored at ultra-low freezers which may
not be available in certain communities)
▪ Given as a single dose
▪ Dosing Information
o Multidose Vial: 5 doses per vial
o Dosage: 0.5mL
o Do not mix with a diluent
o Discard vial when there is not enough vaccine to obtain a complete
dose. Do not combine residual vaccine from multiple vials to obtain
a dose
▪ Age Indicators: 18 years old and older
▪ Schedule: Single dose
▪ Administration: Intramuscular injection in the deltoid muscle

w/ HARVEY L., ANJ C.,

HANNAH P., & PATRICK Y.
AIRAH M.
 PROTEIN BASED VACCINES CONSIDERATIONS FOR VACCINATION OF PEOPLE WITH CERTAIN
UNDERLYING MEDICAL CONDITIONS
Any current authorized COVID 19 vaccine can be administered to people
with underlying medical conditions who have no contraindications to
vaccination.
CONTRAINDICATIONS
CDC considers a history of the following to be a contraindications to
vaccination with covid 19 vaccines
▪ Severe allergic reaction (anaphylaxis) after a previous dose or to a
component of the COVID 19 vaccine.
▪ Immediate allergic reaction of any severity toa previous dose or known
diagnosed allergy to a component of the vaccine.
KILLED OR LIVE ATTENUATED

FAQs ON SARS-CoV-2 VACCINE

Interim clinical considerations for the use of COVID 19 vaccines currently
authorized in the United States
INTERCHANGEABILITY OF COVID-19 VACCINE PRODUCTS
▪ Any current authorized COVID-19 vaccine can be used when indicated.
ACIP does not state a product preference. However Covid 19 vaccines are
not interchangeable
▪ mRNA COVID-19 Vaccines (PFizer and Moderna)
▪ The safety and efficacy of a mixed product series have not been
evaluated. Both doses of the series should be completed with the same
product.
COADMINISTRATION OF OTHER VACCINES
None of the currently authorized COVID 19 vaccines are live virus vaccines.
Because data are lacking on the safety and efficacy of COVID 19 vaccines
administered simultaneously with other vaccines, the vaccine series should
routinely be administered alone with a minimum interval of 14 days before
or other administration of any other vaccine.
PEOPLE WITH PRIOR OR CURRENT SARS COV 2 INFECTION
Data from clinical trials indicate that the currently authorized COVID19
vaccines can be given safely to people with evidence of a prior SARS COV 2
infection.
VACCINATING PEOPLE WITH A KNOWN COVID 19 EXPOSURE OR DURING
COVID 19 OUTBREAKS
COVID 19 vaccines are not currently recommended for outbreak
management or post exposure prophylaxis to prevent SARS COV 2 infection
in a person with a known exposure because the median incubation of COVID
19 is 4 to 5 days. It is unlikely that a dose of COVID 18 vaccine would provide
an adequate immune response with the incubation period for effective post
exposure prophylaxis.

w/ HARVEY L., ANJ C.,

HANNAH P., & PATRICK Y.
AIRAH M.
 LIVE ATTENUATED (LAV) INACTIVATED (KILLED ANTIGEN) SUBUNIT (PURIFIED ANTIGEN) TOXOID (INACTIVATED TOXINS)
▪ derived from disease-causing pathogens which have been ▪ made from microorganisms that
PROTEIN-
weakened under lab conditions have been killed through physical POLYSACCHARIDE CONJUGATE
BASED
▪ they will grow inside, but will cause no/very little disease or chemical processes. These
▪ these are live pathogens that are weakened in the laboratory cannot cause disease ▪ SAFEST VACCINE
▪ technically, it is almost as if saying we’re saying that the main ▪ has an excellent stability profile ▪ do not contain live components
pathogen is given to you so that you will develop an immune because they have no life ▪ they contain only the antigenic parts of the
response components and have no risk of pathogen, which are necessary to elicit a “MOST EASY TO DEAL WITH”
▪ amongst all of the types of vaccines, this is the one that has the most introducing disease (safer and protective immune response vaccine
DESCRIPTION excellent immune response more stable than the live ▪ e.g. in a certain bacteria, you have to know what
o since you are giving a live pathogen into the body so that you will attenuated vaccines) is the antigenic portion of that pathogen (e.g.
develop an antibody for this, however, it is less safe compared to ▪ this type of vaccines are the surface antigen)
inactivated vaccines vaccines that are usually free ▪ the surface antigen will be extracted and will be
doses and most of them require the one that will be used in the vaccine formation
booster doses in the future ▪ similar with killed vaccines, they have an excellent
stability profile (have no live components, no risk
of inducing the disease, and is safer and more
stable than the live attenuated vaccines)
▪ stimulate excellent immune response, pathogens provide continual ▪ since the pathogen is already ▪ antigenic properties of the various potential ▪ based on the toxin produced
antigenic stimulation-sufficient memory cell production killed, it may not always induce an subunits of a pathogen must be examined in detail by certain bacteria: the toxin
▪ live microorganisms provide continual antigenic stimulation, giving immune response and the to determine which particular combination will invades the bloodstream and
sufficient time for memory cell production response may not be long lived produce an effective immune response but they is responsible for symptoms of
▪ attenuated pathogens are capable of replicating within host cells ▪ several doses may be required to are the safest amongst all of the vaccines the disease
▪ excellent immune response evoke an immune response ▪ it is very specific to a certain antigenic component ▪ usually, this is the type of
▪ may not always induce an immune ▪ once a response is elicited, there is no guarantee vaccine that requires an
response at first dose that an immunological memory will be formed in adjuvant
▪ response may not be long-lived, a correct manner ▪ to increase the immune
requiring several doses of vaccine o it is not 100% sure that in the next infection, response, the toxoid is
▪ LESS STRONG IMMUNE that surface antigen that we extracted from the absorbed to aluminum or
IMMUNE
RESPONSE COMPARED TO LIVE vaccine will be present in the pathogen since calcium salts, which serves as
RESPONSE
VACCINES sometimes, in certain organisms, one may be adjuvants (adjuvants boost the
absent from that specific specie (this doesn’t immune response of the
have a surface antigen), hence, the vaccine is individual) and may also
not effective against the said pathogen require several doses
▪ must determine which combination of antigenic ▪ may require several doses and
properties will produce an effective immune usually need an adjuvant
response with the correct pathway ▪ NOT HIGHLY IMMUNOGENIC
▪ a response may be elicited, but with no guarantee
that memory will form for future responses
▪ LESS STRONG IMMUNE RESPONSE COMPARED
to LAVs
▪ since live attenuated vaccines (LAVs) contain living organisms, there ▪ no risk of inducing disease, they do ▪ do not contain live components and are ▪ cannot cause the disease
is a degree of unpredictability raising some safety and stability not contain live components considered as very safe ▪ no possibility of reversion to
concerns ▪ more stable ▪ have no live components, no risk of inducing the virulence
▪ attenuated pathogens can revert to original form and cause disease ▪ have no live components, no risk disease ▪ stable, as they are less
▪ potential harm to individuals with compromised immune systems of inducing the disease ▪ safer and more stable than LAVs susceptible to changes in
(e.g. HIV) ▪ safer and more stable than LAVs ▪ EXCELLENT STABILITY PROFILE temperature, humidity and
▪ sustained infection (BCG-local lymphadenitis) ▪ EXCELLENT STABILITY PROFILE light
SAFETY AND
▪ contamination of tissue culture ▪ vaccine cannot cause disease
STABILITY
▪ immunization errors (Reconstitution, cold chain) it prevents
o a very unstable product since these are live pathogens ▪ very rare local and systemic
o the storage is very strict here: usually they are in freezing reactions
temperatures and freezing-thawing cycle is generally not ▪ usually stable and long lasting
recommended (once they are thawed, they must be given) ▪ EXCELLENT STABILITY
▪ usually not given in pregnancy PROFILE
▪ less safe compared to inactivated vaccines

AIRAH M.
 mRNA VIRAL VECTOR VACCINE (very recent vaccine)
mRNA vaccine is a very new technology and has been in development in early 2019 before SARS-CoV-2 hit. ▪ uses a safe virus to deliver the genetic code (DNA) of SARS-CoV-2 spike protein into the human cells to
mRna vaccine was initially developed for Ebola virus and is actually undergoing clinical trials using this type make protein
of technique as vaccines for Ebola virus. However, this has been superseded by the pandemic and mRNA ▪ JNJ-7843672 uses a human adenovirus to deliver the code for the SARS-CoV-2 spike protein
vaccine is one of the technology or types of vaccine that is on the market and is currently available as vaccines ▪ AZD1222 uses a non-replicating chimpanzee adenovirus to deliver the code for a SARS-CoV-2 spike protein
for SARS CoV-2. (used in MERS-COV)
▪ messenger (mRNA) is introduced to the cells providing the cells readable instructions on how to make WHAT DOES IT DO?
SARS-CoV-2 spike protein A purified spike protein is injected into
▪ this mRNA component is protected by lipid nanoparticles deliver mRNA to the cell’s cytoplasm a host or carrier virus and this carrier
▪ mRNA from the COVID-19 vaccine never enters the nucleus of the cell - the mRNA does not alter or interact virus carrying the DNA or the genetic
with the DNA. These are eventually degraded inside the cell. code of a particular antigen that you
WHAT IS mRNA? want your body want to recognize is
▪ It uses a molecular technique wherein the mRNA is introduced in contained. So, you give this virus to the
the cells. Providing readable (???) instructions on how to make a individual and then once it is absorbed,
SARS-CoV-2 protein. So technically, you are introducing an mRNA it will then infect or attach itself to a cell
component into the cell. So, this mRNA is protected by lipid and from there, the spike protein gene
nanoparticles which deliver mRNA to the cell's cytoplasm. Once is purified and then adenoviral is
they enter the cell, protein translation will ensue inside the cell injected, then body produces spike
and antibodies for that particular spike protein will be developed protein and finally the immune system
by the cell. produces the antibody. So, if you think
▪ ANALOGY on how vaccines work: So the vaccine contains a code, about it, it is similar to the live
and that code will be absorbed to your cell and then your cell will attenuated vaccine except that in live attenuated vaccine, the pathogen itself that is injected is the one that
read that code. Then it will produce the antibodies. you want your body to identify. In the Viral Vector Vaccine, it is using a different virus to carry the genetic
code so that once it attaches itself to the immune cells, it will inject that genetic code and then the immune
SARS-CoV-2 SPIKE PROTEIN
cells will read that genetic code – thus, producing the antibodies.
▪ the antibodies that are coded in the mRNA
▪ protein found outside of the SARS-CoV 2 virus WHAT ARE THE POSSIBLE COMPLICATIONS?
Adenovirus is actually a causative agent of the seasonal/common flu. So that is why, the safety issue for this
IS IT SAFE? is that this type of vaccine actually produces more adverse reactions than any other type of virus because
▪ based on their initial findings, it is safe you are technically injecting yourself with a human adenovirus or an adenovirus that causes flu. So, usually
▪ the mRNA does not alter or interact with the DNA because they patients that are given this type of vaccine are reported to produce full length symptoms (e.g. fever and
are limited, thus, they remain outside of the cell and they are cough) but when the patient recovers from it, there is an abundant production of antibodies. Take note that
eventually degraded or broken down in the cytoplasm the adenovirus given is modified so that they won’t replicate inside the body.

AIRAH M.
 ASTAZENECA COVID-19
SARS-CoV-2 VACCINE PFIZER-BIONTECH COVID-19
BASIS VACCINE {ChAdOx1-S MODERNA COVID-19 VACCINE JANSSEN COVID-19 VACCINE
(VERO CELL), INACTIVATED VACCINE
[recombinant])
NAME CoronaVac BNT162b2 ChAdOx1 nCoV-19 or AZD 1222 mRNA-1273 JNJ-78436735 or Ad26.COV2.S
GENERA Tozinameran Brand: Comirnaty Tozinameran Brand: Comirnaty
COMPANY SINOVAC Pfizer-BioNTech AstraZeneca Moderna Jansse by Johnson and Johnson
EFFICACY 50% in Brazil and 91.4 in Turkey 95.0% 94.1% up to 74%
Vector Based vaccine that uses
killed virus (monkey kidney cells + beta-
TYPE OF VACCINE mRNA Vaccine Modified Chimpanzee adenovirus mRNA V DNA based vaccine
propiolactone)
(ChAdOx1)
-70°C ± 10°C for up to 10 days
STORAGE 2 to 8°C 3 months at 2-8°C (ref temp.)
unopened stable up to 6 months when
at least six months when
Diluent: 0.9% Sodium Chloride, shipped and stored at negative
refrigerated at 38 to 46°F (2-8°C)
STABILITY up to 6 months (normal saline, preservative 20°C
free), only lasts for 10 days
AGE INDICATOR ages 18 to 59 years 16 years of age and older 18 and older 18 years of age and older 18 years old and older
2 dose series separated by 21
SCHEDULE 2nd dose given after 4 weeks 2 doses between 4-12 weeks 2 dose series separated by 28 days Single dose
days
ADMINISTRATION IM injection in the deltoid muscle IM injection in the deltoid muscle IM injection in the deltoid muscle IM injection in the deltoid muscle IM injection in deltoid muscle
DOSING 0.5ml (600SU) 2, 0.3ml doses 21 days apart 2, 0.5mL between 4 - 12 weeks single dose
▪ does not support the use of SARS-CoV-2 o Multidose Vial: 5 doses per vial
o Multidose vial: 10 doses per vial
o Dosage: 0.5mL
Vaccine (Vero Cell), inactivated o Dosage: 0.5ml
Multidose Vial: 6 doses per vial; o Do not mix with a diluent
CoronaVac on health care workers Do not mix with a diluent, discard
DOSING Vaccine must be mixed with o Discard vial when there is not
exposed to COVID-19 patients as it has a vial when there is not enough
INFORMATION diluent before administration enough vaccine to obtain a
low efficacy of 50.4% in this group vaccine to obtain complete dose.
complete dose. Do not combine
▪ 0.5ml (600SU) of inactivated SARS-CoV- Do not combine residual vaccine
residual vaccine from multiple
2 inactivated antigen from multiple vials to obtain a dose
vials to obtain a dose

EMERGENCY USE AUTHORIZATION (EUA) INFORMATION

ASTAZENECA COVID-19 VACCINE {ChAdOx1-S
BASIS SARS-CoV-2 VACCINE (VERO CELL), INACTIVATED PFIZER-BIONTECH COVID-19 VACCINE
[recombinant])
COVID-19 Vaccine (ChAdOx1) S1 Recombinant Vaccine
Pfizer-BioNTech COVID-19 Vaccine
PRODUCT NAME SARS-CoV-2 vaccine (Vero Cell) Inactivated (Corna Vac) (ChAdOx1-S [recombinant]) (COVID-19 Vaccine
(BNT162b2)
AstraZeneca)
30 mcg suspension for Intramuscular
DOSAGE STRENGTH AND FORM 600SU/0.5mL suspension for injection (IM) 0.5ml Solution for Injection (IM)
Injection
PHARMACOLOGIC CATEGORY Vaccine Vaccine Vaccine
Store in a refrigerator 2 to 8 degrees C. Do not freeze, keep
STORAGE Store at 2 to 8C. Protect from light. Do not freeze. Shelf life is 6 months. Prior to dilution, store at -80°C to -60°C
vials in outer carton to protect from light.
5ml of Solution in a 10-dose vial (clear type 1 glass) with
15 and 195 multiple dose vials (after stopper (elastomeric with aluminum overseal) with a plastic
PACKAGING Vial (box of 40’s) dilution each vial contains 6 doses of flip off cap. Packs of 10 vials. 4ml of solution in an 8-dose vial
0.3mL) (clear type 1 glass) with stopper (elastomeric with aluminum
overseal) with a plastic flip off cap. Packs of 10 vials.
Pfizer Manufacturing Belgium NV- Puurs,
MANUFACTURER Sinovac Life Sciences Co,. Ltd. Belgium, Phjarmacia and Upjohn Catalent Anagi S.R.L Anagi (FR) Italy
Company ::C. Kalamazoo, Michigan, USA
This product is suitable for clinically healthy people aged 18 to 59 years
susceptible to the virus. Vaccination of this product stimulates the body to For active immunization for the prevention For active immunization of individuals greater than or
INDICATION induce immunity against SARS-CoV-2 virus for the prevention of disease of COVID-19 caused by SARS-COV-2 in equal 1o 18 years old for the prevention of coronavirus
caused by SARS-CoV-2 virus. This product is not recommended for use on individuals 16 years of age and older disease 2019 (COVID 19).
healthcare works with exposure to COVID-19 Patients.

AIRAH M.
AIRAH M.
 KNOW YOUR COVID-19 VACCINES (data as of May 05, 2021)
Pfizer Oxford Sinovac Gamaleya Bharat
Moderna Novavax Janssen
BioNTech AstraZeneca CoronaVac Sputnik V BioTech
Technology viral vector viral vector viral vector
mRNA inactivated virus inactivated virus mrRNA protein subunit
Platform (non-replicating) (non-replicating) (non-replicating)
Philippine FDA EUA
January 14, 2021 January 28, 2021 February 22, 2021 March 19, 2021 April 19, 2021 May 5, 2021 - April 19, 2021
Approval [a]
Dose & Frequency 2 doses, 21 days apart [a] 2 doses, 4-12 weeks apart [a] 2 doses, 28 days apart [a] 2 doses, 3 weeks apart [a] 2 doses, 28 days apart [a] 2 doses, 28 days apart [b] 2 doses, 21 days apart [c] 1 dose [a]
Storage -18°C and below -25 to -15°C
-80 to -60°C [a] 2 to 8°C [a] 2 to 8°C [a] 2 to 8°C [a] 2 to 8°C [h] 2-8°C (3 months) [a]
Requirements (frozen solution) [a] 2 to 8°C (30 days) [e]
66.1-66.9% against
70-4% against asymptomatic 91.6% against symptomatic 94.1% against symptomatic confirmed moderate
Vaccine Efficacy 95% against COVID-19 [a] 65-91% (based on Brazil, COVID-19 [b] 80.6% against PCR- COVID-19 [b] awaiting Official Phase III to severe/critical
Based on Phase III asymptomatic COVID-19 Indonesia, and Turkey confirmed symptomatic Interim Journal COVID-19
Clinical Trial (CT) [b] 100% against severe Trials) [a] 100% against moderate or COVID-19 [e] 100% against severe Publication
COVID-19 [b] severe cases [b] COVID-19 [b] ~77-85% against
severe COVID-19 [j]
▪ pain on injection site
▪ hyperthermia
▪ swelling [b]
▪ pain, erythema, or swelling
▪ local lymphadenopathy ▪ headache
on injection site ▪ injection site pain
at injection site ▪ asthenia
▪ headache ▪ axillary lymphadenopathy ▪ redness
▪ injection site pain and ▪ allergic reaction that may ▪ muscle/joint pain
▪ short-term, mild-to- ▪ fatigue ▪ fever ▪ swelling
Common Adverse tenderness be caused by any ▪ malaise
moderate pain at ▪ fever ▪ headache awaiting Official Phase III ▪ tiredness
Events Reported ▪ fatigue component of the ▪ sore throat
injection site ▪ body ache ▪ fatigue Interim Journal ▪ headache
Observed in Phase ▪ headache vaccine (hives, allergic ▪ diarrhea
▪ fatigue ▪ abdominal pain ▪ myalgia Publication ▪ muscle pain
III CT ▪ feverishness rashes and purpura, ▪ rhinorrhea
▪ headache [b] ▪ nausea ▪ arthralgia ▪ chills
▪ myalgia [b] anaphylactic shock) ▪ loss of appetite
▪ vomiting [e] ▪ nausea ▪ fever
▪ convulsion (with or ▪ pain in the oropharynx
▪ vomiting ▪ nausea [g]
without fever) [i] ▪ nasal congestion
▪ chills [b]
▪ colds
▪ sneezing
▪ cough [b]
References: a. FDA Philippines EUA Approval b. Publication in Journals for Phase III Interim Results c. WHO Landscape and Tracker of COVID-19 Candidate Vaccines d. WHO Interim Recommendations for EUL e. Submission to FDA EUA Application f. Clinicaltrials.gov g.
Center for Disease Control and Prevention h. Publication in Journals for Phase 1 and/or Phase 2 CT results i. FDA Published Product Information Materials j. US FDA Published Vaccine Fact Sheets

AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS CLASSIFICATION OF MUTATIONS CHROMOSOME MUTATION GENOME MUTATION
TOPIC 6: MUTATIONS ▪ Deletion
1 based on the survival of the individual ▪ Aneuploidy
Lecturer: Ms. Jia Adelle P. Relamoagos ▪ Duplication
lethal happens when mutation causes death of all ▪ Polyploidy
▪ Nondisjunction
▪ a really simple process of a mistake made in a mutation individuals undergoing mutation ▪ Autopolyploidy
▪ Inversion
DNA sequence that is being copied sub lethal happens when it causes death of 90% of the ▪ Allopolyploidy
▪ Translocation
▪ an induced misspelling of the DNA sequence mutation individuals
▪ a change in a DNA sequence sub vital happens when such mutation kills less than 90% I. GENE MUTATION
▪ can result in DNA copying mistakes made during mutation of the individuals ▪ involve insertion or removal of 1or more base pairs
cell division: exposure to ionizing radiation, vital happens when a mutation does not affect the ▪ gene mutation is a change in single base pair within DNA
mutations chemical, colds, and mutagens, or infections by mutation survival of an individual sequences
viruses supervital
▪ a heritable change in genetic material enhances the survival of the individual EFFECTS OF GENE MUTATIONS
mutation
▪ could be a permanently structural change of DNA ▪ most mutations are neutral: they have no effect on the
2 based on causes of mutation polypeptide
▪ alterations can be passed on to daughter cells
spontaneous mutation induced mutation ▪ some mutations result in a less active product
▪ mutations in reproductive can be passed to
produced due to treatment ▪ less often an inactive product
offspring occurs naturally without any
with either chemical/physical ▪ very few mutations are beneficial
cost
germ-line mutations somatic mutations agent ▪ affect molecular changes in the DNA sequence of a gene
occur in the eggs & sperm occur in body cells rate is very slow such as the agents capable of inducing ▪ alter the coding sequence within a gene
can be passed onto offspring cannot be passed on methylation followed by such mutations are called ▪ causes permanent change in DNA sequence
deamination of cytosine mutagens and when used for
HISTORY BODY (SOMATIC) GAMETE (GERM)
rate is higher in eukaryotes crop improvement program is
▪ English farmer, Seth Wright, recorded a case of mutation for the MUTATION MUTATION
than prokaryotes known as mutation breeding
first time in the year 1791 where he recorded a male lamb with body cell mutations can cause gamete cell mutations affect
e.g. UV light of sunlight e.g. x-rays causing mutations
unusual short legs cancer the egg and the sperm
causing mutation in ?bacteria? in cereal
▪ the term mutation is coined by Hugo de Vries in 1900s by his all offspring of the individual
3 based on tissue of origin only the individual is affected
observation on (???) can be affected
▪ (some are from wiki since we cannot hear what Miss is saying) the somatic mutation germinal mutation
1 Point Mutation
systemic study of the mutation started in 1910 where Thomas Hunt occurs in gamete or
occurs in somatic cells ▪ a one base change in DNA
Morgan shows that genes reside on chromosomes while reproductive cells
determining the nature of sex-linked traits by studying Drosophila it is in an asexually in sexually reproductive 1 silent mutation
melanogaster reproducing species somatic species where only germinal ▪ single base substitution in the 3rd base nucleotide position of a
o he determined that the white-eyed mutant was sex-linked based mutation transmits from one mutations are transmitted to codon
on Mendelian's principles of segregation and independent progeny to the next progeny the next generation ▪ results in NO change in amino acid
assortment 4 based on direction of mutation ▪ this occurs when a change of a single DNA nucleotide within
▪ Hermann Joseph Muller concluded that the x-ray exposure caused forward mutation reverse mutation the protein coding portion of the gene does not affect
the lethal mutations in the offspring of the x-ray treated flies occurs in a reverse direction ▪ NOTE: the first two letters of the genetic code are the most
when the mutation occurs
o he also found that mutations occurred in both the male and that is from the mutant allele critical
from the normal or wild type
female flies when exposed to x-rays, indicating that both sexes to the normal or wild type 2 missense mutation
allele to mutant allele
were vulnerable to radiation-induced mutations (1927) allele ▪ single base substitution in 1st or 2nd base nucleotide position
o later on was awarded with a Nobel prize in 1946 (took this from 5 types of trait affected ▪ will result in a change of an amino acid (changing one letter in
wiki too) visible mutation biochemical mutation the sequence)
affects the phenotypic affect the production of ▪ a genetic change involving the substitution of one base in the
LEARNING OUTCOMES
character biochemicals DNA for another which results in the substitution of one amino
▪ Understand the concept of mutations
can be detected by normal does not show any acid in a polypeptide or another
▪ Learn how the DNA structure can change into a new structure and
observation phenotypic character ▪ common example: Sickle Cell Anemia (blood disease): missense
permit a new phenotypic development
mutation at a single point in the DNA
▪ Discuss the mutation types, classification and DNA repairs
TYPES OF MUTATIONS ▪ this mutation cause for a different amino acids and affects the
LECTURE CONTENTS overall shape of the protein produced
GENE MUTATIONS
▪ Classifications of Mutation
point mutation frameshift mutation
▪ Types of Mutation Phenotypic Variation original: The fat cat ate the wee rat
▪ Silent
▪ Factors Causing Mutations ▪ Addition point mutation: The fat hat ate the wee rat
▪ Missense
▪ Repair of DNA Damage ▪ Deletion
▪ Nonsense
w/ ARIC JOSE M.
AIRAH M.
 3 nonsense mutation
▪ single base substitution that yields stop codons
▪ stop codons: UGA, UAA, UAG
▪ there are 3 nonsense codons in a genetic code
▪ change in one nitrogen base in DNA (e.g. albinism)
▪ results in a premature stop codon
▪ in a transcribed mRNA, it results in a truncated incomplete,
unusual, and nonfunctional protein product → yields the stop
codon
Main difference between the two?
missense mutation nonsense mutation
introduces a distinct codon introduces a stop codon to
leading to a nonsynonymous the gene sequence, leading to
amino acid in the polypeptide the premature chain
chain termination
resulting in a conversative and results in a truncated
non-conservative change to incomplete, unusual, and
the protein nonfunctional protein product
both are point mutations or the single nucleotide substitutions
which introduce distinct changes in the ultimate protein product
(a) silent mutation; (b) missense mutation; (c) nonsense mutation
2 Frameshift Mutation
▪ the addition or deletion of 1 or more bases
▪ are due to powerful mutagens; physical or chemical
▪ gene addition or deletion
▪ one or more bases are added or deleted, the equivalent of
inserting or removing letters in a sequence
▪ because our cells read DNA in three-letter words, adding or
removing one letter changes each subsequent word
▪ involves the insertion or deletion of a nucleotide in which the
number of deleted base pairs is not divisible by three (important
because the cell reads a gene in groups of three bases)
▪ each group of three bases corresponds to one of 20 different ③ Beneficial
amino acids used to build a protein ▪ presence of a brain chemical microcephalin (a proposed
▪ if a mutation disrupts this reading frame, the entire DNA mutation) with the human’s development of art, music, and
sequence following the mutation will be read incorrectly complex tool-making practices
▪ what we will see is a premature termination (instead of the II. CHROMOSOME MUTATION
encoded protein having a certain particular size, it will end up Chromosome structure become influenced by:
being shorter and it won’t be able to accomplish its assigned role) ▪ change in amount of genetic information in chromosome
▪ diseases caused by frameshift mutation include Chron’s disease, because of
cystic fibrosis, and some forms of cancer (Miss mentioned this a. deletion b. duplication
during the addition frameshift mutation) ▪ similar amount of genetic information but the materials are
▪ ?DNA meaningless an often results in a shortened protein and rearranged
nonfunctional? a. inversion b. translocation
▪ ’t’ from cat is removed, but we keep the original letter spacing:
deletion loss of chromosomal segment
original: The fat cat ate the wee rat ▪ repetition of chromosomal segment
point mutation: The fat caa tet hew eer at. duplication
▪ gain of segment
▪ ADDITION (INSERTION) MUTATION ▪ a change in the direction of the genetic
▪ DELETION MUTATION inversion material along a single chromosome
▪ reversal of region
▪ a segment of one chromosome becomes
attached to a different chromosome
translocation
▪ simple translocation: one way transfer
▪ reciprocal translocation: two way transfer
1 DUPLICATION
▪ in this mutation, some genes are being duplicated and displayed
twice in the same chromosome
▪ this means that ?it can gain a segment of DNA?
▪ during the insertion of an extra of a copy of region of a
chromosome into a neighboring position
▪ zygotes produced from gametes involving duplications are often
viable and may or may not have any series problems
▪ the various sorts of duplications are related to the color vision
conditions that many of which are quite subtle in their effects
(e.g. certain anemias involving abnormal hemoglobin called the
Thalassemias)
Additional information:
ADVANTAGES AND DISADVANTAGES OF MUTATION
① Neutral
▪ they may have little or no effect on the survival of an
organism or on its ability to reproduce
▪ they may result in the same kind of organisms ?when the?
change still tells the cell to do what it should (there is no
difference)
▪ the average human has 50-100 mutations within the DNA
most, if not all, are neutral or beneficial
▪ bacterial resistance to antibiotics
▪ insecticide resistance in bugs
▪ rapid mutation rates in virus’s proteins allowing them to
adapt to new “hosts”
② Harmful
w/ ARIC JOSE M.
AIRAH M.
▪ Charcot Marie-Tooth Disease is a group of disorders passed TRANSLOCATION INVERSION
down through families that affect the nerves outside the brain chromosomal abnormality
and spine. These are called peripheral nerves. whereby there is a break in a chromosome
▪ some symptoms of this Charcot Marie-Tooth Disease involves particular chromosome in which rearrangement in which a
deformity of the foot, numbness in the foot or legs, ?lapping?, this chromosome will then fuse segment of chromosome is
hitting the foot hard when walking, then later, there are similar into a different chromosome, being reversed end to end
symptoms that may appear on the hands which may include to forming a fusion product
claw like hands occurs when a single
chromosome undergoes
these chromosomal breakage and
translocations are typically seen rearrangement within itself
3 TRANSLOCATION in cases of leukemia (e.g. acute inversions do not include
▪ movement of part of a chromosome to another part of the myeloid leukemia) the centromere and both
genome breaks occur in one arm of
▪ may happen with the same chromosome the chromosome
▪ translocation is an intra-chromosome translocation 5 NONDISJUNCTION
▪ other translocations involve transfer of a region of a ▪ failure of chromosome to separate in meiosis
problems in at least 40 genes cause different forms of this disease chromosome to a non-homologous chromosome ▪ causes gamete to have too many or too few chromosomes
2 DELETION o e.g. certain types of Down syndrome involve translocations
▪ disorders:
▪ deletions result when a gene is between chromosome 14 and chromosome 21 o Down Syndrome: three 21st chromosomes
mistakenly removed from a o this type of translocation between non-homologous o Turner Syndrome: single X chromosome
chromosome, as a result of chromosome is called an inter-chromosomal translocation o Klinefelter Syndrome: XXY
unequal crossing over 4 INVERSION
▪ based on the figure shown ▪ inversions happen when a whole region of genes on a
below, often times, zygotes chromosome gets flipped around
produced by gametes involving
TWO TYPES OF INVERSIONS
deletion are not viable since
paracentric inversions pericentric inversions
they do not have the full
the centromere is not
complement of the genes
included in the inversion
base on the images below: the centromere is involved in
include the centromere and
▪ first image: this results from a the inversion
there is a break point in each
very rare mutation, caused by arm
the loss or deletion of a
significant portion of the ▪ these types of inversions lead to abnormalities in crossing over
genetic material from the and meiosis resulting in some chromosomes which are not viable
chromosome number 5 which is vital to the cell growth while others are viable but have new combinations of genes
▪ the ?cry? is caused by an abnormal development of the child’s ▪ these sorts of inversions are thus important in reshuffling genes
on a chromosome This is just a summary of the chromosome mutation.
larynx
loss of a few bases, loss of large regions
DELETION
of chromosome
duplication of a large region of a
DUPLICATION
chromosome
the transfer or movement of a
TRANSLOCATION chromosome fragment to a non-
homologous chromosome
the order of genes in chromosome is
INVERSION
being inverted
III. GENOME MUTATION
a. Aneuploidy c. Autopolyploidy
b. Polyploidy d. Allopolyploidy
▪ normal organism is euploid with exact chromosome number that
is multiple of chromosome set (2n)

