Journal of Microbiological Methods 75 (2008) 566–571

Contents lists available at ScienceDirect

Journal of Microbiological Methods

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j m i c m e t h

A novel DNA microarray for rapid diagnosis of enteropathogenic bacteria in stool

specimens of patients with diarrhea
Yuanhai You a, Chunxiang Fu b, Xun Zeng a, Daishan Fang b, Xiaomei Yan a,
Baochun Sun b, Di Xiao a, Jianzhong Zhang a,⁎
a
National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, PR China
b
The Centre for Disease Control and Prevention of Shandong Shengli Petroleum Administration, Dongying, PR China

a r t i c l e i n f o a b s t r a c t

Article history: A microarray technique for the detection and identification of enteropathogenic bacteria at the species and
Received 10 July 2008 subspecies levels was developed in this study, and the target bacteria included pathogenic Escherichia coli,
Received in revised form 29 August 2008 Vibrio cholerae, Vibrio parahaemolyticus, Salmonella enterica, Campylobacter jejuni, Shigellae, Yersinia
Accepted 1 September 2008
enterocolitica, and Listeria monocytogenes. The virulence gene of each pathogen was chosen as the
Available online 14 September 2008
amplification target, labeled with a fluorescence dye by multiplex polymerase chain reaction (PCR), and
Keywords:
hybridized to the specific virulence gene probes that had been immobilized on a microchip. Stool specimens
Microarray from 34 patients with diarrhea were tested in this study. Five were positive for multiple genera. Nested PCRs
Enteropathogenic bacteria and sequencing were used to amplify and identify the related genes, which were found to share 95.8% to
Diarrhea 100% of the nucleotide identity with the corresponding regions in the Genbank database. Real-time PCR was
Rapid diagnosis used to determine the number of gene copies to determine the sensitivity of this technique, which was
shown to be 58 copies/μl. The results indicated that the microarray technique which targets multiple
virulence genes of enteropathogenic bacteria at the species and subspecies levels is an attractive diagnostic
tool for rapidly and simultaneously identifying multiple enteropathogenic pathogens in clinical practice,
especially in patients with infectious diarrhea.
© 2008 Elsevier B.V. All rights reserved.

1. Introduction
At present, the widespread occurrence of infectious diarrhea has
become one of the major public health problems worldwide. There-
fore, a rapid response, which includes identification of the pathogens
and prevention of the spread of these pathogens in the community, is
crucial for the control of disease outbreak and case investigations.
Transmission of the pathogens often occurs through the consumption
of contaminated food and water. The most important step for the
prevention and surveillance of infectious diseases is rapid diagnosis
and identification of the pathogen. However, conventional methods for
detecting enteropathogens involve separate culture steps followed by
biochemical identification and serotyping. These methods are cumber-
some and time consuming. Therefore, a rapid, specific, and sensitive
method is required for detecting and identifying the pathogens can be
efficiently.
Over the recent years, microarray technology has been applied to
many sectors of life and medical science including genomic research,
single nucleotide polymorphisms analysis (SNP), and drug discovery
⁎ Corresponding author. National Institute for Communicable Disease Control and
Prevention, Chinese Center for Disease Control and Prevention, P.O. Box 5, Changping,
Beijing 102206, PR China. Tel.: +8610 61739456; fax: +8610 61739439.
E-mail address: zhangjianzhong@icdc.cn (J. Zhang).
(Adelaide et al., 2004; Wu et al., 2003; Burton et al., 2005; Chen et al.,
2005). Correspondingly, there is an increased number of commercial
DNA arrays available for clinical and epidemiological application.
Indeed, microarray analysis has been proven to provide a novel and
unique method of diagnosis, control and prevention of infectious
diseases (Douglas et al., 2003; Lemarchand et al., 2005; Maynard et al.,
2005; Murray et al., 2001; Gonzalez et al., 1997; Purdy et al., 2000). In
the present study, a microarray-based assay was developed and
evaluated for the detection and identification of eight enteropatho-
genic bacteria at the species and subspecies levels.
2. Materials and methods
2.1. Design and manufacture of the DNA microarray
In this study, a total 34 virulence gene probes, according to
different species, subspecies, serogroups and biotypes, were used and
spotted on individual locations of the array (Table 1). The standard
polymerase chain reaction (PCR) mixture (25 μl) contained 1 U of Taq
DNA polymerase, (Tiangen Biotech, Beijing) Co., Ltd, China), 1×
reaction buffer supplemented with 2.0 mM MgCl2 (Tiangen Biotech),
600 nM of each of forward and reverse primers, a 200 mM
concentration of each deoxynucleoside triphosphate (dATP, dGTP,
dCTP, and dTTP, Promega, Madison, Wisconsin, USA), and 1 μl of DNA

