Research
© 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Construction and Application of a Protein
Interaction Map for White Spot Syndrome
Virus (WSSV)*□ S
Pakkakul Sangsuriya‡§, Jiun-Yan Huang¶, Yu-Fei Chu¶, Kornsunee Phiwsaiya‡储,
Pimlapas Leekitcharoenphon‡, Watcharachai Meemetta‡, Saengchan Senapin‡储,
Wei-Pang Huang¶, Boonsirm Withyachumnarnkul‡**‡‡, Timothy W. Flegel‡储§§,
and Chu-Fang Lo¶§§¶¶
White spot syndrome virus (WSSV) is currently the most
serious global threat for cultured shrimp production. Al-
though its large, double-stranded DNA genome has been
completely characterized, most putative protein functions
remain obscure. To provide more informative knowledge
about this virus, a proteomic-scale network of WSSV-
WSSV protein interactions was carried out using a com-
prehensive yeast two-hybrid analysis. An array of yeast
transformants containing each WSSV open reading frame
fused with GAL4 DNA binding domain and GAL4 activation
domain was constructed yielding 187 bait and 182 prey
constructs, respectively. On screening of ⬃28,000 pair-
wise combinations, 710 interactions were obtained from
143 baits. An independent coimmunoprecipitation assay
(co-IP) was performed to validate the selected protein
interaction pairs identified from the yeast two-hybrid ap-
proach. The program Cytoscape was employed to create
a WSSV protein–protein interaction (PPI) network. The
topology of the WSSV PPI network was based on the
Barabási-Albert model and consisted of a scale-free net-
work that resembled other established viral protein inter-
action networks. Using the RNA interference approach,
From the ‡Center of Excellence for Shrimp Molecular Biology and
Biotechnology (Centex Shrimp), Mahidol University, Rama VI Rd.,
Bangkok, 10400, Thailand; §Department of Biotechnology, Faculty of
Science, Mahidol University, Rama VI Rd., Bangkok, 10400, Thailand;
¶Institute of Zoology, National Taiwan University, Taipei, Taiwan,
Republic of China; 储National Center for Genetic Engineering and
Biotechnology (BIOTEC), National Science and Technology Develop-
ment Agency, Pathum Thani, 12120, Thailand; **Shrimp Genetic Im-
provement Center, Surat Thani 84100, Thailand; ‡‡Department of
Anatomy, Faculty of Science, Faculty of Science, Mahidol University,
Bangkok, 10400, Thailand; ¶¶Institute of Bioinformatics and Biosignal
Transduction, College of Bioscience and Biotechnology, National
Cheng Kung University, Tainan, Taiwan, Republic of China
Received March 13, 2013, and in revised form, October 21, 2013
Published, MCP Papers in Press, November 11, 2013, DOI
10.1074/mcp.M113.029199
Author contributions: P.S., S.S., W.H., T.W.F., and C.L. designed
research; P.S., J.H., Y.C., K.P., P.L., W.M., and S.S. performed re-
search; S.S., W.H., B.W., T.W.F., and C.L. contributed new reagents
or analytic tools; P.S., S.S., W.H., T.W.F., and C.L. analyzed data;
P.S., S.S., and T.W.F. wrote the paper.
Molecular & Cellular Proteomics 13.1
This is an Open Access article under the CC BY license.
This paper is available on line at http://www.mcponline.org
knocking down either of two candidate hub proteins gave
shrimp more protection against WSSV than knocking
down a nonhub gene. The WSSV protein interaction map
established in this study provides novel guidance for further
studies on shrimp viral pathogenesis, host-viral protein in-
teraction and potential targets for therapeutic and prevent-
ative antiviral strategies in shrimp aquaculture. Molecular
& Cellular Proteomics 13: 10.1074/mcp.M113.029199, 269–
282, 2014.
White spot syndrome virus (WSSV)1 is the causative agent
of white spot disease (WSD) and is one of the most serious
viral pathogens that threaten the shrimp culture industry
worldwide. Because WSD causes rapid and high mortality up
to 100% within 3–10 days after viral infection (1), it causes
dramatic economic losses on farms. WSSV is a large envel-
oped, ovoid to bacilliform, double-stranded DNA (dsDNA)
virus with a genome of ⬃300 kb (See reviews in (2, 3)). The
WSSV genome has been completely characterized for iso-
lates from Thailand (GenBank accession number AF369029),
China (accession number AF332093) and Taiwan (accession
number AF440570). To expand its basic genetic information,
various genomic and proteomic approaches have been ap-
plied to gain more insight into the molecular mechanisms of
WSSV pathogenesis (See reviews in (2, 3)). However, the roles
of most of the WSSV proteins still remain to be elucidated.
This is due to the fact that many of its putative open reading
frames (ORFs) lack homology to known proteins in the data-
base. Protein–protein interaction studies can provide a valu-
able framework for understanding the roles of protein func-
tions. Interaction studies of WSSV proteins have particularly
focused on viral structural proteins (4 –15). However, so far
there has been no report on a protein–protein interaction (PPI)
network for WSSV or any other crustacean virus. By contrast,
1
The abbreviations used are: WSSV, white spot syndrome virus;
WSD, white spot disease; ORF, open reading frame; BD, binding
domain; AD, activation domain; PPI, protein–protein interaction;
IMNV, infectious myonecrosis virus.
269
WSSV Protein Interaction Network
several PPI networks for cellular organisms such as Saccha-
romyces cerevisiae (16, 17), Helicobacter pylori (18), Drosoph-
ila melanogaster (19), Caenarhabitis elegans (20), Plasmodium
falciparum (21), and Homo sapiens (22, 23) and pathogens
such as bacteriophage T7 (24), vaccinia virus (25), hepatitis C
virus (26), and herpesviruses (27–29) have already been es-
tablished. Therefore, the present study aimed to obtain a
more fundamental understanding of WSSV protein interac-
tions. A comprehensive yeast two-hybrid assay was em-
ployed to generate viral fusion proteins with DNA binding (BD)
and activation (AD) domains in an array format that effectively
allowed searching every possible binary interaction in WSSV.
The interaction results from the yeast two-hybrid assays were
subsequently validated by coimmunoprecipitation (co-IP).
Topological properties of the WSSV PPI network were as-
sessed and compared with previously published viral net-
works. Candidate viral hub proteins with high numbers of
interacting partners were identified in this study and their
significance was investigated using an RNA interference
approach.
EXPERIMENTAL PROCEDURES
WSSV and Shrimp—The WSSV Taiwan isolate (WSSV-TW) origi-
nally isolated from a batch of WSSV-infected Penaeus monodon
collected in Taiwan in 1994 (30, 31) was used as the template for
WSSV ORFs amplification. To propagate the virus and use it in
experimental challenges, a crude WSSV stock was prepared from
moribund P. vannamei infected with WSSV-TW strain. Gill and stom-
ach tissues were homogenized in TNE buffer (20 mM Tris-Hcl, pH 7.4,
400 mM NaCl, 1 mM EDTA) and clarified by centrifugation at 1500 ⫻
g for 10 min at 4 °C. The supernatant was then diluted in PBS at
dilution of 1:100, filtered through 0.45 ␮m membrane filter and stored
at ⫺80 °C as a virus stock. SPF P. vannamei (5– 6 g body weight) were
kindly provided by Charoen Pokphand Company. The animals were
acclimatized in a wet laboratory in 1000 L aquaria containing contin-
uously aerated artificial seawater at 15 ppt and 26 –28 °C for 2–3 days
before experiments began.
Modification of pGBKT7 Plasmid—To enable simple homologous
recombination, pGBKT7 or BD plasmid (Clontech) was modified to
contain the multiplex cloning site (MCS) similar to pGADT7 or AD
plasmid (Clontech). This was achieved by digestion of pGADT7 with
NdeI and BamHI enzymes and use of the 48-bp released fragment for
insertion into NdeI-BamHI digested pGBKT7. The sequence of the
resulting plasmid named pGBKT7–1 was verified by DNA sequencing
(Macrogen Co. Ltd., South Korea).
Selection and Amplification of WSSV Open Reading Frames
(ORFs)—To construct WSSV protein arrays, criteria in selecting
WSSV ORFs were as follows. First, all 180 ORF that encoding putative
functional proteins predicted in the China isolate (GenBank accession
number AF332093) (32) were chosen. All of these were also found in
the Taiwan isolate (GenBank accession number AF440570). To en-
hance the integrity of the library, 22 predicted ORFs that appear in
both the Thailand (GenBank accession number AF369029) and Tai-
wan isolates but are missing in the China isolate were included. Thus,
a total of 202 putative ORFs were chosen for inclusion in this study.
Among these, large ORFs with nucleotide sequences longer than
3135 bp were divided into sub-fragments to increase the success for
PCR amplification and for protein expression in yeast cells. Thus, the
total number of WSSV fragments required to be amplified was 246
(202 plus 44 fragments). Primers were designed in two sets to be
270
used for two rounds of PCR amplification. The first primer set was
designed based on the WSSV genome sequences to bind specifically
to the selected fragments. Additionally, both upstream and down-
stream primers contained common sequences of 15–17 nucleotides
that facilitated binding with the second primer. The second primer set
(including BD and AD primer sub-sets) was designed to contain
additional 34 –35 nucleotide sequences that were homologous to
sequences used in the yeast two-hybrid vectors. The primer set
designs are shown in supplemental Table S1 and the sequences of
the primers in supplemental Table S2.
A two-step PCR reaction was performed with primer set 1 in the
first PCR reaction to amplify each WSSV fragment. In the second
reaction WSSV fragments were amplified to contain flanking regions
homologous to the yeast two-hybrid vectors, pGBKT7–1 and
pGADT7. The first reaction was carried out in 25 ␮l containing 0.2 ␮M
of each primer, 200 ␮M of dNTP mix, 1.5 mM of MgCl2, 2.5 U of
TaqDNA polymerase (Invitrogen), 1⫻ reaction buffer, and WSSV DNA
template. The PCR protocol comprised initial activation at 94 °C for 3
min followed by 30 cycles at 94 °C for 30 s, annealing at 50 °C for
30 s, extension at 72 °C with time depending on the size of the DNA
target (1 min per 1 kb) and then final extension at 72 °C for 5 min. After
verification of the first PCR products by agarose gel electrophoresis,
they were used as templates for the second PCR reaction with primer
set 2. Each product was subjected to two more reactions (one with
the BD primer set and another with the AD primer set). The second
PCR reaction and protocol was the same as in the first reaction,
except that the annealing step was at 65 °C instead of 50 °C. Finally,
PCR products were purified using a PCR purification kit (Qiagen)
before being cloned into pGBKT7–1 and pGADT7 vectors.
Generation of WSSV Protein Arrays—All PCR-generated WSSV
DNA fragments were fused with GAL4 DNA binding domain (BD) and
activation domain (AD) of pGBKT7–1 and pGADT7, respectively, by
natural homologous recombination in yeast. The pGBKT7–1 and
pGADT7 were linearlized by EcoRI and SmaI restriction enzymes. For
bait construction, each amplified WSSV DNA fragment and linearized
pGBKT7–1 vector were co-transformed into yeast Saccharomyces
cerevisiae strain Y187 (Clontech). For prey construction, a recombi-
nation experiment was carried out using WSSV fragments and linear-
ized pGADT7 in yeast strain AH109 (Clontech). High-throughput
transformation was carried out as previously described (33). The
experiment was conducted in 96-well plates so that each well con-
tained one WSSV DNA fragment. After transformation, recombinant
clones from each well were selected by growing on solid S.D. medium
lacking tryptophan (S.D./-Trp) for baits or lacking leucine (S.D./-Leu)
for prey selection. The transformants were then verified by being
subjected to yeast colony PCR using vector primers (supplemental
Table S2). The validated homologous recombinant clones (pools of
3– 6 individual clones) were transferred into a 96-well plate containing
appropriate selective media and the cultures were grown at 30 °C.
The bait and prey constructs in 96-well plates were called as BD
arrays or AD arrays, respectively.
High-throughput Screening of Protein Arrays by Yeast Mating—
WSSV protein–protein interaction was sought using a yeast mating
strategy in which each bait was used to screen for each prey in the AD
arrays. Briefly, an individual bait was grown in 5 ml of S.D./-Trp at
30 °C for 24 – 48 h with shaking and then expanded by inoculation of
2 ml cultures into 30 ml of S.D./-Trp to be grown for a further 24 – 48
h. After yeast collection and resuspension in 15 ml of YPD containing
10% glucose, 2 ␮l of bait culture was dropped on the YPD agar
containing 10% glucose, and yeast spots were allowed to dry at room
temperature. For AD array preparation, 20 ␮l of each prey cultured in
S.D./-Leu was inoculated into 80 ␮l of YPD containing 10% glucose
and then grown at 30 °C overnight. Next, 3 ␮l of each prey culture
was dropped on top of the bait spots and the resulting plate was
Molecular & Cellular Proteomics 13.1

