See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/305634549

Hyperglycemia induces mixed M1/M2 cytokine profile in primary human

monocyte-derived macrophages

Article in Immunobiology · July 2016

DOI: 10.1016/j.imbio.2016.07.006

CITATIONS READS

6 211

8 authors, including:

Kondaiah Moganti Alexei Gratchev

University of Münster N.N. Blokhin Cancer Research Center
14 PUBLICATIONS 36 CITATIONS 144 PUBLICATIONS 4,250 CITATIONS

SEE PROFILE SEE PROFILE

Martin C Harmsen Julia Kzhyshkowska

University of Groningen Universität Heidelberg
234 PUBLICATIONS 6,359 CITATIONS 161 PUBLICATIONS 3,637 CITATIONS

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Macrophages in cancer View project

Development of biomaterials for cardiac repair View project

All content following this page was uploaded by Kondaiah Moganti on 18 December 2017.

The user has requested enhancement of the downloaded file.

 Immunobiology 222 (2017) 952–959

Contents lists available at ScienceDirect

Immunobiology
journal homepage: www.elsevier.com/locate/imbio

Hyperglycemia induces mixed M1/M2 cytokine profile in primary

human monocyte-derived macrophages
Kondaiah Moganti a , Feng Li a , Christina Schmuttermaier a , Sarah Riemann b ,
Harald Klüter a,c , Alexei Gratchev d,e , Martin C. Harmsen f , Julia Kzhyshkowska a,c,e,∗
a
Institute of Transfusion Medicine and Immunology, Medical Faculty Mannheim, University of Heidelberg, Theodor-Kutzer Ufer 1-3, 68167 Mannheim,
Germany
b
Fifth Medical Department, Medical Faculty Mannheim, University of Heidelberg, Mannheim, Germany
c
Red Cross Blood Service Baden-Württemberg–Hessen, Friedrich-Ebert Str. 107, D-68167 Mannheim, Germany
d
Institute of Carcinogenesis, N.N.Blokhin Russian Cancer Research Center, Moscow, Russian Federation
e
Laboratory for Translational Cellular and Molecular Biomedicine, Tomsk State University, 36 Lenin Prospekt, Tomsk 634050, Russian Federation
f
University of Groningen, University Medical Center Groningen, Dept. Pathology and Medical Biology, The Netherlands

a r t i c l e i n f o a b s t r a c t

Article history: Hyperglycaemia is a key factor in diabetic pathology. Macrophages are essential regulators of inflamma-
Received 2 June 2016 tion which can be classified into two major vectors of polarisation: classically activated macrophages (M1)
Accepted 21 July 2016 and alternatively activated macrophages (M2). Both types of macrophages play a role in diabetes, where
Available online 22 July 2016
M1 and M2-produced cytokines can have detrimental effects in development of diabetes-associated
inflammation and diabetic vascular complications. However, the effect of hyperglycaemia on differentia-
Keywords:
tion and programming of primary human macrophages was not systematically studied. We established a
Macrophage
unique model to assess the influence of hyperglycaemia on M1 and M2 differentiation based on primary
Cytokine
TNF-alpha human monocyte-derived macrophages. The effects of hyperglycaemia on the gene expression and secre-
IL-1beta tion of prototype M1 cytokines TNF-alpha and IL-1beta, and prototype M2 cytokines IL-1Ra and CCL18
IL-1Ra were quantified by RT-PCR and ELISA. Hyperglycaemia stimulated production of TNF-alpha, IL-1beta and
CCL18 IL-1Ra during macrophage differentiation. The effect of hyperglycaemia on TNF-alpha was acute, while
Hyperglycemia the stimulating effect on IL-1beta and IL-1Ra was constitutive. Expression of CCL18 was supressed in M2
Inflammation macrophages by hyperglycaemia. However the secreted levels remained to be biologically significant.
Our data indicate that hyperglycaemia itself, without additional metabolic factors induces mixed M1/M2
cytokine profile that can support of diabetes-associated inflammation and development of vascular
complications.
© 2016 Elsevier GmbH. All rights reserved.

1. Introduction adipose has increased macrophages infiltration compared to nor-

Low grade inflammation is an essential process in the progres-
sion of Diabetes Mellitus which frequently leads to development
of macro- and micro vascular complications. Macrophages are
key innate immune cells which control homeostasis and coordi-
nate inflammatory and healing reactions (Gordon et al., 2014).
Macrophages derive from circulating monocytes that are actively
recruited into tissues with increased metabolic turn-over and par-
ticularly to sites of pathogen or trauma-induced damage. Thus,
∗ Corresponding author at: Dept. of Innate Immunity and Tolerance, Institute
of Transfusion Medicine and Immunology, Medical Faculty Mannheim, Heidelberg
University, Theodor-Kutzer Ufer 1-3, D-68167 Mannheim, Germany.
E-mail address: julia.kzhyshkowska@medma.uni-heidelberg.de
(J. Kzhyshkowska).
mal tissue, that at least in part depends on release of CCL2 by
adipocytes (Heilbronn and Campbell, 2008; Kraakman et al., 2014).
Cytokines can drive two directions of macrophages differentia-
tion resulting in development of M1 (classically activated) and M2
(alternatively activated) macrophages (Murray et al., 2014).
Pathological activation of macrophages results in the develop-
ment of chronic inflammatory disorders including cardiovascular
diseases. Both M1 and M2 macrophages can contribute to the
development of chronic inflammation by unbalanced production
of inflammatory cytokines, enzymes, and growth factors as well as
by suppression of tolerogenic scavenging function (Gordon et al.,
2014; Kzhyshkowska et al., 2012; Crowther et al., 2001). M1-
produced cytokines TNF-alpha and IL-1beta induce inflammatory
activation of endothelial cells (Crowther et al., 2001). In turn,
inflammatory responses of the endothelial cells lead to the devel-
opment of atherosclerosis, restenosis, but also to microvascular