0167-7012/$ – see front matter © 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.mimet.2008.09.007
 Y. You et al. / Journal of Microbiological Methods 75 (2008) 566–571 567

Table 1 phoresis and diluted to a final concentration of 500 ng/μl in 50%

Accession numbers of the sequences used for the microarray dimethyl sulfoxide (DMSO). Twenty microliters of each probe were
Species/subspecies (n=8) Gene (n = 34) Accession no. transferred to a 384-well microplate for printing, and spotted on
Escherichia coli amino-coated slides using the GenTAC G3 Robotic Workstation
EHEC O157:H7 rfbE, eaeA, vt1, vt2, S83460, Z36899, Z11541, M36727, (Genomic Solutions, Ann Arbor, USA). The average size of the spots
hlyA X94129 was 250 μm. All probes were distributed in ten macroarrays which
ETEC lt, st AB011677, M25607
contained three marker spots for array positioning at three corners.
EPEC bfpA, eaeA AF304477 Z11541
EIEC ipaH M32063 Positive, negative and blank controls and gene probes were printed in
EaggEC aaF/I Z32523 quadruplicate. A plant's sequence, rbcl, which shares little sequence
Vibrio cholerae identity to those of enteropathogens was used as a positive control,
O1 classic o1ag, ct, rtx, ompw X59554, X51948, AF119150, D30053 and a sequence of a mammal's gene, gpx1, was used as a negative
O1 eltor o1ag, ct, ompw X59554, X51948, D30053
O139 o139ag, ct ,ompw AB012956, X51948, D30053
control. The location of each probe on the glass surface is shown in
Vibrio parahaemolyticus toxR, tl, tdh, trh M36437 M10069 S67850 L11929 Fig. 1 and listed in Table 2. The slide was then rehydrated and heat
Salmonella enterica iroB, invA, spvC U62129 M90846 M78536 dried at 80 °C for 1 h, UV cross-linked in a UV cross linker (Stratagene,
Campylobacter jejuni mapA, ceuE, cdt X80135, X82427, U51121 California, USA) at 250 mJ and washed in 0.2% sodium dodecyl sulfate
S. dysenteriae rfbG U57549
(SDS) for 5 min. Finally, the probe on the glass surface was heat
S. flexneri rfbR NC004337
S. sonnei wzy AF402315 denatured in distilled boiling water for 2 min and allowed to air-dry.
Yersinia enterocolitica yst, yad, virF X13382 U09235 AF102990
Listeria monocytogenes iap, hly, prfA M80351, AF253320, X61210 2.2. Specimen preparation and DNA extraction

A total of 34 stool specimens were collected into sterile containers

template. PCR was performed with a Little Genius Thermocycler
(BIOER Technology Co., Ltd, Hangzhou, China) with the following
conditions: initial activation at 94 °C for 5 min, 30 cycles at 94 °C for
45 s, 56 °C for 45 s, and 72 °C for 45 s, followed by final extension at
72 °C for 5 min. PCR products were purified using a QIAquick PCR
purification column (QIAGEN GmbH, D-40724 Hilden, Germany). All
PCR products were checked for purity by 1.5% agarose gel electro-
from 34 patients exhibiting symptoms of diarrhea during August and
October 2005 in the Hospital of Shandong Shengli Oilfield. The stool
specimen was suspended in 0.9% NaCl with the proportion of about 1:1.
For some thick specimens, more NaCl was required. Then, the
suspended specimen was mixed with ddH2O) at a ratio of 1:1. Genomic
Table 2
Gene position on the microarray