TABLE I
Sequences and names of primers used
Names Sequences (5⬘ to 3⬘)
WSSV050-RNAi-F TTAATTCGCTACTATTAATA
WSSV050-RNAi-R TTTTATATCCTCAAGAG
WSSV050-F ATGCTTATTTTAATTAA
WSSV051-RNAi-F TTCAGGGCGGCTATCTTATG
WSSV051-RNAi-R GCGGTAGCGTTCTCTTCATC
WSSV051-F TTCACGAACGGCTGCCATTT
WSSV517-RNAi-F AAGGAACGGAATGTCCACAA
WSSV517-RNAi-R CCAGTGGTGCTGACGATG
WSSV517-R TCCCCGCGGTTTTGTTCCTTGTAATT
ICP11-F CGGATCCACCATGGCCACCTTCCAGACT
ICP11-R AGCGGCCGCCTTCTGTTGTTGGCACAAT
Actin-F AGGCTCCCCTCAACCCCAAGG
Actin-R GCAGTGATTCTGCATGCG
incubated at 30 °C for 48 h. Diploid cells were then selected by
replica-plating onto S.D./-Leu/-Trp followed by incubation for 48 h at
30 °C. To select positive interactions, the diploids were transferred to
S.D. medium lacking adenine, histidine, leucine, and tryptophan
(S.D./-Ade/-His/-Leu/-Trp) containing 40 ␮g/ml of X-␣-gal followed by
incubation at 30 °C for up to 2 weeks. Growth of blue yeast colonies
on this selective medium was scored as a positive interaction. This
screening for interactions was carried out independently at least
twice. All baits used for screening were previously verified not to be
auto-activated. This was done by mating all baits with yeast AH109
containing empty pGADT7 vector in the same manner as described
above. Baits that grew and turned blue on selective media were not
used for protein interaction screens.
Bioinformatic Data Analysis—Homology searches were performed
using BLAST program in the NCBI database (http://www.ncbi.nlm.
nih.gov/BLAST/). DNA and protein sequence analyses were carried
out using the EXPASY server (http://au.expasy.org/). The protein–
protein interaction networks were visualized using Cytoscape soft-
ware (www.cytoscape.org). Network parameters were analyzed by
the Cytoscape plug-in called Network analyzer (34).
Coimmunoprecipitation Assays—For validation of WSSV protein
interactions from yeast two-hybrid assay, each WSSV gene fragment
was cloned into heat inducible vectors pDHsp/V5 and pDHsp/FLAG
containing a Drosophila heat shock protein 70 promoter (35) using the
primers listed in supplemental Table S2. Additionally, to increase the
molecular mass of small ORFs (coding a product less than 10 kDa),
such WSSV genes were cloned into pDHsp/EGFP-V5 vector (14) for
fusion with an EGFP (enhanced green fluorescent protein) tag at the
C-terminal end. The FLAG-tagged and V5-tagged WSSV fusion plas-
mids were cotransfected pairwise into Sf-9 (Spodoptera frugiperda)
cells. Cotransfection and coimmunoprecipitation followed methods
previously described (35). The immunoprecipitated complexes were
separated by SDS-PAGE before being subjected to immunoblot as-
say. The V5-tagged fusion proteins were detected with rabbit anti-V5
antibody (Sigma) and goat anti-rabbit IgG-HRP conjugate (Sigma).
The FLAG-tagged fusion proteins were detected with mouse anti-
FLAG antibody (Sigma) and goat anti-mouse IgG-HRP conjugate
(Sigma).
Double-stranded RNA Production—Based on RNAi capacity pre-
diction (36), 207-bp and 282-bp fragments of WSSV051 and
WSSV517, respectively, were targeted for double-stranded RNA
(dsRNA) production. The respective fragments were amplified by PCR
using primer pairs as follows: WSSV051-RNAi-F and WSSV051-
RNAi-R and WSSV517-RNAi-F and WSSV517-RNAi-R (Table I). The
amplicons obtained were cloned into pDrive vector (Qiagen, Valencia,
Molecular & Cellular Proteomics 13.1
WSSV Protein Interaction Network
Remarks
dsRNA production &
transcription analysis
dsRNA production &
transcription analysis
dsRNA production &
transcription analysis
WSSV detection
Internal control
CA). Recombinant plasmids with opposite orientation of respective
fragments were linearized with HindIII restriction enzyme to prepare
sense and antisense templates. Single stranded RNAs were then
generated by in vitro transcription using T7 RNA polymerase (Pro-
mega, Madison, WI). Equivalent amounts of sense and antisense RNA
were mixed and annealed by incubation at 37 °C for 1 h. After DNA
removal and purification, the dsRNA integrity was monitored in aga-
rose electrophoresis gels and by RNase treatment with appropriate
nucleases. The in vitro transcribed dsRNAs were subsequently quan-
tified by spectrophotometer and freshly dissolved in 150 mM NaCl
solution before use. Additionally, WSSV050 gene was selected as a
nonhub gene and dsRNA-WSSV050 was prepared in the similar
manner using specific primers listed in Table I. A nonrelated dsRNA
used in control experiments was also designed from infectious myo-
necrosis virus (IMNV) (37).
Suppression of WSSV Hub Genes—Specific pathogen free (SPF)
shrimp P. vannamei of average 5– 6 g body weight (BW) were divided
into four groups of 14 individuals each. Groups I, II, and III were
injected with 50 ␮l of WSSV051, WSSV517, and IMNV dsRNAs,
respectively (2.5 ␮g/g BW) at the lateral area of the fourth abdominal
segment. Group IV was injected with 50 ␮l of 150 mM NaCl solution.
At 2 days post dsRNA and NaCl administration, all groups were
subsequently challenged with 50 ␮l of crude WSSV stock at a dilution
of 5 ⫻ 10⫺5 that gave ⬃50% shrimp death within 5 days (5-day LD50).
At 3 days and 6 days post WSSV injection, four shrimp specimens
from each group were sampled for RT-PCR and PCR analysis. Mean-
while, three shrimp specimens were kept for histopathology. Briefly,
the cephalothorax region of samples was fixed in Davison’s fixative
solution and processed for standard paraffin sectioning (38). The
sections were then stained with hematoxylin and eosin (H & E).
For the mortality test, a parallel experiment was carried out by
dividing shrimp into four groups of 15 individuals each. All groups
administrated dsRNAs or NaCl were then challenged with WSSV as
described above. Shrimp mortality was monitored twice a day until 17
days post WSSV challenge. The mean time to death was calculated
for the 15 shrimp in each group. Experiments were performed in
duplicate. Statistical analysis was carried out using one-way analysis
of variance with SigmaStat software followed by pairwise multiple
comparison procedures (Holm-Sidak method) with differences con-
sidered to be statistically significant when p ⱕ 0.05.
Comparison of Protective Effects Using dsRNAs From WSSV Hub
and Nonhub Genes—To compare the protective effects of dsRNAs
produced from WSSV hub and nonhub genes, a knockdown experi-
ment was carried out as described above with some alternations.
Briefly, whiteleg shrimp P. vannamei (average 5– 6 g BW) were divided
271
WSSV Protein Interaction Network
into four groups including group I (hub WSSV051 dsRNA injection),
group II (hub WSSV517 dsRNA injection), group III (nonhub WSSV050
dsRNA injection), and group IV (NaCl injection control). Groups I to III
had subgroups of two each for treatment with either 1 ␮g or 5 ␮g of