w/ ARIC JOSE M.
AIRAH M.
▪ e.g. Drosophila melanogaster normally with 8 chromosomes. The
species is diploid, having two sets of 4 chromosomes each.
▪ the rare occasion where abnormal fruit fly reproduce 12
chromosome containing 4 chromosomes each, so these
alteration is called the triploid fruit fly with 12 chromosomes
Chromosome vary in 2 ways:
POLYPLOID ANEUPLOID
an increase in the number of
abnormal number of
the complete sets of
chromosome within a set
chromosome
in animals and plants variations are less common
III.A CHANGE IN CHROMOSOME NUMBER
1 ANEUPLOIDY
▪ normally 2N (haploid individual) cells ends up either with extra
copies of homologous chromosomes or fewer than the normal
2 POLYPLOIDY
diploid number
▪ 3N/sets or more of chromosomes in a nucleus
▪ happens when homologous chromosomes fail to segregate
▪ can happen because of a failure of the spindle fibers in mitosis or
properly during meiosis (nondisjunction)
Edwards Trisomy 18 meiosis to segregate chromosomes into separate groups
▪ the monosomy in which the deployed individual has only one
▪ a genetic disorder ▪ these polyploid populations are often effectively reproductively
member of a certain homologous chromosome,
caused by a presence isolated from the parent species and thus can be considered
▪ the other common type of aneuploidy is called trisomer because
of a third copy of the species in their own right
the individual has 3 copies of the particular chromosome
?whole part? of ▪ examples:
chromosome 18 o plant species and some fish and amphibians
▪ many parts of the body o domestic wheat is hexaploid (6N)
are being affected o seedless plants are usually triploid (3N)
▪ babies are often born ▪ individuals with triploid syndrome have three of every
small and have heart chromosome for a total of 69 rather than the normal 46
defects chromosomes
▪ babies with triploid syndrome usually are lost through early
miscarriage, however some infants have been born and survived
as long as 5 months
“XYY” Jacob’s Syndrome Men o affected infants are usually small and have multiple birth
▪ a genetic condition that occurs when a male has an extra copy of defects,
a Y chromosome in each of their cells o those that survived are usually (??) meaning that some cells
▪ sometimes, this mutation is only present in some cells have the normal number of 46 chromosome and some cells
▪ males with XYY syndrome has 47 chromosomes because of the have a complete extra set of chromosomes
▪ aneuploidy involving the sex chromosomes is common
extra Y chromosome 3 AUTOPOLYPLOIDY
▪ XYY males are normal but XXY males and XXXY males have a
▪ usually they are taller than the average, but typically causses no ▪ a polyploidy in which all the chromosomes originate from the
syndrome called Klinefelter syndrome
unusual physical features same diploid parent species
▪ this aneuploidy leads to a number of syndromes in humans (e.g.
▪ most have normal sexual development and able to father ▪ domestic banana and various seedless plants are often triploid
Trisomy 21 [Down] Syndrome) characterized by mental
children autopolyploids
retardation and other abnormalities
▪ associative risk of learning disabilities 4 ALLOPOLYPLOIDY
▪ these males are often actually intersex or hermaphroditic partially
▪ are also delayed development of speech and language skills ▪ a polyploidy in which sets of chromosomes are form different
developed sex organs of both genders (these individuals are
▪ a small percentage of men with 47 or XYY syndrome are species
sterile: Klinefelter Syndrome sterile) and are often subjected to
diagnosed with an autistic spectrum disorders and which are real ▪ usually hybrid plants (N1 + N2) from such crosses are not fertile
hormones or surgery to bring them in conformance to social
development conditions that affect communication and social since proper pairing of chromosomes does not occur in meiosis
gender roles
interaction ▪ sometimes, the chromosome numbers continuously give a
double (???) to tissue within two N1 plus two N2
o if this tissue is germ tissue, now this tissue that can give rise to
a haploid tissue by a meiosis
o the result can be gametes chromosome complements

w/ ARIC JOSE M.
AIRAH M.
 o when the two of these gametes fuse, the result is the
alloplooidy plant with a viable chromosome complement, the
two N1 plus two N2
FACTORS THAT CAUSES/CONTRIBUTES TO MUTATION
① Error in DNA replication
▪ When replication errors become mutations, incorrectly paired
nucleotides would still remain following this match ?repair?
become permanent mutation. After the next cell division, this is
because once such mistakes are established, the cell no longer
recognizes them as errors.
▪ There are also other causes of mutation (e.g. spontaneous
mutation) which could also result in abnormalities in biological
processes, underlying cause lies within the cell induced mutation
caused by environmental agents, and causes of spontaneous
mutation (there are different abnormalities in crossing over, then,
a very aberrant segregation of chromosome during the meiosis,
and there are mistakes by DNA polymerase during replication)
② Damaging effects of mutagens
▪ chemicals: alkylating agents (e.g. nitrosoguanidine, nitrosamine)
▪ radiations: X-rays, U.V rays, etc.
▪ chemical mutagens: used in research to study mutagenesis;
there are three kinds of chemical mutagens:
o alkylating agents
o intercalating agents
o physical mutagens
o base analogs
Note that there are common causes of mutation, these are additional
to the factors that may contribute to the mutation.
▪ aberrant recombination: could also cause abnormal crossing over
may cause deletion, duplication, translocation, and inversions
▪ aberrant segregation: could lead to the abnormal chromosomal
segregation that may cause the aneuploidy or dipolyploidy
▪ errors in DNA replication that the mistake by DNA polymerase
may cause a point mutation
▪ toxic metabolic products which could cause products of a normal
metabolic processes may be chemically reactive agents that can
alter the structure of the DNA
▪ the transposable elements can insert themselves in the sequence
of genes
▪ depurination which is a rare occasion: the linkage between the
pairings and deoxyribose trans spontaneously break if not repaired,
can lead to mutation also
▪ deamination: when cytosine and 5-methylcystosine trans
spontaneously deaminate to create a ?uracyl or thymine?
▪ tautomeric shifts: spontaneous changes in base structure can
cause mutation and can occur immediately prior to DNA replication
▪ induced chemical agents: chemical substances may cause changes
in the structure of DNA such as the nitrosoguanidine and the
nitrosamine
▪ physical agents: UV lights and x-ray, damages the DNA
CHEMICAL MUTAGENS: used in research to study mutagenesis; there cause certain diseases (e.g. cancer). Mutagens could include the
are three kinds of chemical mutagens: radioactive substances, x-ray, UV radiation, or certain chemicals.
THREE KINDS OF CHEMICAL MUTAGENS DNA REPAIR
1 alkylating agents
TYPES OF REPAIR
▪ for the alkylating agents adds a little group, the methyl group,
DIMER REPAIR OTHER TYPES
the result in this pair basis and DNA replication
▪ the pairing with wrong basis in a methyl group bond with
▪ Methylases
▪ Direct Repair
guanine would pair with thymine instead of cytosine ▪ Light repair
▪ Base excision and nucleotide excision repair
▪ example: formalin, nitrogen, ethylene oxide ▪ Dark repair
▪ Mismatch repair
▪ NOTE: the most commonly used chemical mutagens are the
▪ Recombinational repair
alkylating agents (e.g. ethylmethyl sulfonate, N-methyl-N-
nitrosuria) that induce point mutations in the DNA LIGHT REPAIR
2 intercalating agents
▪ these agents insert into the DNA and pushes bases apart
▪ example is lactosine which is a type of chemical produced by
peanut and molds
▪ the mold is Aspergillus flavus or the fungus, causing the
frameshift mutation
▪ example of this is the benzopyrine (from smoke causing
frameshift mutation)
3 physical mutagens?
4 base analogs
▪ basically mimics the nitrogen base DARK REPAIR
▪ substitution of a base analog will result to an altered base pairing ▪ nucleotide excision
and structural changes that may affect the DNA replication and
▪ repair mutation from any causes including dimer
transcription of genes
▪ the enzyme will cut off the incorrect bases and fill it with newly
▪ since (???) can pair with either adenine or guanine, it also affects
synthesized DNA
the base paring during the DNA replications that may lead to
▪ the enzyme occur in either present or absent of light
mutation
METHYLASES
▪ because they often have different base pairing roles that the
▪ discovered by Hamilton Smith
bases they replace, other chemical mutagens can modify DNA
▪ the methylases will bound with all normal bases that following
basis which may result to different base pairing roles
the parents strands
▪ example: nitrose acid deaminates cytosine converting it into
▪ endonuclease then cut the bases that does not have the
uracyl → this uracyl then pairs with adenine in the subsequent methylases bond
round of replication, thus, resulting in the conversion of a
So how the abnormal DNA sequences that does not obviously show
guanine-cytosine base pair to an adenine-thymine base pairs
the different dimers can be detected? How does methylation affect
PHYSICAL MUTAGENS DNA?
▪ DNA methylation is a biological process by which methyl groups
1 non-ionizing radiation
are being added to the DNA molecules
▪ causes the formation of T=T dimers. UV light @ 260
▪ this methylation process can change the activity of a DNA
▪ affecting formation harmful covalent bonds between pyrimidine
segment without changing the sequence
(T and C)
▪ when located in the gene promoter, DNA methylation physically
▪ forming gap in DNA strand= no paring, no replication = cell
acts to repress gene transcription
death
DIRECT REPAIR
2 ionizing radiation
an enzyme recognizes an incorrect alteration in DNA structure and
▪ damages DNA by causing formation of “free radicals” leading to
directly converts it back to a correct structure
mutations
BASE EXCISION AND NUCLEOTIDE EXCISION REPAIR
▪ e.g. x-rays
▪ during this repair, an abnormal nucleotide or base is first
o gamma rays from radioactive fallout penetrates the body
recognized and removed from the DNA
o alpha rays from inhaled dust containing radioactive fallout
▪ a segment of DNA in this region is being excised
▪ NOTE: Anything that causes a mutation could change the DNA
of a cell. DNA changes caused by mutagens may harm cells and
w/ ARIC JOSE M.
AIRAH M.
 ▪ then, the complementary DNA strand is used as a template to
synthesize a normal DNA strand
MISMATCH REPAIR
▪ this is similar to excision repair except that the DNA defect is a
base pair mismatch in the DNA, not an abnormal nucleotide
▪ the mismatch is recognized and a segment of DNA in this region
is removed
▪ the parental strand is used to synthesize the normal daughter
strand of the DNA
RECOMBINATIONAL REPAIR
▪ occurs when the DNA damage causes a gap in synthesis during
DNA replication
▪ the gap of is being exchanged between the abnormal DNA, and
their corresponding region in the normal replicated double helix
▪ after this occurs, it is possible to fill in the gap using the
complementary DNA strand
additional: there is an inexpensive method that uses ?oxothropic?
bacteria to measure the mutagenicity of a chemical compound

READING ASSIGNMENT
▪ What are the characteristics of mutation?
▪ What mutation is used as an indicator of mutation rate in the Ames
test?
▪ Why can the Ames test work as a test for carcinogenicity?

REFERENCE
Klug,W.S,Cummings M.R., Spencer,C.A., Paliadino, M.A. (2006),
Concepts of Genetics, 9th Ed.pp 198-218

w/ ARIC JOSE M.
AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS
TOPIC 7: MOLECULAR TESTING ON GENETIC DISORDERS
Lecturer: Ms. Jia Adelle P. Relamoagos
▪ according to the National Human Genome Research
Institute, it is a disease causing whole or impart by
change in the DNA sequence away from the normal
genetic sequence
disorder ▪ can be caused by mutation or in one gene or by
mutation in multiple genes or by the combination of
gene mutation and environmental factors or it could
be damage to chromosomes
▪ generally used to confirm or rule out a suspected
genetic disorder
▪ helps to determine the possibility of developing or
genetic passing on a genetic disorder by individual at some
test stage in life
▪ currently, there are thousands of genetic tests
available for use, and newer ones are being developed
rapidly
LEARNING OUTCOMES:
▪ to understand the importance of molecular testing
▪ to learn the different molecular testing on genetic disorders
▪ to know the application of different molecular testing
SIGNIFICANCE
What could be the significance of having molecular testing and molecular
disorders?
it could predict the probability of disease of asymptomatic at risk
1 better information for the pros and cons for the test and in discussing
persons
it could also detect carriers of hereditable disorders and diagnose
2
genetic disease prenatally
3 opportunity to help educate family members about potential risks
4 relevant for the patient’s relatives as well as the patient him/herself
used solely for personal decision making rather than for directing
5 treated early in life
medical care
MOLECULAR GENETIC TESTING
▪ the analysis of chromosomes, either DNA, RNA, or proteins or certain
analytes, in order to detect alterations related to a heritable disease
disorders
▪ an increasingly useful, cause-effective, sensitive, noninvasive tool that
allows clinicians to establish the cause of the disease in symptomatic
persons, predicts the probability of disease in asymptomatic person,
and detect carriers of hereditable disorders and diagnose genetic
disease prenatally
▪ clinical use: relies upon the availability of test methods that allow
accurate detection of mutations
▪ there could be a technical skill(s) of the lab in performing the test, the
clinical knowledge of the healthcare professional in understanding
the application of their test results, and the interest of the patient in
the result
▪ fun fact: Did you know that chromosome analysis (commonly called
as karyotyping) was first introduced as the clinical tool in the year
1960s and has been progressively defined to allow greater detection
rates in abnormalities using a variety of staining techniques (e.g. G ▪ in many cases, this is used to confirm a diagnosis when a particular
and R bonding). condition is based on its clinical signs and symptoms
▪ chromosomes’ elongation (e.g. high resolution studies and FISH ▪ this test can be performed before birth or anytime during a person’s
[fluorescence in situ hybridization]) life, however, it is not available for all genetic conditions
▪ the analysis of the proteins as classically been either through protein ▪ the result of this test can influence an individual’s choice about
detection (e.g. electrophoresis, immunohistochemistry) and the healthcare and the management of a disorder
quantitation or the serum concentration of a hormone or 3 CARRIER TESTING
quantitation of the enzyme activity ▪ identify people who carry one copy of a gene mutation that, when
▪ as of December 2003, molecular genetic testing is offered in non- present in two copies, causes a genetic disorder (e.g. cystic fibrosis)
clinical bases for over 658 inherited disorders by hundreds of ▪ offered to individuals who have a family history of genetic disorder
international laboratories and to people in certain ethnic groups with an increased risk of
▪ molecular genetic testing fits the traditional molecular model when specific genetic conditions
used for diagnosis, predictive testing in populations straining for ▪ example: if both parents are tested and the test can provide
disorders in which early detection of at risk individuals allows medical information about a couple’s risk of having a child with genetic
intervention to reduce morbidity and mortality condition (e.g. cystic fibrosis transmembrane conductance regulator
▪ molecular genetic testing fits a distinctly non-medical model when or CFTR gene mutation from each parent)
used to part a genetic status, solely to facilitate personal decision o people who have only one copy of CFTR are called CF carriers
making (e.g. predictive testing when no treatment exist, care ▪ this test is used to identify people who carry one copy of a gene
detection for autosomal recessive and also the X-linked disorders and mutation that, when present with two copies, can lead to a genetic
prenatal diagnoses) disorder
▪ molecular genetic testing is context of specific and time-sensitive
when two people who are
▪ before recommending a test, the clinician must understand the when one parent has CF and one
carriers have a child, there is a
reason for requesting the test at that time parent is a carrier, there is a 50%
25% chance of having a child
▪ molecular testing differs from traditional, molecular, or medical chance of having a child with CF
with CF
testing in two ways: significance #’s 4 and 5
▪ genetic testing is voluntary because testing has benefits and
limitations
▪ the decision about whether to be tested is a personal & complex one
▪ the geneticist or genetic counselor or a professional can help provide
the social and emotional aspects of the test
TYPES OF GENETIC TESTS
1 NEWBORN SCREENING
▪ is used just after birth to identify the genetic disorders that can be
▪ millions of babies are tested each year in the US, all states are
currently testing infants for phenylketonuria (a genetic disorder that 4 PRENATAL TESTING
causes intellectual disability when left untreated), congenital ▪ is used to detect changes in a fetus’ genes or chromosomes before
hypothyroidism (disorder of the thyroid gland), and other genetic birth
disorders ▪ this type of testing is being offered during pregnancy if there is an
▪ these tests are done on a small blood sample which is being taken by increased risk that the baby will have a genetic or chromosomal
pricking the baby’s heel disorder
▪ unlike other types of genetic testing, the parent will only receive the
result when it yields a positive result
▪ if the test is positive, there will be additional testing needed to
determine whether the infant has a genetic disorder
▪ before a person does a genetic test, it is important that he/she
understands the testing procedure
▪ the benefits and limitations of the test, the possible consequences of
the test results: the process of educating a person about the test and
obtaining permission is called informed consent (necessary for
individual’s education)
2 DIAGNOSTIC TESTING
▪ used to identify or rule out a specific genetic or chromosomal
condition
AIRAH M.
▪ in some cases, this test can lessen a couple’s uncertainty or help them
make decisions about a certain pregnancy if they cannot identify all
possible inherited disorders and birth defects
▪ there are different types of prenatal testing:
o blood/saliva test
o urine test
o ultrasounds (e.g. translucency)
o amniocentesis
o chorionic villus sampling
o percutaneous umbilical blood sampling
5 PRE-IMPLANTATION TESTING
▪ germline mutations that are present at conception and have phenotypic
▪ also called as the pre-
implantation genetic diagnosis
▪ somatic mutations that arise after conception are the basis of certain
(PGD)
▪ this is a specialized technique
that can reduce the risk of having
a child with a particular genetic or
chromosomal disorder
▪ being used to detect genetic changes in embryos that were created
using assisted reproductive technique (e.g. in vitro fertilization:
involves the removal of woman’s egg cells and fertilizing them with
egg cells outside the body)
▪ to perform this test, a small number of cells (as seen on the image)
are taken from these embryos and tested for certain genetic changes
▪ only embryos without these changes are implanted in the uterus to
initiate pregnancy
6 PREDICTIVE AND PRE-SYMPTOMATIC TESTING
▪ a bit more complicated than diagnostic testing
▪ this test happens when people who know they may be at risk for
Huntington’s disease (HD), however, they do not have symptoms at
the time of testing to learn whether they will get HD in their lifetime
▪ HD is a progressive brain disorder caused by a defective gene which
causes changes in the central area of the brain, affecting the
movement, mood, and thinking skills of an individual
▪ used to detect gene mutations associated with disorders that appear
after birth, often later in life
▪ these tests are really helpful to people who have family members with
a genetic disorder but does not present clinical features of the
disorders themselves at the time of testing
▪ this test can identify mutations that increase a person’s risk of
developing disorders with a genetic basis and certain types of cancers
as well
▪ this test can determine whether a person will develop a genetic
disorder (e.g. hereditary hemochromatosis, iron overload disorder)
before any signs and symptoms appear
▪ the results of this test can provide information about a person’s risk
of developing a specific disorder and may help with making decisions
about medical care
INHERITED DISORDERS
▪ steps: it will digest the DNA with an appropriate restriction enzyme
effects, implications for reproduction, or both
→ run the digested DNA on the agarose gel → denature the DNA
(usually while still on the gel) → the transfer of the denatured DNA to
acquired disorders (e.g. cancer)
the membrane, a probe of the specific membrane will label the ssDNA
MOLECULAR GENETIC TESTING METHODS and visualize the radioactively labelled target sequence (if we use:)
1 DIRECT TESTING o radiolabeled 32P chrome, we visualize with autoradiograph
these three are described on the next table o a biotin detection is done by colorimetric methods
▪ mutation analysis o bioluminescent visualization uses luminescence
▪ mutation scanning (screening)
▪ sequence analysis (sequencing)
▪ this test allows the detection of mutations, the positive identification
of disease-causing genetic alterations that established a person’s
genetic status independent of the knowledge of patient history, or
the risk status
2 INDIRECT TESTING
▪ relies on linkage analysis in which the DNA sequences serve as
markers to track a gene mutation within a family in which at least two
members are affected
▪ used when direct DNA analysis is not possible because the gene is
not known
▪ when used in this manner, the linkage analysis can determine the
genetic status of an asymptomatic person only within the context of
a highly-structured study of family DNA samples and absolute
certainty of the correct clinical diagnosis in the family
▪ this analysis can also be used as an adjunct in prenatal testing in
disorders in which complex gene arrangements, often involving an
adjacent pseudogene, complicate the interpretation of the direct
DNA test results
DIRECT TESTING 2 MUTATION SCANNING
1 MUTATION ANALYSIS ▪ identify variant gene regions, which are
▪ sickle cell anemia or set of known mutations using a panel of common further analyzed, typically by sequence
mutations (e.g. cystic fibrosis carrier detection) analysis
▪ Southern blot analysis to detect large deletions (e.g. ▪ identify the sequence alteration
dystrophinopathies, muscular dystrophy, Becker dystrophy, large ▪ is a two-step process in which a DNA
trinucleotide repeat expansions [e.g. myotonic dystrophy]) segment is being screened via one of a
▪ to simplify this analysis: DNA molecules are transferred from an variety of techniques (e.g. single strand
agarose gel onto a membrane, then southern blotting is designed to confirmational or polymorphism,
locate a particular sequence of DNA within a complex mixture denaturing gradient gel electrophoresis, denaturing gradient high
Southern Blotting Technique pressure liquid chromatography)
▪ can be used to locate a particular gene within an entire genome ▪ mutation scanning is often used when mutations are distributed
▪ NOTE: the amount of DNA needed for this technique is dependent throughout the gene
on the size and specific activity of the probe ▪ when most families have different mutations and when sequence
▪ short probes tend to be more specific under optimal conditions analysis will be excessively time consuming due to the size of a given
gene, then denaturing gradient gel electrophoresis (DGGE), which
AIRAH M.
 is used in mutation scanning, is a technique used to separate short to
medium DNA fragments based on their melting characteristics
o this has been used frequently for identifying single nucleotide
polymorphisms without the need for DNA sequencing and as a
molecular fingerprint method for complex ecosystem
communities, particularly in conjunction with the amplification of
microbial 16S rRNA genes
3 SEQUENCE ANALYSIS
▪ nucleotide sequence is determined for a segment of DNA that may
be an entire gene or a portion of a gene (e.g. select exons in which
mutations are known to a cluster)
▪ this is considered as the gold standard molecular genetic test by
many interpretation of the significance of a sequence alteration may
not be straightforward, likewise, a failure to detect sequence
alternation may not indicate the absence of a disease-causing
mutation in that gene
▪ once a disease-causing mutation is identified (by whatever test
method) in one affected family member, others at risk in the family
need only to be tested by mutation analysis for the family as specific
mutation (it could be the mutation that has been detected in the
affected relative)
▪ however, the need to identify the family’s specific mutation in an
affected family member first before testing the at-risk relatives is a
testing paradigm foreign to many non-geneticists
▪ if the family specific mutation is not known, there is a failure to detect
a mutation in an at-risk relative and this is not informative because
one cannot distinguish between the true absence of a disease-
causing mutation and the failure to detect this mutation due to either
the limitations of the test method employed or the testing of the
wrong gene
GENETIC TESTING PARADIGMS
1 DIAGNOSTIC TESTING
▪ in the evaluation of patients and their families, genetic testing
information can be used in medical testing paradigm and genetic
counseling paradigm or can be both
▪ in medical testing paradigm, genetic tests provide patients and their
physicians with information that directly influences the medical care
▪ diagnostic testing establishes or confirms a diagnosis in a particular
symptomatic person
2 PREDICTIVE TESTING
▪ is used to identify a disease-causing gene alteration known to be
present in the family and at-risk asymptomatic relatives to clarify their
genetic status
▪ however, some further categorizes this testing as pre-symptomatic testing be used in relatives at risk. This concept is schematically
when it is certain that all persons who have the altered gene will presented in the figure above.
become symptomatic and as pre-dispositional when penetrance of ▪ Experts say that genetic testing has proven to be a valuable and widely
the mutation is being reduced and <100% of persons with the altered used tool in patient’s care, spanning patient’s need from diagnosis to
gene will be affected pre-symptomatic diagnosis, for the purpose of initiating interventions
that reduce the morbidity and mortality to reproductive decision making.
SIGNIFICANCE ▪ Those with futuristic ?bent? have tended to overlook the present
GENETIC EVALUATION GENETIC COUNSELING availability of advantages of molecular genetic testing and focused on
process of information which does not exist.
process of educating patients about
gathering on a patient or ▪ Gene therapy could be individualized medicine of pharmacogenetics
the nature and cause of the inherited
family with a known or and routine population screening for inherited susceptibility to common
disorder
suspected genetic disorder diseases.
conveying the genetic risks, providing
establishing a diagnosis the information for informed medical
through physical examination and personal decision making, offering
and genetic testing and a psychosocial support, and referring
performing risk assessment geographically dispersed at-risk family
members to local genetic services
GENETIC TESTING INFORMATION RESOURCE: GENETESTS
RISKS
EMOTIONAL: people may feel angry, depressed, anxious, or even guilty
about the results
SOCIAL: in some cases, genetic testing creates tension within a family
because the results can reveal information about other family members
in addition to the person who is tested
FINANCIAL CONSEQUENCES: the possibility of genetic discrimination
in employment or insurance is also a concern
▪ a very accessible (open access) tool for you to get genetic testing
▪ Experts suggest that there should be a population screening in order
information resource
to determine the genetic susceptibility for common diseases and
▪ many inherited disorders molecular genetic testing is not available at all
adequate population studies to determine the positive, predictive
because the causative gene(s) is not known
▪ in other instances, the gene is known but the test sensitivity is less than value of such will just be a beginning because medical, dietary, and
environmental interventions to reduce the risk of disease
that of the clinical evaluation or high cause on low volume preclude the
development will also be in early stages of investigation.
development of a clinical test
▪ when family implemented, the healthcare professionals will become
▪ in these instances, testing may only be conducted in a research context
the mainstay of this system
▪ due to the speed of new gene discovery and the rapid transition of
▪ in order to promote the use of molecular genetic testing for inherited
testing from research lab to clinical practice, clinicians, professionals, or
disorders for cascade screening among primary care providers,
researchers need an easily accessible, centralized, & continuously
standard of care need to be changed to include this paradigm and
updated genetic testing information resource
the current complexities will need to be minimize through more
▪ GeneTest is a website funded by the US National Institute of Health (NIH)
standardized tests, ordering and results, reporting and improve the
and the other federal agencies and maintain at the University of
reimbursement of testing of post-index cases and at-risk relatives
Washington is designed to facilitate awareness of test availability & use
▪ GeneTest is highly regarded by medical professionals REFERENCES
refer to image below:
▪ Genetic testing paradigms maybe foreign to some professionals and
third-party players. So, in order to test at-risk relatives, the disease-
causing mutation must first be identified in a family member who has
that disease. Only when the exact family-specific mutation is known can
AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS EXAMPLES OF MOLECULAR DIAGNOSTICS IN CANCER o it is important to note that not everyone with a mutation in the
TOPIC 8: MOLECULAR DIAGNOSTICS IN CANCER TEST ASSOCIATED HEALTH CONDITION(s) BRCA1 and BRCA2 gene will get cancer
Lecturer: Sir Jerome Mantal, CSE, MSCI (c) human papilloma virus ▪ moreover, many people diagnosed with breast cancer do not have
cervical cancer
cricket noises on these video timestamps, will edit again if Sir will reply… (HPV) either of these mutations wherein preventive surgery may not be the
▪ 03:25 ▪ 26:12-29:23 ▪ 58:52-1:00:55 BRCA1 and BRCA2 best choice for these individuals
breast, ovarian, and cervical cancers since we have alternatives to preventive surgery, which are available,
▪ 05:00-05:35 ▪ 32:55-36:40 ▪ 1:06:17-1:07:50 genes ▪
▪ 09:12-17:12 ▪ 37:42-39:24 ▪ 1:15:33-1:17:22 CA125 protein ovarian cancer individuals discuss their options with their family and physician prior
▪ 21:32-24:02 ▪ 40:25-43:58 to making a decision
prostate specific
CANCER is a disease that results from genetic changes (changes in the prostate cancer 2 DIAGNOSIS
antigen (PSA)
patient's DNA, to be specific) HER2/neu gene breast cancer ▪ differential diagnosis helps differentiate cancer from benign tumors
▪ understanding the genetic changes that takes place in cancer allow us to DNA mismatch repair ▪ molecular diagnostics can even help classify different cancer subtypes
understand the disease genes that affect the same issue
▪ as technology improves, it is easier or less expensive to identify the exact Lynch syndrome (colon cancer) ▪ in this analysis, it may help estimate the aggressiveness of the cancer
(MSH2, MLH1, MSH6,
changes that have occurred in any particular cancer patient PSM2) in general
▪ the development of new targeted drugs means that knowing the exact acute myelogenous leukemia and GIST 3 PROGNOSIS
genetic changes in any given patient is increasingly important in KIT gene ▪ if you have cancer, you may have questions about how serious your
tumors of the gastrointestinal tract
determining the right treatments for that individual EGFR, ALK, and KRAS cancer is and your chances of survival: these estimates of how this will
▪ the tests currently available are designed to predict how likely a lung cancer go for you is called prognosis
genes
particular cancer is to respond to a chemotherapy drug or how likely it ▪ some cancers are naturally more aggressive than others, and knowing
Molecular diagnostics are most commonly conducted on samples of
is to come back or recur after it's been removed this may help patients and physician determine which treatment to
blood, saliva, or tumor tissue.
PRECISION MEDICINE AND MOLECULAR DIAGNOSTICS ▪ to determine an accurate result out of the sample, doctors or select
▪ precision medicine in etiology aims to improve the length and quality researchers commonly use tumor issues or blood samples ▪ molecular diagnostics can also be used to evaluate the likelihood that
of life of the patients by selecting treatment based on biological an existing cancer will recur after treatment: this is actually another
HOW ARE MOLECULAR DIAGNOSTICS USED? aspect of prognosis
understanding of their cancer
▪ molecular diagnostics can be used to select therapy based on CLINICAL USES OF MOLECULAR DIAGNOSTICS ▪ several molecular diagnostics are available to predict the likelihood
biomarkers identified from a tumor genome, transcriptome, or proteome risk assessment Am I at increased risk for cancer? of breast cancer, for example, or any cancer types recurrence in
▪ researchers anticipate the integration of this information that will Do I have cancer? What type of cancer do I women with early stage (or not negative, estrogen receptor positive,
diagnosis invasive breast cancer who will be treated with hormone therapy)
provide a more detailed molecular picture of tumors and improve the have?
likelihood that patients will benefit from the treatment prognosis What is the expected course of my cancer? ▪ these tests examine multiple genes and cells obtained from one
▪ molecular diagnostics are part of the “personalized or precision sample of the breast tumor
predicting
Will my cancer respond to medication?
medicine” in revolution of healthcare system treatment response GENES, PROTEINS, AND CHROMOSOMES: THE “MOLECULAR” IN
▪ doctors have been trying to deliver personalized medicine for centuries Should I receive a normal or lower dose or MOLECULAR DIAGNOSTICS
pharmacokinetics
but the ability to do so is becoming more precise with improved none at all? ▪ molecular diagnostic tests will not be made possible without
diagnostics and therapeutic tools monitoring How is my cancer responding to this understanding the molecular features of the disease
▪ the term “precision medicine” is now being used to refer to a relatively treatment response treatment? ▪ abnormal cell types will be determined if we have referenced normal cell
new and evolving field that provides important information that can be monitoring types
used to select the best treatment for each patient Has my cancer come back?
recurrence ▪ we have to know the normal regulation or functions of our genes,
▪ the information of precision medicines come from DNA, RNA, proteins, chromosomes, and proteins so that we can determine what are the
▪ molecular diagnostics and precision medicines are changing the face of
or related molecules specific molecular characteristics that change within our body
medicine
▪ the tests that detect these molecules, molecular diagnostics are ▪ e.g. in cancers, such as Wilm’s tumor and retinoblastoma, gene deletions
▪ although we are still at an early stage of the game, molecular diagnostics
fundamental components of precision medicine or activations are responsible for initiating cancer progression
undoubtedly will play an ever increasing role in cancer medicine and for
PERSONALIZED MEDICINE ▪ in fact, inactivation of tumor suppressor genes is associated with many
the foreseeable future
types of cancers as chromosomal regions associated with tumor
healthcare professionals use information from a variety of sources to ▪ we will only discuss three of these clinical uses which are risk
suppressors are commonly deleted or mutated
provide care tailored to each individual patient assessment, diagnosis, and prognosis
▪ biochemical disease characteristics
1 RISK ASSESSMENT
▪ evidence-based medicine: integrating best available research
▪ done through molecular profiling and help a person determine how
evidence with clinical expertise and patient values
likely he or she is to develop cancer
▪ physician knowledge and experience
▪ can also be used to help decide whether a person should undergo
▪ precision medicine: information about DNA, RNA, or related
more intensive screening or just take preventive measures
molecules associated with health or disease
▪ e.g. the case of Angelina Jolie, which uses blood to test BRCA1 and
▪ patient history, other health conditions, treatment preferences
BRCA2 gene types mutation: changes of these genes will result into
increasing risk of breast cancer and several types of cancer cells
o Angelina Jolie has BRCA1 mutations and, in fact, she publicly
acknowledged that one and their potential to cause cancer