Array position Gene

B2–5 rtx
C2–5 rfbE
D2–5 rfbR
E2–5 Iap
B8–11 o1ag
C8–11 eaeA
D8–11 tl
E8–11 yadA
B26–29 Negative control
C26–29 vt2
D26–29 virF
E26–29 ct
H20–23 aaF/I
K20–23 toxR
H2–5 spvC
I2–5 hlyA
J2–5 mapA
K2–5 rfbG
H8–11 Positive control
I8–11 wzy
J8–11 o139ag
K8–11 yst
H14–17 Negative control
I14–17 ceuE
H20–23 Negative control
I20–23 cdt
I26–29 iroB
B14–17 Negative control
C14–17 lt
D14–17 ipaH
E14–17 hlyO
B20–23 Negative control
C20–23 st
D20–23 ompw
E20–23 prfA
J14–17 vt1
K14–17 trh
J20–23 bfpA
K20–23 tdh
J26–29 invA
Fig. 1. Microarray template showing the identity of each probe listed in Table 1. Marker
spots for array positioning blank control negative control positive control Positive controls: rbcl.
● virulence gene probe. Negative controls: gpx1.
568 Y. You et al. / Journal of Microbiological Methods 75 (2008) 566–571
DNA was extracted by boiling the specimens for 10 min followed by
centrifugation at 4000 rpm for 5 min. Two microliters of the
supernatant containing genomic DNA were used for PCR labeling.
2.3. Multiplex PCR amplification and labeling
DNA prepared from each of the stool specimens was labeled with
Cy5-dUTP (GE, Healthcare Bioscience, Uppsala, SWISS) by a multiplex
PCR system. The reaction was performed in 25 μl of 1 U of Taq DNA
polymerase (Tiangen), 1× reaction buffer with 2.0 mM MgCl2, 600 nM
(each) reverse primer, 200 nM dGTP, dATP, and dCTP, 50 nM dTTP
(Promega), 40 nM Cy5-dUTP(General Electric), and 2 μl of DNA
template. The PCR protocol included an initial activation step at 94 °C
for 5 min followed by 40 cycles at 94 °C for 45 s, 56 °C for 45 s, and
72 °C for 45 s, with a final extension step at 72 °C for 5 min. The
fluorescently labeled products of multiplex PCR were purified by using
the QIAquick PCR purification kit (QIAGEN GmbH), according to the
manufacturer's protocol, then dried in a vacuum, and finally solubilized
in 10 μl of water.
2.4. DNA microarray hybridization and scanning of microarrays
The concentrated Cy5-labeled DNA was resuspended in 90 μl of
hybridization solution consisting of 50% formamide, 3×SSC, 0.1% SDS,
5×Denhardt's solution (Denhardt, 1966), and 0.1 mg/ml salmon sperm
DNA (Stratagene). The labeled DNA was denaturated at 94 °C for 2 min,
quickly chilled on ice and then placed on the slide on the GenTAC
Hybridization Station (Genomic Solutions) and hybridized for 12 h at
42 °C. The hybridized slide was washed once for 3 min in 2 × SSC
containing 0.1% SDS at room temperature, twice for 3 min with 0.1 ×
SSC, 0.1% SDS, and once for 3 min with 0.1× SSC prior to scanning.
Fluorescence images of the enteropathogenic virulence gene chip
were recorded with a GenTAC LS IV scanner (Genomic Solutions).
2.5. Nested PCR, sequencing of PCR products and sequence analysis
The positive spots on the microarray were confirmed by conven-
tional and nested PCR using gene specific primers that directly amplify
DNA prepared from stool specimens. PCR conditions were the same as
previously described in the DNA microarray design and manufacture.
The PCR-amplified DNA fragments were purified by 1.5% electrophor-
esis in an agarose gel, extracted with a QIAquick gel extraction kit
(QIAGEN GmbH) according to the manufacturer's protocol, and
sequenced by Beijing AuGCT Biotechnology Company Ltd (Beijing,
China). Sequence analysis was performed with the program Clustal X
1.8 (InforMax Inc, USA).
2.6. Real-time PCR for the stool specimens
Real-time PCR was performed in the Line Gene Thermal cycler (BIOER
Technology Co., Ltd, Hangzhou, China). Each reaction mixture contained
20 μl of 2×SYBRGreen PCR MasterMix, 200 nmol forward primer and