http://dx.doi.org/10.1016/j.imbio.2016.07.006
0171-2985/© 2016 Elsevier GmbH. All rights reserved.
 K. Moganti et al. / Immunobiology 222 (2017) 952–959
pathologies such as diabetic retinopathy and renal vasculopathy
(Fiedler et al., 2006).
Hyperglycemia is the most pronounced biochemical feature of
both type 1 and type 2 diabetes. In endothelial cells, hyperglycemia
causes ROS-dependent pro-inflammatory and pro-adhesive acti-
vation which rely on altered intracellular signaling (Popov, 2010).
M1 macrophages primarily utilize glucose as an energy substrate
(Tannahill et al., 2013; Vats et al., 2006), whereas M2 macrophages
utilizes fatty acids as an energy source (Tannahill et al., 2013; Vats
et al., 2006). M1 macrophages are more metabolically active in
hyperglycemic conditions, and promote obesity associated insulin
resistance (Espinoza-Jimenez et al., 2012; Freemerman et al., 2014).
The M2 macrophages are significantly more heterogeneous in their
phenotypes and functional activities compared to M1, and their
role in progression of metabolic syndrome and diabetes is complex
including both detrimental and beneficial effect. In general, it is
believed that M2 macrophages inhibit type 2 diabetes by reducing
the obesity and insulin resistance (Espinoza-Jimenez et al., 2012;
Castoldi et al., 2016). However, it has been recently demonstrated
in a mouse model for chronic Trypanosoma cruzi infection that
adipose tissue macrophages are polarized towards an M2 phe-
notype (F4/80 + CD11c-CD206+). This phenotypic shift correlated
with an acute insulin resistance followed by chronic hyperglycemia
with hypoinsulinemia, evidencing an infection-related-diabetes
progression (Cabalén et al., 2016). In a mouse model for streptozo-
tocin (STZ)-induced type 1 diabetes it was found that F4/80-positive
peritoneal exudate macrophages have significantly reduced levels
CD86, CD54, TNF-alpha and IL-6 but enhanced nitric oxide (NO)
secretion production. However, these effects can be only partially
explained by hyperglycemic conditions (Sun et al., 2012).
Hyperglycemia also affects the phenotype of macrophages
in clinical atherosclerotic plaques (Erbel et al., 2016). A history
of diabetes associates with significantly increased proportion of
CD68+ macrophages expressing high levels of aldose reductase
(AR; geneAKR1B1), a rate-limiting enzyme of the polyol pathway
associated with diabetes and atherosclerosis (Erbel et al., 2016).
However, the effect of hyperglycemia on the differentiation and
activation of subpopulations of primary human macrophages has
not yet been systematically investigated. M1 and M2 macrophages
produce distinct patterns of inflammatory cytokines, where M1
are a major source of TNF-alpha and IL-1beta, and M2 produce
CCL18 and IL-1Ra (Kzhyshkowska et al., 2016). In this study for the
first time we systematically investigated the influence of hyper-
glycemia on the cytokine production in primary human M0, M1 and
M2 macrophages. We demonstrated that hyperglycaemia itself,
without additional metabolic factors can induce a mixed M1/M2
phenotype, where the profile of released cytokines can support the
progression of diabetes and vascular complications.
2. Materials and methods
2.1. Isolation of human monocytes
Blood monocytes were isolated from buffy coats (DRK
Mannheim) obtained from healthy blood donors after informed
consent as described previously (Kzhyshkowska et al., 2004): Buffy
coats were diluted with Ca2+ - and Mg2+ -free phosphate-buffered
saline (PBS) (Biochrom) at a 1:1 ratio. A total of 30 ml of diluted
buffy coats were layered on top of 15 ml Biocoll (Biochrom, Berlin,
Germany) in a 50 ml polypropylene tube and centrifuged at room
temperature at 420 x g for 30 min. Peripheral blood mononuclear
cells (PBMC) were collected from the interphase and washed three
times with PBS (Biochrom). Next, the PBMCs were further purified
by PercollTM density gradient centrifugation at room temperature
at 420 x g for 30 min. The upper layer, containing monocytes, was
953
collected and washed with PBS for three times. The cells obtained
were subjected to CD14+ magnetic cell sorting using monocyte
isolation kit (Milteny Biotech, Bergisch Gladbach, Germany), result-
ing in 95–98% monocyte purity, controlled by flow cytometry. The
monocytes were cultured at the concentration of 1 × 106 cell/ml in
customized SFM glucose-free medium supplemented with 5 mM
(normoglycemia, NG) or 25 mM (hyperglycemia, HG) glucose (Life
Technology, Darmstadt, Germany), and with cytokines in the pres-
ence of 7.5% CO2 for the time periods from 6 h up to 6 days.
Following cytokines were used: human interferon-gamma (IFN-
gamma) at the concentration of 100 ng/ml, human interleukin-4
(IL-4) at the concentration of 10 ng/ml, and human macrophage
colony-stimulating factor (M-CSF) 5 ng/ml (all from TEBU Prepro-
tech, Frankfurt am Main, Germany).
2.2. Cytokine secretion assay
Concentrations of secreted cytokines TNF-alpha, IL-1beta, IL-
1Ra and CCL18 were analyzed in macrophage culture supernatants
using ELISA assays from R&D systems (Wiesbaden, Germany)
according to the manufacturer’s instructions.
2.3. RNA isolation and cDNA synthesis
For RNA isolation, the cells were lysed in TRK lysis buffer and the
RNA was isolated using E.Z.N.A Total RNA kit according to the rec-
ommendations of the manufacturer. Total RNA (1 ␮g) was treated
with 2U RNase free DNase I (Thermo Scientific, Germany). cDNA
synthesis was performed using RevertAid RT Reverse Transcription
Kit (Thermo Scientific, Germany) with oligo-dT primers according
to the recommendations of the manufacturer. The obtained cDNA
was diluted 1:10 with double distilled water and 1 ␮l was used for
PCR
2.4. Quantitative PCR analysis
Levels of mRNA for TNF-alpha, IL1B, IL1RA, CCL18 were
quantified using TaqMan PCR master mix (Applied Biosystems,
Darmstadt, Germany) in the standard conditions. Following
primers have been used: for TNF-alpha FP: TCTTCTCGAAC-
CCCGAGTGA, RP: AAGCCTGTAGCCCATGTTGTAGCAAACC, probe:
FAM-AGCTGCCCCTCAGCTTGA-BHQ1, for IL1B FP: ACAGATGAAGT-
GCTCCTTCCA, RP: GTCGGAGATTCGTAGCTGGAT, probe: FAM-
CTCTGCCCTCTGGATGGCGG-BHQ1, for IL1RA FP: GAAGATGTGC-
CTGTCCTGTGT, RP: CGCTCAGGTCAGTGATGTTAA, probe: FAM-
TGGTGATGAGACCAGACTCCAGCTG-BHQ1; for CCL18 FP: ATAC-
CTCCTGGCAGATTCCAC, RP: GCTGATGTATTTCTGGACCCAC, probe:
FAM-CAAGCCAGGTGTCATCCTCCTAACCAAGAGAG-BHQ1, and for
18S rRNA FP: CCATTCGAACGTCTGCCCTAT, RP: TCACCCGTG-
GTCACCATG, probe: JOE-ACTTTCGATGGTAGTCGCCGTGCCT-BHQ1.
Amplification was performed using Light cycler 480 system (Roche
Lifesciences). The expression levels of analyzed genes were nor-
malized according to the 18s rRNA. All the samples were calibrated
to donor 1 (non-stimulation) NS.
3. Results
3.1. Hyperglycaemia induces acute but not long-term production
of TNF-alpha in human macrophages
TNF-alpha is a key inflammatory cytokine produced by M1
macrophages stimulated by IFN-gamma (Martinez and Gordon,
2014a,b). Elevated TNF-alpha levels are found in diabetic conditions
(Quan et al., 2011). We first examined the kinetics of how hyper-
glycemia affects pro-inflammatory activation of human primary
954 K. Moganti et al. / Immunobiology 222 (2017) 952–959

