From DNA to

protein

Rut Klinger
MIS IB DP Topic 2.7
Essential Idea
The structure of DNA allows
efficient storage of genetic information
 Molecular
biology
paradigm

GENE EXPRESSION
LEADS TO PROTEIN
SYNTHESIS
Transcription is the synthesis of mRNA copied from
the DNA base sequence by RNA polymerase

• RNA polymerase
• uses uridine instead of thymidine

• moves from 3’ to 5’ end

• adds nucleotides
• makes RNA strand
Deducing the DNA base
sequence for the mRNA
strand
• Sequence of freshly made RNA is
complementary to the DNA template
sequence
• Uridines are used instead of thymidines

DNA: CTGTCCATGCTAAACCGACTTGC
RNA: GACAGGUACGAUUUGGCUGAACG
 RNA polymerase separates the DNA
Transcription strands and synthesises a complementary
RNA copy from one of the DNA strands

process by which an RNA sequence is

produced from a DNA template When the DNA strands are separated,
ribonucleoside triphosphates align
opposite their exposed complementary
base partner

RNA polymerase removes the additional

phosphate groups and uses the energy
from this cleavage to covalently join the
nucleotide to the growing sequence

Once the RNA sequence has been

synthesised, RNA polymerase detaches
from the DNA molecule and the double
helix reforms
The amino acid sequence of polypeptides is
determined by mRNA according to the genetic code

• The DNA is transcribed into mRNA on the basis of their

complementarity.
• Translation is the process of conversion of nucleic acid information
into amino acids.
• There is no complementarity between amino acids and mRNA.
• Hence, translation is not controlled by complementarity but by the
genetic code
Genetic code
• The genetic code can be defined as the set of certain rules
using which the living cells translate the information encoded
within genetic material 🡪 DNA or mRNA sequences.
• The complete set of relationships among amino acids and
codons is said to be a genetic code which is often
summarized in a table.
• A codon is a sequence of three nucleotides which together
form a unit of genetic code in a DNA or RNA molecule.
• In other words, genetic code is defined as the nucleotide
sequence of the base on DNA which is translated into a
sequence of amino acids of the protein to be synthesized.
• In other words, genetic code is defined as the nucleotide
sequence of the base on DNA which is translated into a
sequence of amino acids of the protein to be synthesized.
 Codons of three bases on mRNA correspond to one amino
acid in a polypeptide

• Four different bases and 20 amino acids – so

one base can’t code for one amino acids

• 16 combos for 2 bases = still  too few

therefore living organisms use a triplet code

• Sequence of three bases is called codon –

each codon codes for a specific amino acid to
be added to the polypeptide

• Amino acids are carried on another kind of

RNA called tRNA, each has a specific ( has
three base anticondon complementary to the
mRNA codon for the particular amino acid
 Structure of tRNA

• Structurally, the tRNA is an inverted L-shaped

molecule which has an anticodon loop and amino
acid acceptor end.  
• The anticodon loop makes bases complementary
to the codes on the mRNA and amino acid end
binds to the respective amino acids 🡪 it helps in
protein synthesis.  
• Each amino acid has a specific tRNA.
• Initiator tRNA initiates the translation while stop
codons have no tRNA.
Translation is the synthesis of
polypeptides on ribosomes

• Translation is process of protein synthesis in which the

genetic information encoded in mRNA is translated into a
sequence of amino acids on a polypeptide chain

• This is the second of the two processes needed to produce a

specific polypeptide

• It is the synthesis of polypeptide with an amino acid

sequence chosen by the base sequence of a molecule of
RNA

• It takes place on the cell structure in the cytoplasm known as

ribosomes – they are complex structures that consist of a
small and a large subunit, with binding sites for each of the
molecules that take place in the translation
Ribosomes

mun.ca

wired.com
 produced in transcription
gives information about
mRNA – messenger sequence of aminoacids in
polypeptide

carries aminoacids for

tRNA – transfer translation process

RNA Types
rRNA – ribosomal builds ribosomes

some other that you don’t have to know

 Translation
process of protein synthesis in which the genetic information encoded in mRNA is translated into a
sequence of amino acids on a polypeptide chain

• Ribosomes bind to mRNA in the cytoplasm and move along

the molecule in a 5’ – 3’ direction until it reaches a start
codon (AUG)

• Anticodons on tRNA molecules align opposite appropriate

codons according to complementary base pairing (e.g. AUG
= UAC)

• Each tRNA molecule carries a specific amino acid (according

to the genetic code)

• Ribosomes catalyse the formation of peptide bonds between

adjacent amino acids

• The ribosome moves along the mRNA molecule synthesising

a polypeptide chain until it reaches a stop codon

• At this point translation ceases and the polypeptide chain is

released
hyperphysics.phy-astr.gsu.edu
General Idea

http://www.schenectady.k12.ny.us/putman/biology/data/translation/poly.html
 Transcription & Translation
• In nucleus • In cytoplasm
• Makes mRNA • Makes polypeptides

http://stemcells.nih.gov/Stati
cResources/info/scireport/im
ages/figurea6.jpg
 Genetic code
• Universal
• Universal
• Degenerated
• Triplet
• Comma-free
• Unambiguous
• Non-overlapping

Excercise:

DNA sequence:
TAC  GGT  CAC  TGA  AGT  CCC  TGC  TTA  CTG  AAT

What peptide will be the result?

Universl Genetic code
• All organisms use the same genetic code
• Each codon means the same in each organism

• Genetic code is universal

Genetic code -Not always the same
• Some organisms produce and use slightly different amino acids 🡪
Exceptions:
• mitochondrial DNA
• some heterotrophic unicellular protists
• bacteria
• yeasts
• viral genetic material

http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=c

riken.jp sandwalk.blogspot.com
Degenerate genetic code
• The genetic code has only ~20 amino acids but has
64 different codon combinations
• Consequently, the genetic code is said to show
degeneracy – more than one codon may code for a
single amino acid
• Due to the shape of the tRNA molecule, the third base of
an anticodon is not orientated optimally for base pairing
• Consequently, third base is less discriminatory towards
complementary pairing
• This is why degeneracy always occurs in the third base
of a codon (this site is known as the wobble position)
• Degeneracy of the genetic code allows for the
occurrence of silent mutations – whereby a change in
the DNA sequence does not alter the polypeptide
sequence
Gene The sequence of DNA that is
transcribed into RNA is called a
gene

The strand that is transcribed is

called the antisense strand and is
complementary to the RNA
sequence 

The strand that is not transcribed

is called the sense strand and is
identical to the RNA
sequence (with T instead of U)
One Gene –
One
Polypeptide
one gene codes for one
polypeptide
Gene Theory Exceptions

•Some proteins are composed of a number of

polypeptides and in this theory each polypeptide has its
own gene, e.g. haemoglobin is composed of 4
polypeptides (2 of each type) and there is a gene for
each type of polypeptide.

•This theory, like so many in biology, has exceptions,

e.g.:
• Some genes code for types of RNA which do not
produce polypeptides (tRNA, rRNA).
• Some genes code for more than one polypeptide
(different exon composition).
•Polycistronic genes (more mRNAs coded under one
promoter)
Resources

• Textbook chapter 2.7 p. 111-122

• https://www.youtube.com/watch?v=LsEYgwuP6
ko&t=1s
• https://www.youtube.com/watch?v=8_f-8ISZ164
&t=1s
• www.thoughtco.com/
• https://byjus.com/
• https://ib.bioninja.com.au/
• https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/w
printgc.cgi?mode=c