dsRNA per gram BW. At 2 days post injection (dpi) of dsRNA or NaCl,
shrimp in each group (24 –34 individuals each) were challenged with
crude WSSV stock at a 3-day LD50 dose. Shrimp mortality was
monitored twice daily for 17 days. At days 3 and 6 of the experiment,
shrimp specimens were sampled for investigation of WSSV tran-
scripts by RT-PCR, as described above.
RT-PCR Analysis—Total RNA of shrimp specimens was isolated
from gill tissues using TrizolTM (Invitrogen) as described in the man-
ufacture’s protocol. RNA quantity and quality were assessed by
measuring absorbance at 260 and 280 nm. Semi-quantitative RT-
PCR was employed to evaluate the expression profiles of hub genes
WSSV051 and WSSV517 and nonhub gene WSSV050 after dsRNA
treatement. WSSV partial sequences were amplified using respective
primer pairs; WSSV051-F and WSSV051-RNAi-R for WSSV051,
WSSV517-RNAi-F and WSSV517-R for WSSV517, and WSSV050-F
and WSSV050-RNAi-R for WSSV050 (Table I). Partial P. vannamei
␤-actin (GenBank accession no. AF300705) amplified using primers
described in Table I was used as a control. RT-PCR reactions were
carried out in a 20 ␮l reaction solution containing of 400 ng of total
RNA template, 0.2 ␮M of each forward and reverse primer, 0.8 ␮l of
SuperScript One-Step RT/Platinum Taq mix (Invitrogen) and 1X reac-
tion buffer. The reaction protocol comprised reverse transcription at
50 °C for 30 min followed by denaturation at 94 °C for 2 min followed
by PCR cycling consisting of denaturation at 94 °C for 15 s, annealing
at 55 °C for 30 s and extension at 68 °C for 30 s. The PCR cycling was
optimized to detect each transcript as follows: 40 cycles for WSSV
genes and 25 cycles for ␤-actin. RT-PCR products were analyzed by
agarose gel electrophoresis.
WSSV Diagnosis by PCR—WSSV infection was evaluated by PCR
amplification of ICP11 using specific primer pairs listed in Table I.
DNA samples were prepared by homogenizing shrimp gill tissues in
TF lysis buffer (50 mM Tris-HCl, pH 9, 50 mM NaCl, 100 mM EDTA, 2%
SDS, 1 ␮g/ml proteinase K). After incubation of tissue lysates at 60 °C
for 10 min, DNA was extracted using the standard phenol/chloroform
protocol (39). DNA quantity and quality was measured by spectro-
photometer. PCR reactions were carried out in a 20 ␮l reaction
solution containing 500 ng of DNA sample, 0.2 ␮M of each forward
and reverse primer, 200 ␮M of dNTP mix, 1.5 mM of MgCl2, 2.5 U of
TaqDNA polymerase (Invitrogen), and 1⫻ reaction buffer. The ampli-
fication protocol comprised first denaturation at 94 °C for 3 min
followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at
55 °C for 30 s and extension at 72 °C for 30 s. Amplification of shrimp
␤-actin using primers listed in Table I and the same reaction compo-
nents and thermal cycling protocol described for ICP11 above served
as an internal control.
RESULTS
Construction of WSSV Protein Arrays—WSSV proteins
fused with the GAL4 DNA-binding domain (BD) or activating
domain (AD) were arranged in a matrix or array format to
facilitate the search for pairwise protein interactions. WSSV
ORFs predicted to encode functional proteins were amplified
and revealed an ⬃92% successful amplification rate. Of 246
fragments, 227 fragments were successfully prepared for ho-
mologous recombination with pGBKT7–1 (BD) plasmid
whereas 226 fragments were prepared for pGADT7 (AD) plas-
mid. Amplification of most of the large ORFs of ⬃3000 –7000
bp failed. In the yeast homologous recombination steps, 187
272
(representing 170 ORFs) out of the starting 227 WSSV frag-
ments were able to generate yeast transformants for bait
arrays and 182 (representing 172 ORFs) out of the 226 WSSV
fragments could produce transformed cells for prey arrays.
Putative functions of WSSV ORFs in the arrays have been
roughly classified into 6 categories; (1) DNA replication, tran-
scription and regulation, (2) nucleotide metabolism, (3) struc-
tural proteins, (4) protein motifs and/or signatures, (5) protein
modification, and (6) unknown (supplemental Table S3).
Identification of WSSV Protein–protein Interactions—Before
screening for protein interactions, the BD constructs that
could autonomously induce reporter genes were screened out
to eliminate false positive results. Of 187 baits, there were 31
baits that could activate HIS3, ADE2 and MEL1 (supplemental
Table S4) reporter genes. Therefore, they were excluded from
further screening. In the yeast two-hybrid assay, each bait
was mated with every prey in the AD arrays, thereby gener-
ating 28,392 pairwise combinations of proteins (156 baits ⫻
182 preys). After selecting the diploids, they were tested for
reporter gene activation on S.D./-Ade/-His/-Leu/-Trp/X-␣-gal
plates. Growth of blue colonies representing potential positive
interactions was scored. The interactions were independently
performed at least twice. The reproducible results were
scored as high confidence (H) results whereas the results with
poor reproducibility were referred to as low confidence (L)
results. During the mating experiments, it was found that 13
baits failed to generate diploid cells so they could not be used
for further assays. The total interaction numbers from the
remaining 143 baits were 710. Among these, 26 interaction
pairs were detected in both orientations (i.e. bait-prey and
prey-bait reciprocal interactions). It was also revealed that of
the 143 baits, there were 42 baits that did not show interaction
with any tested viral prey protein (i.e. 0 interactions). The
distribution of the number of protein interaction partners of all
tested baits was revealed to range from 0 to 48. The top 22
proteins with the highest number of interactions ranging from
10 to 48 were shown in Fig. 1A. The ratio of interactions to the
total number of examined ORFs of WSSV was calculated as
4.97.
Building the WSSV Protein–Protein Interaction (PPI) Net-
work—To build the WSSV protein–protein interaction (PPI)
network, the open source software platform Cytoscape for
visualization of complex-networks (40, 41) was employed. All
the WSSV proteins that yielded interactions were set as input
for the Cytoscape program. The results revealed that our
WSSV PPI network comprised 668 interactions (edges) from
142 different proteins (nodes) (Fig. 1B). The 142 individual
nodes were derived from 101 bait proteins and an additional
41 prey proteins. Proteins with a large number of interactions
(usually called hubs) are likely to be more essential than
proteins with a few links (42). However, there are many criteria
to specify hub proteins (43). In this study, we defined the top
8 proteins with the highest number of interactions shown in
Fig. 1 as hubs. Therefore, the hub proteins in the WSSV PPI
Molecular & Cellular Proteomics 13.1
 WSSV Protein Interaction Network