AIRAH M.
 MOLECULAR BIOMARKERS IN CANCER CHROMOSOMAL ALTERATIONS AS BIOMARKERS IN CANCER o a targeted therapy known as crizotinib has been developed to
▪ cancers arise from an accumulation of genetic or epigenetic changes that inhibit the excessive protein produced by ALK overactivity and may
THE PHILADELPHIA CHROMOSOME AND BCR-ABL GENE
result in alterations of the proteins expressed in the affected cells be useful for people with non-small cell lung cancer, whose tumor
▪ the levels of specific proteins can be increased or decreased, or their is positive for the ALK fusion gene
function and distributions are altered by post-translational modifications 2 CHROMOSOME INVERSION
▪ these protein alterations can affect cell metabolism and physiology, cell
growth, and death, and secretion of molecules that signal other cells and
tissues
▪ in cancer research, molecular biomarkers referred to substances that the end-to-end switching of a portion of DNA
are indicative of the presence of cancer in the body within the same chromosome
o biomarkers include genes and genetic variations, differences in
messenger RNA or protein expressions, post-translational
modifications of proteins and metabolite levels
o as the molecular changes that occur during tumor progression takes 3 GENE AMPLIFICATION
place over a number of years, genomic, proteomic, and metabolomic ▪ also called as “copy number
biomarkers can also be potentially used to detect cancer that variation”, “chromosomal
determine prognosis and monitor disease progression and ▪ specific alterations in chromosomes can be biomarkers for cancer duplication”, or “gene duplication”
therapeutic response ▪ usually, these chromosomal alterations are not only biomarkers but ▪ includes deletions or loss of part of a
o molecular biomarkers are basically certain alterations in also are the underlying cause of the cancer chromosome and amplifications in
chromosomes DNA, RNA, proteins, and related molecules that have ▪ one example is the Philadelphia chromosome which is one of the which a part of the chromosome is
the potential to cause cancer or other diseases: when such alterations most well-known chromosomal alterations in cancer duplicated
are linked with a particular state of disease or health, they are known o these chromosomes occur when genetic materials from ▪ this is where a piece of DNA is abnormally copied one or more times
as molecular biomarkers chromosome 9 swap places with genetic material of chromosome ▪ duplication in parts of a gene may cause too many copies of the
22 (a process known as translocation) protein to be made, which can then cause over activity
are alternations in chromosomes, DNA, RNA,
molecular o the combined genetic on chromosome 22 creates a cancer- ▪ this is the case for certain breast cancers that are termed HER2 (+)
proteins, and related molecules that indicate a
biomarkers causing gene known as BCR ABL (these genes contain the (known as human epidermal growth factor: a protein that normally
particular biological condition (e.g. cancer)
instructions to make an abnormal protein that causes leukemia: helps cell growth)
the abnormal protein is similar to our normal proteins except that
it cannot chop itself off) EXAMPLES OF TUMOR SUPPRESSOR GENES
molecular alterations can be inherited or GENE ASSOCIATED HEALTH CONDITION(s)
molecular diagnostics that test for the presence of the Philadelphia
acquired Li-Fraumeni syndrome (increased risk for
chromosome can be done in several ways P53
multiple cancer types)
▪ one of the most common methods is to determine whether the RNA
BRCA1 and BRCA2
sequence where the fusion protein is present in person's blood breast, ovarian, and cervical cancers
genes
▪ these molecular diagnostic methods can be accounted with the
▪ molecular alterations can be inherited or passed on from one generation ▪ brain cancers
presence of this RNA sequence which indicates that the body's
to the next and were acquired during the course of life CDKi2A (cyclin dependent ▪ non-small-cell lung cancers
actively making the fusion protein and allow us to infer the presence
▪ whether or not genetic alterations can be passed on from one generation of the Philadelphia chromosome kinase inhibitor 2A) ▪ leukemia
to the next depends on what type of cell in which it occurs ▪ melanomas
▪ genetics alterations can occur in two types of cells: germ cells and EXAMPLES OF SOME CHROMOSOMAL ABNORMALITIES
somatic cells ASSOCIATED WITH CANCERS proto-oncogenes tumor suppressors
1 CHROMOSOME TRANSLOCATION ▪ these genes are needed for
germ cells somatic cells ▪ normal genes that slows down
▪ chromosomal translocation, like the development, day-to-day
the reproductive cells in humans: non-reproductive cells cell division, repairs mistakes,
one that produces the Philadelphia housekeeping, and repair
eggs (female) and sperms (male) (other cell types) and initiate cell death when it is
chromosome, is common in many other ▪ when some mutations develop
needed to prevent cancer
types of cancer in proto-oncogenes, they can
▪ mutations in tumor suppressor
▪ most often, these translocation results become oncogenes or genes
genes can interrupt the therapy
in fusion proteins that cannot shut that stimulate cells to grow out
function, removing the breaks
themselves off of control, which leads to
that normally prevent cancer
▪ in fact, there are more than 200 fusion proteins that have been cancer
identified oncogene tumor suppressor gene
▪ anaplastic lymphoma kinase (ALK) ▪ is a mutated form of a proto-
o normally regulate cell growth oncogene – a gene involved in ▪ is a type of gene that helps
o however, when ALK refuses with any other several other genes, it normal cell growth control cell growth
overproduces a protein that removes breaks from cell growth ▪ may cause the growth of cancer ▪ mutations may lead to cancer
o these uncontrolled cell growth plays a certain role in some cancers cells
or tumor tissue from about 3-5% of people with non-small cell
lung cancer and as gene abnormality

AIRAH M.
▪ tumor suppressor genes on both arms of the chromosome 9 appear to by events in the internal or external environments (e.g. somatic EXAMPLES OF SOME CANCER BIOMARKERS AND THEIR CLINICAL USES
be frequently involved in many types of cancer mutations) (specifically proteins as biomarkers in cancer)
Cancer Type Cancer Biomarker Spx Type Clinical Use(s)
▪ chromosome 9 is frequently deleted in bladder tumors, lung tumors, and ▪ several different types of mutations can occur (as shown in the image
▪ estrogen receptor (ER)
basal cell carcinomas above) ▪ progesterone receptor (PR) predicting treatment
▪ loss of the B arm of the chromosome 9, in particular: the 9P 21 to 22, is breast tissue
▪ human epidermal growth response
also common in many human tumors point mutations insertions deletions
factor receptor 2 (HER2)
▪ prior studies have shown the region of 9P 21 to 22 to be deleted in single nucleotide nucleotide bases ▪ diagnosis
leukemias, melanomas, gliomas, as well as lung, bladder, head, and neck bases can be changed can be inserted into ▪ prognosis
cancers to different bases the sequence ▪ monitoring
testicular α-fetoprotein blood
treatment response
EXAMPLES OF MUTATIONS THAT CAN OCCUR IN GENES ▪ monitoring disease
recurrence
▪ monitoring
treatment response
prostate prostate specific antigen blood
▪ monitoring disease
recurrence
▪ prognosis
▪ monitoring
carcinoembryonic antigen treatment response
colorectal blood
(CEA) (advanced disease)
▪ monitoring disease
recurrence
▪ diagnosis
▪ prognosis
▪ monitoring
ovarian CA-125 blood
treatment response
Single Nucleotide Polymorphisms (SNPS): gene alterations used in ▪ monitoring disease
▪ insertion and deletions are referred to as “indels” recurrence
biomarkers in cancer
▪ are arbitrarily distinguished from deletions and amplifications that ▪ proteins biomarkers are probably the most common type of biomarker
occur at the chromosomal level by the number of DNA bases that are evaluated by molecular diagnostics today
involved ▪ tumors can ?set? certain proteins that enter the bloodstream and these proteins
▪ the current convention is to use the term “indel” to describe deletions can then be evaluated by taking a blood sample and subject, subjecting it to a
or insertions that involve 1-50 nucleotides or so and to use the term molecular diagnostic test
“copy number variation” to refer to larger deletions and insertions CEA TEST
that typically involved in >100 nucleotides ▪ these proteins are not used for diagnosis but rather to monitor the treatment
of people already diagnosed with colon cancer, thyroid cancers, and cancers of
EXAMPLE OF CHROMOSOMAL AND GENE-LEVEL BIOMARKERS ASSOCIATED the rectum, lung, breast, liver, pancreas, stomach, and ovaries
WITH CANCER ▪ in some cases, this is conducted prior to treatment and then re-taken several
TYPES OF SOMATIC OR times over the course of treatment in order to monitor how well the treatment
EXPLANATION
BIOMARKER GERMLINE is working and determine whether it cancer has progressed or recurred
Chromosomes ▪ for certain cancers, CEA levels may also be used to determine the prognosis and
genetic material from one staging, like the cancer size and its spread away from its initial site
chromosome switches places with ▪ also used along with other biomarkers and clinical tests
▪ small alterations in certain parts of our DNA can also serve as biomarkers translocation somatic ▪ for some cancers, it is only useful in people whose cancer has spread from its
genetic material from another
▪ two individuals do not have exactly the same DNA sequences in all of chromosome original site or has metastasize
their chromosomes and genes unless they are identical twins a piece of genetic material switches
COMMUNICATION OF SCIENTIFIC FINDINGS
▪ we all exhibit genetic variations and some of these variations are inversion and to end within the same somatic
inherited and others are acquired over the course of our lives chromosome
▪ several different types of genetic variation can occur ▪ a portion of DNA is lost (deletion)
or copied two or more times
single nucleotide polymorphisms (SNPS) copy number
(amplification)
variation (deletion somatic
▪ there are differences in only one nucleotide base pair in the DNA ▪ sometimes amplifications (aka
or amplification)
sequence that of course in at least 1% of the population compared to gene duplications) are described
everyone else as mutations at the gene level
Genes
▪ account for 90% of all variation in human DNA
a single nucleotide base is somatic or
▪ they are not exclusively good or bad: some of these may be beneficial, point mutations
substituted for another germline
harmful, or may have no detectable effect at all insertions or a small portion of DNA is inserted somatic or
▪ SNPs that have potentially negative health consequences are often deletions (indels) or deleted germline ▪ because of the development done or brought to us by the study of
referred to as mutations genomics, we're able to develop tools and other approaches to
▪ SNPs are only called “mutations” if they occur a new, either by being diagnosis specific diseases, especially with cancers
inherited on the germline mutations or induced in the cancerous tissue ▪ genomics has led to the realization that cancers are typically associated
with changes in multiple genes and proteins

AIRAH M.
▪ molecular diagnostics have been developed to evaluate a gene profile
or the assessment of many genes at once
▪ one of the most widely used and been studied gene profile or genomic
tests is the oncotype or breast cancer assay
o these tests examine a panel of 21 genes that provides information
in methods in molecular diagnostics, with the advent of the PCR, we are
about breast cancer
able to have in vitro diagnostics, tissue sampling, or tissue storage
o specified for use in women with early stage (e.g. Stage I or II), HER2 (-
), estrogen receptor (+) in basic breast cancer, who will be treated with
hormone therapy
o the results of these tests are given as a score that predicts the
likelihood of breast cancer recurrence: the higher the score, the more
likely the cancer is to re-occur
o these tests can also predict whether a woman with early stage or
invasive breast cancer, that is ER (+) and HER2 (-), will benefit from the
chemotherapy added onto her hormone therapy (adjuvant therapy)
▪ those developments that have been developed by the researchers or
scientists can be best understood through communication of scientific
findings or studies
▪ breakthroughs in genomics, or proteomics in general, and related
disciplines are communicated to the public and scientific articles
▪ these articles are published in scientific or medical journals that are
primarily read by other scientists, but may also be reported by the media
▪ the findings are then translated by various organizations (e.g.
government, foundations, and advocacy groups) into language that can
be understood by the general public
▪ some breakthroughs in science results in new products (e.g. molecular
diagnostics and targeted therapies)
▪ once these products are approved or cleared by the government
agencies, they may be available to the patients or be implemented within
the community
METHODS IN MOLECULAR DIAGNOSTICS
IN VITRO DIAGNOTICS, TISSUE SAMPLING, TISSUE STORAGE
a number of techniques are employed in modern diagnostics to detect and
quantify specific DNA or RNA sequences, as well as proteins
▪ the most fundamental technique is PCR which is a method used to
amplify of DNA or RNA sequences until there are so many copies that
they can be detected and measured
Polymerase Chain Reaction (PCR)
▪ tests may search only for certain gene variants or map the entire
sequence of a targeted portion of DNA which also includes the whole
genome site to detect all mutations in the sequences
▪ PCR is powerful tool for locating short segments of a gene where
known critical mutations or variances can lead to altered cell
functions associated with disease or altered functions
▪ PCR tests for the presence of a portion of DNA that has a known base
sequence, which is a DNA marker associated with the gene of
interest, employing the same enzymatic process used by natural DNA
replication to rapidly amplify or copy that sequence until there are
thousands or millions of copies
▪ because PCR relies on amplification, it is highly sensitive, meaning, it
can detect specific DNA segments that may be present at very low
levels in the sample
▪ once the DNA is amplified, it can be analyzed in multiple ways,
depending on the desired result
▪ the DNA can be measured just for size, to check for a large deletions ▪ tissue that is intended for use in more distant future (e.g. for research)
or insertions of DNA, measured for abundance or assess base-by- is kept in tissue banks
base to determine the sequence of the DNA sample in order to locate ▪ a snap frozen tissue stored at -80°C, DNA protein can remain viable
potential biomarkers for many years and RNA only may last for up to 5 years
tissue type, collection methods, and storage methods can influence the
viability of the tissue for molecular diagnostic testing
DETECTION OF DNA
IN VITRO DIAGNOSTICS
▪ DNA sequencing
▪ molecular diagnostics are often referred to as in vitro diagnostics
o e.g. Sanger sequencing and automated sequencing machine will
o the words “in vitro” is Latin term for “in glass” and refer to the
be obtained from the sequencing analysis
glass test tubes in which the test were originally performed
o we also use DNA probes which are important tools in several
o today, the phrase “in vitro diagnosis” refers to tests that are
molecular diagnostics that are used to detect the presence of
conducted on samples taken from the body (e.g. blood, saliva, cells
specific DNA sequences: this take the advantage of the fact that
from a tumor)
each nucleotide base in DNA binds on the one or other base
o in vitro diagnostics can be always contrasted with in vivo
▪ DNA microarrays: developed to detect thousands of genes at once
diagnostics (e.g. ultrasound, X-rays, computed tomography [CT
o feature: integral to the field of genomics since in DNA microarrays,
scans]) which are performed in the living person and produce an
DNA probes containing select the DNA sequence or array are
image
spotted in a grid pattern on a very small glass surface
o currently, all molecular diagnostics are performed in vitro and
o these methods actually looks like thousands of tiny dots arranged
sometimes the whole field of molecular diagnostics is referred to
in the precise rows and columns
as “in vitro diagnostics”
o the product is each dot contains a single DNA probe that is
▪ today, the two types of diagnostics – in vitro and in vivo – were
designed to have hybridized with the complimentary DNA
absolutely coming together: for example, specific molecules in the
sequence in the tissue sample
body are being labeled with chemicals that make them visible with
o because there are many spots for probes, many different DNA
imaging machines, as is being done with the administration of
sequences can be detected at the same time
radioactive estrogen to person combined with imaging to examine
o this allow us to have high throughput or the analysis of many DNA
estrogen receptors in the living body
sequences in parallel
TISSUE SAMPLING
o DNA microarray: best method, or if not, these are called Genome
▪ for tissue sampling, the first step in molecular diagnostics is to obtain
Chip or Gene Chip, which can be placed on other surfaces besides
a show or a specimen for testing
glass or bed arrays
▪ tissue samples are collected by different methods depending on the
▪ capillary and well arrays which work all the same
purpose and the type of test
▪ blood samples are often drawn from veins in the arm METHODS USED TO DETECT DNA
▪ urine can be studied DNA Sequence Data from an Automated Sequencing Machine
▪ saliva obtained from the mouth
▪ samples may be taken from the skin following a local anesthetic
▪ when samples need to be obtained from a solid tissue abnormality,
or two more, the simplest and least invasive option is a fine needle
biopsy, in which a fine needle is inserted into the tissue and cells that
are aspirated
▪ if a large amount of tissue is needed, a core needle biopsy may be
used to remove cells and a small amount of surrounding tissue
▪ surgical procedures might be also useful in the removal of an even
larger amount of tissue needed
▪ another method involves the use of flexible instrument called
endoscope that is inserted into one of the body’s openings
DNA Probe Hybridizing with DNA in Tissue
▪ the endoscope allows the physician to see abnormal areas from the
Sample
lining of organs and pinch off tiny bits of tissues
TISSUE STORAGE This graphic shows a DNA probe (red letters on the
▪ tissues that do not undergo immediate molecular diagnostic testing left with a fluorescent marker attached) hybridizing
may be processed and stored for future use with a complementary DNA sequence in a tissue
▪ the tissue that we obtain from the living is stored for a couple of days sample. DNA sequences that are not
▪ one way of preserving the tissue is to treat it with chemicals (e.g. complementary to the DNA probes do not bind and
formalin and wax embedding) the probe (along with the fluorescent markers) are
▪ another method is to snap freeze the tissue and store it at -80°C washed off. In reality, DNA probes are much longer
than just 4 nucleotide bases.
AIRAH M.

