Journal Pre-proofs

Research paper

Local expressions and function of Kiss1/GPR54 in goats' testes

Yanguo Han, Xiaoli Peng, Weijiang Si, Guiqiong Liu, Yuqing Han, Xunping
Jiang, Risu Na, Liguo Yang, Jiayuan Wu, Guangxin E, Yan Zeng, Yongju
Zhao, Yongfu Huang

PII: S0378-1119(20)30157-8
DOI: https://doi.org/10.1016/j.gene.2020.144488
Reference: GENE 144488

To appear in: Gene Gene

Received Date: 9 November 2019

Revised Date: 14 February 2020
Accepted Date: 19 February 2020

Please cite this article as: Y. Han, X. Peng, W. Si, G. Liu, Y. Han, X. Jiang, R. Na, L. Yang, J. Wu, G. E, Y.
Zeng, Y. Zhao, Y. Huang, Local expressions and function of Kiss1/GPR54 in goats' testes, Gene Gene (2020),
doi: https://doi.org/10.1016/j.gene.2020.144488

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover
page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version
will undergo additional copyediting, typesetting and review before it is published in its final form, but we are
providing this version to give early visibility of the article. Please note that, during the production process, errors
may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier B.V.

 Local expressions and function of Kiss1/GPR54 in goats' testes

Yanguo Hana, Xiaoli Penga, Weijiang Sia, Guiqiong Liub, Yuqing Hana, Xunping Jiangb, Risu Naa,

Liguo Yangb, Jiayuan Wua, Guangxin Ea, Yan Zenga, Yongju Zhaoa, Yongfu Huanga,*1

a College of Animal Science and Technology, Southwest University, Chongqing Key Laboratory of

Forage & Herbivore, Chongqing Engineering Research Centre for Herbivores Resource Protection

and Utilization, Chongqing 400715, China

b College of Animal Science and Technology, Huazhong Agricultural University, Key Lab of

Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan 430070,

China

ORCID
Yanguo Han 0000-0002-6859-2642; Xiaoli Peng 0000-0002-7505-8448; Weijiang Si 0000-0002-4977-394X;
Guiqiong Liu 0000-0003-3688-5958; Yuqing Han 0000-0002-5556-2866; Xunping Jiang 0000-0001-7822-1784
Risu Na 0000-0002-9123-1722; Liguo Yang 0000-0002-0990-8694; Jiayuan Wu 0000-0002-1481-3673;
Guangxin E 0000-0001-7116-5177; Yan Zeng 0000-0002-4698-838X; Yongju Zhao 0000-0001-9256-8856;
Yongfu Huang 0000-0002-0885-3820

Local expressions and function of Kiss1/GPR54 in goats' testes

Abbreviations: RT-PCR, reverse transcriptase PCR; GPR54, G protein-coupled receptor 54;

GnRH, gonadotropin-releasing hormone; LH, luteinising hormone; FSH, follicle-stimulating

hormone; HPG, hypothalamic-pituitary-gonadal; HRP, horseradish peroxidase.

* Corresponding author at: College of Animal Science and Technology, Southwest University,

Chongqing Key Laboratory of Forage & Herbivore, Chongqing Engineering Research Centre for

Herbivores Resource Protection and Utilization, No.2 Tiansheng Road, Chongqing 400715, China.

E-mail address: H67738337@swu.edu.cn (Y. Huang).

Yanguo Hana, Xiaoli Penga, Weijiang Sia, Guiqiong Liub, Yuqing Hana, Xunping Jiangb, Risu Naa,

Liguo Yangb, Jiayuan Wua, Guangxin Ea, Yan Zenga, Yongju Zhaoa, Yongfu Huanga,*2

a College of Animal Science and Technology, Southwest University, Chongqing Key Laboratory of

Forage & Herbivore, Chongqing Engineering Research Centre for Herbivores Resource Protection

and Utilization, Chongqing 400715, China

b College of Animal Science and Technology, Huazhong Agricultural University, Key Lab of

Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Wuhan 430070,

China

Abbreviations: RT-PCR, reverse transcriptase PCR; GPR54, G protein-coupled receptor 54;

GnRH, gonadotropin-releasing hormone; LH, luteinising hormone; FSH, follicle-stimulating

hormone; HPG, hypothalamic-pituitary-gonadal; HRP, horseradish peroxidase.

* Corresponding author at: College of Animal Science and Technology, Southwest University,

Chongqing Key Laboratory of Forage & Herbivore, Chongqing Engineering Research Centre for

Herbivores Resource Protection and Utilization, No.2 Tiansheng Road, Chongqing 400715, China.

E-mail address: H67738337@swu.edu.cn (Y. Huang).