FIG. 1. WSSV protein–protein interactions. A, Distribution of the number of protein interaction partners from the top 22 proteins with the
highest connectivity. The x axis depicts the WSSV baits whereas the y axis represents the number of their interaction partners. The eight
identified hubs are marked by asterisks. The ORF numbers for both Taiwan isolate (WSSV) and China isolate (WSV) are indicated. Known

Molecular & Cellular Proteomics 13.1 273

WSSV Protein Interaction Network

FIG. 2. The WSSV hub interactions. A PPI network was built based on protein interactions generated from two predicted hubs WSSV051
and WSSV517. Hub proteins present in this network are marked as octagons. The network represents 33 nodes and 45 edges. WSSV ORFs
were assigned 5 different labeled colors according to their putative functions.

network included WSSV004, WSSV051, WSSV118, WSSV188,
WSSV349, WSSV395, WSSV471, and WSSV517 with the in-
teraction partners ranging from 20 – 48. We focused primarily
on two hubs, WSSV051 having 21 interacting proteins and
WSSV517 with 24, for interaction validation and functional
characterization. The local view of an interaction network
through WSSV051 and WSSV517 hubs was then built to
observe the relationship with their protein partners. It was
shown in Fig. 2 that the network built based on the two hubs
comprised 45 edges and 33 nodes. Three other hubs men-
tioned above were also present in this network.
To characterize the WSSV PPI topological properties, the
network parameters automatically obtained from the Cyto-
scape plug-in Network analyzer were evaluated based on the
Barabási-Albert model (44). Complex networks can be clas-
sified into three different types as random, scale-free, and
hierarchical networks (see review in (45)). One characteriza-
tion parameter widely used to identify the type of complex
network is the degree distribution, P(k), the probability that a
selected node has k interactions. A logarithmic scale plotting
of P(k) with k shown in Fig. 3 demonstrated that the degree
distribution showed a linear regression with a slope of 0.91.
This could be approximately fitted by a power law P(k)⬃ k⫺␥,
where ␥ is the degree exponent (i.e. the slope) (45). The
significance of linear regression was therefore described by
the equation of y ⫽ 30.38x⫺0.91 with R2 ⫽ 0.82. The degree
exponent (0.91) of the WSSV network resembled exponents
published for viral networks more than it resembled expo-
nents published for cellular networks (supplemental Table S5).
It also indicated that the WSSV PPI network was scale-free as
has been found in most biological networks (44).
WSSV PPI Confirmed by Coimmunoprecipitation—In this
study, a coimmunoprecipitation assay (co-IP) was carried out
to validate the quality of the hub interactions identified by the
high-throughput yeast two-hybrid method. WSSV hub pro-
teins WSSV051 and WSSV517 were constructed as FLAG
fusion proteins whereas their interacting partners were con-
structed to have a V5 epitope tag. In this study, 62 pairs of
interactions accounting for 34 ORFs were subjected to the
co-IP assay (supplemental Fig. S1, S2, S3, and S4). Three
randomly selected prey proteins that did not bind to WSSV
hub proteins from the yeast two-hybrid approach were also
negative by co-IP assays. A confirmation rate of ⬃82% (31/
38) was obtained for this assay. Some interaction pairs could
not be confirmed because of relatively poor WSSV protein
expression in the Sf-9 cell system. The interactions from the
yeast two-hybrid study and the co-IP assay are summarized
in Table II. In conclusion, the results demonstrated that rep-

functions or predicted characteristic domains of some WSSV ORFs are indicated. B, A protein–protein interaction network of WSSV as
generated by the Cytoscape program. WSSV proteins (nodes) are shown in circles and interactions (edges) are indicated by lines. The arrows
point to target or prey proteins. The network consists of 142 nodes and 668 edges. Eight predicted hubs are indicated by yellow circles.

274 Molecular & Cellular Proteomics 13.1

 WSSV Protein Interaction Network

FIG. 3. Properties of the WSSV PPI

network. A, The network parameters of
WSSV PPI were automatically calculated
by the Network analyzer. B, Degree dis-
tribution of WSSV proteins (P(k)) and
node degrees k were plotted on a log-log
scale and fitted by linear regression. The
distribution follows a power law of
P(k)⬃k⫺␥, where ␥ is the degree exponent
(i.e. slope), indicating a characteristic of
scale-free network where ␥ is 0.91.

TABLE II
Validation of yeast two-hybrid results by a co-IP assay. Y2H Yeast two-hybrid results; H High confidence interactions; L Low confidence
interactions; ⫺ No interactions. ⫹ The Y2H results could be confirmed by co-IP assay; ⫺ The Y2H results could not be confirmed by co-IP assay;
N
Proteins not expressed in Sf-9; ND Not done
WSSV051 interacting protein WSSV517 interacting protein
Preya Characteristic Y2H co-IP Preya Characteristic Y2H co-IP
WSSV002 H ⫹ WSSV001 H ⫹
WSSV004 (WSV477) Cys2/Cys2-type Zinc H ⫹ WSSV002 H ⫹
finger
WSSV076 (WSV020) H ⫺ WSSV004 (WSV477) Cys2/Cys2-type Zinc finger H ⫹
WSSV079 (WSV023) H ⫺ WSSV039m (WSV514) DNA polymerase H ND
WSSV108 (WSV051) Immediate-early gene H ⫺ WSSV065 (WSV009) VP95 H ⫹
WSSV118 H ⫹ WSSV076 (WSV020) H ⫺
WSSV120 (WSV063) Zinc finger (RING H N WSSV079 (WSV023) H ⫹
finger)
WSSV144 Ser-rich H ⫹ WSSV110 (WSV053) H ⫺
WSSV147 H N WSSV118 H ⫹
WSSV189 (WSV134) H N WSSV134 (WSV077) VP36A H ND
WSSV205 His-rich H N WSSV144 Ser-rich H ⫹
WSSV271c (WSV216) VP124 H N WSSV146 H ND
WSSV291 (WSV235) H ⫹ WSSV147 H N
WSSV298 (WSV242) VP300/VP41B H ⫹ WSSV189 (WSV134) H N
WSSV322 (WSV267) H ⫹ WSSV233 (WSV177) H ND
WSSV380 (WSV324) H ⫹ WSSV293 (WSV237) VP41A H N
WSSV387 (WSV331) H ⫹ WSSV302 H ND
WSSV395 (WSV339) VP39B/VP39 H ⫹ WSSV322 (WSV267) H ⫹
WSSV453 (WSV394) H N WSSV387 (WSV331) H ⫹
WSSV454 (WSV395) Thymidine-Thymidylate H ⫹ WSSV395 (WSV339) VP39B/VP39 H ND
kinase
WSSV458 (WSV399) H N WSSV405 (WSV349) H ⫹
WSSV113 (WSV056) Cys2/His2-type Zinc ⫺ ⫺ WSSV453 (WSV394) H N
finger
WSSV454 (WSV395) Thymidine-Thymidylate kinase H ⫹
WSSV458 (WSV399) H N
WSSV307 (WSV252) Prenyl group binding site ⫺ ⫺
(CAAX box) (IPR001230)
WSSV466 (WSV407) Threonyl-tRNA synthetase ⫺ ⫺
(COG)
a
Numbers of ORF were based on the genome of the Taiwan isolate (GenBank accession no. AF440570). ORFs in brackets represent the
China isolate (GenBank accession no. AF332093).

Molecular & Cellular Proteomics 13.1 275

WSSV Protein Interaction Network
FIG. 4. Cumulative mortality assay. A, Juvenile P. vannamei were injected intramuscularly with NaCl or dsRNAs (specific to IMNV,
WSSV051 and WSSV517 genes) 2 days before WSSV challenge. There were 15 shrimp in each group and experiments were conducted for
17 days. The results are indicated as means with error bars of duplicate experiments. B, Mean time to death was calculated in each treatment
group and is shown as mean with standard error (S.E.).
resentative WSSV protein interactions from the yeast two-
hybrid data could be confirmed by independent methods.
Protection of Shrimp Against WSSV by Knockdown of
WSSV Hub Genes—The RNA interference (RNAi) approach
has been employed to protect shrimp against viral pathogens
including WSSV. However, the antiviral efficiency varied
among the targeted genes. With respect to the WSSV PPI
network described here, it was proposed that WSSV hubs
which connect various proteins in the network might be ideal
targets for antiviral strategies. Thus, the protective effects of
dsRNA specific to the 2 WSSV hub genes WSSV051 and
WSSV517 were examined. Groups injected with nonrelated
dsRNA of IMNV (dsRNA-IMNV) and NaCl served as control
groups. At 8 days post infection (dpi), the control shrimp
groups injected with NaCl and dsRNA-IMNV showed 100 and
50% mortality, respectively, whereas shrimp injected with
dsRNA-WSSV051 and dsRNA-WSSV517 revealed no mortal-
ity (Fig. 4). Although all shrimp died within 17 dpi, the mean
time to death of groups dsRNA-WSSV051 (15 ⫾ 0.44 days)
and dsRNA-WSSV517 (16.13 ⫾ 0.09 days) was about three
times longer when compared with the NaCl control group
(5.06 ⫾ 0.25 days) and almost two times longer than the
dsRNA-IMNV control group (9.38 ⫾ 0.12 days) (Fig. 4). Sta-
tistical analysis revealed significant differences in mean time
to death (p ⬍ 0.001) among all the groups, so the 1 day
difference between the longest delay for dsRNA-WSSV517
and the second longest delay for dsRNA-WSSV051 was
significant.
Knockdown Specificity of WSSV Hubs—To examine the
specificity of dsRNAs mediated silencing of WSSV051 and
WSSV517, RT-PCR analysis was conducted to measure re-
spective viral transcripts using actin expression for compari-
son. At 3 dpi, WSSV051 transcripts were clearly reduced in
276
shrimp treated with the dsRNA-WSSV051 when compared
with control groups injected with NaCl and dsRNA-IMNV (Fig.
5A, top panel). Significant reduction of viral gene expression
was also observed in the group injected with dsRNA-
WSSV517 (Fig. 5A, bottom panel). The knockdown effect
remained at 6 dpi (Fig. 5A, right panel). The results indicated
that specific knockdown of hub genes was achieved at the
transcription level.
The same shrimp specimens were also analyzed for the
viral loads by PCR amplification using primers specific for
WSSV gene ICP11. ICP11 (a DNA mimic protein) is the most
highly expressed viral gene, making it a good indicator of
WSSV infection (46, 47). As shown in Fig. 5B, at 3 dpi, ICP11
amplicons were barely detectable in shrimp treated with
dsRNA-WSSV051 and dsRNA-WSSV517, whereas they were
clearly detectable from the NaCl and dsRNA-IMNV groups. At
6 dpi, all the tested shrimp from the control groups clearly
showed WSSV amplicons whereas they could be detected in
only a few shrimp from the WSSV hub dsRNA treated-groups
(Fig. 5B).
The significance of WSSV hub knockdown was further in-
vestigated histopathologically in shrimp tissues. The subcu-
ticular epithelium of the shrimp stomach (a major target for
WSSV) was examined by H&E staining. A representative pho-
tomicrograph at 3 dpi (Fig. 6) showed enlarged nuclei with
basophilic intranuclear inclusions characteristic of WSSV in-
fection in both control groups (bottom panel) but not in the
group injected with dsRNA-WSSV051 or dsRNA-WSSV517
(top panel). The findings supported the results obtained from
RT-PCR and PCR analysis as described above. Similar histo-
pathological appearance was also observed in the 6 dpi sam-
ples except that one of the three shrimp in the dsRNA-
WSSV517 group showed light WSSV lesions (data not shown)
Molecular & Cellular Proteomics 13.1

