[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.

113]

Original Article

miR‑22‑3p Ameliorates the Symptoms of Premature Ovarian

Failure in Mice by Inhibiting CMKLR1 Expression
Miaomiao Pan1,2*
1
The First College of Clinical Medical Science, China Three Gorges University, Yichang, China, 2Department of Gynecology, Central People's Hospital of Yichang,
Yichang, China

Abstract
Premature ovarian failure (POF) affects many adult women less than 40 years of age and leads to infertility. This study was aimed at exploring
the improving effects of miR‑22‑3p on the symptoms of POF in mice by inhibiting chemokine‑like receptor 1 (CMKLR1) expression. Female
mice were intraperitoneally injected with cyclophosphamide to construct POF mice models. Lentiviral vectors containing miR‑22‑3p, short
hairpin RNA (sh)‑CMKLR1, and overexpression (oe)‑CMKLR1, respectively, or in combination, were injected into the ovaries of both sides
of POF mice. miR‑22‑3p and CMKLR1 expression in ovarian tissues of mice was assessed, and the targeting relationship between miR‑22‑3p
and CMKLR1 was predicted and verified. Serum estradiol (E2), anti‑Mullerian hormone, and follicle‑stimulating hormone levels were assessed.
Ovarian weight was weighed, and pathological changes and the number of primordial follicles, primary follicles, secondary follicles, and atresia
follicles were observed. Apoptosis of ovarian tissues was determined. In ovarian tissues of POF mice, miR‑22‑3p expression was decreased
while CMKLR1 expression was increased. miR‑22‑3p up‑regulation or CMKLR1 down‑regulation restored sex hormone levels, improved
ovarian weight and the number of primordial follicles, primary follicles, and secondary follicles, and reduced the number of atresia follicle and
ovarian granulosa cell apoptosis in POF mice. miR‑22‑3p targeted CMKLR1, and overexpressing CMKLR1 reversed the ameliorative effects
of miR‑22‑3p overexpression on POF mice. Our research highlights that overexpressed miR‑22‑3p down‑regulates CMKLR1 to ameliorate
the symptoms of POF in mice. Therefore, the miR‑22‑3p/CMKLR1 axis could improve the symptoms of POF.

Keywords: Ameliorative effects, apoptosis, chemokine‑like receptor 1, follicle counts, microRNA‑22‑3p, ovarian weight, premature
ovarian failure, sex hormone levels

Introduction proliferation, development, apoptosis, tumorigenesis, and

hematopoiesis.[6] miRs are found to exert regulatory functions
Premature ovarian failure (POF) is usually utilized to
in oocyte maturation and ovarian follicular development, and
describe women less than 40 years of age, who present with
miRs are differentially expressed in the plasma of POF patients
hypergonadotropic hypogonadism, amenorrhea, as well as
and normal cycling women.[7] Extensive evidence has shown
infertility.[1] The incidence of POF is elevated year by year,
that miRs play a role in the pathology of epithelial ovarian
which seriously influences the patients’ physical and mental
cancer (EOC), and many miRs are differentially expressed
health and enhances the economic burden on families and
in EOC.[8] It is also reported that miRs play important roles
society.[2,3] Reasons for POF involve some genetic diseases,
in initiating and developing female infertility‑associated
autoimmunity disorders, and environmental factors.[4] Despite
diseases.[9] Furthermore, miRNAs are regarded as a group
achievements in human infertility diagnosis and treatment,
of key regulatory elements after transcription in POF, a
POF is still classified as being idiopathic in 50%–80% of cases,
common medical condition accompanying intricate molecular
strongly indicating a genetic source for the disease.[5]
MicroRNAs (miRs) can mediate posttranslational silencing *Address for correspondence: Dr. Miaomiao Pan,
of the genes associated with the modulation of differentiation, The First College of Clinical Medical Science, China Three Gorges University,
Department of Gynecology, Central People's Hospital of Yichang, Yiling
Received: 10‑Jan‑2023 Revised: 15‑Mar‑2023 Accepted: 27‑Mar‑2023 Avenue, Yichang, China.
Published: 06-Jul-2023 E‑mail: panmiaomiao172@163.com

Access this article online This is an open access journal, and articles are distributed under the terms of the Creative
Commons Attribution‑NonCommercial‑ShareAlike 4.0 License, which allows others to remix,
Quick Response Code:
tweak, and build upon the work non‑commercially, as long as appropriate credit is given and
Website: the new creations are licensed under the identical terms.
www.cjphysiology.org
For reprints contact: WKHLRPMedknow_reprints@wolterskluwer.com

DOI: How to cite this article: Pan M. miR-22-3p ameliorates the symptoms of
10.4103/cjop.CJOP-D-23-00004 premature ovarian failure in mice by inhibiting CMKLR1 expression. Chin
J Physiol 2023;66:200-8.