Image of a DNA Microarray (AKA: An Array “HEAT MAP”)
This graphic shows a DNA microarray.
▪ after taking consideration of all those cytogenetic techniques or
Each part of the grid contains a DNA
probe. After exposure to a sample
containing a person’s DNA, some of the
probes hybridize and some do not.
▪ this is because if we have undergone all those tests without taking these
Those that do not hybridize light up,
indicating that the specific DNA sequence is present in the sample. The
different colors of the dots correspond to different levels of expression.
Sometimes, different colored dots (e.g. red, black, green) are used in
microarrays.
▪ these conventional cytogenetic tests involve the taking cells from a
certain area of the body and growing to cells in a test tube for one
day or more
▪ the cells that are dividing are then stopped or essentially frozen in
the process of division
▪ it is essential that the cells are dividing because only in this stage can
the chromosomes be seen using our regular microscopes
▪ dividing cells are often placed on a microscope slide
▪ each chromosome is evaluated in multiple cells, usually at least 20,
by looking under regular microscopes
▪ these type of tests is often used to detect Down syndrome, in which
the affected individual has an extra copy of chromosome number 21
▪ these genetic diseases can be detected by simply counting the
chromosomes
▪ those two sides of genetic tools are used for typing of blood cancers
(e.g. leukemia) and the Philadelphia chromosome (this is an example
of somatic abnormality or one that occurs in non-germline cells that
is and is not inherited)
Fluorescence In Situ Hybridization (FISH)
In FISH, DNA probes are labeled
with fluorescent dye then
exposed to chromosomes whose
DNA double strands have been
separated or denatured. The
probes are allowed to hybridize
with the DNA in the
chromosomes, then viewed
under a fluorescent microscope. DNA that is bound to the probes
(indicating the presence of the specific DNA sequence) will be visible as
fluorescent light (shown as pink spots on the chromosome in the lower
right).
▪ fluorescence in situ hybridization (FISH), also known as molecular
cytogenetic testing, is a way to visualize and document the location
of genetic material including specific genes or DNA sequences within
genes
▪ is used to look for the presence and absence or relative positioning
or the number of specific DNA segments under a fluorescence
microscope
▪ unlike conventional cytogenetic techniques, FISH does not have to
perform on cells that are actively dividing, which makes it more
versatile
▪ is particularly helpful in finding copy number variations especially
translocation and amplification such as (putol)
SPECIFICITY AND SENSITIVITY
HOW GOOD ARE MOLECULAR DIAGNOSTICS?
▪ a biomarker with ideal specificity and sensitivity would be evident in all
VALIDITY, RELIABILITY, AND CLINICAL UTILITY
four red people but none for blue people
▪ a biomarker with ideal specificity but low sensitivity might be evident in
molecular biology techniques in molecular diagnosis of cancer, we might
two red people but none in blue people (in other words, it would miss
also take into consideration the question “How good are molecular
some of the people with the condition, but wouldn't falsely identify
diagnostics in terms of validity, reliability, and clinical utility?”
anyone with their condition)
▪ biomarker with ideal sensitivity but with low specificity would be evident
three important elements, it might pose a major problem with a
in all red people but might also be evident in 3 blue people (it would
molecular diagnostic tests
correctly identify all people who have the condition but would falsely
▪ is a measure of how well the test measures what it identify some people as having the condition when they actually do not
purports to measure have)
▪ molecular diagnostics must exhibit two types of validity
analytical in order to be useful: the analytical (focused on this
validity topic) and clinical
▪ e.g. a test designed to detect a mutation associated
with a melanoma should not give a positive response
for an unrelated mutation associated with diabetes
▪ is the ability of the test to correctly identify those
patients without the condition
▪ stated another way, a test is specific if it gives a positive
result only when the condition is present
▪ for instance, a specific test for a cancer mutation would
give a negative result for everyone who does not have
the mutation and only give a positive result if someone
TRUE AND FALSE POSITIVES AND NEGATIVES
does have the mutation Does the person actually have the TEST RESULT
▪ depends on analytical validity, and a poorly biomarker or condition being tested for? POSITIVE (yes) NEGATIVE (no)
reproducible or inaccurate test may be positive in YES true positive false negative
specimen, in which the actual biomarker does not exist NO false positive true negative
▪ depends on the use of the context, so it can relate to
▪ results of molecular diagnostics or any test for that matter can be
the specificity between normal or benign conditions
classified as correct or incorrect
and cancer between different types of cancer, etc.
▪ we always want the results of tests to be correct or true, however,
▪ a lack of specificity is problematic because if that causes
when a test is incorrect, the results are said to be false
mental anguish and can lead people to undergo
specificity ▪ accurate and useful tests have high true positive and true negative
unnecessary follow up procedures and treatments that
rates and low false positive and false negative rates
are associated with waste
▪ in the ideal case, the test would identify only for those with the
▪ e.g. men with high levels of PSA or abnormal findings
biomarker or condition but would also identify everyone with a
on digital rectal exam may elect to undergo needle
biomarker or condition
biopsy and such biopsies can cause stress and anxiety,
▪ in real life, very few molecular diagnostics come close to this idea
and may be associated with financial cost
▪ in molecular diagnostic testing, these terms are often called the
o although prostate needle biopsies are relatively
positive and negative predictive values (PPV or NPV)
safe, they can use, or they can cause severe
▪ no test is perfect and, depending on the condition, it may be better
bleeding or infection of the prostate gland or
to have a higher positive predictive value or a negative predictive
urinary tract and 1% of the patients
value
o in addition to erectile dysfunction and
true positive true negative
incontinence, these tests are not without
when a test correctly identify a when a test correctly determines
drawbacks and risk and, as with all medical tests,
person with a given biomarker or that a person does not have a
it's best to minimize the number of patients who
condition, the result is said to be a given biomarker or condition, the
undergo them unnecessarily
true positive result is said to be a true negative
▪ these two concepts can apply to analytical validity of
high positive predictive value high negative predictive value
the molecular diagnostic tests as well as to the clinical
a highly specific test will have a highly sensitive tests will have a
validity of the biomarker
sensitivity high positive predictive value, that high negative predictive value,
is the ability of the test to correctly identify those
patients with biomarker or condition is, if it is a positive in a patient, it is that is, if the test is negative in the
very likely that the patient has the patient, it is very unlikely that the
condition patient has the condition
AIRAH M.
 TEST RELIABILITY ▪ in contrast, other experts believe that clinical utility
(results of the tests are repeatable) is a broader concept that involves the practical
▪ e.g. if a molecular diagnostics performed on Monday indicates that a aspect of usefulness in the clinic
cancer is positive for a certain gene, it should also give the same How are molecular diagnostics clinically validated?
result on Tuesday ▪ by conducting studies that document the relationship of the test
▪ unreliable tests are not useful in making diagnosis or treatment outcome with an important medical or clinical outcome
decisions ▪ for instance, if the molecular diagnostics purports to detect response to
▪ for example, in testing reliability of HGR2 molecular diagnostics: therapy, then the test results would need to show a relationship with
reliability is an issue with tests used to detect HER2 overexpression in reduced tumor growth, patient survival, or another important variable in
breast cancer, and approximately one quarter of breast cancer can a clinical study
overexpress a gene known as HER new ▪ such studies provide scientific proof of molecular diagnostic accuracy
o these over expression causes cells to produce too much HER without validation in a clinical study
protein and because the HER protein is involved in the cell growth ▪ the test accuracy must be considered and proven
and replication, cells that have too much HER receive too many
signals telling them to grow and replicate MOLECULAR DIAGNOSTICS IN ONCOLOGY
o a medication known as ?tisotumab? inhibits the activity of the Cancer is deadly. Though initiatives and approaches to fight the disease was
HER2 proteins, however, this medication is only approved to treat employed, it still remains a mystery on how to completely eradicate such
cancer that are positive for HER2/new overexpression which must disease.
be determined by a test in a companion diagnostics ▪ there is increasing interest in the development of newer and sensitive
o two different types of tests are available for this purpose: techniques to screen and diagnose the patients with cancer, as early as
immunohistochemistry and FISH possible, especially in high-risk groups where conventional technology
⇥ although many women obtain accurate and reliable results falls short
from these tests, guidelines from the American Society for ▪ although histopathology remains the standard conventional method
Clinical Oncology and College of American Pathologists states for cancer, recent diagnostic techniques (e.g. imaging, PCR, flow
that 20% of the current HER2 testing may be inaccurate cytometry, FISH, CSH, microarray) contribute a major breakthrough in
⇥ conversely, if a test result is positive, that is if the tumor does diagnosis, prognosis, and therapeutics of cancer
not overexpress HER2/new but the test gives a positive results, ▪ our understanding of functional and molecular characteristics of tumors
women may receive a treatment that is not likely to benefit improves a multimodal imaging approach will evolve, enhancing the
them acoustic accuracy and lowering the current thresholds for detection,
▪ these problems with reliability are important because the tests are thus, minimizing the loss of due to cancer
being used to determine treatment HEREDITARY CANCER SYNDROMES CIRCULATING TUMOR FRAGMENTS
▪ is the measure of a test’s ability to provide clinically Assay
relevant information ▪ recurrent mutations (PCR)
▪ CTCs
▪ depends on a close association of the biomarker ▪ single-gene analysis (Sanger
▪ ctDNA
with a clinical important outcome (e.g. response to Sequencing, MLPA)
▪ RNA
▪ multigene panels (NGS)
clinical a medication or aggressiveness of the cancer) ▪ proteins
▪ whole exome sequencing
validity ▪ e.g. one reason that the PSA test is not useful a Cancer Patients
screening tool for prostate cancer is because it lacks ▪ control of tumor eradication
clinical validity, that is, routine PSA testing does not ▪ risk of 2nd malignancy
▪ monitoring of tumor burden
▪ choice of treatment
increase a man lifespan ▪ choice of therapy
▪ is related to the concept of clinical utility Healthy People
▪ is the overall usefulness of a molecular diagnostic ▪ identification of subjects at-risk ▪ early diagnosis
in clinical practice determine by weighing its PREDICTIVE MARKERS CARCINOMAS OF UNKNOWN PRIMARY
Assay
benefits and drawbacks
▪ DNA ▪ cells
▪ this definition is still evolving, with some experts ▪ single markers
▪ RNA ▪ tissue slices
equating clinical validity and clinical utility ▪ integrative assays
▪ proteins ▪ PDXs
▪ can be considered as the opposite of specificity Molecular Targets Tissue-Specific Markers
▪ it is the ability of the test to correctly identify those ▪ HER2
▪ ALK ▪ RNA
clinical utility patients with a biomarker or condition ▪ EGFR-MUT
▪ ROS ▪ proteins
▪ it should correctly identify everyone who has the ▪ BRAF-MUT
biomarker or condition: with this test, you can be Tumor Phenotypes Tumor-Specific Markers
relatively certain that if you have the biomarker or ▪ MSI-H ▪ point mutations
▪ BRCAness ▪ gene rearrangements
condition, you will get a positive result on the test
▪ mutation burden ▪ copy number variations
▪ some experts define clinical utility as the test ability
to provide clinically relevant information, which is
the exact definition used for clinical validity

AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS SEASONALITY
TOPIC 9: MOLECULAR TESTING ON INFECTIOUS DISEASES ▪ in temperate climates, the seasonal incidence of respiratory viruses is as
(RESPIRATORY VIRUSES) diverse as the number of species associated with RTI, but the majority of
Lecturer: Ms. Catherine B. Lago, MSc infections occur between fall and early spring
LEARNING OUTCOMES: environmental factors social factors
After completing this topic, you should be able to: such as low temperatures and associated with colder months
▪ discuss the various respiratory viruses and specify groups/types and/or humidity (e.g. crowding indoors)
subtypes that cause human infections
▪ in tropical climates, infections occur year-round or with increased
▪ describe the seasonality and shedding of respiratory viruses
incidence during the rainy season (primarily flu virus)
▪ explain the advantages and disadvantages of NAATs in Viral Diagnostics
▪ summarize the example of Platforms/Instruments and Respiratory Panels VIRAL DIAGNOSTICS
in Molecular Diagnostics ▪ since most cases of viral respiratory infection (VRI) are associated with
LEARNING OUTLINE: mild, self-limiting illness, laboratory testing is not necessary
I. Introduction ▪ during this pandemic or serious cases, rapid laboratory diagnosis of the
II. Molecular Targets etiological agent can be important
▪ Influenza Viruses (A, B, C) o can guide therapy, potentially eliminating unnecessary use of
▪ Paramyxoviruses: RSV, HMPV, PIV antibiotics and enabling the use of antivirals when appropriate
▪ Adenovirus (A, B, C, D, E, F, G) o important for infection control interventions to minimize the risk of ▪ infects hundreds of millions of people
▪ EVs – including RVs and HPeVs nosocomial spread annually with 250,000 – 500,000
▪ Coronaviruses: HCoV, SARS, MERS Relative Rates of Respiratory Viruses Among Respiratory Tract Syndromes
deaths worldwide
URTI LRTI
III. Molecular Technologies and Limitations of Testing common cold ILIa croup bronchiolitis pneumonia ▪ classified into 3 distinct types: A, B,
VIRUS
RESPIRATORY VIRUSES
(pediatric/adult) (all ages) (pediatric) (pediatric) (pediatric/adult) and C viruses based on major
AdV 5-10/1 0.4-9 1 1-8 1-10/3-13 antigenic differences
▪ commonly infect only the URT, and when LRT infection does not occur, HCoV 10-15/11 0.2-10 2b 1-8 3-7/6-13
it is most often due to contiguous spread Influenza 25-30/8 8-52 9 1-10 4-22/21-31
▪ subtypes based on antigenic
▪ cause distinct clinical syndromes based on their tropism for different HMPV 1-5/1 0.2-10 <1 3-12 1-13/3-22 characterization of the surface
sites of the respiratory tract
PIV 1-5/5 0.4-11 42c 1-3 8-28/6-14 glycoproteins hemagglutinin (HA)
RSV 1-5/3 0.4-19 15 70-80 3-45/13-24
and neuraminidase (NA)
RV/EV 40-50/71 4-29 21 15-35 3-45/13-24 https://www.cdc.gov/flu/avianflu/influenza a virus subtypes.htm
a
Influenza-like illness: fever, myalgia, pharyngitis, and dry cough https://www.cdc.gov/flu/resourcecenter/freeresources/graphics/images.htm
b
Frequencies not yet well established.
c
PIVI=31%, PIV2=5%, PIV3=6% HUMAN FLU TYPES FLU A SUBTYPES
routinely tested in the lab 198 possible combinations
This table summarizes the rates of respiratory viruses among respiratory
▪18 known HA subtypes (H1…H18)
tract syndromes. Indicated here are the URT and LRT infections, together Flu A
▪11 known NA subtypes (N1…N11)
with the different viruses. The viruses that cause URT infections infects both Flu B (e.g. Pampanga Flu A/H5N6)
children and adults, but commonly in children (lesser prevalence in adults).
HUMAN FLU A SUBTYPES ASIAN AVIAN FLU A SUBTYPES
While for LRT infections, the data are mostly from pediatric and only
pneumonia for adults. pdm (pandemic) H1N1 H5N1, H5N6
(replaced seasonal H1N1) H7N2
MOLECULAR TARGETS: INFLUENZA VIRUS
H3N2 H9N2
These influenza viruses are also diverse and highly pathogenic strains are
those of the avian strains. In the previous pandemic, the 2009 H1N1 Influenza Positive Tests Reported to CDC by US Public Health
pandemic, it is a reassortment of viruses from the humans that infects the Laboratories, 2019-2020 Season
swine (just like the avian flu virus where the reassortment happened which
generated the new 2009 H1N1 pandemic strain or subtype).

URT LRT
nasal cavity trachea (windpipe)
nasopharynx bronchus
oropharynx bronchioles
larynx (voicebox) alveoli
Clinical Entity
otitis media croup (laryngo-tracheo-bronchitis)
rhinitis tracheobronchitis
coryza bronchitis ▪ two waves of activity: started early in some parts of the country
pharyngitis broncholitis ▪ initial peak due to B/Victoria lineage viruses, followed by second
laryngitis pheumonitis higher peak of A(H1N1) pdm09 (pandemic 2009) viruses

AIRAH M.
▪ few A(H3N2) viruses and very small number of B/Yamagata lineage ▪ causes non-pulmonary complications: myocarditis and pericarditis, ▪ are classified as four types and two subtypes:
viruses circulated as well as exacerbations of other underlying disease such as chronic PIV1, 2, 3, 4a, and 4b
(insert image) heart failure and chronic renal disease parainfluenza virus ▪ PIV1 and to a lesser extent PIV2 are the
▪ infections are usually acute, self-limited, febrile illness which manifest (PIV) most significant cause of croup
clinically as fever (≥38°C for at least 2 days), malaise, and cough with TARGET GENES ▪ PIV3 is a significant cause of bronchiolitis,
attack rates as high as 10-40% bronchitis, and pneumonia
▪ occurrence is generally seasonal with outbreaks of varying severity ▪ sample: total RNA extracted from NS,
Ts, and/or NPS in VTM (NP or ▪ primary infections present as URTI beginning 2-8 days after infection
observed almost every winter
bronchial wash, nasal or through the nose or eyes
▪ pandemics caused by different antigenic subtypes of influenza A have
endotracheal aspirate, sputum) ▪ spread to the LRT within 1-3 days as the result of viral impairment of the
occurred in:
ciliary epithelium
▪ test algorithm:
H1N11 H2N2 H3N22 H1N1 o TYPING: M gene (to distinguish MOLECULAR TARGETS: ADENOVIRUSES
1918 1957 1968 2009 between Flu A and B)
1
one of the first documented, also called as the Spanish Flu, wherein o FLU A SUBTYPING: HA and NA
a lot of people died during the 2nd wave (than the 1st wave) genes
2
associated with higher mortality because of many several factors
(e.g. immunity of the population)

TIMELINE OF HUMAN FLU PANDEMIC

▪ commonly associated with patients having respiratory symptoms

▪ most strains of influenza replicate in the URT where α-2, 6-linked sialic
acid receptors predominate on cell surfaces
▪ Glu222Gly substitution in the HA gene is associated with a greater
affinity for α-2, 3-linked receptors which are more abundant in the LRT,
resulting in a greater risk for viral pneumonia
MOLECULAR TARGETS: PARAMYXOVIRUSES (RSV, HMPV, PIV)
o e.g. found in strains of avian influenza and in some strains of 2009
H1N1
▪ human AdVs are further divided into 7 species (A through G) and 57
types
▪ several group B AdVs, including serotypes 3, 7, 14, and 21, have caused
outbreaks of acute respiratory disease (ARD)
▪ ARd outbreaks due to a virulent strain of serotype 14 in 2006 and 2007
was associated with a significant number of ICU admissions and deaths
in previously healthy young adults
▪ infections begins with replication in non-ciliated respiratory epithelium
Tao, YJ and Zheng, W. Visualizing the influenza genome. Science. 2012 Dec 21;338(6114):1545 6. doi : 10.1126/science.1231588 of the tonsils and adenoids (the specimen collection of adenoviruses are
different from other viruses)
▪ utilize cell receptors that are abundantly expressed in epithelial cells in
multiple organs or tissues

ZOONOTIC INFLUENZA STRAINS CAR CD46

▪ associated with unique clinical presentations and is more concerning groups A, C, E, and F groups B and D
as these strains have the potential to be more pathogenic, as seen ▪ can persist as a latent infection for years after an acute initial infection
with the avian H5N1 strains and may reside in lymphoid tissue, renal parenchyma, or other tissues
▪ have the potential to be the source of the next pandemic due to low ▪ reactivation may occur in severely immunosuppressed patients
levels of immunity in the human population (since these zoonotic
strains primarily infect birds and swines) MOLECULAR TARGETS: ENTEROVIRUS (EVs) – including
▪ single amino acid changes appear to be responsible for changes in RHINOVIRUS (RVs) and HUMAN PARECHOVIRUSES (HEpVs)
host range

INFLUENZA INFECTIONS
▪ usually begin with an abrupt onset of symptoms after an incubation
period of 1-2 days and last 4-5 days (acute specimens: within 5 days
from onset of symptoms) ▪ the major cause of LRT illness in young
▪ causes primary viral pneumonia that requires ICU admission and respiratory children
mortality is high syncytial virus (RSV) ▪ RSV A is associated with more severe disease
▪ causes pulmonary complications: secondary bacterial pneumonia, than subgroup B
bronchiolitis, and croup, as well as exacerbation of chronic pulmonary ▪ causes a broad range of URTI/LRTI, which are enterovirus (EVs)
human
diseases such as chronic bronchitis, asthma, and worsening clinically indistinguishable from RSV human ▪ associated with RTI in addition to a wide array
metapneumovirus
pulmonary functions in children with cystic fibrosis ▪ the severity of illness associated with HMPV parechoviruses of other disease
(HMPV)
A is similar to HMPV B infection (HPeVs)

AIRAH M.
 ▪ is the most commonly detected respiratory
virus in all age groups
▪ preferentially infects the URT, primarily the
paranasal sinuses and nasopharynx
▪ large- and medium-sized airways also maintain
rhinovirus (RV) high-level RV replication
o bronchiolitis in infants and exacerbations in
patients with chronic asthma
o LRTI (e.g. pneumonia, croup, and bronchitis)
also occur and result in a significant number
of hospitalizations
NOVEL BETACORONAVIRUSES
Here are the genomes of the nCoVs. Both 2019-nCoV and SARS-CoV
are more similar compared to the MERS-CoV. Based on the publications,
there are around 80% sequence homology when comparing the SARS-
CoV-2 (2019-nCoV-) from SARS-CoV-1. When comparing the 1a/b of
both viruses, it is about more than 90% sequence homology, that is why
the 2019-nCoV was renamed as SARS-CoV-2. Just like the MERS-CoV,
the target genes in detecting the SARS-CoV-2 include the E gene, the
orf1ab, and the N gene.

EV A-D RV A-C HPeV A

associated with human infections
This shows the viral influenza shedding peaks (red circle). The peak of
EV C EV D RV A
the viral shedding is primarily on the first 2 days from the day of onset
(C104, C109, C117) (D68) RV D
of the symptoms.
associated with more serious respiratory disease
MOLECULAR TARGETS: CORONAVIRUS

▪ named “coronaviruses” due to the crownlike MOLECULAR TECHNOLOGIES AND LIMITATIONS OF TESTING
structures in the EM SPECIMEN COLLECTION
▪ low pathogenic CoVs cause mild URT diseases
▪ optimal specimens originate
form the site of viral replication:
229E OC43 NL63 HKU1 primarily the URT, in particular
alpha-CoV genus beta-CoV genus the NP region
▪ NP aspirates, washes, swabs, or
▪ two highly pathogenic beta-CoVs cause serious viral pneumonitis,
brushings, have statistically
leading to hospitalization and death with overall mortality rates of 10%
equal sensitivity for NAAT,
and 30%, respectively:
particularly when flocked
o Severe Acute Respiratory Syndrome associated CoV (SARS-CoV) It also varies on the severity of the disease. The hospitalized patients still
swabs are used
o Middle East Respiratory Syndrome CoV (MERS-CoV) shed the virus up to 35 days, while those non-hospitalized patients
▪ combined with throat swab and an NP swab may improve virus
▪ infection with typical HCoV begins with replication in the ciliated (those on the communities) only shed the virus up to 20 days.
detection
epithelial cells of the nasopharynx
▪ throat swab alone is not recommended for most viruses, except AdV VIRAL DIAGNOSTICS
SARS MERS (infects tonsils and adenoids) and avian influenza (infects more the The NAATs have other variants aside from PCR as shown in the table below.
infect upper airway but there is is also associated with a biphasic LRT) The molecular technology also covers NGS (how other viruses are detected
little epithelial cell damage but illness strikingly similar to SARS ▪ calcium alginate swabs and swabs with wood shafts should not be since routine PCR cannot detect them).
rapidly spreads to the alveoli except for more frequent renal used for respiratory specimen collection because they may interfere
Diagnostic
leading to pneumonia and ARDS failure with NAATs (since they may have chemicals like formalin or other technique
Variants Principle Strengths Weaknesses
both have higher mortality rates than the current SARS-CoV-2 which preservatives that may interfere with NAATs) ▪ high
has a mortality rate of 10% [last update of Miss] ▪ specimens should be placed in sterile viral transport medium (VTM) sensitivity
▪ high
▪ SARS-CoV-2 causes COVID-19 and refrigerated until transported to the laboratory for testing ASAP specificity ▪ must rely on
▪ multiple variants are circulating/emerging ▪ freezing and thawing should be avoided or minimized to avoid ▪ RIA
formation of ▪ high speed QC assurance
degradation of virus particles, exposing the viral RNA to nucleases Ag-Ab through throughput ▪ high risk of
o B.1.1.7 lineage (aka 20I/501Y.V1 Variant of Concern [VOC] 202012/01) immunoassay ▪ EIA (FPIA, MEIA,
recognition and ▪ quick TAT interferences
CLIA)
o B.1.351 lineage (aka 20H/501Y.V2) binding (≤20 min) ▪ high cost
VIRUS SHEDDING ▪ different types
o P.1 lineage (aka 20J/501Y.V3)
▪ aside from proper specimen collection, one should know when to of tags, labels
▪ some of the potential consequences of emerging variants are: ▪ automated
collect the specimen at the right time
o ability to spread more quickly in people method
▪ peak respiratory virus shedding occurs on the 1st or 2nd day of acute ▪ high
o ability to cause either milder or more severe disease in people
illness and generally declines substantially after 4 days sensitivity
o ability to evade detection by specific viral diagnostic tests (because of ▪ high
▪ shedding duration varies with: ▪ longer run
the mutation, there is a high possibility that the primers and probes that amplification specificity
o virus ▪ RT-PCR and detection ▪ high speed
time
were previously developed to detect the circulating SARS-CoV-2 viruses ▪ requires
o patient age ▪ qPCR of sequences throughput
are no longer 100% specific and sensitive) NAAT
▪ NASBA from the viral ▪ quick TAT
specific
o severity of illness primers for
o decreased susceptibility to therapeutic agents (e.g. monoclonal TMA genome (DNA (≤20 min)
o comorbidities or RNA) ▪ different types
targets
antibodies)
o immune status of tags, labels
o ability to evade natural or vaccine-induced immunity automated
https://www.cdc.gov/coronavirus/2019-ncov/science/sciencebriefs/scientific brief emerging variants.html ▪ NAATs detect viral targets generally 6-14 days after infection method

AIRAH M.
 ▪ high PLATFORMS/INSTRUMENTS 2014 Molecular Options
sensitivity
▪ high 1 Luminex xTAG RVP 12+/RVP Fast 8
▪ high cost fully automated: extraction, amplification, and detection
polymerization specificity 2 Film Array 17 viral targets and 3 bacterial targets
▪ pyrosequencing
of DNA ▪ identification
▪ needs GeneXpert BD Max Panther
▪ fluorescently
template by of novel
bioinformatics 3 GenMark RVP 14+ viruses
labelled dNTP skills for data
NGS ▪ detection of
incorporation genomic
analysis
Gene Probe-PRodesse ProFlu Plus/Plus subtypes
of labeled sequences
released ▪ delay in use 4 ▪ RSV/Influenza A/B/H1, H3, novel H1
dNTPs, and ▪ genotyping
hydrogen ion
terminate the ▪ accurate
for routine ▪ ProFlu 1-4, ProFlu hMPV, ProFlu Adenovirus, On SmartCycler
(H+) clinical
extension detection of
diagnostics Nanosphere Verigene
mutations and 5
▪ RSV/Flu A/B/H1/H3
drug resistant automated amplification and detection
mutations
(requires separate NA extraction) Focus 3M
6
ionization of ▪ RSV/Flu A/B/ A H1N1 2009
▪ MALDI-TOF MS the sample, ▪ high 3M Integrated
▪ expensive LightCycler eSensor Illumigene 7 Cepheid, Xpert Flu A/B (A/H1N1 2009, H1, H3)
▪ ESI MS then separation sensitivity
equipment Cycler
MS
▪ often of the particles ▪ versatility
▪ limited and more…
combined with according ot ▪ cost-
other methods: their mass-to- effectiveness
database 7
disadvantage of GeneXpert Technology (cartridge-based: was available
library
PCR-MS charge ratio ▪ high workload at June 2020): takes time to develop their own technology unlike the
(m/z) PCR assay (if you already have the other reagents [primers and probes],
Souf S . Recent advances in diagnostic testing for viral infections. Bioscience Horizons. Vol. 9. 2016
you can already do the tests)
NUCLEIC ACID AMPLIFICATION TESTS (NAATs) TARGETS AND PLATFORMS CONCLUSIONS
▪ results can be obtained within minutes to hours Manufacturer Target Organisms and Platforms ▪ molecular diagnostics has revolutionized our ability to detect RTIs by
▪ the test of choice for VRI vs. rapid antigen tests and viral culture (takes GBS Influenza C. difficile CT/GC
increasing sensitivity of virus detection, broadening the array of
up to 5 days) BD Max, BD Max,
BD Viper viruses detected, and enabling the detection of multiple infections
SmartCycler SmartCycler
▪ exquisite sensitivity, and enabled the discovery of new respiratory ▪ furthermore, test results are available in a timeframe that can better
Panther or
viruses (e.g. HMPV, many HCoV, and RV C group) Gene-Probe SmartCycler
Tigris impact patient management
▪ detection of a large number of respiratory viruses in single assays, Cepheid GeneXpert ▪ these tools have also advanced our understanding of the epidemiology
including viruses that could not be detected by conventional virology Focus 3M Integrated Cycler and pathogenesis of respiratory virus disease
▪ high throughput, faster TAT, ease of use, automation, versatility, use of a Meridian Illumigene Illumigene
REFERENCES
closed system to reduce contamination and cost Roche Cobas 48003
▪ Hu T, Liu Y, Zhao M, Zhuang Q, Xu L, He Q. 2020. A comparison of COVID 19, SARS
3
can be used for SARS-CoV-2; can automatically perform nucleic acid extraction up
and MERS. PeerJ 8:e9725 https:// doi.org/10.7717/peerj.9725
MOLECULAR TESTING IN ID to PCR; very expensive and is very bulky (not available in the PH)
▪ Souf, S . Recent advances in diagnostic testing for viral infections. Bioscience
MOLECULAR RESPIRATORY PANELS Horizons. Vol. 9. 2016
Multiplex PCR: Detection and Differentiation of Respiratory Viruses ▪ Stellrecht KA. Molecular Testing for Respiratory Diagnostic Molecular Pathology.
2017;123 137. doi:10.1016/B978 0 12 800886 7.00011 X
▪ Tao, YJ and Zheng, W. Visualizing the influenza genome. Science. 2012 Dec
21;338(6114):1545 6. doi : 10.1126/science.1231588
▪ https://www.cdc.gov/coronavirus/2019 ncov/science/science briefs/scientific brief
emerging variants.html

▪ reduce need for molecular trained personnel and space

▪ allows testing on all shifts and improve TAT
▪ NOTE: Prevention of sample contamination is still very important in
close systems. Sample preparation should be done in a separate
room. Use of dedicated lab coat and changing gloves between VIDEO: Cepheid's Xpert® Xpress SARS-CoV-2 Test (for the Virus that
sample is highly recommended. causes COVID-19) & the GeneXpert® System
(https://www.youtube.com/watch?v=2s4KxC4M8Gw)
INTERPRETATION OF NAAT RESULTS Cepheid’s Xpert Xpress Test for easy rapid detection of SARS-CoV-2, the
FALSE-NEGATIVE RESULTS FALSE-POSITIVE RESULTS virus that causes COVID-19, has just received emergency use authorization
▪ improper specimen collection or rare from the FDA. In about 45 minutes, health care workers will be able to get
handling ▪ lab contamination or Film Array Respiratory Panel (BioFire) detects 20 respiratory pathogens results whether patients have symptoms or not.
▪ the patient is no longer shedding other factors (also one of the commonly used in the US) ▪ It begins with the clinician collecting a patient sample. The patient
detectable virus, or at least at the sample is mixed in a tube.
site of collection ▪ Using the included pipette, this is then transferred into the Cepheid
▪ sequence deviations or mutations cartridge which already includes the testing reagents.
at the molecular target regions ▪ The lid is snapped closed and the cartridge is ready to place into the
GeneXpert system.