FIG. 5. Knockdown specificity of dsRNA for WSSV051 and WSSV517. A, RT-PCR analysis of WSSV051 and WSSV517 transcripts in gill
tissues from shrimp from the knockdown experiments. Individual shrimp (4) from each treatment were collected at 3 and 6 days post injection
(dpi). Shrimp actin transcripts served as the internal control. B, PCR analysis of ICP11 to monitor the viral loads from the shrimp specimens
in (A). ICP11 and shrimp actin were separately amplified in each reaction but loaded in the same well.
FIG. 6. Histopathological examination for WSSV lesions in
shrimp from the knockdown experiments. Hematoxylin and eosin
stained sections of subcuticular epithelium of the stomach of shrimp
from the knockdown experiments. Examples of tissue sections from 3
days post WSSV challenge are shown. Cells with basophilic intranu-
clear inclusions characteristic of WSSV infection (arrow heads) were
revealed in the control groups but not observed from the groups
injected with dsRNA specific for WSSV051 and WSSV517. Bar indi-
cates 20 ␮m.
whereas all the shrimp examined from the control groups
showed severe lesions. Taken together, the results demon-
strated that the knockdown of WSSV hubs by dsRNA was
specific and had consequences that were observed by a
significantly longer mean time to death, lower viral loads and
fewer WSSV lesions.
Molecular & Cellular Proteomics 13.1
WSSV Protein Interaction Network
Suppression of a Nonhub Gene Yielded No Protection
Against WSSV—To further examine the importance of WSSV
hub genes, a preliminary experiment was carried out to test
the protective effect of dsRNA against the arbitrarily chosen,
nonhub gene WSSV050 (unknown function) with 3 binding
partners (WSSV036, WSSV064 and WSSV492c). This knock-
down experiment with either 1 or 5 ␮g/g BW dose of
WSSV050 dsRNA resulted in 100% shrimp mortality within
6 –10 days after WSSV challenge, the same as in the NaCl
injected control group (Fig. 7). By contrast, protection was
clearly seen when targeting hub genes WSSV051 and
WSSV517, similar to the trends from the previous experiment.
Curiously, the level of protection did not correlate with the
dose of dsRNA used. Differences in level of protection be-
tween the two experiments probably related to differences in
the batches of test shrimp used and the different challenge
doses (higher in the second experiment). Specificity of WSSV
gene knockdown was verified by RT-PCR of gill tissues col-
lected at 3 and 6 days postchallenge (data not shown).
DISCUSSION
A WSSV PPI network has been successfully mapped using
a comprehensive yeast two-hybrid assay to search every
possible binary interaction in a Taiwan-isolated viral stock. On
searching ⬃28,000 possible pairwise protein interactions, 710
interactions were revealed. The explanation for these many
interactions could be attributed to the high number of binding
partners ranging from 20 – 48 for hub proteins identified in the
assay. In addition, it was observed that some preys
(WSSV002, WSSV076, WSSV118, WSSV120, and WSSV298)
interacted with most of the baits, thereby generating a high
number of interactions. Although the significance of these
277
WSSV Protein Interaction Network
FIG. 7. Comparison of protective
effects between WSSV hub and non-
hub genes. dsRNAs were prepared
from WSSV hub genes (WSSV051 and
WSSV517) and a nonhub gene
(WSSV050). Two dosages of each dsRNA
(1 ␮g and 5 ␮g dsRNA per g BW) were
used for injection to P. vannamei 2 days
before WSSV challenge. Control group
was injected with NaCl solution followed
by WSSV challenge. Shrimp mortality was
recorded for 17 days after WSSV
injection.
interactions needs to be further investigated, we speculated
that they may act as adaptor proteins in certain viral
pathways.
In our bait collections, there were 13 baits that failed to
generate diploid cells. It might be because of instability of the
plasmids or toxicity to yeast cells. Another 42 baits did not
yield any interaction with WSSV protein preys. Those proteins
may tend to interact with host proteins rather than viral pro-
teins themselves and might therefore be considered to be
involved in processes such as viral infection or host immune
evasion. In addition, it was revealed that 31 baits (⬃17% of
the total constructed baits) had self-activation activity. This
proportion was quite reasonable because self-activation is
often observed in yeast two-hybrid assays. For example, in-
vestigation of a vaccinia virus PPI network revealed ⬃9% and
of a human PPI network ⬃20% self-activating baits (23, 25).
Interestingly, four (WSSV108, WSSV126, WSSV136 and
WSSV156) out of the 31 auto-activating baits have been pre-
viously identified as WSSV immediate early (IE) genes with
transcription activity (48), supporting our analysis. It was not
known if the remaining self-activating baits (especially those
with a zinc finger motif) found in this study might also have
uninvestigated transcription functions, because most tran-
scription factors contain zinc finger motifs that often mediate
DNA binding activity (49). Additionally, several baits coding for
WSSV structural proteins were autoactivators similar to re-
sults regarding virion protein interactions of herpes simplex
virus type 1 that revealed ⬃32% of viral structural proteins
capable of auto-activation (50).
Excluding the baits that generated no diploid cells, yielded
no interaction with WSSV proteins or caused auto-activation,
710 potential interactions among 101 baits were identified. Of
these, only 26 could be supported by reciprocal bait-prey
pairings (i.e. bidirectional). The low confirmation rate by recip-
rocal interaction was considered to result from characteristic
technical limitations of the yeast two-hybrid system (27, 28).
Similarly low bidirectionality has been previously reported for
Kaposi’s sarcoma-associated herpesvirus (KSHV) (27) (only 1
of 123), VZV (27) (only 10 of 173) and human cytomegalovirus
278
(51) (only 11 of 79). Confirmation tests using an independent
co-IP assay gave a validation rate of ⬃82%. Lower confirma-
tion rates have been reported in other PPI networks for hu-
mans (66%), (KSHV) (50%) and Epstein-Barr virus (EBV)
(47%) (23, 27, 28). However, the number of WSSV protein
interactions to be tested should be enlarged to increase reli-
ability of our data. In addition, the new putative interactions
need to be confirmed by other biological or biochemical as-
says. It is a common feature of the large-scale yeast two-
hybrid screen to produce low coverage data, i.e. missing
previously identified interactions (52). For example, minimal
overlap interactions have been found for different high-
throughput interaction datasets observed in Drosophila net-
works (19, 53, 54) and KSHV networks (27, 55). In addition,
only six out of 43 interactions of the EBV proteins described
by Calderwood et al. (28) were detected in the EBV network
reported by Fossum et al. (29). Reasons for low coverage of
our WSSV dataset might be because of incompleteness of the
ORF arrays or to the fact that some interactions could not be
detected because of limitations of the yeast two-hybrid assay.
This was also evident, for example, when some interactions of
KSHV structural proteins could not be found by yeast two-
hybrid assay but could be detected by co-IP (55).
The topology of the WSSV PPI network followed the power
law, indicating that it had scale-free properties similar to many
cellular networks (44). A significant key of scale-free networks
is hubs that hold the nodes together in the network. Never-
theless, the WSSV PPI network had an unusually small degree
exponent (␥) different from those of known cellular networks
but more closely related to those of viral PPI networks (sup-
plemental Table S5). Uetz et al. (27) suggested that this un-
usual characteristic in the viral networks presumably reflected
their incompleteness as stand-alone networks. They therefore
modeled KSHV protein– human protein interactions using an
orthologs-based approach which resulted in a complete
change in network topology to that of a more typical scale-
free network (27). A similar phenomenon might be expected
for a WSSV protein-shrimp protein interaction network.
Molecular & Cellular Proteomics 13.1