Table 3
Diagnostic performance of the DNA microarray in 34 stool specimens of patients with diarrhea
Suggested species/ No. of No. of positive diagnostic probes
subspecies/ serotype specimens ipaH wzy mapA ceuE cdt
Enteroinvasive Escherichia coli 2 2
Enterotoxigenic Escherichia coli 5 5
Shigella 3 1 3
Campylobacter jejuni 4 4 3 4
Yersinia enterocolitica 4 2
Salmonella enteric 1 1
Vibrio parahaemolyticus 2 1
Vibrio cholera 3 1
Negative results were obtained in 10 specimens.
reverse primer respectively, 16 μl ddH2O, and 2 μl template DNA. Stool
specimens were heated at 95 °C for 10 min, followed by 40 cycles of
melting at 94 °C for 15 s, annealing at 56 °C for 30 s, and extension at 72 °C
for 30 s. At the end of each PCR run, data were automatically analyzed by
the system and amplification plots were obtained.
3. Results
3.1. Microarray analysis of clinical stool specimens
DNA prepared from the stool specimens of 34 patients with diarrhea
were screened by the microarray. A total of 16 genes were detected in 24
(70.6%) of 34 specimens. Based on the microarray, eight species,
subspecies or serotypes of pathogens were indicated (Table 3), and a
total of six hybridization profiles were identified (Fig. 2). Fig. 2A is the
hybridization profile of specimen 10, which shows that the three specific
genes, mapA (j2–5), ceuE(i14–17) and cdt(i20–23) of Camplylobacter
jejuni, and lt(c14–17) and st(c20–23), which are specific for enterotoxi-
genic Escherichia coli (ETEC), are positive. Other positive genes included
yadA(e8–11), virF(d26–29), hlyA(i2–5), and ct(e26–29). As shown in
Fig. 2B, yst(k8–11), virF(d26–29),wzy(i8–11), hlyA(i2–5), cdt(i20–23),
st (c20–23), and ct(e26–29) are positive for specimen 16. In Fig. 2C for
specimen 3, the specific gene, wzy(i8–11) is positive. Fig. 2D and E shows
ipaH(d14–17) is positive for specimen 22 and specimen 7. In Fig. 2F for
specimen 18, ipaH(d14–17) and wzy(i8–11) are positive. These positive
spots suggest that two enteropathogens might co-exist in five cases, and
three enteropathogens in two cases. Enteroinvasive E. coli (EIEC) was
found positive in two cases, and ETEC was detected in five cases. Other
pathogens detected were C. jujeni (n = 4), Y. enterocolitica (n =4), and
V. parahaemolyticus (n = 2) and S. sonnei (n = 1). (Table 3).
3.2. Confirmation of microarray results
The microarray findings of enteropathogens were subsequently
confirmed by the species or subspecies-specific conventional PCR and
nested PCR from six patients' stool specimens. PCR using specific
primers for these virulence genes yielded 200–500 base pair fragments
(Fig. 3) that were sequenced and found to share 95.8% to 100%
nucleotide identity with the corresponding regions in the GenBank
database. As shown in Fig. 3A, six specific bands were obtained by a
conventional PCR. Lanes b to d were the specific genes mapA, ceuE, and
cdt of C. jejuni, which were all positively amplified from specimen 10.
Lanes l to n were ipaH genes of EIEC amplified from specimen 22,
specimen 7 and specimen 18, respectively. As shown in Fig. 3B, the
negative PCR products virF (specimen 10), hlyA (specimen 16), hlyA
(specimen 10), lt (specimen 16), st (specimen 16), and lt (specimen 10)
were then amplified and produced six specific bands by nested PCR.
3.3. Data and statistical analysis of real-time PCR
Real-time PCR amplification from the stool specimens was carried
out to determine the sensitivity of microarray. The standard curve
lt st yad yst virF ompW ct hlyA toxR tl iroB
4 1 1 1
1 1 2 1 1
1 4 2 2 3 1
2 2
1 3 3
 Y. You et al. / Journal of Microbiological Methods 75 (2008) 566–571 569