ABSTRACT

Kisspeptin, encoded by the Kiss1 gene, and its receptor GPR54 have a central regulatory role in the

male reproduction. However, their functions in peripheral tissues, such as testes, remain unclear. This

study investigated the local expressions and function of Kiss1/GPR54 in goats' testes. The mRNA

expression of Kiss1/GPR54 in pubertal goat Leydig cells was detected through reverse transcriptase

PCR (RT-PCR), and its protein expression in Leydig cells or the testis was examined by

immunohistochemistry and Western blot analysis. Isolated and cultured Leydig cells were treated with

different concentration of kisspeptin (0, 1, 10 and 100 μM) and kisspeptin antagonist for 4, 24 or 72 h.

The direct effect of kisspeptin on testosterone secretion and Kiss1/GPR54 mRNA expression was

evaluated by ELISA and RT-PCR. Kiss1/GPR54 mRNA and protein were expressed in Leydig cells

and spermatids, and GPR54 were expressed in Sertoli cells. Kisspeptin treatment significantly

stimulated testosterone secretion in Leydig cells, with the highest levels found under 24 h of treatment

with 10 μM kisspeptin. Treatment with kisspeptin + kisspeptin antagonist significantly reduced the

kisspeptin-stimulated testosterone secretion in Leydig cells. Kisspeptin treatment significantly

enhanced the expression of Kiss1/GPR54 mRNA in Leydig cells. These data suggest the local

expressions of Kiss1/GPR54 in goats' testes and its autocrine role in Leydig cells, which is helpful in

understanding the regulation role of kisspeptin/GPR54 system in other peripheral tissues.

Keywords: Kisspeptin; GPR54; Autocrine; Leydig cell; Testosterone; Goat

1. Introduction

Kisspeptin, encoded by the Kiss1 gene, is a vital neuropeptide in the central regulation of the

reproductive axis. In humans, the Kiss1 gene encodes a 145-amino-acid precursor protein which

produces four shorter peptides of 54, 14, 13 or 10-amino acids (Wang et al., 2015; Cao et al., 2019; Li

et al., 2019). Kisspeptin and its G protein-coupled receptor 54 (GPR54) play a key role in the initiation

of mammalian puberty and adult reproduction by regulating the release of gonadotropin-releasing

hormone (GnRH) of hypothalamus and the subsequent secretion of pituitary luteinising hormone (LH)

and follicle-stimulating hormone (FSH) (Salehi et al., 2015; Katulski et al., 2018; Nestor et al., 2018).
LH and FSH secretion can stimulate steroidogenesis, gonadal maturation and gametogenesis in the

testes or ovaries by their specific receptors (Jin and Yang, 2014; Zhai et al., 2018; Zhuandi et al., 2018).

Kisspeptin administration can stimulate testes maturation and testosterone secretion by

hypothalamic-pituitary-gonadal (HPG) axis (Ullah et al., 2019). The knockout or mutations of Kiss1 or

GPR54 can prevent testes maturation and inhibit testosterone secretion (Lapatto et al., 2007; Chan et al.,

2009). Thus, the kisspeptin/GPR54 system plays a vital central regulatory role in the maturation and

function of testes.

Kiss1/GPR54 and its proteins were expressed in different testicular cells. Kiss1 mRNA expression

have been detected in goats, mice, rats, rhesus monkeys and human testes and GPR54 mRNA

expression has also been detected in mice, rats, rhesus monkeys and human testes (Samir et al., 2015;

Terao et al., 2004; Tariq et al., 2013; Mei et al., 2013). Kiss1 mRNA expression has been detected in

mouse (Anjum et al., 2012; Wang et al., 2015) and goat (Samir et al., 2015, 2018) Leydig cells by

real-time polymerase chain reaction (RT-PCR), and kisspeptin has been immunolocalised to Leydig

cells in mice (Anjum et al., 2012; Salehi et al., 2015; Mei et al., 2013) and goats (Samir et al., 2015,

2018). GPR54 mRNA or protein expression has been found in mouse Leydig cells (Wang et al., 2015;

Hsu et al., 2014). The GPR54 protein is not expressed in the Leydig cells of rhesus monkeys (Tariq et

al., 2013), which shows discrepancies among animal species. The expression of GPR54 in goat testes

remains unclear. The testosterone secreted by Leydig cells plays a crucial role in male gonadal

development and fertility, however, the direct role of kisspeptin/GPR54 system on testosterone

secretion in testicular Leydig cells shows discrepancies among animal species. Kisspeptin antagonists

can considerably inhibit testosterone secretion in purified goat Leydig cells (Samir et al., 2018).

Nevertheless, kisspeptin does not affect the secretion of testosterone in Leydig tumour cell line MA-10

or primary Leydig cells from adult mice (Wang et al., 2015; Mei et al., 2013). In addition, Kisspeptin

protein expression have been detected in mature human spermatozoa, rhesus monkey and mouse

spermatocytes and spermatids (Cao et al., 2019; Tariq et al., 2013; Pinto et al., 2012), and GPR54

protein expression is detected in mature human spermatozoa, rhesus monkeys spermatocytes and

Sertoli cells (Tariq et al., 2013; Pinto et al., 2012), which indicates that the kisspeptin/GPR54 system

possibly regulates spermatogenesis and fertilization in an autocrine or paracrine manner. These results

suggest that in addition to the central regulatory role, Kiss1/GPR54 may play a direct role in the animal

testis.
 To investigate the local expressions and function of Kiss1/GPR54 in goats' testes, we examined

the expression of Kiss1/GPR54 in goats' testes and Leydig cells, and investigated the direct regulatory

role of kisspeptin on testosterone secretion in Leydig cells by GPR54.