The putative WSSV hubs identified in this study were likely
to play roles in many biological processes according to the
putative functions of their targets such as nucleotide metab-
olism, DNA replication and virion assembly. WSSV051 has
been identified as structural protein VP448 (also known as
VP55) from purified WSSV virions using SDS-PAGE accom-
panied by mass spectrometry (56). A later study using a
microarray approach also indicated that the time course ex-
pression pattern of WSSV051 clustered in the gene group
related to WSSV envelope protein assembly (57). Interest-
ingly, two structural proteins (WSSV298 and WSSV395) iden-
tified as WSSV051 interacting proteins in the present study
were also classified in the same cluster of WSSV051 (57). This
supports our interaction data and might suggest roles for
these proteins in WSSV virion assembly. For WSSV517, the
function remains unknown, but a previous report using a DNA
microarray approach classified WSSV517 as an early gene
because it was expressed at the early stage post WSSV
infection (58). Interaction between WSSV517 and the middle
part of DNA polymerase (WSSV039m) was revealed. Further
study is required to explore possible roles of WSSV517 in viral
DNA replication.
Explanations as to how one protein is capable of binding
multiple partners have been recently described by means of
intrinsic protein disorder (59 – 63). Intrinsically disordered pro-
teins or intrinsically unstructured proteins are proteins char-
acterized by lack of a well-defined structure even though they
remain perfectly functional. There is bioinformatics and in vitro
experimental evidence that intrinsic structural disorder is a
distinctive and common characteristic of many hub proteins
and that a disordered domain facilitates the different confor-
mational requirements for binding to different partners (64 –
66).
RNAi is a powerful tool for gene silencing and holds prom-
ise for antiviral therapy in shrimp. This has drawn much at-
tention for shrimp protection against viral diseases, and es-
pecially WSSV. Many WSSV genes such as VP15, VP19 VP24,
VP26, VP28, VP281, protein kinase, DNA polymerase, ribonu-
cleotide reductase large and small subunits (rr1 and rr2),
immediate early genes (IE1 and IE3), and thymidine kinase
and thymidylate kinase (tk-tmk) have been targeted using
either dsRNA or small interfering RNA (siRNA) (67–72). The
degree of protection has varied (e.g. ⬃30 –95% survival) and
might be because of the different viral doses used in each
experiment. It was also suggested that the protection effect
depends on the function of the gene encoded proteins and
their roles during the viral life cycle (71, 72). In this regard, we
speculated that knockdown of the central hubs in WSSV
network could provide shrimp protection against WSSV and
prove their significances in viral processes. The importance of
hub silencing has been previously described in the bacterial
entry network of Chlamydia pneumoniae in which knockdown
the hubs significantly inhibited C. pneumoniae infectivity in
human cell lines (73). Our silencing of WSSV hubs by treating
Molecular & Cellular Proteomics 13.1
WSSV Protein Interaction Network
shrimp with hub dsRNAs significantly delayed mortality and
improved survival in viral challenges when compared with
untreated controls. Efficacy was supported by tissue exami-
nation that revealed WSSV lesions (hypertrophied nuclei) in
every group except for the knockdown groups injected with
WSSV051 and WSSV517 dsRNAs. In addition, examination
revealed that expression of nontargeted WSSV genes such as
the WSSV DNA polymerase was also suppressed (data not
shown). We speculate that defects in DNA synthesis may
have resulted from silencing of the two hub genes, leading to
down-regulation of additional viral genes and to improved
shrimp survival. Thus, the comparison of knocking down hub
and nonhub genes supported the contention that WSSV hub-
genes are important and may serve as potential targets for
protection against shrimp mortality caused by WSSV. One
requirement for reaching such a practical goal is a method to
effectively deliver WSSV hub-specific dsRNAs to shrimp by
oral administration.
WSSV has had an enormous impact on the global shrimp
culture industry as a result of economic losses from severe
mortality. Novel technology for virus control based on an
improved understanding of WSSV is expected. Molecular
studies have been carried out to gain insight into both shrimp
immunity and WSSV pathology and have included both
genomic and proteomic approaches. However, overall inter-
actions (or interactomes) have not previously been reported
and it is hoped that this first study of the WSSV PPI network
will serve as the starting point for further work. For example,
many WSSV proteins were identified as interesting candidates
for testing in knockdown experiments similar to those we
carried out for the hub genes WSSV051 and WSSV517. An-
other network topological feature called a bottleneck (a pro-
tein that connects more than two sub-networks) has also
been proposed to be a good target for inhibition of protein
interactions (74). Data mining and experimental validation for
WSSV bottleneck proteins could be further investigated.
Apart from a gene knockdown approach in disruption of pro-
tein interactions, other strategies have been previously pro-
posed. These include, for example, development of specific
antibodies and the use of small molecule inhibitors to selec-
tively interfere with protein interactions (see reviews (75, 76)).
The WSSV protein interaction data could then be employed as
a fundamental resource to screen for such substances either
by actual experiments, by computational based approaches
or both.
Nevertheless, one dataset alone cannot completely eluci-
date protein functions or biological processes, and combina-
tion with other datasets may lead to significant new insights
(77). For example, integration of the WSSV interaction dataset
presented here with other high-throughput data sets such as
WSSV transcriptional profiles may give a better understanding
of the dynamic processes that occur during infection. Finally,
the parallel development of a shrimp protein interaction net-
work and a shrimp-virus interaction network, either by real
279
WSSV Protein Interaction Network
experiment or by prediction from protein orthologs would
allow for combination among networks and may lead to fur-
ther insights on viral pathogenesis and the host response for
the development of disease control strategies.
Acknowledgments—We thank Ms. C. Jaengsanong for skilled
technical assistance.
* This work was supported by research grants from Mahidol Uni-
versity, L’Oreal Thailand ‘for Women in Science’ fellowship 2011, a
National Taiwan University research grant (NTU-99R80830), National
Science Council grants and National Cheng Kung University grants.
P.S. was the recipient of a Royal Golden Jubilee Ph.D. scholarship
(PHD/0231/2548) from the Thailand Research Fund. In addition, P.S.
has been supported by a Mahidol University postdoctoral fellowship
program.
□S This article contains supplemental Figs. S1 to S4 and Tables S1
to S5.
§§ To whom correspondence should be addressed: Institute of
Bioinformatics and Biosignal Transduction, College of Bioscience and
Biotechnology, National Cheng Kung University, No. 1, University
Road, Tainan 70101, Taiwan (R.O.C.). E-mail: gracelow@mail.ncku.
edu.tw and Center of Excellence for Shrimp Molecular Biology and
Biotechnology (Centex Shrimp), Mahidol University, Rama VI Rd.,
Bangkok, 10400, Thailand. E-mail: tim.flegel@gmail.com.