AIRAH M.
The GeneXpert system can be run 24/7 in healthcare settings of all sizes,
including near patients. An easy-to-use and scalable solution, the
GeneXpert system is available in several configurations. Our largest
GeneXpert, the Infinity, incorporates automation to help load up to 80
cartridges that can be run simultaneously. Cepheid’s Xpert Express test can
be used easily by health care providers where it is needed most.
VIDEO: Journey Inside the Cepheid GeneXpert® Cartridge - 3D
Animation (https://www.youtube.com/watch?v=j-y3xi1K7JE)
The GeneXpert cartridge comprises the foot, the valve, the body, the
reaction tube, and the top. Reaction beads, reagent and rinse are loaded
and the top affixed to complete factory assembly. The cartridge is ready for
use.
▪ First, the user opens the cap, adds the sample to be tested and snaps the
cap shut.
▪ The closed cartridge is placed in a GeneXpert module. All contents will
remain within the cartridge throughout processing.
▪ A plunger lowers into the central tube, and the valve rotates to the first
position.
▪ The plunger rises, drawing in the sample.
▪ The valve rotates to a new position.
▪ The plunger lowers, pushing the sample into the active area.
▪ The sample flows into the active area and through the filter, trapping
organisms on the filter.
▪ The valve rotates the draw and wash fluid, which flushes the filter and is
collected in the waste chamber.
▪ Rotating again, liquid reagent is drawn, then pushed through the filter.
▪ A sonic horn actuates, and provides energy to break apart the organisms,
releasing their genetic material.
▪ Next, the liberated genetic material is pushed into the chamber
containing reaction beads.
▪ To mix the solution, the plunger cycles the fluid to dissolve the beads.
The sample is now prepared and pulled into the reaction tube.
▪ The GeneXpert module rapidly heats and cools the reaction tube, while
LEDs illuminate the solution with up to 10 colors of light. If the solution
grows brighter, color detectors confirm the presence of the targeted
DNA we're looking for.
▪ The test is now complete, and the cartridge may be removed from the
gene expert module. All contents remain contained within the cartridge
for safe disposal.

AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS SUMMARY
TOPIC 10: MOLECULAR TESTING ON INFECTIOUS DISEASES ▪ molecular methods intended for the detection of Flavivirus genomes
(FLAVIVIRUSES – DENGUE, ZIKA, ETC.) must be updated continuously with new sequence data to adapt
Lecturer: Ms. Jaspher H. Baliguat, RMT oligonucleotides and probes for the correct detection of circulating
LEARNING OBJECTIVES: strains
After completing this lecture topic, you should be able to: ▪ owing to the genetic relatedness of the different Flaviviruses, Virus-
▪ Discuss the different types of Flaviviruses and know the most prevalent specific molecular methods should be extensively evaluated with related
type that causes human infection in the Philippines Flaviviruses for the presence of nonspecific results that could lead to
▪ Visualize the different structure and genome of Flavivirus wrong diagnoses
▪ Relate the structure and genome of Flaviviruses with the different ▪ sensitivity of the techniques plays a major role in the molecular diagnosis
molecular diagnostic tests of the Flaviviruses, mainly when a low viral load is expected in the
▪ Know the different types of Molecular Diagnostic Tests per type of the samples, as in the case of neurotropic flaviviruses
Flavivirus
▪ The use of generic methods for the detection of flaviviruses is a good
LEARNING OUTLINE: option for diagnosis in areas where different flaviviruses cause nearly
I. Introduction similar symptoms. However, it is a mandatory to perform complementary
▪ Dengue tests to identify the infecting virus unequivocally.
▪ Japanese Encephalitis ▪ Several methods for the molecular diagnosis of the different flaviviruses
▪ West Nile Virus
have been reported. However, in general, these methods have not been
▪ Zika Virus
validated with clinical samples, which would clearly provide a real picture
▪ Yellow Fever
▪ Other Flaviviruses of their reliability in daily practice.
II. Viral Structure and Genome ▪ the ability of some techniques to discriminate between different
III. Molecular Diagnostics serotypes, lineages or subtypes, depending on the flavivirus of interest,
is of benefit for epidemiological purposes and/or clinical management
FLAVIVIRUSES
of the patients
▪ the genus Flavivirus contains more than 70 viruses transmitted to
▪ the development of isothermal methods for the molecular diagnosis of
humans by arthropods (mosquitoes and ticks)
▪ flaviviruses are positive-strand RNA viruses that are closely related flavivirus infections could provide those laboratories in endemic areas
genetically with restricted capacity (e.g. in the field or in point-of-care facilities) with
▪ the viral genome of approximately 10-11 kb encodes a polypeptide that the opportunity to perform the diagnosis with good standards of quality
contains the three viral structural proteins – capsid (C), membrane (M), ▪ From recent external quality assurance studies, we have learnt that the
and envelope (E) – and seven nonstructural (NS) proteins: NS1, NS2A, most important factor for the quality of the diagnostic results is the
NS2B, NS3, NS4A, NS4B, and NS5 competence of each laboratory. Training and participation in external QA
▪ flaviviruses have a global distribution and some members of the genus programs should be carried out regularly for those laboratories involved
constitute a major public health issue (e.g. yellow fever virus, dengue in the molecular diagnosis of flaviviruses.
virus, West Nile virus, Japanese encephalitis virus) with high morbidity or
REFERENCES
mortality rate
▪ clinical diagnosis: not reliable because of the unspecific symptoms and
is mandatory to confirm the etiology of the disease
FAMILY FLAVIVIRIDAE
▪ zoonotic arboviruses
▪ associated with other causes of viral hemorrhagic fever
▪ positive, single-stranded, enveloped viruses
▪ found in arthropods
▪ occasionally infect humans
▪ one genus: Flavivirus
MEDICALLY IMPORTANT FLAVIVIRUSES
mosquito-transmitted viruses tick-transmitted viruses
▪ Yellow Fever ▪ tick-borne Encephalitis
▪ Dengue Fever (MC) ▪ Kyasanur Forest Disease
▪ Japanese Encephalitis (MC) ▪ Alkhurma Disease
▪ Zika Virus ▪ Omsk Hemorrhagic Fever
▪ West Nile Virus
*the viruses are tabulated on the next pages*

w/ DEAN MOSES D.
AIRAH M.
 MOSQUITO-TRANSMITTED VIRUSES

DENGUE FEVER JAPANESE ENCEPHALITIS ZIKA VIRUS

▪ painful, debilitating, mosquito-borne disease that is caused by any one
▪ also known as Jap-E
INTRO

of four closely related dengue viruses

▪ neuro-invasive human pathogenic virus an arthropod-borne virus
▪ mosquito-borne
▪ common in the Philippines
▪ common in the Philippines
▪ genus: Flavivirus
▪ Family: Flaviviridae
▪ virions: spherical, 40-50 nm diameter, inner core (C), lipid envelope with
glycoprotein polymers (E), and membrane (M)
▪ genome: infectious, 11kb, ssRNA, positive polarity
▪ virus is inactivated by heat and disinfectant, containing detergent of lipid
solvent
▪ serotypes: DENV-1, DENV-2, DENV-3, DENV-4

▪ Genus: Flavivirus; Family: Flaviviridae

▪ the virion is enveloped, spherical, and about 50 nm in diameter
▪ its surface proteins are arranged in an icosahedral-like symmetry
▪ single-stranded positive sense RNA
VIRAL PROFILE

▪ approximately 11 kb in length
▪ consists of single open reading frame, flanked with five and three
and translated regions
▪ the viral particle, the E protein, and the cross-section profile of the JE ▪ it also encodes 3 structural proteins and 7 nonstructural proteins
virus are shown in the picture ▪ N-segmented with the envelope icosahedral capsid
▪ contains a nucleocapsid which is surrounded by a lipid envelope
▪ among all three, E gene is the most important and the most studied one
▪ has a roughly spherical shape ▪ there are also seven nonstructural (NS) proteins – NS1, NS2A, NS2B, NS3,
▪ inside the virus is the nucleocapsid which is made of the viral genome NS4A, NS4B, and NS5 – that are also involved in the virus replication
NC proteins
▪ the nucleocapsid is surrounded by a membrane called the viral envelope,
a lipid bilayer that is taken by the host
▪ embedded in the envelope are the E and M proteins that span through
the lipid bilayer: these proteins form a protective outer layer that controls
the entry of the virus into the human cells
▪ the genome encodes 3 structures – capsid (C), membrane (M), and
envelope (E) – and seven nonstructural (NS) proteins: NS1, NS2A, NS2B,
NS3, NS4A, NS4B, and NS5
▪ it is transmitted through a bite/sting of an infected animal or insect ▪ direct contact
spread through a bite of infected mosquito Aedes spp. (Aedes aegypti and
TM

▪ mostly infected Culex species mosquitoes (Culex tritaeniorhynchus) ▪ caused by a virus transmitted primarily by Aedes mosquitoes,
Aedes albopictus)
▪ cannot be transmitted from person to person which bites during the day
▪ presentation of symptoms: mild to severe ▪ the leading cause of viral encephalitis in Asia where there is a ▪ symptoms: generally mild
▪ 1 in 4 infected with dengue get sick manifestation of fever, headache, nausea, diarrhea, vomiting, and ▪ include: fever, rash, conjunctivitis, muscle and joint pain (myalgia
▪ 1 in 20 people with symptomatic dengue fever will develop severe myalgia which may last for several days and arthralgia), malaise, or headache
symptoms ▪ serious illnesses may result to fatal and persistent neurological damage ▪ infection during pregnancy
PATHOGENICITY

▪ each episode of infection, induces a life-long protective immunity to
the homologous serotype but only partial and transient protection
against subsequent infection of other three serotypes (if you have been
infected with one serotype of dengue, you are already given immunity to
that specific serotype, however, this does not mean that you are given
immunity to the other three serotypes)
serum, plasma, anticoagulated blood, tissues from dead patients (from
SPX
▪ the virus is maintained in a cycle between mosquitoes and vertebrate
hosts (pigs and wading birds)
▪ humans are dead-end hosts because they usually do not develop high
enough concentrations of JE virus in their bloodstreams to infect
mosquitoes
▪ can also be prevented by vaccination
o causes infants to be born with microcephaly and other
congenital malformations (Congenital Zika Syndrome)
▪ It is also associated with other complications of pregnancy
including preterm birth and miscarriage
▪ Increased risk of neurologic complications is also associated with
Zika virus infections in adults and in children, including the Guillain-
Barre syndrome, neuropathy, and myelitis
total RNA extracted from Serum (Urine or Saliva)

serum or CSF
autopsy) (serum was not stated by Maam but was on the ppt)

w/ DEAN MOSES D.

AIRAH M.
 PURPOSE ▪ serological – ELISA – standard diagnostic test ▪ IgM Capture ELISA
▪ to confirm the clinical diagnosis ▪ virus isolation ▪ ZIKA MAC-ELISA
▪ to provide information for epidemiologic surveillance ▪ RNA detection ▪ Zika virus IgM Antibody Testing
LAB DIAGNOSIS o viral RNA is extracted from serum or from suspected tissues of the ▪ Plaque Reduction Neutralization Tests (PRNT)
▪ detecting virus or any of its components (virus or its genome, dengue patients or mosquito homogenates ▪ NAAT: can be used on serum, plasma, WB, CSF, urine, or amniotic
antigen) o product is then amplified by RT-PCR and the products are analyzed fluid
▪ serologic response after infection by restriction digestion and determined by the nucleotide sequence ▪ RT-PCR
of the PCR product ZIKA rRT-PCR ASSAY
▪ Viral Isolation and Culture
o identified sequence is compared with the nucleotide sequence found
o disadvantage: the results are available for a number of days as Test Algorithm:
in Gene bank or other databases
compared to PCR testing (hours only) ▪ Screening Assay: Set 1107 (E gene)
▪ RT-LAMP (Reverse Transcription loop-mediated isothermal
▪ Antigen Detection (e.g. fluorescence Ab test) ▪ Confirmatory Assay: Set 4479c (NS2B gene)
Amplification)
▪ Serological
o one step nucleic acid amplification method
o ELISA
o multiply specific sequences of RNA
o Hemagglutination-Inhibition Titers (simple, sensitive, cheap, and
o creates cDNA from RNA
the reagents to be used are easily prepared; disadvantage: there is
o no thermal cycles unlike PCR
pretreatment of samples by acetone before use to remove the
o performed at constant temperatures
inhibitors and also does not discriminate from other flaviviruses,
▪ RT-PCR, 3 available commercial kits
and known positive and negative samples should be used)
o Quantification JEV kit
o Complement-Fixation Test (less sensitive and more specific; no
DIAGNOSIS

o Innoplex JEV detection kit

longer used)
o Geno-Sen’s JEV Real-time PCR kit
▪ Neutralization Test (neutralizing Abs can be detected in early
convalescence in the primary infection) JEV RT-PCR ASSAY
▪ ELISA (IgM, IgG) (some cases are not detected for 7-10 days in the ▪ this is the same with performing the dengue RT-PCR assay
primary infection, and may not be detected in the secondary infection) ▪ sample: total RNA extracted from serum (or CSF)
▪ RT-PCR ▪ test algorithm (NS3 gene):
o used before IgM can be detected in primary infection and usually, o RT-PCR
the RNA cannot be detected after the formation of the Abs) o Nested PCR
o confirm for the secondary infection where the IgM is low and ▪ forward and reverse primers are specific only for JE detection together
undetectable with RNAsin which acts as a ribonuclease inhibitor
o used to detect four serotypes of dengue DENGUE ASSAY RESULTS JEV ASSAY RESULTS
o screening, for samples taken within 5-7 days from appearance of RT-PCR
symptoms
o typing for dengue RNA RNA EXTRACTION
50-100ul of RNA is extracted from
detected samples
patient’s serum before PCR examination
▪ RNA Extraction MANUAL EXTRACTION
▪ Reverse Transcription RNA is extracted by the use of any
o RNA to cDNA manual commercial kits
▪ High Pure Viral RNA from Roche NESTED PCR
▪ PCR
▪ QIAmp Viral RNA Mini Kit from Qiagen
o Amplification For the interpretation of results:
AUTOMATED EXTRACTION
(Hybridization) ▪ If all samples were (+) in duplicate, like if it’s (+) in 1107 and in
▪ MagNA pure LC RNA isolation kit
⇥ target sequences 4479c, It is reported as Positive
amplified into million copies ▪ If they are not (+) in all wells or only (+) in one gene, either 1107
⇥ repeated heating and cooling cycles or 4479c, it is reported as Equivocal
o Detection: probes are used to detect presence of dengue RNA ▪ If it is (-) in all wells, it is reported as Negative
REPORTING OF RESULTS
NESTED FINAL
LANE RT-PCR
PCR RESULT REPORTING OF RESULTS INTERPRETATION
2: Sample A
POS DENV-1
DENV-1 RT-PCR NESTED PCR FINAL RESULT POSITIVE NEGATIVE EQUIVOCAL
(511 bp) (482 bp) Ct <38 Ct >38 Ct <38 in 1 of the 2 wells
POS POS
RESULTS

POS DENV-2 JEV

3: Sample B DENV-2 (382 bp) (19 bp)
(511 bp) (119 bp) QC CRITERIA
POS DENV-3 NEG NEG ALL POS CONTROLS ALL NEG CONTROLS
4: Sample C
(511 bp) (290 bp)
DENV-3 NEG
(no 382 bp) (no 192 bp)
POS DENV-4 Ct = 20-35 Ct >38
5: Sample D DENV-4
(511 bp) (392 bp)
NEG NEG (no
6: Sample E NEG
(no 511 bp) 392 bp)

w/ DEAN MOSES D.

AIRAH M.
 RT-PCR RT-PCR rRT-PCR

Zika Forward and Reverse primers together with the Labelled Probe
TEST ASSAYS

are used. So the amount for the mastermix is 20 uL and the template
NESTED PCR is 5 uL. So again, it has the same procedure for the general procedure
NESTED PCR for PCR. You have the Buffer preparation, RNA-template Addition,
and the Amplification. The ONLY difference for all the protocols or
detection are the Reagents and your Forward & Reverse Primers.

Instruments Used for Molecular Diagnostics of Flaviviruses ▪ screening for samples within 5-7 days appearance of
RT-PCR: Instruments Used symptoms Diagnostic Time to
Clinical Sample Methodology
Method results
▪ Thermal Cycler (Biorad) ▪ testing of RNA detected samples of suspected individuals
mosquito or
▪ LightCycler Instrument (Roche) having the dengue infection

Virus detection & its components

mosquito cell
▪ ABI 7500/7500 FAST (Applied Biosystems) ▪ depend upon what protocol to be followed and what Viral isolation ≥ 1 week
culture
▪ Rotor Gene-Q (Qiagen) instrument to be used in order to generate the data or
EXTRA INFO FOR FLAVIVIRUS ASSAY

inoculation
▪ Mastercycler nexus gradient (Qiagen) results for the dengue detection RT-PCR and
Acute serum Nucleic acid
real time RT- 1-2 days
For the detection of the dengue virus, which includes the (1-5 days of fever) detection
PCR
serotyping, (based on Maam’s experience) it will take 2 days and necropsy tissues
NS1 Ag rapid
(1st day: 1st round of PCR; 2nd day: 2nd round or serotyping or minutes
tests
nested PCR). Then it will proceed to automated or manual Antigen detection NS1 Ag ELISA 1 day
serotyping using the AGE or CE (CE much faster than AGE). immune-
2-5 days
histochemistry
Patient Sera (acute ELISA
1-2 days

Serological Response
serum from 1-5 days IgM or IgG HIA
and 2nd serum 15-21 seroconversion Neutralization minimum
days after) Test of 7 days
IgM detection ELISA 1-2 days
Serum after 5th day (recent infection) Rapid Tests minutes
of fever IGG ELISA
IgG detection 1-2 days
HIA

w/ DEAN MOSES D.

AIRAH M.
 WEST NILE VIRUS YELLOW FEVER
▪ originated in Africa
▪ during 18th and 19th centuries: considered as one of the most dangerous infectious diseases
INTRO

one of the most widespread flavivirus ▪ 1927: Yellow fever virus was the first human virus to be isolated
▪ prototype flavivirus
▪ takes its name from the Latin for Yellow (Flavus)
VIRAL PROFILE

▪ the particle is small, icosahedral, enveloped.

▪ the single-stranded infectious RNA genome is packaged in an icosahedron nucleoside with a lipid envelope
it contains a lipid bilayer, its core, and E and M proteins (upper image: B) and viral spike proteins, the prM and the E
it also has the structural and non-structural proteins (lower image) ▪ the prM protein is processed to M by “virion”- mediated cleavage into immediately before it rests
▪ ssRNA molecule of positive polarity
▪ single open reading frame encoding 10 viral proteins: 3 are structural, 7 are nonstructural proteins
▪ transmitted between birds and mosquitoes
▪ the disease is caused by Yellow Fever Virus and is spread by the bite of an infected female mosquito
TM

▪ acquired by humans through mosquito bites or human-to-human transmission by blood transfusion or

▪ spread primarily by Aedes aegypti, a type of mosquito found throughout the tropics and subtropics
organ transplantation
▪ it infects only humans, other primates, and several types of mosquitoes
PATHO

▪ severe liver and renal dysfunction

manifest flu-like symptoms to neurological manifestations
▪ circulatory shock and hemorrhage
▪ one of the most lethal viral diseases
▪ viral isolation from Blood and CSF – Gold Standard ▪ (mostly) serology: by ELISA
▪ diagnostics predominantly serological ▪ to confirm a suspected case, blood-sample testing with PCR is required
DX

▪ additional confirmation with viral neutralization tests in areas with several circulating flaviviruses ▪ largely molecular
▪ PCR: TaqMan Real-time PCR and NASBA Real-time PCR ▪ PCR: Real-time TaqMan RT-PCR, Real-time SYBR-Green RT-PCR, Heminested RT-PCR, and Virus isolation

FLAVIVIRUS DIAGNOSIS ALGORITHMS

SUMMARY OF MEDICALLY IMPORTANT FLAVIVIRUSES acute phase convalescent phase preferred sample↑ viral load expected
▪ testing the Yellow Fever virus during the acute phase and its convalescent period is YFV RT-PCR, RT-qPCR, IgM, virus isolation IgM, IgG serum, plasma, tissue high
important since the viral load is expected to be increased or high RT-PCR, RT-qPCR, NS1 Ag, IgM,
▪ for Dengue Virus, RT-PCR and rapid test are also collected and performed during the DENV IgM, IgG serum, plasma, CSF, PBMCs up to 106 virions/ml
virus isolation
acute and convalescent phase by using serum or plasma where it will yield up to 106
WNV RT-PCR, IgM, IgG IgM, IgG CSF and serum low
virions per mL
JEV RT-PCR, IgM, IgG IgM, IgG CSF, serum, blood, PBMCs low
▪ for West Nile Virus, Japanese Encephalitis Virus, and Tick-Borne Encephalitis Virus: the
TBEV RT-PCR, IgM, IgG IgM, IgG CSF and serum low
samples are also collected during their acute and convalescent period but is expected
Bold font denotes the most commonly used measure in diagnostic labs.; PBMC: peripheral blood mononuclear cell
to yield low viral load concentration ↑
for molecular diagnostics

w/ DEAN MOSES D.

AIRAH M.
 TICK-TRANSMITTED VIRUSES

ALKHURMA HEMORRHAGIC FEVER VIRUS

TICK-BORNE ENCEPHALITIS (TBE) KYASANUR FOREST DISEASE OMSK HEMORRHAGIC FEVER
(ALKHURMA DISEASE)
▪ it is a zoonotic virus ▪ 1947 when it was first isolated
▪ discovered in 1957 as a cost of fatal febrile disease of humans
▪ TICK HOSTS: ▪ it is a disease caused by tick-borne flavivirus and
in India Karnataka state in India
o Soft Tick: Ornithodoros savignyi associated with occupational or recreational activities
▪ also referred to as “Monkey Fever”
o Hard Tick: Hyalomma dromedary ▪ it is found in a small region near Omsk in Siberia, Russia
INFORMATION

▪ tick-borne viral hemorrhagic disease which can be fatal to

human viral infectious disease ▪ people can become infected through a tick bite ▪ synonym: tick-borne encephalitis (Far eastern subtype)
humans and other primates
involving the CNS and occurring in or when crushing infected ticks (uh oh) ▪ Flaviviridae: spherical, Enveloped virions about 45 nm in
▪ VECTOR: ticks of the genus Haemaphysalis, particularly H.
many parts of Europe and Asia ▪ no human-to-human transmission of AHF has diameter, single stranded positive sense RNA genome
spinigera, and 2 species of Ixodes ticks, but the virus has also
been documented ▪ HOST RANGE: humans, rodents, muskrat, ticks (possible)
been isolated from argasid (soft-skinned) tick Ornithodoros
▪ incubation period: could be as short as 2-4 days ▪ incubation period: 2-10 days
crossi
▪ the Alkhurma virus prototype strain in 1776 was o febrile period: 5-12 days in 40% of patients
▪ MAIN HOSTS: rodents
retrieved from a person in Saudi Arabia during o 2nd febrile period: 10-15 days after infection
the 1990s ▪ mortality rate: estimated to be 0.4-2.5%
VIRAL PROFILE

▪ ANHC (?), pRM, M, NS2A, NS2B, NS3, NS4A, 2K(?),

- NS4B, and NS5 proteins are all of the same length
[(?) – she mentioned it but it’s not in the pic so idk]
▪ Alkhurma disease virus owns the largest
▪ positive strand RNA virus
polyprotein of all tick-Borne flaviviruses
▪ its genome was discovered to code for 1 polyprotein
calculated as of yet
o this is cleaved post-translationally into 3 structural proteins
▪ has been found to be closely related to the
▪ capsid protein
Kyasanur Forest disease, with which it shares 89%
▪ glycoprotein M also contains an envelope protein, capsid protein, viral
Nucleotide sequence in homology envelope, and RNA genome. It has structural and non-
▪ envelope glycoprotein E
o and 7 other non-structural proteins (seen at the pic) structural proteins
THE DISEASE PRESENTATION
FIRST PHASE SECOND PHASE
▪ most often manifested as a two-
initially with non- ▪ has appeared in some ▪ sudden onset of fever, chills, headache, pain in the lower
phased illness ▪ a flavivirus that causes severe hemorrhagic fever with specific flu-like patients and upper extremities, and severe frustration
neurological manifestations such as mental disturbances, symptoms ▪ includes neurologic and
FIRST PHASE SECOND PHASE ▪ papulovesicular rash in the soft palate, cervical
severe headache, tremors, and vision deficits in infected human ▪ fever hemorrhagic symptoms
PATHOGENICITY

associated with involves the lymphadenopathy, and conjunctival suffusion are usually
▪ anorexia in severe form
symptoms like neurological system beings with a fatality rate of 3-10%
▪ general malaise ▪ multi-organ failure present
fever, fatigue, with symptoms of ▪ transmission to humans may occur after a tick bite or contact diarrhea precedes fatal outcomes
headache, meningitis1 and/or
▪ ▪ CNS abnormalities develop after 1-2 weeks with severe
with an infected animal, most importantly a sick or recently ▪ vomiting
muscular ache, encephalitis2 cases present with hemorrhages, low cutaneous rash, and
dead monkey ▪ exposure: contact with livestock with tick
and nausea leukopenia and thrombocytopenia are marked
1
inflammation of the membrane that o no person-to-person transmission has been described exposure or risk factors for humans as is contact
▪ estimated case for fatalities are 1-10%
surrounds the brain and spinal cord with infected ticks whether crushing infected
▪ previous infection leads to immunity
2
inflammation of the brain (bigbrain eyy) ticks with unprotected fingers or by a bite from
an infected tick
▪ can be made in the early stage of illness by molecular detection ▪ can be made in the early stage of the illness by ▪ virus isolation in cell culture
▪ based on the detection of Specific IgM
DIAGNOSIS

by PCR or virus isolation from blood molecular detection by PCR or Virus isolation ▪ serological testing using immunosorbent assay (ELISA)
Antibodies in CSF (Intrathecal
o later, serologic testing using ELISA can be performed from blood can also be done
production) and/or serum, mainly by
▪ diagnosis suspicion by clinical signs and symptoms ▪ serologic testing using ELISA ▪ molecular techniques like PCR can be performed
ELISA

w/ DEAN MOSES D.

AIRAH M.
▪ TBE antibodies appear 0-6 days after
onset and are usually detected when
neurological symptoms are present
▪ specific IgM Antibodies can persist for
up to 10 months in vaccines or
individuals who acquired the infection
naturally
▪ IgG antibodies cross-reaction is
possibly observed with other
flaviviruses
▪ detection by PCR methods could be
valuable for an early differential
diagnostic of TBE
▪ serological evidence by hemagglutinin & immunofluorescence,
neutralization tests
▪ since available conventional diagnostic tests such as Virus
isolation and serological tests, Hemagglutination inhibition and
complement fixation tests are time consuming, there is a study
that reports the development for a rapid and accurate diagnosis
of a suspected Kyasanur forest disease cases:
o IgM antibodies capture ELISA (MAC-ELISA)
o Nested RT-PCR (nRT-PCR)
o TaqMan-based real-time RT-PCR

LABORATORY CRITERIA
(for case confirmation)
at least one of the following five:
▪ TBE specific IgM AND IgG antibodies
in blood
▪ TBE specific IgM antibodies in CSF
▪ Seroconversion or 4-fold increase of
TBE-specific antibodies in paired
serum samples
MOLECULAR METHODS
▪ detection of TBE viral nucleic acid in a
clin spx
▪ isolation of TBE virus from clin spx

w/ DEAN MOSES D.

AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS PROTECT YOURSELF FROM HIV ▪ can be dormant up to 10 years without showing any signs &
TOPIC 11: HIV MOLECULAR TESTING ▪ Get tested at least once or more often if you are at risk. symptoms (just a carrier)
Lecturer: Sir Nestor M. Pompa Jr., RMT, MPH (c) ▪ Use condoms the right way every time you have anal or vaginal sex. ▪ HIV infection in humans came from a type of chimpanzee in Central
Since HIV was first identified in the early 1980s, millions of people continue ▪ Choose activities with little to no risk like oral sex. Africa
to die every year due to HIV-AIDS. This was another pandemic that was not ▪ Don’t inject drugs, or if you do, don’t share needles, syringes, or other ▪ chimpanzee version of the virus (called simian immunodeficiency
suppressed. No vaccine was developed, but medical advances are helping injection equipment. virus, or SIV) was probably passed to humans when humans hunted
to reduce the number of new infections and improve the quality of life and ▪ If you are at risk for HIV, ask your health care provider if pre-exposure these chimpanzees for meat and came in contact with their infected
prognosis for people living with HIV (PLHIV). prophylaxis (PrEP) is right for you. blood as far back as late 1800’s
▪ If you think you’ve been exposed to HIV within the last 3 days, ask a ▪ 2 species in humans are HIV-1 (PH, Asia) & -2 (Africa)
OBJECTIVES:
health care provider about post-exposure prophylaxis (PEP) right ▪ antibodies to HIV typically appear 4-6 weeks after infection
▪ Discuss the laboratory algorithm in the detection of HIV
away. PEP can prevent HIV, but it must be started within 72 hours. ▪ p24 antigen:
▪ Explain the principles of molecular methods in detecting HIV
▪ Get tested and treated for other STDs. o can usually be detected in blood sample from 2-4 weeks after
▪ Interpret results generated by these methods
KEEP YOURSELF HEALTHY & PROTECT OTHERS IF YOU HAVE HIV infection
▪ Provide limitations of the tests
▪ Find HIV care. It can keep you healthy and help reduce the risk of o becomes rapidly undetectable once antibodies to HIV start to
▪ Discuss the quality assurance involved in ensuring the reliability of result
transmitting HIV to others. develop: that is why in serology, there are HIV markers that we can
TOPIC OUTLINE: ▪ Take your HIV medicine as prescribed. test (one of this is the p24 protein)
I. Introduction ▪ Stay in HIV care. STAGES OF HIV INFECTION
II. Algorithm ▪ Tell your sex or injection partners that you have HIV. Use condoms
1 ACUTE HIV INFECTION
III. Nucleic Acid Testing the right way every time you have sex, and talk to your partners about
▪ detectable level of HIV in the blood (detectable in screening tests)
IV. Western Blot Testing PrEP.
▪ they are very contagious
V. Quality Assurance ▪ Get tested and treated for other STDs.
▪ some people have flu-like and other symptoms such as chills, rush,
INTRODUCTION HIV IN THE PH AS OF APRIL 2020: according to National HIV/AIDS &
night sweat, muscle aches, & swollen lymph nodes
STI Surveillance and Strategic Information Unit (NHSSS)
▪ only antigen/antibody tests or nucleic acid tests (NATs) can diagnose
UNITED NATION’S PROGRAM: ▪ 77,882 individuals have been diagnosed with HIV since 1984
acute infection
THE 8 MILLENNIUM DEVELOPMENT GOALS ▪ 257 newly diagnosed cases in April 2020
2 CHRONIC HIV INFECTION
1 eradicate extreme poverty and hunger ▪ NOTE: Reported number of newly diagnosed cases were limited to
▪ aka asymptomatic HIV infection or clinical latency
2 achieve universal primary education the specimen received by SACCI during the reporting period and may
▪ HIV is still active but reproduces at very low levels
3 promote gender equality and empower women have been affected by the ECQ. Notable decrease is still subjected for
▪ people may not have any symptoms or get sick during this phase but
4 reduce child mortality further validation and readers are advised to interpret the data with
can transmit the infection
5 improve maternal health caution and consider other sources of information before arriving at
▪ without taking HIV medicine, this period may last a decade or longer,
6 combat HIV/AIDS, malaria, and other diseases conclusions.
but some may progress faster
7 ensure environmental sustainability AGE GROUP ▪ people can transmit HIV in this phase
8 global partnership for development <15 15-24 25-34 35-49 ≥50 ▪ at the end of this phase, viral load goes up and the CD4 cell count
2,081 (3%) 230 (<1%) 22,406 39,482 13,610 goes down (note: HIV has a receptor to CD4 which is found in helper
HIV
no data on age for 73 cases T cells): the person may have symptoms as the virus levels increase in
▪ an icosahedral virus, a unique virus because it is an RNA (if outside of the
the body, and the person moves into Stage 3
host body)
MODES OF TRANSMISSION ▪ people who take HIV medicine as prescribed may never move into
▪ if within the host, HIV turns into its DNA form
M2M sex sex with M and F M2F sex Stage 3
▪ a lentiviridae, subfamily of retrovirus, formerly known as oncornaviruses
▪ infect human WBCs, specifically T helper cells (T4) 53% (41,082) 27% (21,414) 16% (12,149) 3 AIDS
▪ invades the CD4 cells in the body of the host injecting drugs others* mother-to-child ▪ most severe phase of HIV infection
▪ a global pandemic even in PH, still with an increasing number of cases 3% (2,333) 1% (696) <1% (208) ▪ people with AIDS have such badly damaged immune systems that
▪ preventable, manageable, but not curable *others include the following MOT: blood/blood products (20), they get an increasing opportunistic infections
▪ no vaccine is developed but there are treatment available (anti-retroviral needle prick injury (3), and those with unknown MOT (673) ▪ CD4 cell count drops below 200 cells/mm, or if they develop certain
drugs) opportunistic infections (that is why the main marker for AIDS is the
SEX CD4 count)
HIV 101 MALES FEMALES ▪ people with AIDS can have a high viral load and be very infectious
Without treatment, HIV can make a person very sick and even cause 94% (73,092) 6% (4,779) ▪ without treatment, people with AIDS typically survive about 3 years
death. Learning the basics about HIV can keep you healthy and prevent no data on sex for 11 cases
transmission. STRUCTURE AND GENOME OF HIV
HIV ▪ roughly spherical with a diameter of about 120 nm, around 60 times
CAN BE TRANSMITTED BY NOT TRANSMITTED BY ▪ member of the genus Lentivirus, part of the family Retroviridae smaller than RBC
▪ sexual contact ▪ air or water ▪ transmitted as single stranded RNA ▪ capsid is composed of 2,000 copies of the viral protein p24
▪ sharing needles to inject ▪ saliva, sweat, tears, or closed- ▪ converted into double stranded DNA by reverse transcriptase once ▪ nucleocapsid proteins is made of protein p7 & makes up the viral
drugs mouth kissing inside the body of the host RNA genome
▪ mother to baby during ▪ insects or pets ▪ attacks the CD4 helper T-cells of the immune system ▪ enzymes needed for the development of the virion such as reverse
pregnancy ▪ sharing toilets, food, or drinks transcriptase, proteases, ribonuclease, and integrase in the matrix

AIRAH M.
▪ viral matrix composed of the viral protein p17 that surrounds the ▪ target sequence for viral transactivation
capsid ensuring the integrity of the virion particle ▪ the binding site for Tat protein and for cellular proteins
▪ viral envelope contains proteins from the host cell and relatively few ▪ consists of approximately the first 45 nucleotides of the
copies of the HIV envelope protein, which consists of a cap made of viral mRNAs in HIV-1 or the first 100 nucleotides in HIV-
TAR
three molecules known as glycoprotein (gp) 120, and a stem 2 and SIV: hence, TAR serve as the differentiating factor
consisting of three gp41 for HIV-1 and HIV-2
▪ TAR RNA forms a hairpin stem-loop structure with a side
bulge: the bulge is necessary for Tat binding and function
▪ rev responsive element
▪ RNA element encoded within the env region of HIV-1
RRE
and necessary for Rev function VPR
▪ not found in HIV-2
▪ psi elements
▪ a set of 4 stem-loop structures preceding and
PE
overlapping the Gag start codon and are the sites
recognized by the cysteine histidine box
▪ slippery site
SLIP ▪ responsible for regulating the -1 ribosomal frameshift
out of the Gag reading frame into the Pol reading frame
▪ cis-acting repressive sequences
CRS
▪ inhibit structural protein expression in the absence of Rev VPU
▪ inhibitory/instability RNA sequences
▪ found within the structural genes of HIV-1 and of other
▪ envelope protein is encoded by the HIV env gene that allows the complex retroviruses
INS
virus to attach to target cells and fuse the viral envelope with the ▪ inhibit expression post-transcriptionally & inactivated
target cell's membrane releasing the viral contents into the cell and during mutation
initiating the infectious cycle ▪ absent in HIV-2 NEF
▪ major target for HIV vaccine effort
HIV GENES AND GENE PRODUCTS
(target proteins/sites for 1° & 2° primers in the master mix of reagent) VPX
▪ group specific antigen
GAG
▪ genomic region encoding the capsid proteins
▪ polyprotein NUCLEIC ACID TESTING (PCR BASED): can produce results in 2h minimum
POL ▪ genomic region encoding the viral enzymes protease,
▪ molecular structure of the viral spike by X-ray crystallography and reverse transcriptase, and integrase Abbott m-PIMA analyzer
▪ promotes the infectivity but not the production of viral
particles
▪ in the absence of Vif, the produced viral particles are
defective, while the cell-to-cell transmission of virus is
not affected significantly
▪ viral protein R
▪ a 96-amino acid (14-kD) protein incorporated into the
virion
▪ it interacts with the p6 Gag part of the Pr55 Gag
precursor
▪ functions for Vpr include:
o targeting the nuclear import of pre-integration
complexes
o cell growth arrest
o transactivation of cellular genes
o induction of cellular differentiation
▪ viral protein U
▪ is unique to HIV-1 and absent in HIV 2
▪ this is the target of the differentiation test for HIV-1 and
HIV-2 in molecular
▪ is a 16-kd (81-amino acid) type I integral membrane
protein with at least two different biological functions:
o degradation of CD4 in the endoplasmic reticulum
o enhancement of virion release from the plasma
membrane of HIV-1-infected cells
▪ auxiliary gene that contributes to the virulence of HIV,
abundantly produced during the early phase of viral gene
expression
▪ virion protein of 12 kD found in HIV-2 but not in HIV-1,
necessary for viral replication
*HIV Algorithms to HIV Generation Assays found on the last two pages*
Abbott m-PIMA HIV-1/2
test cartridge
Cepheid GX4 instrument

cryogenic electron microscopy ▪ envelope

▪ RNA genome: 7 structural landmarks (LTR, TAR, RRE, PE, SLIP, CRS, ▪ viral glycoproteins produced as a precursor (gp160),
and INS) and 9 to 10 genes (gag, pol, and env, tat, rev, nef, vif, vpr, RRE which is processed to give a noncovalent complex of the
vpu, and sometimes a 10th tev, which is a fusion of tat, env and rev), external glycoprotein gp120 and the transmembrane
encoding 19 proteins such as gp120, gp160, & gp41 glycoprotein gp41 HIV-1 and HIV-2 differentiation
HIV-1 the amplification chamber
▪ the landmarks in the target genes serve as the primers (primary and ▪ transactivator Cepheid Xpert HIV-1 DRW SAMBA II test module DRW SAMBA II plasma
secondary primers) in the detection of RNA using PCR ▪ transactivator of HIV gene expression viral load test cartridge with controller semiquantitative test
▪ one of two essential viral regulatory factors (Tat and Rev)
for HIV gene expression
TAT
▪ two forms are known:
o Tat-1 exon (minor form) of 72 amino acids
o Tat-2 exon (major form) of 86 amino acids
placed on the Cepheid
▪ can be exhibited in viral cell culture instrument
HIV-1 and HIV-2 differentation

▪ regulatory Cepheid Omni Molbio Diagnostics Trueprep

instrument & controller sample prep device
▪ second necessary regulatory factor for HIV expression
▪ a 19-kD phosphoprotein, localized primarily in the
REV
nucleolus/nucleus, Rev acts by binding to RRE and
SEVEN STRUCTURAL LANDMARKS promoting the nuclear export, stabilization, and
▪ long terminal repeat utilization of the viral mRNAs containing RRE
already has the internet-
LTR ▪ contains important regulatory regions, especially those ▪ viral infectivity factor based results (share results
VIF
for transcription initiation and polyadenylation ▪ a basic protein typically 23 kD in the net)

AIRAH M.
 Molbio Diagnostics Truelab amplification instruments in the following module formats: 2 GeneXpert by Cepheid THREE BASIC STEPS IN WESTERN BLOT TECHNIQUE
UNO DUO QUATTRO
▪ detects HIV 1 in 90 minutes 1 separation by size
▪ uses 100 μl of WB or 1 DBS (60-70 μL) 2 transfer to a solid support (nitrocellulose sheet)
▪ LOD is 278 cp/mL for WB samples and the LOD for the DBS samples marking target protein (immunoblotting) using a proper primary
3
is 668 cp/mL and secondary antibody to visualize
▪ RNA extraction, purification, reverse transcription, and cDNA real time
quantitation GENERAL WESTERN BLOT WORKFLOW
GENERAL STEPS 1 select the method
method selection depends largely on the starting sample (liquid protein
sample or gel)
2 select the equipment
▪ consider the experimental approach, sample format, and desired
resolution, and throughput
▪ thermal cycler, electrophoresis machine, blotting cassette
3 prepare the reagent
▪ selecting the appropriate membrane and transfer buffer is critical to
successful protein transfer
▪ consider the size and change of the proteins, the transfer method,
and the binding properties of the membrane
▪ blotting material, wash buffer, reagent
Regardless of the models of the machine, they all follow these basic 4 perform the transfer
steps. 3 SAMBA by Diagnostics for Real Worlds ▪ set up the transfer apparatus
STEPS IN PCR TESTING ▪ for electrophoretic transfer, select the transfer conditions: use the
▪ HIV-1 Qual Whole Blood Test is an highest electric field strength (V/cm) possible within the heat
in vitro nucleic acid amplification- dissipation capabilities of the system
based test (NAT) for the detection of 5 detect and image the protein
HIV-1 viral RNA and pro-viral DNA ▪ the choice of staining or detection technique is determined by
▪ requires 100 ul of WB sample sensitivity requirement and the imaging equipment available
▪ sample preparation, amplification,
& detection WESTERN BLOT PROCEDURE (MERK PROTOCOL)
▪ primers for LTR protein 1 Sample Preparation: Cell Lysis and Protein Extraction
▪ LOD: 200–1000 copies/ml 2 SDS-PAGE Gel Electrophoresis
▪ running time: 4 – 8 hours 3 Membrane Transfer
▪ tank transfer
WESTERN BLOT TECHNIQUE ▪ semi-dry transfer
4 Immunodetection
▪ traditional immunodetection
▪ 30-minute immunodetection protocol using the SNAP i.d. ® System
▪ walk-away immunodetection with Immobilon GO

WESTERN BLOT PROCEDURE (CONVENTIONAL METHOD)

in real setting, the procedure depends on the protocol followed
EQUIPMENTS 1 Sample Preparation
1 m-PIMA™ HIV-1/2 Detect test ▪ Using the formula: concentration=mass/volume, determine the
▪ a qualitative nucleic acid amplification volume of protein extract to ensure 50 μg in each well.
test for the detection of Human ▪ Add 5 μL sample buffer to the sample and make the volume in each
Immunodeficiency Virus (HIV) type 1 lane equalized using double distilled H2O (dd H2O). Mix well.
groups M/N and O, and type 2 RNA in ▪ Heat the samples with dry plate for 5 minutes at 100°C.
human whole blood and plasma ▪ detecting individual proteins of an HIV-1 lysate are separated according 2 Gel Preparation
samples to size by polyacrylamide gel electrophoresis ▪ Prepare 10% stacking gel & 5 % separating gel. (see image below)
▪ only 25 μL of peripheral blood or ▪ the viral proteins are then transferred onto nitrocellulose paper and ▪ After preparing the 10% stacking gel solution, assemble the rack for
plasma is required to deliver lab reacted with the patient's serum gel solidification.
accurate results for the detection of ▪ any HIV antibody from the patient's serum is detected by an antihuman ▪ Add stacking gel solution carefully until the level is equal to the green
HIV-1 and HIV-2 in 52 minutes immunoglobulin G (IgG) antibody conjugated with an enzyme that in the bar holding the glass plates. Add H2O to the top. Wait for 15–30
▪ process includes RNA Isolation, Reverse Transcription, Amplification, presence of substrate will produce a colored band minutes until the gel turning solidified.
and Detection ▪ positive and negative control serum specimens are run simultaneously ▪ Overlay the stacking gel with the separating gel, after removing the
to allow identification of viral proteins water.

AIRAH M.
▪ Insert the comb, ensuring that there are no air bubbles. ▪ Separate glass plates and retrieve the gel. Reverse Transcriptase p51 p53
▪ Wait until the gel is solidified. ▪ Create a transfer sandwich as follows: Endonuclease p31 p31-34
o Sponge Gag Primer
o 3 Filter Papers Gag Precursor p55 p56
o Gel PVDF Core p24 p26
o 3 Filter Papers Matrix p17 p16
▪ Relocate the sandwich to the transfer Nucleocapsid Precursor p15
apparatus, which should be placed on ice to
maintain 4°C. Add transfer buffer to the INTERPRETIVE CRITERIA FOR HIV-1 WESTERN BLOT
apparatus, and ensure that the sandwich is POSITIVE NEGATIVE INDETERMINATE*
covered with the buffer. Place electrodes on at least two of the one or more bands
top of the sandwich, ensuring that the PVDF following bands: no bands present not meeting
membrane is between the gel and a positive p24, gp41, gp120/160 positive criteria
electrode.
▪ Transfer for 90 minutes. The running time
should be proportional to the thickness of
3 Electrophoresis the gel, so this may be reduced to 45
▪ Pour the running buffer into the electrophorator. minutes for 0.75 mm gels.
▪ Place gel inside the electrophorator and connect to a power supply. 6 Blocking and Antibody Incubation
When connecting to the power source always connect red to red, and ▪ Add secondary antibody in 5% skim milk in
black to black. Tris Buffer Saline Tween-20 (TBST) and
▪ Make sure buffer covers the gel completely and remove the comb incubate for 1 hour.
carefully. ▪ Wash the membrane with TBST for 5
▪ Load marker (6 μL) followed by samples (15 μL) in to each well. minutes. Do this 3 times.
▪ Run the gel with low voltage (60 V) for separating gel; use higher ▪ Prepare Enhanced Chemiluminescence (ECL) *Most common bands seen with indeterminate Western blot (IWB): p17,
voltage (140 V) for stacking gel. mix following the proportion of solution A p24, p55
▪ Run the gel for approximately an hour, or until the dye front runs off and B provided by the manufacturer.
the bottom of the gel. Incubate the membrane for 1–2 minutes. QUALITY ASSURANCE IN HIV TESTING
Use a 1000 μL pipette to ensure that ECL 1 PRE-ANALYTICAL PHASE
covers the top and bottom of the ▪ training
membrane. ▪ laboratory safety
▪ Visualize the result in the dark room. If the background is too strong, ▪ number of trained personnel available and capable of performing HIV
reduce exposure time. testing
HIV-1 WESTERN BLOT ANTIGENS ▪ specimen collection, labeling, and transport conditions
After the addition of the dye or ECL, you can now see the strip bars or ▪ treatment of specimens before testing
bar graph that represent the target proteins. ▪ sources and types of specimens tested
▪ number of specimens tested
▪ selection of test kits
▪ expiration dates of test kits
4 Electrotransfer ▪ Countries should require that all laboratories at all levels must
participate in an external quality assurance (EQUAS) of a laboratory’s
performance.
▪ HIV test kit reagents must be provided by authorized & approved
manufacturers and must be stored at the appropriate temperature as
specified in the product insert provided by the manufacturer.
2 ANALYTICAL PHASE
▪ specimen processing and storage
▪ written procedure manual
HIV-1 and HIV-2 GENE PRODUCTS & WESTERN BLOT ▪ reagent preparation
HIV Gene and Products HIV-1 HIV-2 ▪ testing performance: running of positive and negative controls
Env Primer ▪ performance & maintenance of equipment (e.g. spectrophotometers,
Precursor Protein gp160 gp140 washers)
▪ Cut 6 filter sheets to fit the measurement of the gel, and one External Glycoprotein gp120 gp105/125 ▪ correct use of reagents
polyvinylidene fluoride (PDVF) membrane with the same dimensions. Transmembrane Glycoprotein gp41 gp36/41 ▪ inclusion of internal quality controls in the test kits
▪ Wet the sponge and filter paper in transfer buffer and wet the PDVF Pol Primer ▪ quality control monitoring procedure
membrane in methanol. Reverse Transcriptase p66 p68

AIRAH M.
 3 POST-ANALYTICAL PHASE HIV GENERATION ASSAYS
▪ interpreting results
▪ transcribing results, e.g., recording results on the correct identifier
code
▪ entering data into the tracking system (computer or hard copy)
▪ maintaining records
▪ reviewing quality control

SAFETY PROCEDURE
1 Proper waste disposal & handling of sharps.
Use protective barriers such as rubber gloves and other PPE to
2 prevent exposure to blood, body fluids containing visible blood,
and other fluids to which universal precautions apply.
Immediately and thoroughly wash hands and other skin surfaces
3 that are contaminated with blood, body fluids containing visible
blood, or other body fluids to which universal precautions apply.

REFERENCES
▪ Molecular Diagnostics, Fundamentals, Methods & Clinical Applications
by Buckingham, Lela
▪ www.cdc.gov
▪ www.who.org
▪ www.doh.gov.ph

(confirmatory)

AIRAH M.
 In 2018, the DOH proposed this
new algorithm wherein the
specimens will not be sent to the
NRLSACCL in order to have rapid
and shortened results.

The following tests are used in the

rHIVda Confirmatory Testing
for NRL-SLH/SACCL:
▪ T1-Sysmex HISCL HIV Ag+Ab
Assay Kit
▪ T2-Vidas HIV Duo Ultra or SD
HIV-½ 3.0 or Alere Determine
HIV ½
▪ T3-Geenius HIV ½
Confirmatory Assay Kit

SAFEGUARDS AGAINST ABUSE OF HIV TESTING SERVICES

Population Frequency of HTS: The current policy on HIV testing services specify subsets of the population
that should undergo routine HIV testing, including a recommendation on the frequency of testing.

COMPARISON OF POPULATION BASED ON EXISTING AND PROPOSED POLICIES

CURRENT PHILHEALTH
DOH-PHILIPPINES (AO 2017-0019)
OHAT PACKAGE
▪ only confirmed HIV/AIDS HIV testing should be routinely offered, prioritized for, and promoted to the
cases by SACCL or RITM following:
▪ the package does not ▪ Key population including adolescents
state coverage on the ▪ High risk individuals who have not been tested recently
COMPARISON OF THE CURRENT HIV TESTING ALGORITHM AND THE PROPOSED rHIVda: costs for screening ▪ Partners, infants, and children of PLHIV
Current National HIV Testing Diagnostic Algorithm in PH and/or diagnosis of HIV ▪ Patients showing signs & symptoms consistent with AIDS defining illness
▪ The current HIV testing ▪ Patients with STIs
diagnostic algorithm in the ▪ Patients with Hepatitis B and C
Philippines (Figure 1 on right: ▪ Patients with undergoing and not responsive to interventions
Current National HIV Testing ▪ All confirmed tuberculosis patients
Diagnostic Algorithm [Telan, ▪ All pregnant women regardless of risk
2018]) include screening test Frequency of Testing
from referring labs. ▪ Every 3 months
▪ A reactive result from the ▪ Every trimester and at least once while breastfeeding for pregnant women
screening test will be sent to who belong to the key population or a partner of a PLHIV
SACCL for confirmatory testing, Rapid HIV Diagnostic Algorithm (rHIVda) for the Philippines:
where 2 parallel screening tests
DOH & FDA APPROVED HIV TESTS IN THE PHILIPPINES:
are performed.
▪ RDT’s (Rapid Diagnostic Test)
▪ A reactive result on either of
o SD Bioline HIV Ag-Ab cassette
these tests will then require
o Alere Determine HIV ½
Western blot and/or nucleic
o Geenius HIV ½ Confirmatory Assay Kit
acid test as supplemental
▪ Automated Method:
confirmatory tests.
o Sysmex Ag-Ab (CMIA – 4th generation)
▪ NRLSACCL: National Reference
o Vidas HIV Duo-Ultra (ELFA – 4th generation)
Laboratory for HIV-AIDS and
▪ FOR CDC & US Recommendation:
STI/STDs Comparative Central
o Screening test: 4th generation assay
Laboratory
o Follow up test: HIV 1/HIV 2 differentiation assay
o Confirmatory Test: Nucleic acid (NAT) Testing
AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS ① Person-to-person contact You can prevent infection even after you have been exposed.
TOPIC 11: MOLECULAR TESTING FOR HEPATITIS Hepatitis A can be spread from close, personal contact with an infected Other people recommended for vaccination If you have been exposed
Lecturer: Sir Nestor M. Pompa Jr., RMT, MPH (c) person, such as through having sex, caring for someone who is ill, or to the hepatitis A virus in the last 2 weeks, talk to your doctor about
OBJECTIVES: using drugs with others. Hepatitis A is very contagious, and people can getting vaccinated. A single shot of the hepatitis A vaccine can help
▪ Discuss the laboratory algorithm in the detection of HIV even spread the virus before they feel sick. prevent hepatitis A if given within 2 weeks of exposure. Depending upon
▪ Explain the principles of molecular methods in detecting HIV your age and health, your doctor may recommend immune globulin in
② Eating contaminated food or drink
▪ Interpret results generated by these methods addition to the hepatitis A vaccine.
Contamination of food with the hepatitis A virus can happen at any
▪ Provide limitations of the tests
point: growing, harvesting, processing, handling, and even after Handwashing plays an important role in prevention.
▪ Discuss the quality assurance involved in ensuring the reliability of result.
cooking. Contamination of food and water happens more often in Practicing good hand hygiene—including thoroughly washing hands
TOPIC OUTLINE: countries where hepatitis A is common. Although uncommon, with soap and warm water after using the bathroom, changing diapers,
I. Introduction IV. Confirmatory Tests foodborne outbreaks have occurred in the United States from people and before preparing or eating food—plays an important role in
II. Algorithm V. Quality Assurance eating contaminated fresh and frozen imported food products. preventing the spread of many illnesses, including hepatitis A.
III. Screening Tests
SYMPTOMS INTERNATIONAL TRAVEL AND HEPATITIS A
INTRODUCTION: HEPATITIS Not everyone with hepatitis A has symptoms. Adults are more likely to If you are planning to travel to countries where hepatitis A is common,
▪ inflammation of the liver have symptoms than children. If symptoms develop, they usually appear talk to your doctor about getting vaccinated before you travel. Travelers
▪ there are many possible causes of hepatitis: ① secondary result of 2 to 7 weeks after infection and can include: to urban areas, resorts, and luxury hotels in countries where hepatitis A
medication, drugs, toxins, and alcohol; ② autoimmune causes where the is common are still at risk. International travelers have been infected,
body makes antibodies against own liver tissue ▪ yellow skin or eyes ▪ dark urine or light-colored stools
even though they regularly washed their hands and were careful about
▪ affects the physiological function of the liver ▪ not wanting to eat ▪ diarrhea
what they drank and ate.
▪ may be inflamed or damaged is a vital organ that processes ▪ upset stomach ▪ joint pain
HEPATITIS B
▪ common causes of viral hepatitis: hepatitis A, hepatitis B, hepatitis C (also ▪ throwing up ▪ feeling tired
▪ stomach pain ▪ fever Hepatitis B can be a serious liver disease that results from infection with
D and E, however A,B,C are most common in PH) the Hepatitis B virus.
Symptoms usually last less than 2 months, although some people can
What is hepatitis? ACUTE HEPATITIS B CHRONIC HEPATITIS B
be ill for as long as 6 months.
Hepatitis means inflammation of the liver. The liver is a vital organ that refers to a short-term infection
processes nutrients, filters the blood, and fights infections. When the DIAGNOSIS AND TREATMENT refers to a lifelong infection with
occurring within the first 6
liver is inflamed or damaged, its function can be affected. Heavy alcohol A doctor can determine if you have hepatitis A by discussing your the Hepatitis B virus
months after being infected
use, some medications, toxins, and certain medical conditions can cause symptoms and taking a blood sample. To treat the symptoms of
▪ the infection can range in ▪ the likelihood that a person
hepatitis. hepatitis A, doctors usually recommend rest, adequate nutrition, and
severity from a mild illness develops a chronic infection
fluids. Some people will need medical care in a hospital.
Hepatitis is most often caused by a virus. In the United States, the most with few or no symptoms to depends on the age at which
common types of viral hepatitis are hepatitis A, hepatitis B, and hepatitis PREVENTION a serious condition requiring someone becomes infected
C. Although all types of viral hepatitis can cause similar symptoms, they Vaccination is the best way to prevent hepatitis A. hospitalization ▪ up to 90% of infants infected
are spread in different ways, have different treatments, and some are The Hep A vaccine is safe & effective. The vaccine series usually consists ▪ some people, especially with the Hepatitis B virus will
more serious than others. of 2 shots, given 6 months apart. Getting both shots provides the best adults, are able to clear, or develop a chronic infection
HEPATITIS A protection against Hep A. Hep A vaccination is recommended for: get rid of, the virus without ▪ about 5% of adults will develop
Hepatitis A is a contagious liver infection caused by the hepatitis A virus. treatment chronic Hepatitis B
Hepatitis A can be prevented with a safe and effective vaccine. People 1 Children ▪ people who clear the virus ▪ over time, chronic Hepatitis B can
who get hepatitis A may feel sick for a few weeks to several months but ▪ All children aged 12–23 months become immune & cannot cause serious health problems,
usually recover completely and do not have lasting liver damage. In rare ▪ All children and adolescents 2–18 years of age who have not get infected with the Hep B including liver damage, cirrhosis,
cases, hepatitis A can cause liver failure and even death; this is more previously received hepatitis A vaccine (known as “catch up” virus again liver failure, liver cancer, and
common in older people and in people with other serious health issues, vaccination) even death
such as chronic liver disease. 2 People at increased risk for hepatitis A
HOW IS HEPATITIS B SPREAD?
▪ International travelers
HOW COMMON IS HEPATITIS A? The Hepatitis B virus is spread when blood, semen, or other body fluids
▪ Men who have sex with men
Since the hepatitis A vaccine was first recommended in 1996, cases of from an infected person enters the body of someone who is not
▪ People who use or inject drugs (all those who use illegal drugs)
hepatitis A in the United States have declined dramatically. infected. The virus can be spread through:
▪ People with occupational risk for exposure
Unfortunately, in recent years the number of people infected has been ▪ Sex with an infected person. Among adults, Hepatitis B is often
▪ People who anticipate close personal contact with an international
increasing because there have been multiple outbreaks of hepatitis A in spread through sexual contact. Hepatitis B is easily transmitted
adoptee
the United States. These outbreaks have primarily been from person-to- through sexual activity. In fact, sexual contact is the most common
▪ People experiencing homelessness
person contact, especially among people who use drugs, people way Hepatitis B is spread in the United States. Hepatitis B is 50-100
3 People at risk for severe disease from Hep A infections
experiencing homelessness, and men who have sex with men. times more infectious than HIV.
▪ People with chronic liver disease, including hepatitis B and C ▪ Injection drug use. Sharing needles, syringes, and any other
HOW IS HEPATITIS A SPREAD? ▪ People with HIV equipment to inject drugs with someone infected with Hepatitis B
The hepatitis A virus is found in the stool and blood of people who are 4 Other people recommended for vaccination can spread the virus.
infected. The hepatitis A virus is spread when someone ingests the virus, ▪ Pregnant women at risk for hepatitis A or risk for severe outcome ▪ Outbreaks. While uncommon, poor infection control has resulted in
usually through: from hepatitis A infection outbreaks of Hepatitis B in healthcare settings.
▪ Any person who requests vaccination