2. Materials and methods

2.1. Animals

Five pubertal male Dazu black goats in puberty (approximately 4 months old) from Chongqing

Tengda Animal Husbandry Co., Ltd., Chongqing, China, were used in this study. All animal

experiments and procedures conformed to the guidelines of the Regulations on the Care and Use of

Laboratory Animals of China and were approved by the Science and Technology Ethics Committee of

Southwest University.

2.2. Immunohistochemistry analysis of Kisspeptin/GPR54 in the testis

Pubertal male Dazu black goats were castrated to obtain testicular samples. These testes were

dissected and fixed overnight in 4% paraformaldehyde, and sectioned into sections with thicknesses of

5 μm. These sections were incubated overnight at 4 °C with rabbit polyclonal anti-kisspeptin antibody

(GTX37642, diluted 1:400; GeneTex) or anti-GPR54 antibody (ab140839, diluted 1:300; Abcam) in

blocking solution. Negative controls without antibodies were established with blocking buffer alone.

The sections were washed five times with PBS, and then incubated for 1 hour (h) at room temperature

with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (A21020, diluted 1:2000; Abbkine)

in blocking solution. The sections were rinsed, and then incubated with streptavidin-biotin complex

(Vector Laboratories, USA) for 1 h at room temperature. Immunoreactivity was revealed through

glucose–oxidase nickel-enhanced diaminobenzidine hydrochloride treatment, which generated a brown

precipitate. To confirmed the specificity of the primary antibody that used in this study for

immunolabelling of kisspeptin and GPR54, for the control sections, anti-kisspeptin (1:400) and

anti-GPR54 (1:300) polyclonal antibodies were adsorbed by preincubation with peptides (12.5 μg of

kisspeptin per ml, 16.5 μg of GPR54 per ml) for 1 h at room temperature (Samir et al., 2015; Anjum et
al., 2012). Three replicates were performed for the immunohistochemistry analysis.

2.3 Culture and treatment of Leydig cells

Primary Leydig cells were isolated from testes of pubertal male goats as described by previous

studies (Wang et al., 2015; Salehi et al., 2015; Samir et al., 2018). Briefly, the removed goat testes

were decapsulated in Medium 199 with 10% fetal bovine serum to separate seminiferous tubules.

Seminiferous tubules and cells were washed once with isolation buffer (1× Hank's balanced salt

solution containing 0.1% bovine serum albumin, 0.25 mg/ml collagenase II and 1%

penicillin-streptomycin) incubated in isolation buffer in a vigorously shaken water bath at 34 °C for 30

min and then filtered through a 50 μm nylon mesh filter. The Leydig cells were centrifuged at 2000

rpm and 37 °C for 10 min and then purified through discontinuous Percoll gradient separation as

previously described (Samir et al., 2018). The purity of the Leydig cells was determined by

3β-hydroxysteroid dehydrogenase histochemistry and was found to be over 80% (Samir et al., 2018).

After purification, the Leydig cells were resuspended in 10 ml of Medium 199 without fetal bovine

serum. Live cells were counted through the trypan blue assay and seeded in a flat bottomed 24-well

culture plate (2.5 × 105 cells/well).

The purified Leydig cells were applied immediately to detect the expression of Kiss1/GPR54

mRNA and protein by RT-PCR and Western blot, respectively. In addition, purified Leydig cells were

treated with kisspeptin 54 (0, 1, 10, or 100 μM) for 4, 24 and 72 h to detect the effect of kisspeptin on

testosterone secretion and determine the optimal kisspeptin treatment concentration and cell culture

time. The 0 µM kisspeptin means the PBS, which was used as a negative control. Purified Leydig cells

were also treated with the optimal kisspeptin concentration and kisspeptin + Peptide234 (kisspeptin

antagonist, 10 μM), according to an optimal cell processing time to further determine the effect of

kisspeptin on testosterone secretion and Kiss1/GPR54 mRNA expression. In this study, three replicates

were performed for the detection of Kiss1/GPR54 expression by RT-PCR and Western blot, and the

detection of Kiss1/GPR54 expression and hormonal assay after the treatment of Leydig cells.

2.4. RT-PCR
 Total RNA was extracted from Leydig cells that were untreated or treated with kisspeptin and

Peptide234 by using TRIzol Reagent (Invitrogen Co., CA, USA) and complementary DNA (cDNA)

was synthesised by using PrimeScript™ Reverse Transcriptase reagent kit (Invitrogen Co., CA, USA)

in accordance with the manufacturer’s protocol and as previously described (Samir et al., 2018).

