Genetic variations underlie

phenotypic differences
 Wilt Chamberlain,
a famous NBA basketball player
(7 feet, 1 inch; 275 pounds)

 Willie Shoemaker,
a famous horse racing jockey
(4 feet, 11 inches;
barely 100 pounds).
 Genetic variations cause
inherited diseases

Genetic Diseases Complex Diseases Environmental

Diseases

- Cystic fibrosis - Alzheimer disease - Influenza

- Down syndrome - Cardiovascular Disease - Hepatitis

- Diabetes (type 2) - Measles
- Sickle cell disease
- Parkinson Disease
- Turner syndrome

- Environment - Genes
 Basic terminology
 Locus – location of a gene/marker
on the chromosome.

 Allele – one variant form of a

gene/marker at a particular locus.

Locus1
Possible Alleles: A1,A2

Locus2
Possible Alleles: B1,B2,B3
 A little more basic terminology
Polymorphism:
 Variations in DNA sequence (substitutions,
deletions, insertion, etc) that are present at a
frequency greater than 1% in a population.
 Have a WEAK EFFECT or NO EFFECT at all.
 Ancient and COMMON.
Mutation:
 Variations in DNA sequence (substitutions,
deletions, etc) that are present at a frequency lower
than 1% in a population.
 Can produce a gain of function and a loss of function.
 Recent and RARE.
 Some Facts
 In human beings, 99.9% bases are same
 Remaining 0.1% makes a person unique
 Different attributes / characteristics / traits
• how a person looks
• diseases he or she develops

 These variations can be:

 Harmless (change in phenotype)
 Harmful (diabetes, cancer, heart disease, Huntington's
disease, and hemophilia )
 Latent (variations found in coding and regulatory regions,
are not harmful on their own, and the change in each gene
only becomes apparent under certain conditions e.g.
susceptibility to heart attack)
 Forms of genetic variations
 Single nucleotide substitution: replacement of
one nucleotide with another
 Microsatellites or minisatellites: these tandem
repeats often present high levels of inter- and
intra-specific polymorphism

 Deletions or insertions: loss or addition of one or

more nucleotides
 Changes in chromosome number, segmental
rearrangements and deletions
 SNPs appear at least once per 0.3-1-kb average
intervals.
 Considering the size of entire human genome
(3.2X109 bp),
 the total number of SNPs is around to 5-10 million
 Potentially polymorphic microsatellites are over
100,000 across the human genome
• The insertion/deletions are very difficult to
quantify and
• the number is likely to fall in between SNPs and
microsatellites
 How do we find sequence
variations?

• look at multiple sequences

from the same genome region

• use base quality values to decide

if mismatches are true
polymorphisms or sequencing errors
Vcam1 : Coding-NonSynonymous
AGGAAAAGAACATAACAAGAACTATTTTTCGCCCGAACTC B6
AGGAAAAGAACATAACAAGGACTATTTTTCGCCCGAACTC C3H

B6

C3H
 Human Genetic Variation
Most abundant type:
SNPs-Single Nucleotide Polymorphisms

GATTTAGATCGCGATAGAG
GATTTAGATCTCGATAGAG
^
about 90% of all human genetic variations
What is the difference between
SNP and mutation?

For a variation to be considered a SNP,

it must occur in at least 1% of the population.
 SNP is a kind of a mutation.
 Mutations are any changes made in
the sequence of DNA.
 Mutations don't always have a strong
negative effect, and such mutations (or
changes) in DNA sequence can remain in
the population. ... SNP is a change
(mutation) in a single nucleotide in
the sequence.
 Single nucleotide polymorphisms, frequently
called SNPs (pronounced “snips”), are the most
common type of genetic variation among people.
 Each SNP represents a difference in a single
DNA building block, called a nucleotide. ... Most
commonly, these variations are found in the
DNA between genes.
 SNP array. In molecular biology, SNP array is a
type of DNA microarray which is used
to detect polymorphisms within a population.
 SNP genotyping is the measurement of genetic
variations of single nucleotide polymorphisms
(SNPs) between members of a species.
 It is a form of genotyping, which is the
measurement of more general genetic
variation. SNPs are one of the most common
types of genetic variation.
 A single nucleotide polymorphism, or SNP, occurs
when two individuals in the population differ by a
single letter in the DNA sequence.
 Transcript: For example, a change in the DNA
sequence can lead to a change in the sequence of
the protein that is produced, or it may cause a
protein to terminate prematurely.
 SNPs are different because they are inherited.