REFERENCES
1. Lightner, D. V. (1996) A Handbook of Shrimp Pathology and Diagnostic
Procedures for Diseases of Cultured Penaeid Shrimp. World Aquaculture
Society, Baton Rouge, LA, U.S.A.
2. Leu, J. H., Yang, F., Zhang, X., Xu, X., Kou, G. H., and Lo, C. F. (2009)
Whispovirus. Curr. Top. Microbiol. Immunol. 328, 197–227
3. Sánchez-Paz, A. (2010) White spot syndrome virus: an overview on an
emergent concern. Vet. Res. 41, 43
4. Zhang, X., Huang, C., Tang, X., Zhuang, Y., and Hew, C. L. (2004) Identi-
fication of structural proteins from shrimp white spot syndrome virus
(WSSV) by 2DE-MS. Proteins 55, 229 –235
5. Witteveldt, J., Vermeesch, A. M., Langenhof, M., de Lang, A., Vlak, J. M.,
and van Hulten, M. C. W. (2005) Nucleocapsid protein VP15 is the basic
DNA binding protein of white spot syndrome virus of shrimp. Arch. Virol.
150, 1121–1133
6. Xie, X., and Yang, F. (2006) White spot syndrome virus VP24 interacts with
VP28 and is involved in virus infection. J. Gen. Virol. 87, 1903–1908
7. Chang, Y. S., Liu, W. J., Chou, T. L., Lee, Y. T., Lee, T. L., Huang, W. T.,
Kou, G. H., and Lo, C. F. (2008) Characterization of white spot syndrome
virus envelope protein VP51A and its interaction with viral tegument
protein VP26. J. Virol. 82, 12555–12564
8. Chen, J., Li, Z., and Hew, C. L. (2007) Characterization of a novel envelope
protein WSV010 of shrimp white spot syndrome virus and its interaction
with a major viral structural protein VP24. Virology 364, 208 –213
9. Jie, Z., Xu, L., and Yang, F. (2008) The C-terminal region of envelope protein
VP38 from white spot syndrome virus is indispensable for interaction
with VP24. Arch. Virol. 153, 2103–2106
10. Wan, Q., Xu, L., and Yang, F. (2008) VP26 of white spot syndrome virus
functions as a linker protein between the envelope and nucleocapsid of
virions by binding with VP51. J. Virol. 82, 12598 –12601
11. Liu, Q. H., Ma, C. Y., Chen, W. B., Zhang, X. L., Liang, Y., Dong, S. L., and
Huang, J. (2009) White spot syndrome virus VP37 interacts with VP28
and VP26. Dis. Aquat. Organ. 85, 23–30
12. Zhou, Q., Xu, L., Li, H., Qi, Y. P., and Yang, F. (2009) Four major envelope
proteins of white spot syndrome virus bind to form a complex. J. Virol.
83, 4709 – 4712
13. Lin, Y., Xu, L., and Yang, F. (2010) Tetramerization of white spot syndrome
virus envelope protein VP33 and its interaction with VP24. Arch. Virol.
155, 833– 838
14. Chang, Y. S., Liu, W. J., Lee, C. C., Chou, T. L., Lee, Y. T., Wu, T. S., Huang,
J. Y., Huang, W. T., Lee, T. L., Kou, G. H., Wang, A. H., and Lo, C. F.
(2010) A 3D model of the membrane protein complex formed by the
280
white spot syndrome virus structural proteins. PLoS ONE 5, e10718
15. Li, Z., Xu, L., Li, F., Zhou, Q., and Yang, F. (2011) Analysis of white spot
syndrome virus envelope protein complexome by two-dimensional blue
native/SDS PAGE combined with mass spectrometry. Arch. Virol. 156,
1125–1135
16. Uetz, P., Giot, L., Cagney, G., Mansfield, T. A., Judson, R. S., Knight, J. R.,
Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., Qureshi-Emili, A.,
Li, Y., Godwin, B., Conover, D., Kalbfleisch, T., Vijayadamodar, G., Yang,
M., Johnston, M., Fields, S., and Rothberg, J. M. (2000) A comprehensive
analysis of protein-protein interactions in Saccharomyces cerevisiae.
Nature 403, 623– 627
17. Ito, T., Chiba, T., Ozawa, R., Yoshida, M., Hattori, M., and Sakaki, Y. (2001)
A comprehensive two-hybrid analysis to explore the yeast protein inter-
actome. Proc. Natl. Acad. Sci. U.S.A. 98, 4569 – 4574
18. Rain, J. C., Selig, L., De Reuse, H., Battaglia, V., Reverdy, C., Simon, S.,
Lenzen, G., Petel, F., Wojcik, J., Schächter, V., Chemama, Y., Labigne,
A., and Legrain, P. (2001) The protein-protein interaction map of Helico-
bacter pylori. Nature 409, 211–215
19. Giot, L., Bader, J. S., Brouwer, C., Chaudhuri, A., Kuang, B., Li, Y., Hao,
Y. L., Ooi, C. E., Godwin, B., Vitols, E., Vijayadamodar, G., Pochart, P.,
Machineni, H., Welsh, M., Kong, Y., Zerhusen, B., Malcolm, R., Varrone,
Z., Collis, A., Minto, M., Burgess, S., McDaniel, L., Stimpson, E., Spriggs,
F., Williams, J., Neurath, K., Ioime, N., Agee, M., Voss, E., Furtak, K.,
Renzulli, R., Aanensen, N., Carrolla, S., Bickelhaupt, E., Lazovatsky, Y.,
DaSilva, A., Zhong, J., Stanyon, C. A., Finley, R. L., White, K. P., Braver-
man, M., Jarvie, T., Gold, S., Leach, M., Knight, J., Shimkets, R. A.,
McKenna, M. P., Chant, J., and Rothberg, J. M. (2003) A protein inter-
action map of Drosophila melanogaster. Science 302, 1727–1736
20. Li, S., Armstrong, C. M., Bertin, N., Ge, H., Milstein, S., Boxem, M., Vidalain,
P.-O., Han, J.-D. J., Chesneau, A., Hao, T., Goldberg, D. S., Li, N.,
Martinez, M., Rual, J.-F., Lamesch, P., Xu, L., Tewari, M., Wong, S. L.,
Zhang, L. V., Berriz, G. F., Jacotot, L., Vaglio, P., Reboul, J., Hirozane-
Kishikawa, T., Li, Q., Gabel, H. W., Elewa, A., Baumgartner, B., Rose, D. J.,
Yu, H., Bosak, S., Sequerra, R., Fraser, A., Mango, S. E., Saxton, W. M.,
Strome, S., van den Heuvel, S., Piano, F., Vandenhaute, J., Sardet, C.,
Gerstein, M., Doucette-Stamm, L., Gunsalus, K. C., Harper, J. W., Cusick,
M. E., Roth, F. P., Hill, D. E., and Vidal, M. (2004) A map of the interactome
network of the metazoan C. elegans. Science 303, 540 –543
21. LaCount, D. J., Vignali, M., Chettier, R., Phansalkar, A., Bell, R., Hessel-
berth, J. R., Schoenfeld, L. W., Ota, I., Sahasrabudhe, S., Kurschner, C.,
Fields, S., and Hughes, R. E. (2005) A protein interaction network of the
malaria parasite Plasmodium falciparum. Nature 438, 103–107
22. Rual, J. F., Venkatesan, K., Hao, T., Hirozane Kishikawa, T., Dricot, A., Li,
N., Berriz, G. F., Gibbons, F. D., Dreze, M., Ayivi Guedehoussou, N.,
Klitgord, N., Simon, C., Boxem, M., Milstein, S., Rosenberg, J., Gold-
berg, D. S., Zhang, L. V., Wong, S. L., Franklin, G., Li, S., Albala, J. S.,
Lim, J., Fraughton, C., Llamosas, E., Cevik, S., Bex, C., Lamesch, P.,
Sikorski, R. S., Vandenhaute, J., Zoghbi, H. Y., Smolyar, A., Bosak, S.,
Sequerra, R., Doucette Stamm, L., Cusick, M. E., Hill, D. E., Roth, F. P.,
and Vidal, M. (2005) Towards a proteome-scale map of the human
protein-protein interaction network. Nature 437, 1173–1178
23. Stelzl, U., Worm, U., Lalowski, M., Haenig, C., Brembeck, F. H., Goehler, H.,
Stroedicke, M., Zenkner, M., Schoenherr, A., Koeppen, S., Timm, J.,
Mintzlaff, S., Abraham, C., Bock, N., Kietzmann, S., Goedde, A., Toksöz,
E., Droege, A., Krobitsch, S., Korn, B., Birchmeier, W., Lehrach, H., and
Wanker, E. E. (2005) A human protein-protein interaction network: a
resource for annotating the proteome. Cell 122, 957–968
24. Bartel, P. L., Roecklein, J. A., SenGupta, D., and Fields, S. (1996) A protein
linkage map of Escherichia coli bacteriophage T7. Nat. Genet. 12, 72–77
25. McCraith, S., Holtzman, T., Moss, B., and Fields, S. (2000) Genome-wide
analysis of vaccinia virus protein-protein interactions. Proc. Natl. Acad.
Sci. U.S.A. 97, 4879 – 4884
26. Flajolet, M., Rotondo, G., Daviet, L., Bergametti, F., Inchauspé, G., Tiollais,
P., Transy, C., and Legrain, P. (2000) A genomic approach of the hepa-
titis C virus generates a protein interaction map. Gene 242, 369 –379
27. Uetz, P., Dong, Y. A., Zeretzke, C., Atzler, C., Baiker, A., Berger, B.,
Rajagopala, S. V., Roupelieva, M., Rose, D., Fossum, E., and Haas, J.
(2006) Herpesviral protein networks and their interaction with the human
proteome. Science 311, 239 –242
28. Calderwood, M. A., Venkatesan, K., Xing, L., Chase, M. R., Vazquez, A.,
Holthaus, A. M., Ewence, A. E., Li, N., Hirozane-Kishikawa, T., Hill, D. E.,
Molecular & Cellular Proteomics 13.1