Fig. 2. Microarray hybridization for stool specimens. Panels: A, specimen 10, positive for mapA(j2–5), ceuE(i14–17), cdt(i20–23), lt(c14–17), st(c20–23), yadA(e8–11), virF(d26–29),
hlyA(i2–5), and ct(e26–29); B, specimen 16, positive for yst(k8–11), virF(d26–29); wzy(i8–11), hlyA(i2–5), cdt(i20–23), st (c20–23), and ct(e26–29); C, specimen 3, positive for wzy
(i8–11); D, specimen 22, positive for ipaH(d14–17); E, specimen 7, positive for ipaH(d14–17); F, specimen 18, positive for ipaH(d14–17) and wzy(i8–11).

showed a linear relation of each concentration. The threshold cycle
(Ct) of each amplification reaction was calculated based on the first
PCR cycle at which the fluorescence was 10-fold higher than the
standard deviation of the mean baseline emission. The equations for
the standard curve and its corresponding R2 value were as follows:
Ct = −6.08 Lg copy number + 39.95 (R2 = 0.997). The sensitivity was
indicated to be 58 copies/μl. Melt curves for amplicons generated in
the SYBR Green I assay shows a single peak with a Tm of 79.5 °C. This
single peak indicated the specificity of real-time PCR.
4. Discussion
The routinely utilized serologic and biochemical tests for the
identification and typing of pathogens are only limited to the species
or serogroup levels. Diagnostic DNA microarray for pathogenetic
organisms is a new technique that determines multiple genes from
different kinds of pathogens and thus can be used to detect different
species, biotypes, and/or toxins of pathogenic organisms in the same
specimens, which is the major advantage over the conventional PCR
technique that determines only one gene from a hybridization. DNA
microarray is also more sensitive and accurate than the multiplex PCR
(Gary et al., 2005; Keramas et al., 2003).
At present, diagnostic DNA microarray for infectious disease has
been widely studied by many institutions, and the design of the
diagnostic gene chip mainly focuses on two aspects; one is based on
the 16S and 23S rRNA genes, and the other is based on specific
virulence factor genes (Georgios et al., 2004; Korczak et al., 2005;
Porwollik et al., 2002; Sadjia et al., 2003). 16S rRNA and 23S rRNA
microarrays do not directly characterize virulence factors, and thus,
these assays do not provide any information on the potential virulence
or pathogenicity of the organism identified. For the virulence
microarray, there may be a greater difficulty in the interference of
the primers and the preferential amplification than those in the
multiplex PCR. To overcome these shortcomings, optimization should
be done by selecting highly efficient primers and establishing an
appropriate PCR reaction system (Elfath et al., 2000; Panu et al., 1997).
One of the most important challenges in DNA microarray is the design
of the primers, which can be overcome by the following measures.
First, the annealing temperature must be identical for all primers.
Second, the length of all PCR products must be kept as equal as
possible. Finally, the nonspecific false pairing of these primers must be
kept at a minimum. All these requirements make it very difficult to
design and select a primer with a high specificity and amplification
efficiency. In this study, the 34 pairs of primers were selected based on

Fig. 3. Conventional PCR and nested PCR for the confirmation of the results obtained by microarray technique by using specific primers followed by separation of PCR products in a 1.5%
agarose gel. (A). Lanes: a, 100-bp DNA ladder mix; b, mapA (specimen 10); c, ceuE (specimen 10); d, cdt (specimen 10); e, hlyA (specimen 10); f, lt (specimen 10); g, st (specimen10);
h, virF (specimen 10) ; i, lt (specimen 16) ; j, st (specimen 16) ; k, hlyA (specimen 16) ; l, ipaH (specimen 22); m, ipaH (specimen7); n, ipaH (specimen18); o, yst (specimen16); p, cdt
(specimen16); (B). Lanes: a, 100-bp DNA ladder mix; b, virF (specimen 10); c, hlyA (specimen 16); d, hlyA (specimen 10); e, lt (specimen 16); f, st (specimen 16); g, lt (specimen 10);
h, wzy (specimen 3).
570 Y. You et al. / Journal of Microbiological Methods 75 (2008) 566–571

previous experiments that showed that these 34 pairs of primers were Table 4
the most specific and efficient primers, and that the PCR products Enteropathogen primers