Fig. 1. TNF-alpha secretion in primary human M0, M1 and M2 macrophages in normal and high glucose conditions. Monocytes-derived macrophage we cultivated in normal
(NG, 5 mM) and high (HG, 25 mM) glucose conditions. Supernatants were collected on day 1, 3 and 6 of macrophage cultivation. Concentrations of TNF-alpha were measured
by ELISA in (A) NS − non stimulated (M0) macrophages, (B) IFNgamma stimulated (M1) macrophages and (C) IL-4 stimulated (M2) macrophages. All experiments were
performed in duplicates. Individual donors are indicated as Donor 1-Donor 8.

macrophages by analysis of TNF-alpha release. Human monocyte-
derived macrophages were differentiated for 6 days with either
IFN-gamma (M1), or IL-4 (M2) or no cytokines (M0) in the presence
of 5 mM (NG) and 25 mM glucose (HG) in a serum-free medium
supplemented by concentration (5 ng/ml) of M-CSF to support
macrophage viability without affecting the phenotype. We iden-
tified the stimulating effect of hyperglycemic conditions on the
TNF-alpha release in 5 out of 8 analyzed donors in M0, in 4 our
8 donors in M1, and in 1 out 8 donors in M2. The effect was mostly
pronounced after 1 day of macrophage exposure to hyperglycemia
ranging from 3.9 up to 19.2 times in M0 and ranging from 1.6 up
to 6.7 times in M1 (Fig. 1). The stimulatory effect of hyperglycemia
was declining after 3 and 6 days of macrophage differentiation. On
day 6 there was only very slight increase of TNF-alpha release (up to
5 times in M0 and up to 2 times in M1. The maximal increase in TNF-
alpha gene expression detected on day 6 was only up to 1.6 times
in M1 macrophages (Supplementary Fig. 1). Our data indicated that
hyperglycemia is able to directly induce TNF-alpha production in
primary human monocytes-derived macrophages in acute but not
in chronic inflammatory phase.
3.2. Hyperglycaemia induces IL-1beta gene expression and
secretion in human M0, M1 and M2
IL-1beta is an inflammatory cytokines produced by M1
macrophages in response to IFN-gamma stimulation (Martinez and
Gordon, 2014a,b). We next examined if high glucose levels skew
differentiation of macrophages to a pro-inflammatory phenotype
in differentiating M0, M1 and M2 via IL-1beta measurement. High
glucose stimulated IL-1beta release on all days analyzed (day 1, 3
and 6) in 7 out of 8 donors up to 3.2 times increase in M1. High glu-
cose had also stimulating effect on IL-1beta release in M0 and M2,
with strongest effect in donors 1, 2, 5 and 7 (Fig. 2). On the level of
gene expression, hyperglycemia had a significant stimulating effect
in 4 out of 8 donors (donors 1, 2, 3 and 5) (Supplementary Fig. 2).
The maximum effect was 8.7 times increase in M1 macrophages
(Supplementary Fig. 2). We further examined whether high glu-
cose has an immediate effect on the stimulation of IL-1beta gene
expression and cytokine production. Macrophages from additional
6 donors have been analyzed for IL-1beta mRNA levels and cytokine
release after 6 h and 24 h of high glucose exposure of freshly iso-
lated monocytes in M0, M1 and M2 conditions. In all 6 donors we
found the stimulatory effect of high glucose on IL-1beta mRNA lev-
els in M1 after 6 h (Fig. 3). The strongest effect of 89 times increase
was detected in M1 of donor 10 (Fig. 3). We have detected the stim-
ulatory effect of hyperglycemia on IL-1beta release in M0, M1 and
M2 from 4 out 6 donors after 6 h (Supplementary Fig. 3).
Our data indicate that hyperglycemia has a direct effect on
induction of IL-1beta gene expression and release that is not
switched off a by negative feedback mechanism.
3.3. Hyperglycaemia induces IL-1Ra release in M0, M1 and M2
IL-1Ra is a prototype cytokine produced by macrophages in
response to IL-4 that inhibits pro-inflammatory effects of IL-1beta
by competitive binding to its receptor (Palomo et al., 2015). We
 K. Moganti et al. / Immunobiology 222 (2017) 952–959 955