AIRAH M.
 ▪ Birth. Hepatitis B can be passed from an infected mother to her
baby at birth. Worldwide, most people with Hepatitis B were
infected with the virus as an infant.
Hepatitis B is not spread through breastfeeding, sharing eating utensils,
hugging, kissing, holding hands, coughing, or sneezing. Unlike some
forms of hepatitis, Hepatitis B is also not spread by contaminated food
or water.
(from another pdf) Hepatitis B is spread when someone comes in contact
with blood from a person who has the disease. Most people born in
China and other Asian countries who have Hepatitis B were infected as
infants or young children. Hepatitis B can be passed from an infected
mother to her baby at birth or from a family member to young children.
Hepatitis B is not a genetic disease. People also do not get Hepatitis B
from sharing meals, bowls, or utensils with someone who has the
disease. Hepatitis B is not spread through breastfeeding, hugging,
kissing, holding hands, coughing, or sneezing.
WHAT ARE THE SYMPTOMS OF HEPATITIS B?
Many people with Hepatitis B do not have symptoms and do not know
they are infected. The disease does not always cause symptoms.
Hepatitis B can stay hidden in the body. Many people can live with
Hepatitis B for 20 years without feeling sick. Still, liver damage from the
disease can take place during this time. If symptoms occur, they usually
appear within 3 months of exposure and can last anywhere from 2-12
weeks. People can live with chronic Hepatitis B for decades without
symptoms or feeling sick. If symptoms do appear, they are similar for
both acute and chronic Hepatitis B and can include:
▪ fever ▪ dark urine
▪ feeling tired (fatigue) ▪ grey-colored stools
▪ not wanting to eat (loss of appetite) ▪ joint pain
▪ upset stomach (abdominal pain) ▪ jaundice (yellow skin
▪ throwing up (vomiting nausea) & eyes)
WHEN DO SYMPTOMS OCCUR?
If symptoms occur with an acute infection, they usually appear within 3
months of exposure and can last up to 6 months. If symptoms occur
with chronic Hepatitis B, they can take years to develop and can be a
sign of advanced liver disease.
HOW WOULD YOU KNOW IF YOU HAVE HEPATITIS B?
Since people often have no symptoms, a specific blood test is the only
way to know if you have Hepatitis B. The only way to know if you have
Hepatitis B is to get tested. Blood tests can determine if a person has
been infected and cleared the virus, is currently infected, or has never
been infected. This is a simple blood test that takes only a little bit of
blood from a person’s arm. Doctors do not always do this test, so it is
important to ask to be tested.
HOW IS HEPATITIS B TREATED?
For those with acute Hepatitis B, doctors usually recommend rest,
adequate nutrition, fluids, and close medical monitoring. Several new
treatments are available for chronic Hepatitis B that can significantly
improve health and delay or reverse the effects of liver disease. Some
people may need to be hospitalized. People living with chronic Hepatitis
B should be evaluated for liver problems and monitored on a regular
basis. Treatments are available that can slow down or prevent the effects
of liver disease.
People who have hepatitis B should see a doctor who is very
knowledgeable about the disease. The doctor can give medicines that
will slow down liver damage. It is important to ask the doctor before
taking any Eastern liver remedies because they might hurt the liver or
cause problems with some of the medicines prescribed by your doctor.
CAN HEPATITIS B BE PREVENTED?
Yes. The best way to prevent Hepatitis B is by getting vaccinated. The
Hepatitis B vaccine is typically given as a series of 3 shots over a period
of 6 months. The entire series is needed for long-term protection. There
is also a combination vaccine that protects against both Hepatitis A and
Hepatitis B.
WHO SHOULD GET VACCINATED AGAINST HEPATITIS B?
All infants are routinely vaccinated for Hepatitis B at birth, which has led
to dramatic declines of new Hepatitis B cases in the US and many parts
of the world. The vaccine is also recommended for people living with
someone infected with Hepatitis B, travelers to certain countries, and
healthcare and public safety workers exposed to blood. People with
high-risk sexual behaviors, men who have sex with men, people who
inject drugs, and people who have certain medical conditions, including
diabetes, should talk to their doctor about getting vaccinated.
WHO SHOULD GET TESTED FOR HEPATITIS B AND WHY?
CDC develops recommendations for testing based upon a variety of
different factors. The results will help determine the next best steps for
vaccination or medical care.
▪ All pregnant women are routinely tested for Hepatitis B. If a woman
has Hepatitis B, timely vaccination can help prevent the spread of
the virus to her baby.
▪ Household and sexual contacts of people with Hepatitis B are at
risk for getting Hepatitis B. Those who have never had Hepatitis B
can benefit from vaccination.
▪ People born (or whose parents were born) in certain parts of the
world (e.g. China and other Asian countries) that have increased
rates of Hepatitis B. Testing helps identify those who are infected so
that they can receive timely medical care.
▪ People with certain medical conditions should be tested and get
vaccinated if needed. This includes people with HIV infection, people
who receive chemotherapy and people on hemodialysis.
▪ People who inject drugs are at increased risk for Hepatitis B but
testing can tell if someone is infected or could benefit from
vaccination to prevent getting infected with the virus.
▪ Men who have sex with men have higher rates of Hepatitis B.
Testing can identify unknown infections or let a person know that
they can benefit from vaccination.
▪ People with multiple sex partners
▪ People with STD
▪ Anyone having sex with an infected partner
Getting tested lets a person know if he or she has Hepatitis B. There are
treatments available for Hepatitis B that can help prevent serious liver
damage. People who find out they have Hepatitis B can also keep other
family members healthy. This is why women are always tested for
Hepatitis B when they are pregnant. Family members who have never
had Hepatitis B can get a vaccine to protect them from getting it.
Hepatitis B test results will be kept confidential. People with Hepatitis B
cannot be forced to leave the United States. They also cannot be fired
from a job, or forced to leave school.
PROTECT YOUR BABY FOR LIFE: HEPATITIS B
If you are pregnant and have hepatitis B, your baby can get a set of
shots starting at birth to prevent infection. All pregnant women should
get a blood test for hepatitis B as part of their prenatal care. Hepatitis B
can be easily passed from a pregnant woman with hepatitis B to her
baby at birth. This can happen during a vaginal delivery or a c-section.
If you have hepatitis B, health care providers can give your baby a set of
shots at birth to prevent your baby from getting infected.
Hepatitis B is a serious liver infection caused by the hepatitis B virus.
When babies become infected with hepatitis B, they have about a 90%
chance of developing a lifelong, chronic infection. Left untreated, about
1 in 4 children who have chronic hepatitis B will eventually die of health
problems related to their infection, such as liver damage, liver disease,
or liver cancer.
PROTECT YOUR BABY FROM HEPATITIS B
▪ Your baby should get the first dose of hepatitis B vaccine and a
shot called hepatitis B immune globulin (HBIG) within 12 hours
of being born.
o HBIG is a medicine that gives your baby’s body a “boost” or extra
help to fight the virus as soon as he or she is born. The HBIG shot
is only given to babies of mothers who have hepatitis B. The HBIG
and hepatitis B vaccine shots help prevent your baby from getting
hepatitis B. These shots work best when they are given within 12
hours after your baby is born.
▪ All the hepatitis B shots are necessary to help keep your baby
from getting hepatitis B.
o Your baby will get 3 or 4 shots in all, depending on your baby’s
birth weight and the vaccine brand. After the first shots are given
in the hospital, the next shot is usually given at 1 to 2 months of
age. The last shot is given when your baby is six months old. Ask
your doctor or nurse when your baby needs to come back for
each shot.
▪ Make sure your baby gets tested after completing the series of
shots.
o After getting all the hepatitis B shots, your doctor will test your
baby’s blood. This blood test tells you and your doctor if your
baby is protected and does not have hepatitis B. The blood test
is usually done 1 to 2 months after completing the series of shots.
Your baby should be at least 9 months of age before getting this
test.
You can breastfeed your baby if your baby gets HBIG and the hepatitis
B vaccine within 12 hours of birth. You cannot give your baby hepatitis
B from breast milk. Ask your doctor if you should still breastfeed if you
have cracked nipples or open sores on your breast.
TEST AND VACCINATE YOUR FAMILY
The hepatitis B virus is very infectious and can also spread to other
family members through contact with blood, semen or other body fluids
from an infected person. Your baby’s father and everyone else who lives
in your house should go to the doctor or clinic to be tested. Family
members who do not have hepatitis B can get the hepatitis B vaccine to
protect them from getting infected.
AIRAH M.
TAKE CARE OF YOURSELF
You may need additional tests to check the health of your liver and see
if you need treatment. Medications, called antivirals, can treat many
people with hepatitis B. However, not everyone needs the treatment.
Ask a doctor before taking any prescription, over-the-counter
medications, supplements, or vitamins because some drugs can
potentially damage the liver. You may also benefit from the hepatitis A
vaccine. Continue to see a doctor after giving birth to monitor your
infection.
HEPATITIS C
Hepatitis C is a liver disease caused by the hepatitis C virus. When
someone is first infected with the hepatitis C virus, they can have a very
mild illness with few or no symptoms or a serious condition requiring
hospitalization. For reasons that are not known, less than half of people
who get hepatitis C are able to clear, or get rid of, the virus without
treatment in the first 6 months after infection.
Most people who get infected will develop a chronic, or lifelong,
infection. Left untreated, chronic hepatitis C can cause serious health
problems including liver disease, liver failure, liver cancer, and even
death.
HOW IS HEPATITIS C SPREAD?
The hepatitis C virus is usually spread when someone comes into
contact with blood from an infected person. This can happen through:
▪ Sharing drug-injection equipment. Today, most people become
infected with hepatitis C by sharing needles, syringes, or any other
equipment used to prepare and inject drugs.
▪ Birth. Approximately 6% of infants born to infected mothers will get
hepatitis C.
▪ Healthcare exposures. Although uncommon, people can become
infected when healthcare professionals do not follow the proper
steps needed to prevent the spread of bloodborne infections.
▪ Sex with an infected person. While uncommon, hepatitis C can
spread during sex, though it has been reported more often among
men who have sex with men.
▪ Unregulated tattoos or body piercings. Hepatitis C can spread when
getting tattoos or body piercings in unlicensed facilities, informal
settings, or with non-sterile instruments.
▪ Sharing personal items. People can get infected from sharing
glucose monitors, razors, nail clippers, toothbrushes, and other
items that may have come into contact with infected blood, even in
amounts too small to see.
▪ Blood transfusions and organ transplants. Before widespread
screening of the blood supply in 1992, hepatitis C was also spread
through blood transfusion and organ transplants.
SYMPTOMS
People can live with hepatitis C without symptoms or feeling sick. Many
people with hepatitis C do not have symptoms and do not know they
are infected. If symptoms occur, they can include:
▪ yellow skin or eyes ▪ dark urine or light-colored stools
▪ not wanting to eat ▪ joint pain
▪ upset stomach ▪ feeling tired
▪ throwing up ▪ fever
▪ stomach pain
If symptoms occur with a new infection, they usually appear within 2 to SCREENING TESTS
12 weeks, but can take up to 6 months to develop.
HEPATITIS PANEL
People with chronic hepatitis C can live for years without symptoms or ▪ HAV IgM ▪ ALT
feeling sick. When symptoms appear with chronic hepatitis C, they often ▪ HBsAg ▪ ALP
are a sign of advanced liver disease. ▪ HBc IgM ▪ Bilirubin (TB, DB, IB)
▪ HBC IgM ▪ Prothrombin Time1
HEPATITIS C CAN BE CURED.
▪ AST
Getting tested for hepatitis C is important to find out if you are infected 1
because there are coagulation factors that are synthesized in the urine
and get lifesaving treatment. Treatments are available that can cure
most people with hepatitis C in 8 to 12 weeks. HBsAg, HAV IgG/IgM, HVC IgM is a rapid chromatographic
immunoassay for the qualitative detection of Hepatitis markers and
HEPATITIS C CAN BE PREVENTED.
antibodies in whole blood, serum or plasma.
Although there is no vaccine to prevent hepatitis C, there are ways to
reduce the risk of becoming infected.
▪ Avoid sharing or reusing needles, syringes or any other equipment
used to prepare and inject drugs, steroids, hormones, or other
substances.
▪ Do not use personal items that may have come into contact with an
infected person’s blood, even in amounts too small to see, such as
glucose monitors, razors, nail clippers, or toothbrushes.
▪ Do not get tattoos or body piercings from an unlicensed facility or in
an informal setting.
GETTING TESTED IS THE ONLY WAY TO KNOW IF YOU HAVE
HEPATITIS C.
A blood test called a hepatitis C antibody test can tell if you have been
infected with the hepatitis C virus—either recently or in the past. If you
have a positive antibody test, another blood test is needed to tell if you
are still infected or if you were infected in the past and cleared the virus TEST PRINCIPLE:
on your own. ▪ the sample initially reacts with monoclonal antibody colloidal gold
conjugate on sample pad
CDC RECOMMENDS YOU GET TESTED FOR HEPATITIS C IF YOU:
▪ this mixture migrates across the membrane by the capillary action
▪ Are 18 years of age and older
and reacts with anti HBsAg in test region
▪ Are pregnant (get tested during each pregnancy)
▪ if sample contains HBsAg a line will form on the membrane at this
▪ Currently inject drugs (get tested regularly)
point indicate positive result
▪ Have ever injected drugs, even if it was just once or many years ago
▪ if antigen is not present no line will form indicating negative result
▪ Have HIV
▪ this mixture continue to flow on control area of membrane should
▪ Have abnormal liver tests or liver disease
exhibit a color band of immunocomplex of goat anti mouse antibody
▪ Are on hemodialysis
IgG
▪ Received donated blood or organs before July 1992
▪ Received clotting factor concentrates before 1987 HBsAg, HAV IgG/IgM & Rapid Test Dipstick is a rapid
chromatographic immunoassay for the qualitative detection of Hepatitis
▪ Have been exposed to blood from a person who has hepatitis C
B Surface Antigen in whole blood, serum or plasma.
▪ Were born to a mother with hepatitis C
*characteristics of human hepatitis viruses and test algorithm: Hepatitis C table are
found on the 2nd to the last page*
*the table for ‘The ABCs of Hepatitis – for Heath Professionals’, together with the viral
structure images of the viruses and test algorithms, are found on the last page*
TEST ALGORITM:
Available Screening, Confirmatory, and Monitoring Test
HBV HCV
Rapid Rapid
Screening
EIA EIA
SIA
Confirmatory Neutralization Assay
HCV RNA (Quali)
HBV DNA HCV RNA
Monitoring
Quantitative Quantitative
AIRAH M.
TEST PRINCIPLE: CONFIRMATORY TESTS MONITORING TESTS
▪ the sample initially reacts with monoclonal antibody colloidal gold NEUTRALIZATION ASSAY, detection of specific hepatitis antibody
BRANCHED DNA ASSAY
conjugate on sample pad
▪ this mixture migrates across the membrane by the capillary action PRINCIPLE sandwich nucleic acid hybridization
and reacts with anti HBsAg in test region METHOD polymerase chain reaction (PCR)
▪ if sample contains HBsAg a line will form on the membrane at this
SAMPLE INHIBITION
point indicate positive result INTERPRETATION
REACTIVITY RATIO PERCENTAGE
▪ if antigen is not present no line will form indicating negative result
▪ this mixture continue to flow on control area of membrane should >0.8 >50% POSITIVE
exhibit a color band of immunocomplex of goat anti mouse antibody <0.8 whatever result NEGATIVE
(IgG) >0.8 <50% for dilution
ELISA, OD value is directly proportional to the antibody concentration Analyzer: COBAS® AmpliScreen HBV Test
PRINCIPLE:
▪ uses a generic DNA specimen preparation technique in a mini pool
testing format
▪ HBV DNA in blood donations is detected by automated amplification
by PCR on the COBAS® AMPLICOR® Analyzer
▪ the assay incorporates an Internal Control for monitoring assay
performance in each individual test as well as the AmpErase (uracil N
glycosylase) enzyme to reduce potential contamination by previously
amplified material (amplicon)
REAGENTS: Sample Processing for 96 test with Controls:
▪ MP (-) C (Multiprep Negative (–))
▪ MP (+) C (Multiprep Positive (+) Control)
▪ MP LYS (Multiprep Lysis Reagent)
▪ MP DIL (Multiprep Specimen Diluent)
▪ MP IC (Multiprep Internal Control)
▪ NHP (Negative Plasma [Human])
▪ COBAS® AmpliScreen HBV Amplification Reagents:
For the procedure, you will prepare 2-folds serial dilutions of sera. Add the o HBV MMX (HBV Master Mix)
pseudotypes Abs and the known reagents. Incubate it at 48 hours at 37°C. o HBV Mg2+ (HBV Magnesium Solution)
The substrate is then added. Stand for 5 minutes at RT. The plate is then ▪ COBAS® AMPLICOR® Wash Buffer:
read at the machine, then goes through the data analysis procedure o WB (10X Wash Concentrate)
(determine the cut-off value), ending at results. ▪ COBAS® AmpliScreen HBV Detection Reagents
o BH PS1 (HBV Probe Suspension 1)
PRINCIPLE o BH4 (HBV Probe Suspension 2)
▪ assay is run according to visual screening procedure o BI PS1 (HBV IC Probe Suspension 1)
▪ two wells are assigned to each sample o BI4 (HBV IC Probe Suspension 2)
▪ specific reagent will compete with the mouse antibody o DN4 (Denaturation Solution)
CHEMILUMINESCENT (CLIA) ASSAY, OD value is directly proportional
▪ coated in the wells for any HBsAg present in the sample and will reduce o CN4 (Avidin Horseradish Peroxidase Conjugate)
to the antibody concentration (more sensitive than ELISA)
the amount of HBsAg binding in the well o SB3 (Substrate A)
▪ in the control reagent there is no competition and it bind normally o SB (Substrate B)
INTERPRETATION OF RESULTS SPECIMEN
SAMPLE INHIBITION EDTA, CPD, CPDA 1, CP2D, ACD A and 4% Sodium Citrate may be used
INTERPRETATION with the Follow sample tube manufacturer’s instructions.
REACTIVITY RATIO PERCENTAGE
>0.8 >50% POSITIVE PROCEDURE
<0.8 whatever result NEGATIVE 1. Sample Processing (Reagent preparation, pre amplification of
>0.8 <50% for dilution sample & control)
2. PCR amplification of target DNA using HBV specific complementary
NOTE for strongly reactive samples: If the inhibition is less than 50% and
primers
the absorbance in the control reagent is greater than 3.500, the sample
3. Hybridization of the amplified products to oligonucleotide probes
should be diluted with 1/100 or 1/10,000
specific to the target(s)
4. Detection of the probe bound amplified products by colorimetric
determination

AIRAH M.
RESULTS AND INTERPRETATION RECOMBINANT IMMUNOBLOT ASSAY HCV Genotype HCV Subtypes
▪ supplemental assay Genotype 1 1a, 1b
HBV RESULT IC RESULT
▪ detects circulating antibodies to 4 HCV Genotype 2 2a, 2b, 2c, 2d
A660 INTPN A660 INTPN proteins Genotype 3 3a, 3b, 3c, 3d, 3e, 3f
NEG CTRL <0.2 NEG ≥0.2 VALID ▪ antigen-antibody reaction Genotype 4 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, 4i, 4j
POS CTRL ≥1.0 POS ≥0.2 VALID ▪ more specific than anti-HCV enzyme Genotype 5 5a
immunoassay Genotype 6 6a
HBV RESULT IC RESULT ▪ false positive reaction can still occur
INTPN
A660 comment A660 comment ▪ largely replaced by HCV RNA testing CLINCAL SIGNIFICANCE OF SEROLOGIC TESTS
<0.2 NEG ≥0.2 VALID negative for HBV DNA
▪ used to diagnose acute or chronic infection
invalid result
<0.2 NEG <0.2 INVALID ▪ 1st antigen to appear in the bloodstream during
(repeat entire test procedure)
acute infection
≥0.2 POS any VALID positive for HBV DNA HBsAg
▪ disappearance indicates recovery from infection
SENSITIVITY ▪ >6 months persistence, chronic infection
▪ Limit of Detection (LOD) = 4.41 IU/ mL, ▪ maybe (+) in 2weeks after vaccination, transient
▪ Range: 3.56 IU/mL to 6.13 IU/ mL corresponds to approximately 22 ▪ produced by infected liver cells during replication
copies/ mL HBcAg
▪ not found in the bloodstream at anytime
GENOTYPE DETECTED ▪ usually detectable for about 6 months
anti-HBc IgM
A, B, C, D, E, F. G, A/C, A/D, C/D, D/E, A/E, B/C, C/E, D/F, B/F ▪ plus HBsAg (+) indicates acute infection
▪ indicates past infection
AVAILABLE TESTS FOR HCV
anti-HBc IgG ▪ usually persists for life after infection
SCREENING CONFIRMATORY MONITORING ▪ absent in vaccinated individuals
Strip Immunoblot Assay ▪ active replication in liver cells
EIA (SIA), includes Recombinant HCV RNA HBeAg ▪ high degree of infectivity
Rapid Tests Immunoblot Assay *RIBA) & (quantitative PCR) HCV genome and recombinant proteins ▪ to monitor success of therapy of chronic infection
HCV RNA (Qualitative PCR) ▪ appears as the e antigen disappears
anti-HBe ▪ end of immune tolerant stage and beginning of
HEPATITIS C VIRUS DIAGNOSTIC TESTING immune clearance stage
DIAGNOSTIC TEST TYPE ▪ recovery, protective immunity
SPECIFICATIONS SEROLOGIC VIROLOGIC anti-HBs ▪ levels may decline with time (that’s why we need
mode of detection antibodies virus a booster)
sensitivity >95% >98% ▪ most specific indication of the presence of virus
specificity variable >98% HBV DNA ▪ to monitor disease activity and ascertain success
detection Antigens and controls for the RIBA HCV 3.0 strip immunoblot assay of therapy
2-6 months 2-6 weeks
post-exposure
*clinical significance: serologic markers table found on the 2nd to the last page*
use screening confirmation NEGATIVE POSITIVE INDETERMINATE
for anti-HCV Abs for anti-HCV Abs test QUALITY ASSURANCE
ANTI-HCV ANTIBODIES at least 2 HCV Ag
▪ ELISA Screening Test no visible band one visible band PRE-ANALYTICAL ANALYTICAL POST-ANALYTICAL
visible bands
o sensitivity: 97% ▪ receiving of request test proper ▪ logbook
HCV RNA (QUANTITATIVE)
o detects circulating HCV antibodies ▪ sample collection, ID (running of documentation
monitor patient’s response to therapy
▪ false positive reactions may occur assignment, controls: internal ▪ recording, signature,
▪ utilizes PCR method
o cross-reacting circulating antibodies transport and storage & external) and release
▪ based on the competitive amplification for viral genome with a known
o nonspecific binding of anti-HCV antibodies
amount of synthetic standard TROUBLESHOOTING
▪ positive predictive value ▪ template and standard is measured at end of procedure
o 95% with risk factors and elevated ALT POSSIBLE SOURCES OF ERROR
GENOTYPING
o 50% without risk factors and normal ALT 1 specimen-related
▪ genetic make-up of an organism virus
▪ hemolyzed blood
FALSE POSITIVES FALSE NEGATIVES ▪ used for epidemiologic studies & recommendation regarding therapy
▪ lipemic
▪ autoimmune disorders ▪ chronically immune suppressed ▪ template and standard is measured at end of procedure
▪ bacteria contaminated
▪ spontaneous resolution of ▪ transplant recipients ▪ utilizes Restriction Fragment Length Polymorphism (RFLP) Analysis,
▪ repeated freezing thawing
viral infection ▪ chronic renal failure on dialysis using genotype specific primers & commercial kits
▪ diluted/pooled sera
▪ HIV positive ▪ the ability of the virus to mutate has resulted in the existence of
▪ presence of cross reacting antibodies
different genetic variations of HCV
▪ excess antibodies (Prozone effect
o HCV has six genotypes, labeled 1 through 6
o there are also subtypes labeled with letters

AIRAH M.
 2 kit/reagent related CHARACTERISTICS OF HUMAN HEPATITIS VIRUSES
▪ expired reagent kit Length of Mechanism of
Virus Family/Genus Size/Genome vaccine
▪ mixing of reagents from different lots Incubation transmission
▪ performance characteristics not satisfactory (sensitivity & specificity) HAV Picornaviridae or Hepatovirus 72 27-30 nm, ssRNA 15-40 days mostly oral-fecal YES
▪ deteriorated due to faulty transport recombinant subunit
HBV Hepadnaviridae or Hepadnavirus 142 nm, circular dsDNA 50-180 days parenteral
▪ intra-lot & inter-lot variation due to faulty manufacturing practices vaccine
3 equipment related parenteral, likely other
HCV Flaviviridae 30-50 nm, ssRNA 14-28 days NO
▪ equipment not maintained or calibrated that includes pipettors & sources
analyzers HDV Unclassified 35-40 nm, ssRNA 50-180 days parenteral transmission NO
▪ irregular temperature monitoring of incubators and refrigerators HEV Caliciviridae 27-34 nm ssRNA 6 weeks oral-fecal NO
▪ use of inappropriate pipette tips
▪ failure to give error messages by the analyzer
▪ failure to detect malfunctions by the analyzers CLINICAL SIGNIFICANCE: SEROLOGIC MARKERS
▪ does not follow periodic service procedure for calibration & HBsAg HBeAg anti-HBc anti-HBe anti-HBs INTERPRETATION
performance check + - - - - Very early acute phase of hepatitis, indicative of viremic status
▪ error in internal controls + + - - - Very early acute phase of hepatitis, very infectious
4 procedural/technologist-based errors + + + - - Acute phase of hepatitis, very infectious
▪ dilution Infrequently found (less than 3%) patient is undergoing HBeAg /Anti HBs
+ + + + -
▪ scratching the coated Ag/Ab from the well seroconversion
▪ inconsistent technique for test & controls Acute phase of hepatitis, px still potentially infectious, good sign of pending
+ - + + -
▪ mixing reagents from different lots of kits resolution of infection
▪ mixing of samples - - + + - Px is in convalescent state of disease may still be infectious from shredding of virus
▪ do not follow SOP - - + - + Patient is in recovery state of disease anti-Hbe levels no longer detectable
▪ wrong pipetting due to carelessness Px is usually in recovery state of disease anti-Hbe, anti-HBs levels no longer
- - + - -
▪ QC not practiced detectable
▪ miscalculation of COV validity test criteria
▪ wrong interpretation of results
TEST ALGORITHM FOR HEPATITIS C: INTERPRETATION OF TEST RESULTS FOR HCV INFECTION AND FURTHER ACTIONS
5 variation of test results
TEST OUTCOME INTERPRETATION FURTHER ACTIONS
▪ mislabeling of specimen
▪ deteriorated specimen HCV antibody no HCV antibody Sample can be reported as nonreactive for HCV antibody. No further action required.
▪ gray zone reactors nonreactive detected If recent exposure in person tested is suspected, test for HCV RNA*
▪ technical errors A repeatedly reactive result is consistent with current HCV infection, or past HCV infection that
presumptive HCV
▪ environmental problems HCV antibody reactive has resolved, or biologic false positivity for HCV antibody. Test for HCV RNA to identify current
infection
▪ specimen errors infection.
▪ kit related errors HCV antibody reactive, current HCV Provide person tested with appropriate counseling and link person tested to care and
▪ review the procedure carefully before starting the run, see product HCV RNA detected infection treatment†
insert always No further action required in most cases.
▪ anticipate procedural steps ahead of time HCV antibody reactive, no current HCV If distinction between true positivity and biologic false positivity for HCV antibody is desired,
▪ follow manufacturer’s protocol carefully and always HCV RNA not detected infection and if sample is repeatedly reactive in the initial test, test with another HCV antibody assay.
▪ if test fails after precautions, an investigation must be conducted to In certain situations, §follow up with HCV RNA testing and appropriate counseling.
determine the most probable cause
▪ do not try to fix/open equipment * If HCV RNA testing is not feasible and person tested is not immunocompromised, do follow-up testing for HCV Ab to demonstrate seroconversion.
If the person tested is immunocompromised, consider testing for HCV RNA.
REFERENCES †
It is recommended before initiating antiviral therapy to retest for HCV RNA in a subsequent blood sample to confirm HCV RNA positivity.
▪ Molecular Diagnostics, Fundamentals, Methods & Clinical Applications §
If the person tested is suspected of having HCV exposure within the past 6 months, or has clinical evidence of HCV disease, or if there is concern
by Buckingham, Lela
regarding the handling or storage of the test specimen.
▪ DOH training manual for HIV and other bloodborne STIs
▪ www.cdc.gov
▪ www.who.org
▪ www.doh.gov.ph