200 © 2023 Chinese Journal of Physiology | Published by Wolters Kluwer - Medknow

[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.113]
Pan: miR‑22‑3p/CMKLR1 axis functions in POF
mechanisms.[10] It has been demonstrated that miR‑22‑3p has an
association with POF.[6] It is confirmed that miR‑22‑3p can act
as an indicator of resistance to platinum‑based chemotherapy,
thus benefiting chemotherapeutic efficiency improvement
and personalized treatment optimization in high‑grade serous
ovarian cancer.[11]
Chemokine‑like receptor 1 (CMKLR1) refers to a G
protein‑coupled receptor involved in multiple forms of human
arthritis and macrophage‑mediated inflammation.[12] Chemerin,
abundantly expressed in barrier tissues, has been reported
to modulate tissue inflammation via mediating CMKLR1,
its functional receptor.[13] Chemerin is one multifunctional
adipokine possessing established functions in adipogenesis,
inflammation, and glucose homeostasis. [14] In addition,
chemerin serves as a cytokine that captures much attention
in the reproductive process, and the chemerin/CMKLR1
axis might play a critical role in maintaining early pregnancy
probably by modulating ERK1/2 phosphorylation.[15] A
previous study has indicated that the chemerin/CMKLR1
axis could be associated with steroidogenesis alterations in
polycystic ovarian syndrome human‑luteinized granulosa
cells.[16] In addition, the chemerin‑CMKLR1 axis regulates
placental progression and spiral artery remodeling in
early pregnancy. [17] However, the improving effects of
the miR‑22‑3p/CMKLR1 axis in POF have been rarely
investigated. Therefore, we designed this study to validate
the role of the miR‑22‑3p/CMKLR1 axis in the symptoms of
POF and our hypothesis was that the miR‑22‑3p/CMKLR1
axis could improve the symptoms of POF.
Materials and Methods
Ethics statement
All animal experiments were conducted in strict accordance
with the guidelines for the care and utilization of laboratory
animals. The study was ratified by Central People's Hospital
of Yichang (approval number: 20210107). All measures were
taken for minimizing animal suffering.
Animal model establishment and treatment
A total of 48 female C57BL/6 mice, aged 10 weeks, were
randomly grouped into 8 groups: the Control group, the POF
group, the miR‑negative control (NC) group, the miR‑22‑3p
group, the short hairpin RNA (sh)‑NC group, the sh‑CMKLR1
group, the miR‑22‑3p + overexpression (oe)‑NC group, and
the miR‑22‑3p + oe‑CMKLR1 group, 6 mice in each group.
All mice were kept at a constant temperature of 26 ± 2°C,
with a 12/12 h (light/dark) photoperiod, and supplied with
water and feed on demand. In addition to the Control group,
the other 7 groups were set up according to the following
protocol to establish POF animal models.[18] The mice were
intraperitoneally injected with cyclophosphamide (CTX) at
a loading dose of 50 mg/kg for 15 consecutive days. After
completing the last CTX injection, mice in the POF group
were then injected with 5 μL of saline into ovaries on both
sides, while the other groups, based on the grouping, were
Chinese Journal of Physiology ¦ Volume 66 ¦ Issue 4 ¦ July-August 2023
correspondingly interjected with 5 μL of lentiviral vectors
containing miR‑22‑3p, sh‑CMKLR1, oe‑CMKLR1, and their
NC lentiviral vectors into the ovaries on both sides.[19,20] All
the above‑mentioned recombinant lentiviral vectors were
obtained from Shanghai GenePharma Co., Ltd. (Shanghai,
China). pLenti‑miR‑22‑3p, pLenti‑sh‑CMKLR1, and
pLenti‑oe‑CMKLR1 were cotransfected into 293T cells with
the helper vectors psPAX2 and pMD2 using Lipofectamine
3000 reagent (Invitrogen, USA), resulting in the production
of the corresponding lentiviral particles. After 48 h of
incubation, the virus‑containing supernatant was collected,
filtered through 0.45 μm cellulose acetate filters, and stored for
experiments. Next, the titer of the recombinant lentivirus was
1 × 108 TU/mL. On the 45th d after completion of all injections,
the specimens of the tail vein blood were collected from each
mouse, stratified at room temperature, and centrifuged at
2800 rpm/min (10 cm radius), and the supernatant was isolated
and preserved at ‑80℃ for further use. After blood collection,
the mice were dislocated by the neck and euthanatized, and
the ovarian tissues of both sides were taken by dissection. The
right side was fixed in 4% paraformaldehyde and the left side
was stored at ‑80℃ for future use.