Fig. 2. IL-1beta secretion in primary human M0, M1 and M2 macrophages in normal and high glucose conditions. Monocytes-derived macrophage we cultivated in normal
(NG, 5 mM) and high (HG, 25 mM) glucose conditions. Supernatants were collected on day 1, 3 and 6 of macrophage cultivation. Concentrations of IL-1beta were measured by
ELISA in (A) NS—non stimulated (M0) macrophages, (B) IFNgamma stimulated (M1) macrophages and (C) IL-4 stimulated (M2) macrophages. All experiments were performed
in duplicates. Individual donors are indicated as Donor 1-Donor 8.

examined how hyperglycemia affects differentiation of monocytes
into M2 by analysis of IL-1Ra release. As expected, highest IL-1Ra
levels were produced by M2 macrophages, stimulated by IL-4 (Sup-
plementary Fig. 4). Hyperglycemia stimulated IL-1Ra release up to
2.9 times in M2 during the whole time course (Supplementary Fig.
4). Moreover, hyperglycemia had also an inducing effect on IL-1Ra
release in M0 and M1 macrophages, with strongest effect (up to 17.1
times) on day 6 observed in M0 for donors 1, 3, 4, 5 and 7. In M1, the
strongest effect was observed for donor 5 (2 times increase). RT-PCR
analysis demonstrated that on day 6, glucose levels did not have a
significant effect on IL-1Ra gene expression (Supplementary Fig.
5). We further examined whether high glucose has an immediate
effect on the stimulation of IL-1Ra gene expression and production.
Additional 6 donors have been analyzed for IL-1Ra mRNA levels and
cytokine release after 6 h and 24 h of exposure of freshly isolated
monocytes to high glucose in M0, M1 and M2 conditions. In 5 out of
6 donors we found the stimulatory effect of high glucose on IL-1Ra
mRNA levels in M0, M1 and M2 after 6 h (Fig. 4). The effect was
mostly pronounced in M1, with up to 89.7 times increase for donor
11 (Fig. 4). After 6 h we have detected stimulatory effect hyper-
glycemia on IL-1Ra release in M1 and M2 in all 6 donors, and in
M0 in 5 out of 6 donors (Fig. 5). After 24 h hyperglycemia induced
IL-1Ra release in all macrophage subtypes and in all donors (Fig. 5).
3.4. Hyperglycaemia suppresses CCL18 production in M2
macrophages
CCL18 is abundantly expressed by M2 macrophages in response
to IL-4 on late stages of macrophage differentiation (Kodelja et al.,
1998). We first examined how hyperglycemia affects CCL18 gene
expression using RT-PCR. In macrophages isolated out of all 8
donors analyzed hyperglycemia inhibited CCL18 gene expression
(Fig. 6A, B). However, this suppressive effect was significantly pro-
nounced in donors with general low levels of CCL18 mRNA (donors
1–4, up to 16.7 times decrease, Fig. 6A). Effect of hyperglycemia
on CCL18 release was analyzed on days 1, 3 and 6 by ELISA.
Macrophages, stimulated with IL-4 produced high levels of CCL18
on day 6 of culture under normal glucose conditions. Secreted lev-
els of CCL18 were also suppressed by hyperglycemia on day 3 and
day 6 in most of donors, however the degree of suppression did not
depend on the levels in CCL18 cytokine in normal glucose condi-
tions (Fig. 7).
4. Discussion
Accumulating data coming mostly from mouse models for
diabetes suggest that hyperglycemia along with other metabolic
changes correlates with changes of macrophage phenotypes. How-
ever, direct effect of hyperglycemia on distinct human primary
macrophage subtypes was not addressed up to date. This limitation
was related to the absence of the in vitro model system to propagate
human primary monocytes-derived macrophages in serum-free
medium in normal and hyperglycemic conditions. In the present
study we established such a model system using custom-made
glucose-free medium supplemented by 5 mM and 25 mM glucose
and low levels of M-CSF that does not affect macrophages polarisa-
tion and support viability of all macrophage subpopulations (data
not shown).
We analyzed for the first time the effect hyperglycemia on the
production of prototypic M1 and M2 cytokines in different subpop-
956 K. Moganti et al. / Immunobiology 222 (2017) 952–959