RT-PCR was performed in accordance with manufacturer’s protocol (IQ SYBR Green; Bio-Rad

Laboratories, Inc., Shanghai, China), and the PCR products were identified by agarose gel

electrophoresis method. The specific primers for the Kiss1, GPR54 and β-actin beta (a reference gene)

genes were shown in Table 1 (Bellingham et al., 2001). The quantities of Kiss1 and GPR54 mRNA

were expressed as a proportion of that of the reference gene β-actin in accordance with the 2−ΔΔCT

method (Livak et al., 2001).

2.5. Western blot

Proteins from goats Leydig cell lysates were separated on 12% sodium dodecyl sulphate

polyacrylamide gels and transferred to polyvinylidene fluoride membranes in a semidry blotting

chamber. Blots were blocked with 5% skim milk in PBST for 2 h and probed with rabbit polyclonal

anti-kisspeptin antibody (ab101017, diluted 1:100; Abcam), anti-GPR54 antibody (sc134499, diluted

1:100; Santa Cruz Biotechnology, Inc) or anti-β-actin antibody (ab8227, diluted 1:2000; Abcam) at 4

°C overnight. The membranes were then washed and incubated with HRP-conjugated goat anti-rabbit

IgG (A21020, diluted 1:5000, Abbkine) at 37 °C for 2 hs. After washing, detection was performed with

enhanced chemiluminescence reagent (Pierce, Rockford, IL, USA).

2.6. Hormone assays

Testosterone levels were measured through ELISA. The assays were performed in accordance

with manufacturer’s instructions provided with the testosterone ELISA kit (Cusabio Biotech., Wuhan,

China). The sensitivity, intra- and inter-assay coefficients of variation of the ELISA were 0.05 ng/ml,

15% and 15%, respectively.

2.7. Statistical analysis

 The treatment concentration and time effect of kisspeptin on the testosterone secretion and any

interaction effect were analysed with two-way ANOVA by using SAS 8.1 analytical software program

(SAS Institute, Inc., Cary, NC, USA). Other data were analysed with one-way ANOVA followed by

Duncan’s multiple comparison. The results were expressed as mean ± standard deviation (SD). A value

of p < 0.05 was considered statistically significant.

3. Results

3.1. Kiss1 and GPR54 mRNA expression in goat Leydig cells

The sizes of the amplified Kiss1 and GPR54 genes in cultured goat Leydig cells were consistent

with those of the two target gene fragments (Fig. 1). This result indicated that Kiss1 and GPR54

mRNAs were expressed in goat Leydig cells.

3.2. Immunodetection of kisspeptin and GPR54 protein in goat testes

Kisspeptin and GPR54 immunoreactivities were detected in goat testes. The intensity of staining

of kisspeptin was strong in Leydig cells and round spermatids of seminiferous tubules, weak in primary

spermatocytes, and no staining was observed in spermatogonia, elongated spermatids and Sertoli cells

(Fig. 2A). The intensity of staining of GPR54 was strong in Leydig cells and Sertoli cells, weak in

round spermatids, and no staining was observed in spermatogonia, primary spermatocytes and

elongated spermatids (Fig. 2C). In the control sections, no staining was found (Fig. 2B,D).

3.3. Immunodetection of kisspeptin and GPR54 protein in goat testicular Leydig cells

Western blot analysis revealed that the kisspeptin and GPR54 proteins in cultured goat Leydig

cells contained 15 and 43 kDa protein bands, respectively (Fig. 3). These results confirmed that

kisspeptin and GPR54 proteins were expressed in goat Leydig cells.

3.4. Kisspeptin stimulates testosterone secretion by goat testicular Leydig cells

 We detected testosterone secretion in cultured goat Leydig cells that were treated with different

treatment concentrations of kisspeptin 54 and times. A significant effect of treatment concentration and

time, but not treatment concentration × time interactions, was seen for cultured goat Leydig cells

(two-way ANOVA, p < 0.05; p < 0.05 and p > 0.05, respectively). Testosterone levels in 10 μM

kisspeptin treatment group was significantly higher than that in 0, 1 μM kisspeptin treatment groups for

4, 24 and 72 h incubation, and than that in 100 μM kisspeptin treatment group for 24 h incubation (p <

0.05) (Fig. 4). Testosterone levels in 100 μM kisspeptin treatment group was significantly higher than

that in 0, 1 μM kisspeptin treatment groups for 4, 24 and 72 h incubation (p < 0.05) (Fig. 4).

Testosterone levels in 24 h incubation group was significantly higher than that in 4 h incubation group

for the treatments of 0 and 10 μM kisspeptin, and significantly higher than that in 72 h incubation

group for the treatments of 10 and 100 μM kisspeptin (p < 0.05) (Fig. 4). Testosterone levels in 72 h

incubation group was significantly higher than that in 4 h incubation group for the treatment of 0 μM

kisspeptin (p < 0.05) (Fig. 4B).