amplified from these primers were appropriate as the probes immobi- Oligonucleotide primer Sequence
lized on the microarray (Table 4). In addition, a housekeeping gene was ct GGCATACAGTCCTCATCCAG
selected for each species, which makes the results more reliable ACTTTGGGTTTTTTCATCGC
Each virulence gene encodes an important factor for the patho- o1ag TAGACCCGCAGAGGTAGAAA
TCATCGCCTTGAGTTATTCC
genecity of a specific pathogen. First, we selected five specific primers
rtxC TAGGTGGTGTGATGCTGCT
based on the virulent gene of V. cholerae, i.e. ompW, o1ag, o139ag, ct GCACCTTTCGGATACAGC
and rtx. We used ompW, which is a species specific gene encoding an o139ag GTGGTCTATGGGTTGATGATG
outer membrane, to identify whether the pathogen is V. cholerae. Then, AATGGATAAGGGCGTTGG
o1ag and o139ag were used to determine the serogroup. rtx, which ompW CCACCTACCTTTATGGTCC
GAACTTATAACCACCCGCG
encodes a toxin repeated regulated factor, was used to determine st AAGCGAGTGCACCTCGACAT
whether the pathogen belongs to O1 classic or to O1 Eltor. Finally, we ATGGAGCACAGGCAGGATTAC
used ct to identify whether this pathogen produces cholerae lt GGCGACAGATTATACCGTGC
enterotoxin. Therefore, we would be able to identify the enteropatho- CGGTCTCTATATTCCCTGTT
eaeA ACTATACTCCGATTCCTCTGG
gen simultaneously at the species, subspecies, serogroup, biotype and
GCTTTGGCTTCCGCTAT
subtype levels and to determine its capacity of toxin production and rfbE AGATTGCGCTGAAGCCTTTG
invasion using one simple hybridization test. As shown in Fig. 2A, a TCTTTCCTCTGCGGTCCTAG
hybridization profile of specimen 10, three probes mapA(j2–5), ceuE vt1 TGATTGATAGTGGCACAGGG
(i14–17) and cdt(i20–23) of C. jejuni were all positive. These genes ACAGTAACAAACCGTAACATCG
vt2 GCCTTCTAAGCAATCGGTC
were all specific for C. jejuni and were absent in C. coli and other related
GATAGACATCAAGCCCTCGT
campylobacters. CeuE and cdt are two virulence factors which play an ipaH ACGGACAACAGAATACACT
important role in infection and pathogenecity (Urs et al., 1995;). Lt CTGATGGACCAGGAGG
(c14–17) and st(c20–23), which are the toxin genes of ETEC, encode aaF/I TATTATAAGGACGGCACAAC
AGTATCGCCCAGACACG
heat-liable and heat-stable enterotoxin respectively. ETEC strains that
bfpA GAAATACGAAAAAGGTCTGTCT
produce enterotoxins are a significant cause of morbidity and CGCTTCAGCAGGAGTAATAG
mortality. YadA(e8–11) and virF(d26–29), which are toxin genes of hlyA AGTAAAATAGGAAGAACCGC
Yersinia, encode Yersinia adhesion and virulence related factor, GGACTGATAGCCAGCATAAC
respectively. These results suggested that specimen 10 likely harbored mapA TTCTTGTGAAAGTCCTGGTGGTT
GTACATCTTGCTTGGTGCGGATT
multiple pathogens including C. jejuni, ETEC and Y. enterocolitica. As
cdt AGAACAGCCACTCCAACAGG
shown in Fig. 2D and E, ipaH gene of EIEC was positive, and in Fig. 2F, GTCCCTCCGCTTGCTTG
ipaH(d14–17) and wzy(i8–11) were all positive in specimen 18, ceuE CGCTTTGAGATTATTCACGATG
suggesting that specimen 22 and specimen 17 likely harbored EIEC., AGAGACTAGCCCTTGCGAAGTT
tl GCAAGGTTACAACATCACG
but specimen 18 probably harbored S. sonnei.
ACGCTTTACCAGTCTTTAGG
We identified three specific gene probes including rfbG, rfbR and wzy tdh TTCCATCTGTCCCTTTTCCT
that can best detect Shigella at the species level, after a large scale CTTGACCTGATTTTACGAACAC
screening. We used ipaH gene probe to detect EIEC; however, since trh ATTGACCTGCCATCCATAC
Shigella also harbored ipaH, we combined rfbG, rfbR and wzy with ipaH TTCTCACCAACGAAATCACTAAC
toxR GTCTTCTGACGCAATCGTTG
as the detection criteria for Shigella. At present, research work for some
ATACGAGTGGTTGCTGTCATG
bacteria is not as extensive as that of V choleara at the molecular level, yad ATCTGCGTTGTTCTCATCTC
thus it is difficult to find specific virulence genes for microarray GTAACTGCCGAATCTCCC
development. Therefore, we believe that for those bacteria that can yst TTGAAATAACTAGGCTGGGTCG
CACTGAACTGCCCTGAAACTG
hardly be identified based on the sequences or nucleic acid, the
virF GGCAGAACAGCAGTCAGACATA
microarray technique has an advantage of being rapid and large scale, GGTGAGCATAGAGAATACGTCG
and thus, our array is indeed intended as a rapid high-throughput iroB TGGTTTCGATTCGGAAGCGG
screening tool only. TGGCGGCGGTAGGCGTTAG
In this study, the target labeling was based on multiplex PCR. invA GCTCTTTCGTCTGGCATT
TTCCACTGCGATAACGG
Although the primer system has been optimized after numerous
spvC GTAGCTGCTTATGATGGG
experiments, it is impossible to keep the amplification efficiency to an GAGGTGTTCTGTGCCGTTA
equal level for all PCRs. In addition, the so-called preferential rfbR GCATTCCTTGCTCTATCCTCAC