 Mutations can happen in any DNA molecule, in any

cell, but they are only inherited if they occur in
the DNA that's passed on to our
offspring. SNPs occur about every 200-1000
bases.
 How To Analyze Your Single Nucleotide
Polymorphism (SNP) Chip Data
1. Cluster your SNPs. First, sort the data by
chromosome, and then by chromosome
position, in order to cluster your SNPs. ...
2. Choose which SNPs to pursue. ...
3. Find your SNPS on the chromosome. ...
4. Identify gene functions. ...
5. Dig deeper.
 To be classified as a SNP, two or more
versions of a sequence must each be
present in at least one percent of the
general population.
 SNPs occur throughout the human
genome—about one in every 300 nucleotide
base pairs.
 This translates to about 10
million SNPs within the 3-billion-nucleotide
human genome.
A SNP in the coding region of the DNA
(cSNP) may or may not result in amino acid
substitutions in the protein being formed.
 If an amino acid substitution occurs, the
protein created may have a different
shape or tertiary structure and thus
significantly influence
that protein's ability to exert its
biologic effect.
 Life cycle of SNP
(long way from mutation to SNP)
Appearance of
new variant
by mutation Survival of rare allele

Increase in allele frequency

after population expand

New allele is fixed

in population as novel polymorphism
 SNPs occur every 300-1000 bases in human
genome;
 Two of every three SNPs involve the
replacement of cytosine (C) with thymine (T);

 SNPs can occur in both coding (gene) and

noncoding regions of the genome;
 Many SNPs have no effect on cell function,
but others could predispose people to disease
or influence their response to a drug.
 Transitions
 Purine to purine or pyrimidine to
pyrimidine
 A to G or G to A T to C or C to T

 Transversions
 Purine to pyrimidine or pyrimidine to
purine
 SNP Databases

•NCBI dbSNP
http://www.ncbi.nlm.nih.gov/SNP/index.html

•Human Genome Variation Database (HGVbase)

http://hgvbase.org/

International HapMap Project

http://snp.cshl.org/
1. Coding SNPs
Synonymous: when single base substitutions
do not cause a change in the resultant amino
acid
Non-synonymous: when single base
substitutions cause a change in the resultant
amino acid
2. Non-coding SNPs that influence gene
expression
3. Non-coding silent SNPs
 SNPs are used as genetic markers to
identify genes responsible for disease
susceptibility or a particular trait.
 Point mutations

 Not all single base pair differences are SNPs

 They can be a mutation if least abundant

allele has a frequency < 1% in a population
Causes of gene mutations
 Consequences of mutations
 Most mutations are neutral
• 97% DNA neither codes for protein or RNA, nor
indirectly affects gene function
• A new variant in the 1.5% coding regions may not
result in a change in amino acid
• Variants that change amino acid may not affect
function
 Certain mutations have functional
effect and even cause disease
• Gain-of-function mutations often produce dominant
disorders
• Loss-of-function mutations result in recessive disease
 Consequences of mutations
 Missense mutations differ in severity
• conservative amino acid substitution substitutes
chemically similar amino acid, less likely to alter
function
• nonconservative amino acid substitution substitutes
chemically different amino acid, more likely to alter
function
• consequences for function often context-specific
 Nonsense mutation results in premature
termination of translation
• truncated polypeptides often are nonfunctional
 Point mutation in non-coding region may affect
transcription, RNA splicing, and protein
assembling
 A conservative replacement (also called a
conservative mutation or a conservative
substitution) is an amino acid replacement in a
protein that changes a given amino acid to a
different amino acid with similar biochemical
properties (e.g. charge, hydrophobicity and
size).
A missense mutation changes a codon so
that a different protein is created, a non-
synonymous
change. Conservative mutations result in
an amino acid change. ... These are both
examples of a non-conservative (missense)
mutation.
 Silent mutations code for the same amino
acid (a "synonymous substitution").
 Residues in a protein might
be buried inside or exposed
to the solvent surrounding
the protein.
 The buried residues usually
form hydrophobic cores to
maintain the structural
integrity of proteins while
the exposed residues are
tightly related to protein
functions.
 Microsatellite
di-, tri-, and tetra-nucleotide repeats