3.5. Effect of kisspeptin antagonist on kisspeptin-stimulated testosterone secretion in goat Leydig cells

Considering the effect of the previous kisspeptin treatment on testosterone levels and cost savings,

the Leydig cells in the kisspeptin treatment group was treated with 10 μM kisspeptin 54 for 24 h, and

the Leydig cells in kisspeptin + Peptide234 (kisspeptin antagonist) group was first treated with 10 μM

kisspeptin 54 for 24 h, and then with 10 μM Peptide234 for 24 h. Testosterone levels in kisspeptin +

Peptide234 treatment group was significantly lower than that in kisspeptin treatment group, and

testosterone levels in kisspeptin treatment group was significantly higher than that in control group (p <

0.05) (Fig. 5). However, no significant difference in testosterone levels in Leydig cells was detected

between the kisspeptin + Peptide234 treatment and control groups (p > 0.05) (Fig. 5).

3.6. Effect of kisspeptin stimulation on Kiss1 and GPR54 expression in goat testicular Leydig cells

Similarly, Kiss1 mRNA expression in kisspeptin treatment group was significantly higher than

that in kisspeptin + Peptide234 treatment and control groups (p < 0.05) (Fig. 6A). No significant
difference in testosterone levels in Leydig cells was detected between the kisspeptin + Peptide234

treatment and control groups (p > 0.05) (Fig. 6A). GPR54 mRNA expression in kisspeptin treatment

group was significantly higher than that in control group (p < 0.05) (Fig. 6B). No significant difference

was found in GPR54 mRNA expression in Leydig cells between kisspeptin treatment group and

kisspeptin + Peptide234 treatment group, or kisspeptin + Peptide234 treatment group and control group

(p > 0.05) (Fig. 6B).

4. Discussion

The functions of kisspeptin/GPR54 system in testicular Leydig cells remain either controversial or

unknown. The present work provides evidence for the local expressions of Kiss1/GPR54 in goats'

testes and the autocrine role of kisspeptin in Leydig cells, which is helpful for understanding the

regulation role of kisspeptin/GPR54 system in peripheral tissues other than the hypothalamus.

In the current study, the expression of kisspeptin/GPR54 system was detected in different cells of

goat testes. The expression of kisspeptin/GPR54 system was detected in goat testicular Leydig cells. In

this study, the expression of Kiss1/GPR54 mRNA was detected in cultured goat Leydig cells through

RT-PCR. Kiss1/GPR54 mRNA expression was also found in mouse and other Shiba goat Leydig cells

(Hsu et al., 2014; Samir et al., 2018). Most studies revealed that kisspeptins are immunolocalised in

Leydig cells in mice and goats (Wang et al., 2015; Samir et al., 2015, 2018), and only a few studies

detected the expression of GPR54 protein in mouse Leydig cells (Wang et al., 2015; Hsu et al., 2014).

One study showed that kisspeptin and GPR54 protein were not expressed in rhesus monkey Leydig

cells (Tariq et al., 2013). In this study, the expression of kisspeptin and GPR54 protein were detected in

goat Leydig cells by immunohistochemistry and Western blot analysis. The expression of

kisspeptin/GPR54 protein in Leydig cells showed discrepancies among animal species. The expression

of Kiss1/GPR54 mRNA and kisspeptin/GPR54 protein in goats suggested that kisspeptin/GPR54

system may regulate functions of goat Leydig cells in an autocrine manner. In addition, the expression

of kisspeptin/GPR54 system was also detected in goat testicular Sertoli cells and germ cells. This study

showed that the intensity of staining of kisspeptin was strong in round spermatids of seminiferous

tubules, weak in primary spermatocytes. GPR54 was expressed strong in goat Sertoli cells, weak in

round spermatids. Other studies also showed that GPR54 was expressed in Sertoli cells of rhesus
monkey testis (Tariq et al., 2013; Irfan et al., 2016), spermatids and spermatozoa of mouse and human

(Pinto et al., 2012; Mei et al., 2013; Hsu et al., 2014). Two studies showed that kisspeptin increased

sperm motility and fertilization capacity (Pinto et al., 2012; Hsu et al., 2014). These results indicated

the possibility of a direct effect of the kisspeptin on Sertoli cells and germ cells.

In the present study, kisspeptins play a direct regulatory role on testosterone secretion in goat

Leydig cells. In this study, kisspeptin treatment significantly stimulated testosterone secretion in

cultured goat Leydig cells, and the optimal treatment concentration and time was 10 μM kisspeptin and

24 h, respectively. Testosterone levels in kisspeptin + Peptide234 (kisspeptin antagonist) treatment

group was significantly lower than that in kisspeptin treatment group, and testosterone levels in

kisspeptin treatment group was significantly higher than that in control group, which indicated that

kisspeptin antagonist treatment significantly reduced kisspeptin-stimulated testosterone secretion in the