Vidal, M., Kieff, E., and Johannsen, E. (2007) Epstein-Barr virus and virus
human protein interaction maps. Proc. Natl. Acad. Sci. U.S.A. 104,
7606 –7611
29. Fossum, E., Friedel, C. C., Rajagopala, S. V., Titz, B., Baiker, A., Schmidt,
T., Kraus, T., Stellberger, T., Rutenberg, C., Suthram, S., Bandyopad-
hyay, S., Rose, D., von Brunn, A., Uhlmann, M., Zeretzke, C., Dong, Y. A.,
Boulet, H., Koegl, M., Bailer, S. M., Koszinowski, U., Ideker, T., Uetz, P.,
Zimmer, R., and Haas, J. (2009) Evolutionarily conserved herpesviral
protein interaction networks. PLoS Pathog. 5, e1000570
30. Wang, C. H., Lo, C. F., Leu, J. H., Chou, C. M., Yeh, P. Y., Chou, H. Y.,
Tung. M. C., Chang, C. F., Su, M. S., and Kou, G. H. (1995) Purification
and genomic analysis of baculovirus associated with white spot syn-
drome (WSBV) of Penaeus monodon. Dis. Aquat. Organ. 23, 239 –242
31. Lo, C. F., Hsu, H. C., Tsai, M. F., Ho, C. H., Peng, S. E., Kou, G. H., and
Lightner, D. V. (1999) Specific genomic DNA fragment analysis of differ-
ent geographical clinical samples of shrimp white spot syndrome virus.
Dis. Aquat. Organ. 35, 175–185
32. Yang, F., He, J., Lin, X., Li, Q., Pan, D., Zhang, X., and Xu, X. (2001)
Complete genome sequence of the shrimp white spot bacilliform virus.
J. Virol. 75, 11811–11820
33. Hazbun, T. R., and Miller, J. P. (2005) Genome-wide analysis of protein-
protein interactions using a two-hybrid array. Chapter 37, in Protein-
Protein Interactions, 2nd edition (eds. Golemis and Adams). Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY, U.S.A.
34. Assenov, Y., Ramírez, F., Schelhorn, S. E., Lengauer, T., and Albrecht, M.
(2008) Computing topological parameters of biological networks. Bioin-
formatics 24, 282–284
35. Leu, J. H., Kuo, Y. C., Kou, G. H., and Lo, C. F. (2008) Molecular cloning and
characterization of an inhibitor of apoptosis protein (IAP) from the tiger
shrimp, Penaeus monodon. Dev. Comp. Immunol. 32, 121–133
36. Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001) RNA interference is
mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, 188 –200
37. Senapin, S., Phiwsaiya, K., Anantasomboon, G., Sriphaijit, T., Browdy,
C. L., and Flegel, T. W. (2010) Knocking down a Taura syndrome virus
(TSV) binding protein Lamr is lethal for the whiteleg shrimp Penaeus
vannamei. Fish Shellfish Immunol. 29, 422– 429
38. Bell, T. A., and Lightner, D. V. (1988) A handbook of normal shrimp histol-
ogy. World Aquaculture Society, Baton Rouge, LA, U.S.A.
39. Sambrook, J., and Russell, D. W. (2001) Molecular cloning: a laboratory
manual. 3 ed. NY: Cold Spring Harbor
40. Shannon, P., Markiel, A., Ozier, O., Baliga, N. S., Wang, J. T., Ramage, D.,
Amin, N., Schwikowski, B., and Ideker, T. (2003) Cytoscape: a software
environment for integrated models of biomolecular interaction networks.
Genome Res. 13, 2498 –2504
41. Cline, M. S., Smoot, M., Cerami, E., Kuchinsky, A., Landys, N., Workman,
C., Christmas, R., Avila-Campilo, I., Creech, M., Gross, B., Hanspers, K.,
Isserlin, R., Kelley, R., Killcoyne, S., Lotia, S., Maere, S., Morris, J., Ono,
K., Pavlovic, V., Pico, A. R., Vailaya, A., Wang, P. L., Adler, A., Conklin,
B. R., Hood, L., Kuiper, M., Sander, C., Schmulevich, I., Schwikowski, B.,
Warner, G. J., Ideker, T., and Bader, G. D. (2007) Integration of biological
networks and gene expression data using Cytoscape. Nat. Protoc. 2,
2366 –2382
42. Jeong, H., Mason, S. P., Barabási, A. L., and Oltvai, Z. N. (2001) Lethality
and centrality in protein networks. Nature 411, 41– 42
43. Vallabhajosyula, R. R., Chakravarti, D., Lutfeali, S., Ray, A., and Raval, A.
(2009) Identifying hubs in protein interaction networks. PLoS ONE 4,
e5344
44. Barabási, A. L., and Albert, R. (1999) Emergence of scaling in random
networks. Science 286, 509 –512
45. Barabási, A. L., and Oltvai, Z. N. (2004) Network biology: understanding the
cell’s functional organization. Nat. Rev. Genet. 5, 101–113
46. Wang, H. C., Wang, H. C., Kou, G. H., Lo, C. F., and Huang, W. P. (2007)
Identification of icp11, the most highly expressed gene of shrimp white
spot syndrome virus (WSSV). Dis. Aquat. Organ. 74, 179 –189
47. Wang, H. C., Wang, H. C., Ko, T. P., Lee, Y. M., Leu, J. H., Ho, C. H., Huang,
W. P., Lo, C. F., and Wang, A. H. (2008) White spot syndrome virus
protein ICP11: a histone-binding DNA mimic that disrupts nucleosome
assembly. Proc. Natl. Acad. Sci. U.S.A. 105, 20758 –20763
48. Li, F., Li, M., Ke, W., Ji, Y., Bian, X., and Yan, X. (2009) Identification of the
immediate-early genes of white spot syndrome virus. Virology 385,
267–274
Molecular & Cellular Proteomics 13.1
WSSV Protein Interaction Network
49. Iuchi, S. (2001) Three classes of C2H2 zinc finger proteins. Cell. Mol. Life
Sci. 58, 625– 635
50. Lee, J. H., Vittone, V., Diefenbach, E., Cunningham, A. L., and Diefenbach,
R. J. (2008) Identification of structural protein-protein interactions of
herpes simplex virus type 1. Virology 378, 347–354
51. To, A., Bai, Y., Shen, A., Gong, H., Umamoto, S., Lu, S., and Liu, F. (2011)
Yeast two hybrid analyses reveal novel binary interactions between
human cytomegalovirus-encoded virion proteins. PLoS ONE 6, e17796
52. Parrish, J. R., Gulyas, K. D., and Finley, R. L. (2006) Yeast two-hybrid contri-
butions to interactome mapping. Curr. Opin. Biotechnol. 17, 387–393
53. Stanyon, C. A., Liu, G., Mangiola, B. A., Patel, N., Giot, L., Kuang, B.,
Zhang, H., Zhong, J., and Finley, R. L. (2004) A Drosophila protein-
interaction map centered on cell-cycle regulators. Genome Biol. 5, R96
54. Formstecher, E., Aresta, S., Collura, V., Hamburger, A., Meil, A., Trehin, A.,
Reverdy, C., Betin, V., Maire, S., Brun, C., Jacq, B., Arpin, M., Bellaiche,
Y., Bellusci, S., Benaroch, P., Bornens, M., Chanet, R., Chavrier, P.,
Delattre, O., Doye, V., Fehon, R., Faye, G., Galli, T., Girault, J.-A., Goud,
B., de Gunzburg, J., Johannes, L., Junier, M.-P., Mirouse, V., Mukherjee,
A., Papadopoulo, D., Perez, F., Plessis, A., Rossé, C., Saule, S., Stoppa-
Lyonnet, D., Vincent, A., White, M., Legrain, P., Wojcik, J., Camonis, J.,
and Daviet, L. (2005) Protein interaction mapping: a Drosophila case
study. Genome Res. 15, 376 –384
55. Rozen, R., Sathish, N., Li, Y., and Yuan, Y. (2008) Virion-wide protein
interactions of Kaposi’s sarcoma-associated herpesvirus. J. Virol. 82,
4742– 4750
56. Huang, C., Zhang, X., Lin, Q., Xu, X., Hu, Z., and Hew, C. L. (2002)
Proteomic analysis of shrimp white spot syndrome viral proteins and
characterization of a novel envelope protein VP466. Mol. Cell. Proteom-
ics 1, 223–231
57. Tsai, J. M., Wang, H. C., Leu, J. H., Hsiao, H. H., Wang, A. H., Kou, G. H.,
and Lo, C. F. (2004) Genomic and proteomic analysis of thirty-nine
structural proteins of shrimp white spot syndrome virus. J. Virol. 78,
11360 –11370
58. Lan, Y., Xu, X., Yang, F., and Zhang, X. (2006) Transcriptional profile of
shrimp white spot syndrome virus (WSSV) genes with DNA microarray.
Arch. Virol. 151, 1723–1733
59. Kim, P. M., Sboner, A., Xia, Y., and Gerstein, M. (2008) The role of disorder
in interaction networks: a structural analysis. Mol. Syst. Biol. 4, 179
60. Stein, A., Pache, R. A., Bernadó, P., Pons, M., and Aloy, P. (2009) Dynamic
interactions of proteins in complex networks: a more structured view.
FEBS J. 276, 5390 –5405
61. Tyagi, M., Shoemaker, B. A., Bryant, S. H., and Panchenko, A. R. (2009)
Exploring functional roles of multibinding protein interfaces. Protein Sci.
18, 1674 –1683
62. Tsai, C. J., Ma, B., and Nussinov, R. (2009) Protein-protein interaction
networks: how can a hub protein bind so many different partners?
Trends Biochem. Sci. 34, 594 – 600
63. Dyson, H. J. (2011) Expanding the proteome: disordered and alternatively
folded proteins. Q. Rev. Biophys. 44, 467–518
64. Dunker, A. K., Cortese, M. S., Romero, P., Iakoucheva, L. M., and Uversky,
V. N. (2005) Flexible nets. The roles of intrinsic disorder in protein
interaction networks. FEBS J. 272, 5129 –5148
65. Dosztányi, Z., Chen, J., Dunker, A. K., Simon, I., and Tompa, P. (2006)
Disorder and sequence repeats in hub proteins and their implications for
network evolution. J. Proteome. Res. 5, 2985–2995
66. Haynes, C., Oldfield, C. J., Ji, F., Klitgord, N., Cusick, M. E., Radivojac, P.,
Uversky, V. N., Vidal, M., and Iakoucheva, L. M. (2006) Intrinsic disorder
is a common feature of hub proteins from four eukaryotic interactomes.
PLoS Comput. Biol. 2, e100
67. Robalino, J., Bartlett, T., Shepard, E., Prior, S., Jaramillo, G., Scura, E.,
Chapman, R. W., Gross, P. S., Browdy, C. L., and Warr, G. W. (2005)
Double-stranded RNA induces sequence-specific antiviral silencing in
addition to nonspecific immunity in a marine shrimp: convergence of
RNA interference and innate immunity in the invertebrate antiviral re-
sponse? J. Virol. 79, 13561–13571
68. Westenberg, M., Heinhuis, B., Zuidema, D., and Vlak, J. M. (2005) siRNA
injection induces sequence-independent protection in Penaeus
monodon against white spot syndrome virus. Virus Res. 114, 133–139
69. Wu, Y., Lü, L., Weng, S. P., Chan, S. M., and He, J. G. (2007) Inhibition of
white spot syndrome virus in Litopenaeus vannamei shrimp by se-
quence-specific siRNA. Aquaculture 271, 21–30
281
WSSV Protein Interaction Network
70. Kim, C. S., Kosuke, Z., Nam, Y. K., Kim, S. K., and Kim, K. H. (2007)
Protection of shrimp (Penaeus chinensis) against white spot syndrome
virus (WSSV) challenge by double-stranded RNA. Fish Shellfish Immunol.
23, 242–246
71. Attasart, P., Kaewkhaw, R., Chimwai, C., Kongphom, U., Namramoon, O.,
and Panyim, S. (2009) Inhibition of white spot syndrome virus replication
in Penaeus monodon by combined silencing of viral rr2 and shrimp
PmRab7. Virus Res. 145, 127–133
72. Sanjuktha, M., Stalin Raj, V., Aravindan, K., Alavandi, S. V., Poornima, M.,
and Santiago, T. C. (2012) Comparative efficacy of double-stranded
RNAs targeting WSSV structural and nonstructural genes in controlling
viral multiplication in Penaeus monodon. Arch. Virol. 157, 993–998
73. Wang, A., Johnston, S. C., Chou, J., and Dean, D. (2010) A systemic
282
network for Chlamydia pneumoniae entry into human cells. J. Bacteriol.
192, 2809 –2815
74. Yu, H., Kim, P. M., Sprecher, E., Trifonov, V., and Gerstein, M. (2007) The
importance of bottlenecks in protein networks: correlation with gene
essentiality and expression dynamics. PLoS Comput. Biol. 3, e59
75. Zeng, J., Zhang, J., Tanaka, T., and Rabbitts, T. H. (2013) Single domain
antibody fragments as drug surrogates targeting protein-protein interac-
tions inside cells. Antibodies 2, 306 –320
76. Metallo, S. (2010) Intrinsically disordered proteins are potential drug tar-
gets. Curr. Opin. Chem. Biol. 14, 481– 488
77. Ge, H., Walhout, A. J., and Vidal, M. (2003) Integrating ‘omic’ information:
a bridge between genomics and systems biology. Trends Genet. 19,
551–560
Molecular & Cellular Proteomics 13.1