Fig. 3. Effect of hyperglycemia on IL-1beta gene expression. Monocytes-derived macrophage we cultivated in normal (NG, 5 mM) and high (HG, 25 mM) glucose conditions
for 6 h and 24 h. RT-PCR was used for quantification of mRNA levels of IL-1beta. Individual donors are indicated as (A) Donor 9-Donor 11 (B) Donor 12-Donor 14. NS—non
stimulated (M0), IFNgamma-stimulated (M1) and IL-4-stimulated (M2) macrophages were analyzed. All experiments were performed in duplicates.

Fig. 4. Effect of hyperglycemia on IL-1Ra gene expression. Monocytes-derived macrophage we cultivated in normal (NG, 5 mM) and high (HG, 25 mM) glucose conditions
for 6 h and 24 h. RT-PCR was used for quantification of mRNA levels of IL-1Ra. Individual donors are indicated as (A) Donor 9-Donor 11 (B) Donor 12-Donor 14. NS—non
stimulated (M0), IFNgamma-stimulated (M1) and IL-4-stimulated (M2) macrophages were analyzed. All experiments were performed in duplicates.
 K. Moganti et al. / Immunobiology 222 (2017) 952–959 957

Fig. 5. IL-1Ra secretion in primary human M0, M1 and M2 macrophages in normal and high glucose conditions. Monocytes-derived macrophage we cultivated in normal
(NG, 5 mM) and high (HG, 25 mM) glucose conditions for 6 h and 24 h. Concentrations of IL1RA were measured by ELISA in (A) NS—non stimulated (M0) macrophages, (B)
IFNgamma stimulated (M1) macrophages, and (C) IL-4 stimulated (M2) macrophages. Individual donors are indicated as Donor 9-Donor 14. All experiments were performed
in duplicates.

ulations of human primary macrophages. M1 and M2 macrophages
produce distinct patterns of inflammatory cytokines, where M1
are a major source of TNF-alpha and IL-1beta, and M2 produce
CCL18 and IL-1Ra (Kzhyshkowska et al., 2016). TNF-alpha is a key
inflammatory cytokine contributing to the development of diabetic
vascular complications (Zhang et al., 2009; Willerson and Ridker,
2004; Bruunsgaard, 2005). High production of TNF-alpha leads to
the severe impairment of glucose tolerance and insulin sensitivity,
it induces endothelial dysfunction in diabetic patients compli-
cated with microangiopathy as well as pro-atherogenic changes
in chronic inflammatory conditions (Espinoza-Jimenez et al., 2012;
Popa et al., 2007; Makino et al., 2005). In addition to triggering
acute and chronic inflammation, TNF-alpha regulates glucose and
lipid metabolism and inhibits insulin production in pancreatic beta
cells (Pickup, 2004). It was previously demonstrated that patients
with newly diagnosed or established diabetes mellitus (DM) have
significantly higher levels TNF-alpha in serum compared to control
subjects without DM (Stentz et al., 2004). Our data indicate that
hyperglycemia can immediately induce TNF-alpha gene expres-
sion and cytokine release primary monocytes, however this effect
is not observed after 24 h of monocytes-to macrophage differentia-
tion. Thus, circulating monocytes, exposed to hyperglycemia in the
blood stream, but not mature macrophages in the tissue might be
the source of elevated TNF-alpha levels in the circulation of diabetic
patients.
Pro-inflammatory cytokine IL-1beta is upregulated in diabetic
vascular complications (Liu et al., 2012; Maedler et al., 2009). In
diabetic retinopathy production of IL-1beta is dramatically upreg-
ulated in the glial cells, endothelial cells, and neutrophils recruited
into the retina (Kowluru and Odenbach, 2004; Alconchel et al.,
1999). Macrophage-derived IL-1beta was shown to induce insulin
resistance in obesity and supports progression of atherosclerosis
(Maedler et al., 2009). In our macrophage model different sub-
types of macrophages were able to produce biologically significant
levels of IL-1beta as direct response to hyperglycemic conditions.
Both gene expression and production of IL-1beta were increased
during macrophage maturation, and, in contrast to TNF-alpha, IL-
1beta production does not undergo downregulation by negative
feed-back mechanism. Therefore, macrophage in hyperglycemia
conditions might be the source of IL-1beta during chronic or low
grade inflammation in different tissues, including fat tissue and
sub-endothelial regions.
IL-1Ra produced by M2 is a natural inhibitor of inflammatory
effects of IL-1beta. IL-1Ra competitively binds to the IL-1R1, recep-
958 K. Moganti et al. / Immunobiology 222 (2017) 952–959