amplification caused by competitive inhibition among the primers is AAGCCGATGTTTCTAAATGCGT
a common problem in multiplex PCR, resulting in varied amount of the rfbG TCTTATTCCATCCAGCGTAGCC
GCCGTATTCGCAATGAGTTT
PCR product and thus different labeling efficiency to some extent. On wzy TTCTTTTTCTGGATAGCCGAGC
the other hand, the amount of different bacteria in a sample may affect CCAATAATCCCTAACTGAGCCG
the performance of different gene probes, and thus contribute to the Iap CAAACTGCTAACACAGCTACT
labeling efficiency. Moreover, alternations or mutations of the genomes TCAGCAATAATAGCACTTGCA
hlyO ACTGCGTTGTTAACGTTTGA
of these bacteria may have occurred during evolution and infection.
TCCGCCTGCAAGTCCTAAGA
Our microarray was intended to be used as a rapid high-throughput prfA AACATCGGTTGGCTAT
screening tool in this study. The results of such microarray should be TCTTTGAGGACTACCGTA
interpreted with many factors under consideration. For example, if the gpx1 GTCGCTCTGAGGCACAAC
housekeeping gene and some virulence genes of one bacterium are CATTTGCGCCATTCACCTC
rbcl AATCTTCTACTGGTACATGGAC
positive on the microarray, and confirmed by nested PCR and TCATCATCTTTGGTAAAATCAAG
sequencing, the probability of the existence will be very high. However,
for some bacteria such as EIEC, for which there are not many specific
probes, the single virulence gene may be still significant in high-
throughput screening.
 Y. You et al. / Journal of Microbiological Methods 75 (2008) 566–571
At present, purified culture bacteria are used as the detection
specimens for microarray in most experiments. However, the sensitivity
and positive predictive value of the culture would be low compared with
the nested PCR due to false negative results caused by death of bacteria
since most patients had been treated with antibiotics before admission
to the hospital. In the present study, we tested stool specimens of 34
patients with diarrhea, and the results were confirmed with the
currently available “standard” methods. Conventional PCR is used
routinely to detect genetic information of microorganisms, but since
some specimens may harbor more than one pathogen, we combined
nested PCR with conventional PCR to confirm the results of microarray.
We believe that this confirmatory approach is accurate and convenient.
In addition, real-time PCR further demonstrated that the sensitivity
of the microarray detection was 58 copies/μl. The major advantage of
this microassay technique over the different PCR assays is that multiple
pathogens from different or same species can be simultaneously
identified on a single specimen. In addition, this microarray technique
is more flexible than PCR assays. One PCR reaction can only produce
one or several gene products, but microarray can detect dozens of gene
products through one hybridization test with high sensitivity.
Infectious diarrhea is caused by various bacteria, viruses or
parasites. At present, no accurate and efficient methods are available
to identify the pathogens. Therefore, the DNA microarray we validated
in the present study may be further combined with virus-specific
probes to develop an even more robust tool for diagnosis of these
pathogenic microorganisms of infectious diarrhea in one chip. Recently,
Lodes et al. (2007) developed a new tool for identification of upper
respiratory tract pathogens using electrochemical detection on an
oligonucleotide microarray. Many other methods based on nucleic acid,
such as solid phase PCR microarray and multiplex PCR have also been
developed (Lodes et al., 2007), however, specific probe selection is still
an important and challenging step that needs further investigation.
In conclusion, we established an enteropathogen gene microarray
technique that includes 34 virulence genes from eight enteropathogen
species and successfully applied this technique to identify the pathogens
in stool specimens from patients with diarrhea. Our findings indicate
that this technique has the potential to become an efficient approach for
rapid detection and identification of enteropathogens. In addition, our
findings suggest that microarray techniques can also be used for
characterization of viral and bacterial infections or contamination in a
variety of sources, including food products and environmental and
clinical specimens, and thus can be a useful platform for identification
and characterization of infectious pathogens.
Acknowledgments
We thank Dr Wei Guo for the optimization of microarray manu-
facture process.
Financial support. This study was supported by the Program on
Research for Public Good, R&D Infrastructure and Facility Develop-