Leydig cells. Previous studies showed that the expression of Kiss1 and GPR54 mRNA in postpubertal

male Shiba goats were significantly higher than that in prepubertal goats, and plasma testosterone

levels in postpubertal male Shiba goats were also significantly higher than that in prepubertal goats,

which indicated that kisspeptin may play a stimulating effect on goat testosterone secretion (Samir et

al., 2015). Kisspeptin antagonist treatment can significantly inhibit basal and hCG-activated

testosterone secretion in purified Shiba goat Leydig cells (Samir et al., 2018). However, some studies

showed that kisspeptin did not affect the secretion of testosterone in mouse Leydig tumour cell line

MA-10 or primary adult mice Leydig cells (Wang et al., 2015; Mei et al., 2013), which may be due to

discrepancies among animal species. These results together with our study showed that kisspeptin

treatment can enhance testosterone secretion of goat Leydig cells and kisspeptin antagonist treatment

can inhibit goat testosterone secretion of goat Leydig cells, which indicated that kisspeptin may play a

direct regulatory role on testosterone secretion in goat Leydig cells. Interestingly, after treatment with 0

μM kisspeptin, testosterone secretion in goat Leydig cells after 24 and 72 h of culture was significantly

higher than that after 4 h. The other study also showed that testosterone levels in Leydig cells after

culturing 24 h was significantly higher than that after culturing for 4 h (Wang et al., 2015). This study

suggested that testosterone secretion would increase with the prolongation of the cell culture time.

Interestingly, testosterone level after treatment of goat Leydig cell culture with 10 μM kisspeptin for 24

h was significantly higher than that being treated with 100 μM kisspeptin for 24 h, which may be due to

a certain inhibitory effect of higher concentrations of kisspeptin produced. Other studies also showed
that drug treatment with higher concentrations can reduce its effect on testosterone secretion of mouse

or rat Leydig cells (Jiang et al., 2015; Ilfergane and Henkel, 2018).

In this study, kisspeptin treatment can enhance the expression of Kiss1/GPR54 mRNA in goat

Leydig cells. Kisspeptin treatment can drastically enhance Kiss1/GPR54 mRNA expression in goat

Leydig cells. The expression of Kiss1 mRNA in kisspeptin + Peptide234 treatment group was

significantly lower than that in kisspeptin treatment group, and the expression of GPR54 mRNA in

kisspeptin + Peptide234 treatment group was lower than that in kisspeptin treatment group but not

significant, and no significant difference between kisspeptin + Peptide234 treatment group and control

group, which indicated that kisspeptin antagonist treatment reduced kisspeptin-stimulated the

expression of Kiss1/GPR54 in the Leydig cells. A previous study showed that immunisation treatment

against kisspeptin can reduce expression of Kiss1 mRNA in the sheep testes (Wassie et al., 2019) . Our

study indicated that kisspeptin treatment can enhance the expression of Kiss1/GPR54 gene in goats

Leydig cells.

5. Conclusion

Kisspeptin/GPR54 system were expressed in the goat testicular Leydig cells, Sertoli cells and

germ cells. Kisspeptin stimulated the testosterone secretion and Kiss1/GPR54 mRNA expression in

Leydig cells, which suggest an autocrine role of kisspeptin in Leydig cells. The study is helpful in

further understanding the regulation role of kisspeptin/GPR54 system in other peripheral tissues.

Further studies should focus on actual roles and the mechanism of actions of Kiss1/GPR54 on Sertoli

cells and germ cells.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal

relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This study was funded by the Chongqing Science and Technology Innovation Special Project (No.
cstc2019jscx-gksbX0135, No. cstc2017shms-zdyfX0059), and the Innovation Team Building Program

in Chongqing University (No. CXTDG201602004).

References

Anjum, S., Krishna, A., Sridaran, R., Tsutsui, K., 2012. Localization of gonadotropin-releasing

hormone (GnRH), gonadotropin-inhibitory hormone (GnIH), kisspeptin and GnRH receptor and

their possible roles in testicular activities from birth to senescence in mice. J. Exp. Zool A Ecol.

Genet. Physiol. 317 (10), 630-644.

Bellingham, M., Fowler, P.A., Amezaga, M.R., Rhind, S.M., Cotinot, C., Mandon-Pepin, B., et al.,

2009. Exposure to a complex cocktail of environmental endocrine-disrupting compounds disturbs

the kisspeptin/GPR54 system in ovine hypothalamus and pituitary gland. Environ. Health Perspect

117 (10), 1556-1562.

Cao, Y., Li, Z., Jiang, W., Ling, Y., Kuang, H., 2019. Reproductive functions of Kisspeptin/KISS1R

systems in the periphery. Reprod. Biol. Endocrinol. 17 (1), 65.

Chan, Y.M., Broder-Fingert, S., Wong, K.M., Seminara, S.B., 2009. Kisspeptin/Gpr54-independent

gonadotrophin-releasing hormone activity in Kiss1 and Gpr54 mutant mice. J. Neuroendocrinol.

21 (12), 1015-1023.

Hsu, M.C., Wang, J.Y., Lee, Y.J., Jong, D.S., Tsui, K.H., Chiu, C.H., 2014. Kisspeptin modulates

fertilization capacity of mouse spermatozoa. Reproduction 147 (6), 835-845.