Fig. 6. Effect of hyperglycemia on CCL18 gene expression. Monocytes-derived macrophage we cultivated in normal (NG, 5 mM) and high (HG, 25 mM) glucose conditions for
6 days. RT-PCR was used for quantification of mRNA levels of CCL18. Individual donors are indicated as (A) Donor 1 − Donor 4 and (B) Donor 5—Donor 8. NS − non stimulated
(M0), IFNgamma-stimulated (M1) and IL-4-stimulated (M2) macrophages were analyzed. All experiments were performed in duplicates.

Fig. 7. Effect of hyperglycemia on CCL18 secretion in primary human M2 macrophages. Monocytes-derived macrophage we cultivated in normal (NG, 5 mM) and high (HG,
25 mM) glucose conditions for 6 days. Concentrations of CCL18 were measured by ELISA in IL-4 stimulated (M2) macrophages. Individual donors are indicated as Donor
1-Donor 8. All experiments were performed in duplicates.

tor of IL-1beta, and blocks its activation (Palomo et al., 2015)
However, elevated levels of IL-1Ra were shown to be associated
with increased risk of type 2 diabetes (Carstensen et al., 2010). Sev-
eral studies showed that IL-1Ra is strongly upregulated in obese
patients, and levels of IL-1Ra correlate with to insulin resistance
(Feve and Bastard, 2009; Strandberg et al., 2006). IL-1Ra is involved
in the inflammatory responses in obesity and prediabetes (Herder
et al., 2009). However, the role of IL-1Ra in diabetic complications
is controversial, and it was reported that IL-1Ra can improve beta
cell secretory function and reduce markers of systemic inflamma-
tion (Larsen et al., 2007). Our study for the first time provides
the evidence that macrophage in hyperglycemic conditions can
be the major source of IL-1Ra. Moreover, hyperglycemia not only
increased the levels of IL-1Ra in M2 macrophages, but was also
able to stimulate its production in M0 and M1 macrophages. This
indicates that hyperglycaemia itself, without additional metabolic
factors can induce mixed M1/M2 phenotype where the profile of
released cytokines can support the progression of diabetes and vas-
cular complications.
CCL18 is abundantly expressed by mature M2 macrophages
(Kodelja et al., 1998). It stimulates collagen production in pul-
monary fibroblasts and is reported to cause fibrosis independent
of TGF-␤ (Luzina et al., 2006). CCL18 was also found to be upreg-
ulated in the diabetic nephropathy (Tam, 2008), and it contributes
to the recruitment of T-cells into atherosclerotic lesions (Reape
et al., 1999). Therefore elevated CCL18 levels are detrimental for
patients with metabolic syndrome and diabetes. However, our
study demonstrated that elevated levels of CCL18 in diabetic con-
ditions are not a consequence of hyperglycemia, and also other
metabolic factors can be expected to induce CCL18.
 K. Moganti et al. / Immunobiology 222 (2017) 952–959
In summary, our study revealed that hyperglycemia induces
constitutive production of M1 cytokine IL-1beta and M2 cytokine
IL-1Ra, moreover the production of IL-Ra is also stimulated in M0
and M1 macrophages. Therefore, hyperglycemia is an essential
factor driving mixed M1/M2 differentiation profile characterized
by production of cytokines that can play a critical role in insulin
resistance, diabetes–associated inflammation and vascular compli-
cations.
Disclosures
The authors have no conflict of interest.
Acknowledgment
This project has received funding from the Marie Curie Inter-
national Research Staff Exchange Scheme with the 7th European
Community Framework Program under grant agreement No.
295185.
Appendix A. Supplementary data
Supplementary data associated with this article can be found,
in the online version, at http://dx.doi.org/10.1016/j.imbio.2016.07.
006.
References
Bruunsgaard, H., 2005. Physical activity and modulation of systemic low-level
inflammation. J. Leukoc. Biol. 78, 819.
Cabalén, M.E., Cabral, M.F., Sanmarco, L.M., Andrada, M.C., Onofrio, L.I., Ponce, N.E.,
Cano, R.C., 2016. Chronic Trypanosoma cruzi infection potentiates adipose
tissue macrophage polarization toward an anti-inflammatory M2 phenotype
and contributes to diabetes progression in a diet-induced obesity model.
Oncotarget 7 (12), 13400–13415 http://doi.org/10.18632/oncotarget.7630.