ment, the Ministry of Science and Technology of P. R. China (grant
name: Establishment of a fast appraisal system for the safety of food
imports and exports).
571
References
Adelaide, E., Melissa, J., Stacey, L., Danielle, R., Frank, J., Douglas, R., 2004. Simultaneous
discrimination between 15 fish pathogens by using 16S ribosomal DNA PCR and
DNA microarrays. Appl. Environ. Microbiol. 70, 4216–4221.
Burton, J., Oshota, O., North, E., Hudson, M.J., Polyanskaya, N., Brehm, J., Lloyd, G., Silman,
N.J., 2005. Development of a multi-pathogen oligonucleotide microarray for
detection of Bacillus anthracis. Mol. Cell. Probes 19, 349–357.
Chen, S., Zhao, S., McDermott, P., Schroeder, C., White, D., Meng, J., 2005. A DNA
microarray for identification of virulence and antimicrobial resistance genes in
Salmonella serovars and Escherichia coli. Mol. Cell. Probes 19, 195–201.
Denhardt, D., 1966. A membrane filter technique for the detection of complementary
DNA. Biochem. Biophys. Res. Commun. 23, 641–652.
Douglas, R., Marlene, K., Melissa, J., Marilyn, C., 2003. Identifying antimicrobial
resistance genes with DNA microarrays. Antimicrob. Agents Chemother. 47,
3290–3295.
Elfath, M., Ahmed, M., Robert, J., Paul, E., 2000. Multiplex PCR: optimization and
application in diagnostic virology. J. Clin. Microbiol. Rev. 13, 559–570.
Gary, J., Carolyn, E., Michele, M., Cheryl, A., Joanne, D., David, A., 2005. Nucleic acid
amplification strategies for DNA microarray-basedpathogen detection. PNAS 102,
19109–19114 2.
Georgios, K., Dang, D., Mariann, L., Henrik, 2004. Use of cultureanalysismicroarrays for
detection of Campylobacter jejuni and Campylobacter coli chicken feces. J. Clin.
Microbiol. 43, 3985–3991.
Gonzalez, I., Grant, K., Richardson, P., 1997. Specific identification of the enteropatho-
gens Campylobacter jejuni and Campylobacter coli using a PCR test based on the
ceuE gene encoding a putative virulence determinant. J. Clin. Microbiol. 35,
759–763.
Keramas, G., Bang, D.D., Lund, M., Madsen, M., Rasmussen, S.E., Bunkenborg, H.,
Telleman, P., Christensen, C.B., 2003. Development of a sensitive DNA microarray
suitable for rapid detection of Campylobacter spp. Mol. Cell. Probes 17, 187–196.
Korczak, B., Frey, J., Schrenzel, J., Pluschke, G., Pfister, R., Ehricht, R., Kuhnert, P., 2005.
Use of diagnostic microarrays for determination of virulence gene patterns
Escherichia coli major cause of neonatal meningitis. J. Clin. Microbiol. 43, 1024–1031.
Lemarchand, K., Berthiaume, F., Maynard, C., Harel, J., Payment, P., Bayardelle, P.,
Masson, L., Brousseau, R., 2005. Optimization of microbial DNA extraction and
purification from raw wastewater samples for downstream pathogen detection by
microarrays. J. Microbiol. Methods 63, 115–126.
Lodes, M.J., Suciu, D., Wilmoth, J.L., Ross, M., Munro, S., et al., 2007. Identification of
upper respiratory tract pathogens using electrochemical detection on an oligonu-
cleotide microarray. PLoS ONE 2 (9), e924. doi:10.1371/journal.pone.0000924.
Maynard, C., Berthiaume, F., Lemarchand, K., Harel, J., Payment, P., Bayardelle, P.,
Masson, L., Brousseau, R., 2005. Waterborne pathogen detection by use of
oligonucleotide-based microarrays. Appl. Environ. Microbiol. 71, 8548–8557.
Murray, A., Lies, D., Li, G., Nealson, K., Zhou, J., Tiedje, J.M., 2001. DNA/DNA hybridization
to microarrays reveals gene-specific differences between closely related microbial
genomes. PNAS 98, 9853–9858.
Panu, H., Aila, M., Jukka, Y., J. Jarmo, W., 1997. Use of multiplex PCR for simultaneous
detection of four bacterial species in middle ear effusions. J. Clin. Microbiol. 35,
2854–2858.
Porwollik, S., Wong, R., McClelland, M., 2002. Evolutionary genomics of Salmonella:
gene acquisitions revealed by microarray analysis. Natl. Acad. Sci. U. S. A. 99,
8956–8961.
Purdy, D., Buswell, C., Hodgson, A.E., Mcalpine, K., Henderson, I., Leach, S.A., 2000.
Characterisation of cytolethal distending toxin (CDT) mutants of Campylobacter
jejuni. J. Med. Microbiol. 49, 473–479.
Sadjia, B., Roland, B., Luke, M., Gabrielle, P., John, F., Josée, H., 2003. Rapid identification
of Escherichia coli pathotypes by virulence gene detection microarrays. J. Clin.
Microbiol. 41, 2113–2125.
Urs, S., Joachim, F., Jacques, N., André, P.B., 1995. Identification of Campylobacter jejuni
the basis of a species-specific gene that encodes a membrane protein. J. Clin.
Microbiol. 33, 855–859.
Wu, C., Valdes, J., Bentley, W., Sekowski, J., 2003. DNA microarray for discrimination
between pathogenic o157:H7 EDL933 and non-pathogenic Escherichia coli strains.
Biosens. Bioelectron. 19, 1–8.