Ilfergane, A., Henkel, R.R., 2018. Effect of Typha capensis (Rohrb.) N.E.Br. rhizome extract F1

fraction on cell viability, apoptosis induction and testosterone production in TM3-Leydig cells.

Andrologia 50 (2), e12854.

Irfan, S., Ehmcke, J., Shahab, M., Wistuba, J., Schlatt, S., 2016. Immunocytochemical localization of

kisspeptin and kisspeptin receptor in the primate testis. J. Med. Primatol. 45 (3), 105-111.

Jiang, X., Cao, X., Huang, Y., Chen, J., Yao, X., Zhao, M., et al., 2015. Effects of treatment with

Astragalus Membranaceus on function of rat leydig cells. BMC. Complement Altern. Med. 15,

261.

Jin, J.M., Yang, W.X., 2014. Molecular regulation of hypothalamus-pituitary-gonads axis in males.

Gene 551 (1), 15-25.

Katulski, K., Podfigurna, A., Czyzyk, A., Meczekalski, B., Genazzani, A.D., 2018. Kisspeptin and LH

pulsatile temporal coupling in PCOS patients. Endocrine 61 (1), 149-157.

Lapatto, R., Pallais, J.C., Zhang, D., Chan, Y.M., Mahan, A., Cerrato, F., et al., 2007. Kiss1-/- mice

exhibit more variable hypogonadism than Gpr54-/- mice. Endocrinology 148 (10), 4927-4936.

Li, Z., Guo, R., Gu, Z., Wang, X., Wang, Y., Xu, H., et al., 2019. Identification of a promoter element

mediating kisspeptin-induced increases in GnRH gene expression in sheep. Gene 699, 1-7.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time

quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 (4), 402-408.

Mei, H., Doran, J., Kyle, V., Yeo, S.H., Colledge, W.H., 2013. Does kisspeptin signaling have a role in

the testes? Front Endocrinol (Lausanne). 4, 198.

Nestor, C.C., Bedenbaugh, M.N., Hileman, S.M., Coolen, L.M., Lehman, M.N., Goodman, R.L., 2018.

Regulation of GnRH pulsatility in ewes. Reproduction 156 (3), R83-R99.

Pinto, F.M., Cejudo-Román, A., Ravina, C.G., Fernández-Sánchez, M., Martín-Lozano, D., Illanes, M.,

et al., 2012. Characterization of the kisspeptin system in human spermatozoa. Int. J. Androl. 35 (1),

63-73.

Salehi, S., Adeshina, I., Chen, H., Zirkin, B.R., Hussain, M.A., Wondisford, F., et al., 2015.

Developmental and endocrine regulation of kisspeptin expression in mouse Leydig cells.

Endocrinology 156 (4), 1514-1522.

Samir, H., Nagaoka, K., Karen, A., Ahmed, E., El Sayed, M., Watanabe, G., 2015. Investigation the

mRNA expression of KISS1 and localization of kisspeptin in the testes of Shiba goats and its

relationship with the puberty and steriodogenic enzymes. Small Ruminant Res. 133, 1-6.

Samir, H., Nagaoka, K., Watanabe, G., 2018. Effect of kisspeptin antagonist on goat in vitro Leydig

cell steroidogenesis. Theriogenology 121, 134-140.

Terao, Y., Kumano, S., Takatsu, Y., Hattori, M., Nishimura, A., Ohtaki, T., et al., 2004. Expression of

KiSS-1, a metastasis suppressor gene, in trophoblast giant cells of the rat placenta. Biochim.

Biophys. Acta. 1678 (2-3), 102-110.

Tariq, A.R., Shahab, M., Clarke, I.J., Pereira, A., Smith, J.T., Khan, S.U., et al., 2013. Kiss1 and Kiss1

receptor expression in the rhesus monkey testis: a possible local regulator of testicular function.

Cent. Eur. J. Biol. 8 (10), 968-974.

Ullah, H., Nabi, G., Zubair, H., Ullah, R., Shahab, M., 2019. Age-dependent changes in the
 reproductive axis responsiveness to kisspeptin-10 administration in healthy men. Andrologia 51 (4)

e13219.

Wassie, T., Liu, G., Jiang, X., Tesema, B., Han, Y., Zhao, J., et al., 2019. Immunization against

Kisspeptin-54 perturb hypothalamic-pituitary-testicular signaling pathway in ram lambs.

Theriogenology 125, 193-202.

Wang, J.Y., Hsu, M.C., Tseng, T.H., Wu, L.S., Yang, K.T., Chiu, C.H., 2015. Kisspeptin expression in

mouse Leydig cells correlates with age. J. Chin. Med. Assoc. 78 (4), 249-257.

Zhai, L., Zhao, J., Zhu, Y., Liu, Q., Niu, W., Liu, C., et al., 2018. Downregulation of leptin receptor

and kisspeptin/GPR54 in the murine hypothalamus contributes to male hypogonadism caused by

high-fat diet-induced obesity. Endocrine 62 (1), 195-206.