Carstensen, M., Herder, C., Kivimaki, M., Jokela, M., Roden, M., Shipley, M.J., Witte,
D.R., Brunner, E.J., Tabak, A.G., 2010. Accelerated increase in serum
interleukin-1 receptor antagonist starts 6 years before diagnosis of type 2
diabetes: whitehall II prospective cohort study. Diabetes 59, 1222.
Castoldi, A., de Souza, C.N., Camara, N.O.S., Vieira, P.M.M.M., 2016. The macrophage
switch in obesity development. Front. Immunol. 6.
Crowther, M., Brown, N.J., Bishop, E.T., Lewis, C.E., 2001. Microenvironmental
influence on macrophage regulation of angiogenesis in wounds and malignant
tumors. J. Leukoc. Biol. 70, 478.
Erbel, C., Rupp, G., Domschke, G., Linden, F., Akhavanpoor, M., Doesch, A.O., Katus,
H.A., Gleissner, C.A., 2016. Differential regulation of aldose reductase
expression during macrophage polarization depends on hyperglycemia. Innate
Immun. 22, 230.
Espinoza-Jimenez, A., Peon, A.N., Terrazas, L.I., 2012. Alternatively activated
macrophages in types 1 and 2 diabetes. Mediators Inflamm. 2012, 815953.
Feve, B., Bastard, J.P., 2009. The role of interleukins in insulin resistance and type 2
diabetes mellitus. Nat. Rev. Endocrinol. 5, 305.
Fiedler, U., Reiss, Y., Scharpfenecker, M., Grunow, V., Koidl, S., Thurston, G., Gale,
N.W., Witzenrath, M., Rosseau, S., Suttorp, N., 2006. Angiopoietin-2 sensitizes
endothelial cells to TNF-␣ and has a crucial role in the induction of
inflammation. Nat. Med. 12, 235.
Freemerman, A.J., Johnson, A.R., Sacks, G.N., Milner, J.J., Kirk, E.L., Troester, M.A.,
Macintyre, A.N., Goraksha-Hicks, P., Rathmell, J.C., Makowski, L., 2014.
Metabolic reprogramming of macrophages: glucose transporter 1
(GLUT1)-mediated glucose metabolism drives a proinflammatory phenotype. J.
Biol. Chem. 289, 7884.
Gordon, S., Pluddemann, A., Martinez Estrada, F., 2014. Macrophage heterogeneity
in tissues:phenotypic diversity and functions. Immunol. Rev. 262, 36.
Heilbronn, L.K., Campbell, L.V., 2008. Adipose tissue macrophages, low grade
inflammation and insulin resistance in human obesity. Curr. Pharm. Des. 14,
1225.
Herder, C., Brunner, E.J., Rathmann, W., Strassburger, K., Tabak, A.G., Schloot, N.C.,
Witte, D.R., 2009. Elevated levels of the anti-inflammatory interleukin-1
receptor antagonist precede the onset of type 2 diabetes: the Whitehall II
study. Diab. Care 32, 421.
Kodelja, V., Muller, C., Politz, O., Hakij, N., Orfanos, C.E., Goerdt, S., 1998. Alternative
macrophage activation-associated CC-chemokine-1, a novel structural
homologue of macrophage inflammatory protein-1 alpha with a
Th2-associated expression pattern. J. Immunol. 160, 1411.
Kowluru, R.A., Odenbach, S., 2004. Role of interleukin-1beta in the pathogenesis of
diabetic retinopathy. Br. J. Ophthalmol. 88, 1343.
View publication stats
959
Kraakman, M.J., Murphy, A.J., Jandeleit-Dahm, K., Kammoun, H.L., 2014.
Macrophage polarization in obesity and type 2 diabetes: weighing down our
understanding of macrophage function? Front. Immunol. 5, 470.
Kzhyshkowska, J., Gratchev, A., Martens, J.-H., Pervushina, O., Mamidi, S.,
Johansson, S., Schledzewski, K., Hansen, B., He, X., Tang, J., 2004. Stabilin-1
localizes to endosomes and the trans-Golgi network in human macrophages
and interacts with GGA adaptors. J. Leukoc. Biol. 76, 1151.
Kzhyshkowska, J., Neyen, C., Gordon, S., 2012. Role of macrophage scavenger
receptors in atherosclerosis. Immunobiology 217, 492.
Kzhyshkowska, J., Gudima, A., Moganti, K., Gratchev, A., Orekhov, A., 2016.
Perspectives for monocyte/macrophage-based diagnostics of chronic
inflammation. Transf. Med. Hemother. 43, 66.
Larsen, C.M., Faulenbach, M., Vaag, A., Vølund, A., Ehses, J.A., Seifert, B.,
Mandrup-Poulsen, T., Donath, M.Y., 2007. Interleukin-1–receptor antagonist in
type 2 diabetes mellitus. New Engl. J. Med. 356, 1517.
Liu, Y., Costa, M.B., Gerhardinger, C., 2012. IL-1␤ is upregulated in the diabetic
retina and retinal vessels: cell-specific effect of high glucose and IL-1␤
autostimulation. PLoS One 7, e36949.
Luzina, I.G., Tsymbalyuk, N., Choi, J., Hasday, J.D., Atamas, S.P., 2006.
CCL18-stimulated upregulation of collagen production in lung fibroblasts
requires Sp1 signaling and basal Smad3 activity. J. Cell. Physiol. 206, 221.
Maedler, K., Dharmadhikari, G., Schumann, D.M., Storling, J., 2009. Interleukin-1