AIRAH M.
 THE ABC’S OF HEPATITIS – FOR HEALTH PROFESSIONALS
HEPATITIS A HEPATITIS B HEPATITIS C
▪ Estimated 21,600 new infections in 2018 ▪ Estimated 50,300 new infections in 2018
US Statistics Estimated 24,900 new infections in 2018
▪ Estimated 862,000 people living with chronic HBV infection in 2016 ▪ Estimated 2.4 million people living with HCV infection in 2016
Percutaneous, mucosal, or nonintact skin exposure to infectious blood, semen, and
Direct percutaneous exposure to infectious blood. Mucous membrane
other body fluids. HBV is concentrated most highly in blood, and percutaneous
exposures to blood can also result in transmission, although this route is
exposure is an efficient mode of transmission.
▪ Fecal-oral route. less efficient.
▪ HBV is transmitted primarily through:
▪ HAV is transmitted through: ▪ HCV is transmitted primarily through:
• Birth to an infected mother
• Close person-to-person contact with an infected person • Sharing contaminated needles, syringes, or other equipment to inject
• Sexual contact with an infected person
Transmission • Sexual contact with an infected person drugs
• Sharing contaminated needles, syringes, or other injection-drug equipment
• Ingestion of contaminated food or water ▪ Less commonly through:
▪ Less commonly through:
▪ Although viremia occurs early in infection, bloodborne transmission • Birth to an infected mother
• Needle-sticks or other sharp instrument injuries
of HAV is uncommon. • Sexual contact with an infected person
• Organ transplantation and dialysis
• Unregulated tattooing
• Interpersonal contact through sharing items such as razors or toothbrushes or
• Needle-sticks or other sharp instrument injuries
contact with open sores of an infected person
15–50 days 60–150 days 14–182 days
IP
(average: 28 days) (average: 90 days) (average range: 14–84 days)
Symptoms (Acute Symptoms of all types of viral hepatitis are similar and can include one or more of the following:
Ifxn) • Jaundice • Fever • Fatigue • Loss of appetite • Nausea • Vomiting • Abdominal pain • Joint pain • Dark Urine • Clay-colored stool • Diarrhea (HAV only)
Likelihood of ▪ <30% of children <6 years of age have symptoms (which typically ▪ Most children <5 years of age do not have symptoms ▪ Jaundice might occur in 20%–30% of people
Symptomatic do not include jaundice) ▪ 30%–50% of people ≥5 years of age develop symptoms ▪ Nonspecific symptoms (e.g., anorexia, malaise, or abdominal pain) might
(Acute Ifxn) ▪ >70% of older children and adults have jaundice ▪ Newly infected immunosuppressed adults generally do not have symptoms be present in 10%–20% of people
Chronic infection develops in:
Potential for
▪ 90% of infants after acute infection at birth
Chronic Infxn after None Chronic infection develops in over 50% of newly infected people
▪ 25%–50% of children newly infected at ages 1–5 years
Acute
▪ 5% of people newly infected as adults
▪ Most people with acute disease recover with no lasting liver damage; acute illness is ▪ Approximately 5%–25% of persons with chronic hepatitis C will develop
Most people with acute disease recover with no lasting liver damage;
rarely fatal cirrhosis over 10–20 years
Severity death is uncommon but occurs more often among older people
▪ 15%–25% of people with chronic infection develop chronic liver disease, including ▪ People with hepatitis C and cirrhosis have a 1%–4% annual risk for
and/or those with underlying liver disease
cirrhosis, liver failure, or liver cancer hepatocellular carcinoma
Serologic Tests for HBsAg, plus
IgM anti-HAV No serologic marker for acute infection
Acute Ifxn IgM anti-HBc
▪ Assay for anti-HCV
Serologic Tests for Tests for chronic infection should include three HBV seromarkers:
Not applicable—no chronic infection ▪ Qualitative and quantitative nucleic acid tests (NAT) to detect and
Chronic Ifxn HBsAg, anti-HBs, Total anti-HBc
quantify presence
▪ All adults aged 18 years and older, at least once
▪ All pregnant women during each pregnancy
▪ All pregnant women should be tested for HBsAg during an early prenatal visit in ▪ People who currently inject drugs and share needles, syringes, or other
each pregnancy drug preparation equipment (routine periodic testing)
▪ Infants born to HBsAg-positive mothers (HBsAg and anti-HBs are only ▪ People who ever injected drugs
recommended) ▪ People with HIV
▪ People born in regions with intermediate and high HBV endemicity (HBsAg ▪ People who receive maintenance hemodialysis (routine periodic testing)
prevalence ≥2%) ▪ People who ever received maintenance hemodialysis
▪ People born in U.S. not vaccinated as infants whose parents were born in regions ▪ People with persistently abnormal ALT levels
Testing Not applicable—no chronic infection with high HBV endemicity (≥8%) ▪ Prior recipients of transfusions or organ transplants, including:
Recommendations ▪ Household or sexual contacts of people who are HBsAg-positive o people who received clotting factor concentrates produced before
for Acute Ifnx Note: testing for past acute infection is generally not recommended ▪ Men who have sex with men 1987
▪ People who inject, or have injected, drugs o people who received a transfusion of blood or blood components
▪ Patients with alanine aminotransferase levels (≥19 IU/L for women and ≥30 IU/L for before July 1992
men) of unknown etiology o people who received an organ transplant before July 1992
▪ People with end-stage renal disease including hemodialysis patients o people who were notified that they received blood from a donor who
▪ People receiving immunosuppressive therapy later tested positive for HCV infection
▪ People with HIV ▪ Healthcare, emergency medical, and public safety personnel after needle
▪ Donors of blood, plasma, organs, tissues, or semen sticks, sharps, or mucosal exposures to HCV positive blood
▪ Children born to mothers with HCV infection
▪ Any person who requests hepatitis C testing should receive it
▪ Acute: AASLD/IDSA recommend treatment of acute HCV without a
No medication available ▪ Acute: no medication available; best addressed through supportive treatment
waiting period
Treatment ▪ Chronic: regular monitoring for signs of liver disease progression; antiviral drugs
Best addressed through supportive treatment ▪ Chronic: over 90% of people with hepatitis C can be cured regardless of
are available
HCV genotype with 8–12 weeks of oral therapy
Children ▪ All infants
Vaccination
▪ All children aged 12–23 months ▪ All unvaccinated children and adolescents aged <19 years There is no hepatitis C vaccine
Reccommendations
▪ Unvaccinated children and adolescents aged 2–18 years ▪ Sex partners of HBsAg-positive people

AIRAH M.
 People at increased risk for HAV infection
▪ International travelers
▪ Men who have sex with men
▪ People who use injection or noninjection drugs
▪ People with occupational risk for exposure
▪ People who anticipate close personal contact with an international
adoptee
▪ People experiencing homelessness
People at increased risk for severe disease from HAV infection
▪ People with chronic liver disease
▪ People with HIV infection
Other people recommended for vaccination
▪ Pregnant women at risk for HAV infection or severe outcome from
HAV infection
▪ Any person who requests vaccination
Vaccination during outbreaks
▪ Unvaccinated people in outbreak settings who are at risk for HAV
infection or at risk for severe disease from HAV
Implementation strategies for settings providing services to
adults
▪ People in settings that provide services to adults in which a high
proportion of those people have risk factors for HAV infection
Vaccination Single-antigen hepatitis A vaccine:
Schedule 2 doses given 6–18 months apart depending on manufacturer
viral structure
(with side notes)
Hepatitis A is caused by Hep A virus (Hepatovirus) under the genus
Picornaviridae. It is a ssRNA that is usually spread by eating
contaminated food or drinking contaminated water with infected
human feces. Vaccine is the effective way of prevention. It can be
diagnosed with laboratory tests that is why they have protein markers
for identification. We will be determining the viral polypeptides (e.g.
VP1, VP2, VP3, VP4: protein markers).
▪ Sexually active people who are not in a mutually monogamous relationship
▪ Anyone seeking evaluation or treatment for a sexually transmitted infection
▪ Men who have sex with men
▪ Anyone with a history of current or recent injection-drug use
▪ Household contacts of people who are HBsAg-positive
▪ Residents and staff of facilities for developmentally disabled people
▪ Health care and public-safety personnel with reasonably-anticipated risk for
exposure to blood or blood-contaminated body fluids,
▪ Hemodialysis, predialysis peritoneal dialysis, and home dialysis patients
▪ People with diabetes mellitus aged <60 years and people with diabetes mellitus aged
≥60 years at the discretion of the treating clinician
▪ International travelers to countries with high or intermediate levels of endemic HBV
infection (HBsAg prevalence of ≥2%)
▪ People living with hepatitis C
▪ People with chronic liver disease (including cirrhosis, fatty liver disease, alcoholic liver
disease, autoimmune hepatitis, and an ALT or AST level greater than twice the upper
limit of normal)
▪ People living with HIV infection
▪ People who are incarcerated
▪ Pregnant women who are identified as being at risk for HBV infection during
pregnancy
▪ Anyone else seeking long-term protection
Single-antigen hepatitis A vaccine:
No vaccine available
2 doses given 6–18 months apart depending on manufacturer
Hepatitis B is caused by the Hepatitis B virus which is a dsDNA and is under the Hepatitis C is caused by Hepatitis C virus, under the Flaviviridae. It is a
orthohepadnovirus. Despite the presence of vaccine, it remains a global health ssRNA that can be transmitted through blood transfusion and very low risk
problem that co-exist with HIV and is one of the known TTIs, hence, it is a routine of sexual or vertical transmission. No vaccine is available hence prevention
practice in PH to test the donor against Hep B. In molecular setting ,we will determine is still practiced. In the laboratory, we determine the glycoprotein,
the protein markers (surface, envelope, core proteins). envelope, and nucleocapsid proteins.
AIRAH M.
 In the laboratory, Hepatitis A is being detected by the presence of the
virus itself (antigen) and the antibodies produced by the body against
Hep A in chronic and acute infection, together with some biomarkers
(e.g. ALT). It is believed from 1st to 6th week of infection that the
antigen or viral load will be determined. After the 6th week, the
antibodies come in. In the first four weeks (1st to 6th week), IgM is very
prominent in the course of infection. As the infection extends through
16th week, IgG is more prominent. The detemination of IgM and IgG
is very important in the diagnosis and prognosis of the patient.
test algorithms
Image above: In the laboratory, Hepatitis B is being diagnosed according
to the course of infection. During the 1st month of exposure to the virus,
Hep B virus DNA can be detected. As it progresses to the 2nd and 3rd month,
the hepatitis marker (HBsAg and IgM anti-HBc) can be detected. The
HBsAg (surface antigen) remains constant in concentration. It will plateau
at the 4th month through the entire infection period. The HBeAg declines
its concentration from the 2nd to the 4th month, hence, the best time to
detect HBeAg is between the 2nd and the 3rd month of the infection. The
anti-HBe will occur between months 5 and 6 of the infection wherein
during this phase, it can be detected. The anti-HBs will occur at months 6
to 7 of the infection. IgG anti-HBc is best used in months 8 onwards.
just follow the flowchart
Image above: The Hepatitis C infection can be diagnosed in
between 2 to 6 months of infection. It will persist up to years. In
the first two months, there is already physical signs and
symptoms of the disease, hence, the doctor can diagnose it
through the symptoms, also with the biomarkers (ALT) or other
hepatitis markers. However, the HCV Abs will continue to rise,
hence, the best way to determine Hepatitis C is the presence of
the HCV Abs.
just follow the flowchart
AIRAH M.
 MOLECULAR BIOLOGY AND DIAGNOSTICS is variable and can be used to detect and type the I.B STREPTOCOCCUS PNEUMONIAE
TOPIC 13: MOLECULAR TESTING ON INFECTIOUS DISEASES Sequence B target, although some variants may escape detection ▪ gram (+) coccus, surrounded by a
(BACTERIAL AND HEALTHCARE-ACQUIRED INFECTIONS) if used together, are useful to detect the organism since polysaccharide capsule
Lecturer: Sir Niño Paolo Tan, RMT, MTMRS (c) both are not present in target organism (variant) and ▪ capsular variability also permits subtypes to
other flora avoid immune detection by antibodies
TOPIC OUTLINE:
▪ is also not specific for the target organism since previously generated by infection or
I. Diagnosis of Bacterial Infections (most common and most relevant) Sequence C
target organism (variant) also has Sequence C administration of vaccine
o Common Bacterial Infections: Escherichia coli 0157, Streptococcus
▪ will detect variants of the target organism but cannot ▪ causes pneumonia, septicemia, otitis
pneumoniae
be used for determining the type media, and meningitis
o Testing for Antimicrobial Resistance: Streptococcus pyogenes,
▪ early and accurate diagnosis of pneumococcal pneumonia remains
Mycobacterium tuberculosis As medical technologists or lab technicians, how will we know what gene or difficult because of the limitations of conventional diagnostic methods
o Common Healthcare-Acquired Infections: MRSA, Clostridium sequence to target? How will the vendors of these PCR or molecular methods (culturing for 3-5 days, smearing, biochemical testing: very cumbersome
difficile know what gene to target for S. aureus or E. coli? and a bit subjective)
DETECTION OF BACTERIAL PATHOGENS ▪ all of these are in the National Center for Biological Information ▪ can be diagnosed rapidly by analyzing sputum through real-time PCR
▪ traditionally based on phenotypic properties (culture, smears, serology, (NCBI) or even in the published literatures: hence, these are researched with the targets at lytA (autolysate)
biochemical reactions) already, and we have data on what particular sequence we should use
Specimen Traditional
o useful but tends to be mutable and not consistent to a given species NUCLEIC ACID AMPLIFICATION TECHNIQUE DETECTION Organism
Source
Gene Target
diagnostic methods
o time consuming and labor intensive (culture takes 3-5 days) ▪ expected to provide early diagnosis for proper treatment ▪ DNA polyermase gene
▪ advancements in molecular diagnostic techniques can provide ▪ detected directly in clinical specimens (blood, tissue, bronchoalveolar plyA (pneumolysin)
simultaneous and differentiation of numerous microbial pathogens lavage fluid, and other body fluids) blood ▪ lytA (autolysin)
o PCR and sequencing assays are particularly useful in the diagnosis Streptococcus CSF ▪ pbp2a (penicillin-
▪ PCR based amplification (targets multi-copy rRNA genes) culture
of microorganisms in patients who: pneumoniae serum binding protein)
▪ pre-analytical factors (specimen collection, transport, and nucleic acid
sputum ▪ pbp2b
⇥ have had prior antimicrobial therapy (some of the organisms extraction) can influence the ability of all amplification techniques to ▪ pspA (pneumococcal
have already died, hence, only a small number of organisms can detect bacterial nucleic acid surface protein)
be recovered)
⇥ had tested positive by blood culture owing to suspected ADVANTAGES DISADVANTAGES II. ANTIMICROBIAL RESISTANCE
contaminants, or strict physical criteria for suitability
⇥ are predisposed towards rare infections ▪ optimum sources and volume
rapid detection,
MOLECULAR TECHNIQUES sensitivity, and quality ▪ appropriate collection method
▪ the use of molecular methods for identification relies on the fact that ▪ transport (w/ ice) & storage conditions
different species of bacteria have distinct nucleic acid sequences (and ▪ specimen longevity
therefore peptides) that can be interrogated for species-level
CLINICAL SPECIMENS
identification
▪ may contain inhibitory substances that interferes with amplification:
▪ molecular methods are based on sequence hybridization or recognition
decreases sensitivity (compared to lab grown organisms [e.g. culture]
using known nucleic acid sequences (primers or probes)
which are cleaner)
▪ specificity of molecular methods targeting these sequences depends on
▪ more resistant to lysis (more buoyant) causing difficulty in extraction
the primers or probes that must hybridize specifically to the chosen point
of nucleic acid and concentrating by centrifugation: decreases
in the genome of the microorganisms
sensitivity and specificity
o genotyping techniques like NAAT, microarray, NGS, FISH
CONTROLS
▪ negative controls to monitor contamination
▪ other controls to monitor the efficacy of nucleic acid extraction
▪ internal control to monitor inhibition during amplification

I.A ESCHERICHIA COLI O157:H7

▪ enterohemorrhagic serotype of E. coli causing HUS ▪ microorganisms naturally develop defenses to antimicrobial agents as a
▪ Shiga toxin gene: can detect the organism using result of mutation (for survival and growth advantage):
this gene however, it is not specific for this o alerted target binding
particular serotype o active extrusion: prevent or push out the antimicrobial agent from
entering the organism, or
BD MAX BioFire Luminex Nanosphere Prodesse o microbial enzymes that inactivate the drug
Enteric FilmArray xTAG Verigene Enteric or Hologic ▪ long-term antibiotic therapy can lead to the development of resistant
Bacterial Panel GI Panel GPP Pathogens SSCS
▪ is common to all three organisms: hence, if we want clones of organisms
Cary-Blair
to test for the target organism only, this is not useful stool Cary-Blair
Stool Stool or Para-Pak
o may persists in low numbers below the detection levels of routine
Sequence A since this is not specific for that particular organism Cary-Blair Stool Stool laboratory sensitivity testing methods
C&S Stool
▪ is not an acceptable area for probe or primer binding *Shiga toxin *Shiga
*Shiga toxin gene
to detect the target gene toxin gene

AIRAH M.
 RESISTANCE MECHANISMS II.A STREPTOCOCCUS PYOGENES o detect mutations in the genes associated with resistance to
EXAMPLE OF ▪ Lancefield group A Streptococcus (GAS) isoniazid and rifampin
MECHANISM EXAMPLE
AGENTS AFFECTED ▪ acute infection causes pharyngitis, impetigo,
Xpert MTB/RIF Test (Cepheid, Sunnyvale, CA)
destruction or scarlet fever, cellulitis, acute bacterial
β -lactamases, ▪ directly test on respiratory specimens
modification of β-lactamases endocarditis, and necrotizing fasciitis
aminoglycosides ▪ nested real-time PCR of the rpoB gene followed by hybridization
agent ▪ acute rheumatic fever (ARF) and acute
▪ both M. tuberculosis complex DNA and rifampin resistance can be
β-lactamases, glomerulonephritis (AGN) for delayed
detected simultaneously
fluoroquinolones, treatment or in cases of drug resistance
elimination of multidrug efflux o the rRNA sequence is not useful here since, even if it is specific, this
macrolides, ▪ a fast-emerging bacterium having drug
agent systems sequence is only for the resistant TB (?), which in this test, we are
chloramphenicol, resistance: like MRSA or tuberculosis
determining whether the organism is resistant or not
trimethoprim GASDirect test
thick cell walls that III. HEALTHCARE-ACQUIRED INFECTIONS
▪ identifies specific rRNA sequence in pharyngeal specimens by a single-
altered cell wall exclude agent, vancomycin, ▪ “Hospital-Acquired Infections/Nosocomial Infections”
stranded chemiluminescent nucleic acid probe
structure altered agent binding β-lactamases ▪ caused by poor infection control of the hospital
▪ specificity: 98-99%
sites ▪ will cause with prolonged hospital stays and the occupation of isolation
alternate metabolic sulfonamides, II.B MYCOBACTERIUM TUBERCULOSIS rooms, resulting in extra in-hospital costs
altered enzymes ▪ Methicillin Resistant Staphylococcus aureus (MRSA)
pathways trimethoprim
▪ Clostridium difficile
GENES CONFERRING RESISTANCE TO ANTIMICROBIAL AGENTS IN ▪ cause of respiratory tract infections causing
III.A MRSA
PARTICULAR ORGANISMS significant levels of morbidity and mortality
▪ leading cause of bone and joint infections,
ANTIMICROBIAL GENE(s) CONFERRING ▪ mycobacterial smears and culture take time as
ORGANISM bacterial pneumonia for children
AGENT RESISTANCE TB is a slow grower in vitro
▪ mecA and mecC: causes resistance of the
Staphylococcus β-lactam antibiotics
oxacillin mecA
aureus o mecA gene replaces penicillin-
Gene Traditional
Streptococcus Organism Specimen Source binding protein PBP1 with PBP2a
penicillin pbp1a and pbp1b Target diagnostic methods
pneumoniae ▪ sputum which has low binding affinity for
gram-negatives β-lactams tem, shv, oxa, ctx-m ▪ bronchoalveolar penicillin
Mycobacterium
vanA, vanB, vanC, vanD, tuberculosis
lavage 14S rRNA culture ▪ PCR is considered to be the best molecular diagnostic tool for MRSA
Enterococcus vancomycin ▪ bronchial washings
vanE, vanG detection
▪ gastric aspirate
Salmonella quinolones gyrA, gyrB, parC, pare
PCR Method Target gene
Mycobacterium isoniazid katG, inhA ▪ nucleic acid amplification methodologies can detect M. tuberculosis single target easy to perform, but amplification inhibition
tuberculosis rifampin rpoB directly in a clinical specimen mecA
PCR can lead to false (-) results
▪ also allow detection from fresh, frozen, or fixed tissue mecA
TESTING FOR ANTIMICROBIAL RESISTANCE Duplex PCR can be very useful
▪ sensitive and specific (compared to AFB smears which are not specific for femB/nuc
▪ done when microorganisms persist despite being treated with mecA
M. tuberculosis; can only detect the presence of AFB which can also be can reach 98% accuracy within 6h of visible
antimicrobial agents that are usually effective against the particular Triplex PCR nuc
present in other organisms) growth detection
isolate or when large numbers of organisms are observed in normally 16S rRNA
▪ targets species-specific sequences, such as IS6110 and 16S rRNA
sterile fluids much faster as detection and amplification is
▪ PCR-positive samples are hybridized with genus-specific and
real-time PCR mecA done at the same time, less sensitive to
PHENOTYPIC METHODS GENOTYPIC METHODS species/complex specific probes contamination
more straightforward where in ▪ qPCR assays have also been developed for M. tuberculosis detection with
in vitro susceptibility testing 1 Nanosphere, Inc. and BioFire Diagnostics, Inc.
the genes responsible for primers and probes targeting rRNA internal transcribed spacer (ITS)
where MIC is measured
resistance is the one detected elements in M. tuberculosis ▪ both are multiplex PCR with fluorescent probes targeting mecA
gene
GENOTYPIC TESTING FOR ANTIMICROBIAL RESISTANCE Amplified MTD Test (Hologic)
▪ specimen used are positive blood cultures
When are genotypic methods done? ▪ directly test on respiratory specimens
2 Cepheid’s Xpert MRSA/SA Blood Culture test
▪ targets the rRNA (16s rRNA) of the M. tuberculosis complex
▪ when an organism has an MIC at or near the breakpoint of resistance ▪ real-time PCR targeting Spa, mecA, SCCmec genes
▪ uses transcription-mediated amplification
▪ genes involved in the resistance of organisms to antimicrobial agents ▪ gram staining on the smears from the positive blood culture is done
▪ hybridization protection assay to detect the amplicons
can be detected directly in the clinical specimen (save more time, less first
hazardous) MULTI-DRUG RESISTANT TB 3 AdvanDx, Inc.
▪ monitoring the spread of a resistance gene in multiple isolates of the ▪ the longer a patient with TB is inadequately treated, the more likely the ▪ utilizes peptide nucleic acid-fluorescent in situ hybridization (PNA-
same organism is more useful in epidemiological investigations development of resistance and possible spread of the resistant FISH) for detection of a positive fluorescent signal directly from a
▪ molecular methods are considered the gold standard for validation organisms positive blood culture
of new phenotypic assays ▪ nucleic acid amplification assays for the determination of drug resistance ▪ targets mecA gene
o rapid and specific detection of mutations in genes associated with ▪ fluorescent microscope for visualization: has subjectivity aspect
resistance to particular antimicrobial agents that provide irrefutable
evidence of resistance in a short period

AIRAH M.
 III.B CLOSTRIDIUM DIFFICILE MOLECULAR TESTING FOR NOSOCOMIAL INFECTIONS
▪ anaerobic, gram (+), spore-forming, ▪ molecular typing is an important infection control tool to monitor the
produces toxins A and B prevalence of certain strains within a healthcare institution
▪ found in environment, GIT, of host ▪ regardless of the methodology chosen, there should be a basic
▪ causes colitis, pseudomembraneous colitis, understanding of the molecular screening and its impact to infection
diarrhea (nosocomial diarreha) control, hospital/laboratory finances, and HAI prevention
▪ toxinogenic C. difficile detection by tissue ▪ has a huge impact in the medical field which are used to augment
culture cytotoxin assay often is considered traditional methods which were considered as the gold standard before
the best method ▪ molecular diagnosis can be used to detect low quantities of pathogen
▪ real-time PCR targets the C. difficile toxin genes (tcdA, tcdB, and which cannot be done using traditional methods
tcdC117) ▪ these have enhanced sensitivity and specificity compared to traditional
▪ newer methods also targets cdtA and cdtB (binary toxins) methods
▪ this toxin gene profiling can allow an evaluation of the pathogenic ▪ can also decrease TAT, especially for the slow-growing microorganisms
potential of C. difficile and those that are difficult to isolate and identify
▪ even if this is expensive, this can be used instead of traditional methods
1 pulsed field gel electrophoresis (PFGE) IF the patient impact outweighs the cost (e.g. GeneExpert for TB: ₱10,000
▪ commonly used in North America for one test)
2 polymerase chain reaction ribotyping (PCR-RT) ▪ gives us more options and more freedom to maneuver which is very
▪ commonly used in Europe important especially nowadays wherein certain diseases and pathogens
▪ analyzes variability of the intergenic spacer region – 16S and 23S are advancing and we can never really be sure about anything (e.g.
ribosomal RNA (rRNA) COVID)
▪ primers are designed that target the conserved regions of the 16S
and 23S rDNAs REFERENCES
▪ variable PCR amplicons are produced that are separated by agarose
gel electrophoresis
▪ the different banding patterns observed for C. difficile isolates are
called as PCR ribotypes
NEWER MOLECULAR-BASED METHODS
▪ comparable testing time, ease of technically performing the assays,
and relatively better performance compared to EIA and culture-based
assays
▪ targets tcdB, tcdB + tcdA, or tcdC (hypervirulent NAP1 strain)
▪ diarrheal/liquid stool is preferred over stool swabs and formed stool

MOLECULAR DIAGNOSTIC TESTS FOR C. difficile

Assay Name Vendor Gene Target Method
ICEPlex C. PCR with capillary
PrimeraDx tcdB
difficile ikit electrophoresis
IMDx C. Intelligent
difficile for Medical tcdB and tcdA* real-time PCR
Abbott m2000 Devices, Inc.
Quidel
Molecular Quidel Corp tcdB and tcdA real-time PCR
Direct
tcdB, tcdA, tcdC, and real-time
Verigene C. Nanosphere,
presumptive ID of PCR/nanoparticle
difficile test Inc.
O27/NAP1/BI strain hybridization
*tcdA: tcdA gene is not tested alone since this is rare, hence, it is better to combine
this with tcdB

result for C. difficile using

multiplex PCR method

AIRAH M.