Zhuandi, G., Tuanjie, C., Luju, L., Abdiryim, A., Yingying, D., Haoqin, L., et al., 2018. FSH receptor

binding inhibitor restrains follicular development and possibly attenuates carcinogenesis of

ovarian cancer through down-regulating expression levels of FSHR and ERβ in normal ovarian

tissues. Gene 668, 174-181.

Abbreviations: RT-PCR, reverse transcriptase PCR; GPR54, G protein-coupled receptor 54;

GnRH, gonadotropin-releasing hormone; LH, luteinising hormone; FSH, follicle-stimulating

hormone; HPG, hypothalamic-pituitary-gonadal; HRP, horseradish peroxidase.

Author contributions

Study conception and design: Y.H., X.P. and Y.H. Acquisition of data: X.P., W.S., R.N., Y.H.,

J.W., and Y.Z. Analysis of data: Y.H. and G.E. Paper drafting: Y.H. and X.P. Critical appraisal of

paper: G.L., X.J., L.Y., and Y.Z. All authors have approved the final paper to be published.
Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal

relationships that could have appeared to influence the work reported in this paper.

Fig. 1. Electrophoresis analysis of (A) Kiss1 and (B) GPR54 RT-PCR products from goat testicular

Leydig cells. Lane 1: Leydig cell samples were amplified by using designed primers for (A) Kiss1 or

(B) GPR54; lane 2: the reference gene (A) β-actin control or (B) negative ddH2O controlfor PCR; M:

DL500 DNA marker.

Fig. 2. Immunohistochemical staining of kisspeptin and GPR54 in testicular tissues from pubertal goats.

Histological sections from goat testes were immunostained with (A) kisspeptin antibody and (C)

GPR54 antibody. Control sections were incubated with primary kisspeptin and GPR54 antibody by

preincubation with kisspeptin (B) and GPR54 (D) peptides. Positive immunostaining of cells in goat

testes appeared brown in colour and is indicated by yellow boxes and arrows, and no immunostaining

is indicated by white boxes and arrows. The insert panels showed the original image (Scale bars = 100

μm). Scale bars = 50 μm. LEY (Leydig cells), SP (spermatogonia), P.SP (primary spermatocytes), RS

(round spermatids), ES (elongated spermatids), SER (Sertoli cells).

Fig. 3. Western blot analyses of (A) kisspeptin and (B) GPR54 protein expression in goat Leydig cell

lysates. (C) β-actin was used as the loading control. M: Marker.

Fig. 4. Effect of kisspeptin on testosterone secretion in cultured goat Leydig cells. Leydig cells were

incubated with four different kisspeptin concentrations (0, 1, 10 or 100 μM) (treatment effect) for 4, 24

and 72 h (time effect). treatment concentration × time indicates the interaction effect of treatment

concentration and time. N/S, not significant. Values scripted with different lowercase letters (a, b, c)

represent significant difference among treatment concentrations (p < 0.05), different capital letters (A,

B, C, D) represent significant difference among time intervals (p < 0.05).

Fig. 5. Effect of kisspeptin antagonist on kisspeptin-stimulated testosterone secretion in Leydig cells.

Cells were treated with kisspeptin 54 (10 μM) for 24 h and then with kisspeptin antagonist (Peptide234,

10 μM) for 24 h. * indicates p < 0.05.

Fig. 6. Effect of kisspeptin stimulation on the expression of (A) Kiss1 and (B) GPR54 mRNA in

Leydig cells. Cells were treated with kisspeptin 54 (10 μM) for 24 h and then with kisspeptin

antagonist (Peptide234, 10 μM) for 24 h. Kiss1/β-actin and GPR54/β-actin indicate the expression of

kiss1 and GPR54 mRNA relative to β-actin. * indicates p < 0.05.

Highlights

► Kisspeptin/GPR54 was expressed in Leydig, Sertoli and germ cells of goat

testes.

► Kisspeptin plays a direct regulation role on testosterone secretion in Leydig

cells.

► Kisspeptin can directly stimulate Kiss1/GPR54 mRNA expression in Leydig

cells.

► Kisspeptins play an autocrine role in goat Leydig cells.

Table 1. Primer sequences of target genes used for RT-PCR in goat Leydig cells.

Gene Primer sequence (5’-3’) Product size Accession no. References

Kiss1 Forward: CTGGTGCAGCGGGAGAAG 57 bp NM_001285710.2 Bellingham et al., 2011

Reverse: GCGCAGGCCGAAGGA
GPR54 Forward: CTACATCCAGCAGGTCTCGG 75 bp XM_018050490.1 Bellingham et al., 2011
Reverse: GTCACGTACCAGCGGTCCA
β-actin Forward: TCCTTCCTGGGCATGGAATC 204 bp NM_001314342.1 Bellingham et al., 2011
Reverse: GGGCGCGATGATCTTGATCT