beta targeted therapy for type 2 diabetes. Expert Opin. Biol. Ther. 9, 1177.
Makino, N., Maeda, T., Sugano, M., Satoh, S., Watanabe, R., Abe, N., 2005. High
serum TNF-␣ level in Type 2 diabetic patients with microangiopathy is
associated with eNOS down-regulation and apoptosis in endothelial cells. J.
Diab. Compl. 19, 347.
Martinez, F.O., Gordon, S., 2014a. The M1 and M2 paradigm of macrophage
activation: time for reassessment. F1000Prime Rep. 6, 13.
Martinez, F.O., Gordon, S., 2014b. The M1 and M2 paradigm of macrophage
activation: time for reassessment. F1000 Prime Reports 6, 13 http://doi.org/10.
12703/P6-13.
Alconchel, M.D., Whyte, J., Torres, A., Cisneros, A., Sarrat, R., 1999. Facial artery and
atherosclerosis. Folia Morphol. 58 (3), 199–206.
Murray, P.J., Allen, J.E., Biswas, S.K., Fisher, E.A., Gilroy, D.W., Goerdt, S., Gordon, S.,
Hamilton, J.A., Ivashkiv, L.B., Lawrence, T., Locati, M., Mantovani, A., Martinez,
F.O., Mege, J.L., Mosser, D.M., Natoli, G., Saeij, J.P., Schultze, J.L., Shirey, K.A.,
Sica, A., Suttles, J., Udalova, I., van Ginderachter, J.A., Vogel, S.N., Wynn, T.A.,
2014. Macrophage activation and polarization: nomenclature and
experimental guidelines. Immunity 41, 14.
Palomo, J., Dietrich, D., Martin, P., Palmer, G., Gabay, C., 2015. The interleukin (IL)-1
cytokine family–balance between agonists and antagonists in inflammatory
diseases. Cytokine 76, 25.
Pickup, J.C., 2004. Inflammation and activated innate immunity in the
pathogenesis of type 2 diabetes. Diab. Care 27, 813.
Popa, C., Netea, M.G., van Riel, P.L., van der Meer, J.W., Stalenhoef, A.F., 2007. The
role of TNF-alpha in chronic inflammatory conditions, intermediary
metabolism, and cardiovascular risk. J. Lipid Res. 48, 751.
Popov, D., 2010. Endothelial cell dysfunction in hyperglycemia: phenotypic
change, intracellular signaling modification, ultrastructural alteration, and
potential clinical outcomes. Int. J. Diab. Mell. 2, 189.
Quan, Y., Jiang, C.T., Xue, B., Zhu, S.G., Wang, X., 2011. High glucose stimulates
TNFalpha and MCP-1 expression in rat microglia via ROS and NF-kappaB
pathways. Acta Pharmacol. Sin. 32, 188.
Reape, T.J., Rayner, K., Manning, C.D., Gee, A.N., Barnette, M.S., Burnand, K.G., Groot,
P.H., 1999. Expression and cellular localization of the CC chemokines PARC and
ELC in human atherosclerotic plaques. Am. J. Pathol. 154, 365.
Stentz, F.B., Umpierrez, G.E., Cuervo, R., Kitabchi, A.E., 2004. Proinflammatory
cytokines, markers of cardiovascular risks, oxidative stress, and lipid
peroxidation in patients with hyperglycemic crises. Diabetes 53, 2079.
Strandberg, L., Lorentzon, M., Hellqvist, Å., Nilsson, S., Wallenius, V., Ohlsson, C.,
Jansson, J.-O., 2006. Interleukin-1 system gene polymorphisms are associated
with fat mass in young men. J. Clin. Endocrinol. Metab. 91, 2749.
Sun, C., Sun, L., Ma, H., Peng, J., Zhen, Y., Duan, K., Liu, G., Ding, W., Zhao, Y., 2012.
The phenotype and functional alterations of macrophages in mice with
hyperglycemia for long term. J. Cell. Physiol. 227, 1670.
Tam, F.W.K., 2008. Diagnostics and therapeutics for diabetic nephropathy
involving ccl18, Google Patents.
Tannahill, G.M., Curtis, A.M., Adamik, J., Palsson-McDermott, E.M., McGettrick, A.F.,
Goel, G., Frezza, C., Bernard, N.J., Kelly, B., Foley, N.H., Zheng, L., Gardet, A.,
Tong, Z., Jany, S.S., Corr, S.C., Haneklaus, M., Caffrey, B.E., Pierce, K., Walmsley,
S., Beasley, F.C., Cummins, E., Nizet, V., Whyte, M., Taylor, C.T., Lin, H., Masters,
S.L., Gottlieb, E., Kelly, V.P., Clish, C., Auron, P.E., Xavier, R.J., O’Neill, L.A., 2013.
Succinate is an inflammatory signal that induces IL-1beta through HIF-1alpha.
Nature 496, 238.
Vats, D., Mukundan, L., Odegaard, J.I., Zhang, L., Smith, K.L., Morel, C.R., Wagner,
R.A., Greaves, D.R., Murray, P.J., Chawla, A., 2006. Oxidative metabolism and
PGC-1beta attenuate macrophage-mediated inflammation. Cell Metab. 4, 13.
Willerson, J.T., Ridker, P.M., 2004. Inflammation as a cardiovascular risk factor.
Circulation 109, II.
Zhang, H., Park, Y., Wu, J., Chen, X., Lee, S., Yang, J., Dellsperger, K.C., Zhang, C.,
2009. Role of TNF-alpha in vascular dysfunction. Clin. Sci. (Lond.) 116, 219.