TGCCACACACACACACACAGC TGCTCATCATCATCAGC
TGCCACACACACA------GC TGCTCATCA------GC

TGCTCAGTCAGTCAGTCAGGC
TGCTCAGTCAG--------GC
 The second abundant genetic variation in the
human genome
 Usually have no functional effect, but some do
 Trinucleotide repeats-
associated diseases
 Characterized by expansion of three-
base-pair repeats
• few repeats to hundreds of repeats
• expansion results in abnormal protein,
disease
• number of repeats may expand in
subsequent generations
 Triplet repeat expansion
• Normal Disease Gene

 Huntington disease CAG 9-35 37-100 Huntingtin

 Kennedy disease CAG 17-24 40-55 androgen receptor
 Spino-cerebellar Ataxia CAG 19-36 43-81 Ataxin 1
 Machado Joseph D CAG 12-36 67-75 SCA
 Myotonic dystrophy CTG 5-35 50-400 DM
 Fragile X CGG CCG GCC 6-50 200-1000 FMR1

 Many result in neurodegeneration

 Severity of many diseases increases with the
number of repeats
 Minisatellite
• 6-64 bp repeating pattern

1 tgattggtct ctctgccacc gggagatttc cttatttgga ggtgatggag gatttcagga

61 attttttagg aattttttta atggattacg ggattttagg gttctaggat tttaggatta
121 tggtatttta ggatttactt gattttggga ttttaggatt gagggatttt agggtttcag
181 gatttcggga tttcaggatt ttaagttttc ttgattttat gattttaaga ttttaggatt
241 tacttgattt tgggatttta ggattacggg attttagggt ttcaggattt cgggatttca
301 ggattttaag ttttcttgat tttatgattt taagatttta ggatttactt gattttggga
361 ttttaggatt acgggatttt agggtgctca ctatttatag aactttcatg gtttaacata
421 ctgaatataa atgctctgct gctctcgctg atgtcattgt tctcataata cgttcctttg

 These occur at more than 1000 locations in the human genome

 Usually have no functional effect
 Transposon and mutation

Transposons are interspersed DNA repeats that can cause

mutations and change the amount of DNA in the genome
Nondisjunction Trisomy

A trisomy is a type of
polysomy in which
there are three
instances of a
particular chromosome,
instead of the normal
two. A trisomy is a
type of aneuploidy (an
abnormal number of
chromosomes).
Includes
Diseases: Down
syndrome
 Trisomy 21
Down Syndrome
 Down Syndrome
 1 per 800 births
 Large tongue
 Flat face
 Slanted eyes
 Single crease
across palm
 Mental
retardation
 Some are not
Turner Syndrome
 Turner Syndrome
 Short
 Absence of a
menstrual period
 Produce little
estrogen
 Sterile
 Extra skin on neck
 Turner syndrome is a female-only
genetic disorder that affects about 1 in
every 2,000 baby girls.
 A girl with Turner syndrome only has
one normal X sex chromosome, rather
than the usual two.
 This chromosome variation happens
randomly when the baby is conceived in
the womb.
 Mutation Polymorphism
 Gene directly leads to  Gene confers an increased
disorder risk, but does not directly
cause disorder
 Mendelian pattern of
inheritance  No clear inheritance pattern

 Rare  Common in population