Detection of sex hormone levels
The levels of estradiol (E2), anti‑Mullerian hormone (AMH),
and follicle‑stimulating hormone (FSH) were tested using ELISA
kits (Mybiosource, USA) according to the instructions. Briefly,
50 μL of mouse serum was supplemented to each well and
cultured at 37°C for 60 min. After the reaction, the wells were
washed 3 times with washing buffer, and then enzyme‑labeled
antibodies were supplemented to each well and cultured at 37°C
for 60 min. Finally, the stop buffer was supplemented and the
optical density (OD) was assessed at 450 nm.[21]
Ovarian weight and follicle counts
The ovaries were harvested and the fatty tissue was removed.
Then the blood was aspirated from the surface of the ovaries
using filter paper, and the ovaries were weighed. Next, the
ovarian tissues were fixed in 4% paraformaldehyde for 24 h
and dehydrated. Following, these tissues were embedded in
paraffin, sliced into 5‑μm‑thick sections, and put on numbered
slides. For observing the morphological changes in mice’s
ovarian tissues, the prepared tissue sections were stained using
hematoxylin and eosin (HE) (Servicebio, Wuhan, China),
and these stained sections were observed under a microscope
to determine follicle counts.[22] The primordial follicle only
contained a single layer of spindle‑shaped granulosa cells; the
primary follicle had a single layer of granulosa cells with at
least three columnar granulosa cells; the secondary follicle had
at least two layers of granulosa cells, and the sinus follicle had
at least two layers of granulosa cells with the follicular lumen.
Terminal deoxynucleotidyl transferase‑mediated
deoxyuridine triphosphate nick end labeling staining
TUNEL assay was conducted to detect apoptosis according
to the manufacturer’s instructions. Paraffin sections were
dewaxed for 60 min at 60°C and gradually rehydrated with
201
[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.113]
Pan: miR‑22‑3p/CMKLR1 axis functions in POF
ethanol (100%, 90%, 80%, and 75%). The slides were rinsed
with phosphate‑buffered saline (PBS) (3 times for 5 min)
and cultured with proteinase K for 25 min at 37°C. After
drying, the slides were added with sufficient rupture solution,
incubated at room temperature for 20 min, and rinsed again
with PBS (3 times for 5 min). Then suitable microliters of
terminal deoxynucleotidyl transferase (TdT) and deoxyuridine
triphosphate (dUTP) enzyme reaction mixture (TUNEL Kit,
Roche, Basel, Switzerland) were supplemented to cover the
samples, and the entire setup was cultured for 2 h at 37°C in a
dark humid atmosphere and rinsed 3 times for 5 min in PBS.
Next, DAPI (Servicebio, Wuhan, China) was utilized to stain
the nuclei for 10 min in the dark. Apoptotic cells in the ovaries
were observed with a fluorescence microscope (ECLIPSE C1,
Nikon, Japan).
Reverse transcription‑quantitative polymerase chain
reaction
Total RNA was isolated by TRIzol reagent (Invitrogen,
USA). RNA was reverse‑transcribed into cDNA strands
following the instructions of the Mir‑X miR First‑Strand
Synthesis kit (Takara, Dalian, China) or PrimeScript RT
reagent kit (Takara). Next, reverse transcription‑quantitative
polymerase chain reaction (RT‑qPCR) analysis of gene
expression was conducted utilizing cDNA and SYBR Premix
Ex Taq II (Takara). RT‑qPCR was conducted on a CFX96
system (Bio‑Rad, Hercules, CA, USA), implementing U6 or
β‑actin as internal references. Relative gene expression was
calculated utilizing the 2−ΔΔCt method. The primer sequences
implemented in this research were displayed in Table 1.
Western blot
Total protein was isolated using RIPA lysate and protein
concentration was tested by implementing the Bicinchoninic
Acid assay (Beyotime, Shanghai, China). Protein samples
were separated by 10%–12% SDS‑PAGE, transferred
to nitrocellulose membranes (Millipore, St. Louis, MO,
USA), and incubated with primary antibodies. These
Table 1: Primer sequences for genes used in reverse
transcription‑quantitative polymerase chain reaction
assay
Gene Sequence
miR‑22‑3p Forward: 5’‑AAGCTGCCAGTTGAAGAACTGT‑3’
Reverse: Reverse universal primers
U6 Forward: 5’‑CAGCACATATACTAAAATTGGAACG‑3’
Reverse: 5’‑ACGAATTTGCGTGTCATCC‑3’
CMKLR1 Forward: 5’‑CAAGCAAACAGCCACTACCAG‑3’
Reverse: 5’‑AAGTAGCCAAAGCCATCAGAGTA‑3’
Bax Forward: 5’‑GGAGATGAACTGGATAGCAATATGG‑3’
Reverse: 5’‑GTTTGCTAGCAAAGTAGAAGAGGGCG‑3’
Bcl‑2 Forward: 5’‑GATGACTTCTCTCGTCGCTAC‑3’
Reverse: 5’‑GAACTCAAAGAAGGCCACAATC‑3’
β‑actin Forward: 5’‑GTATCCATGAAATAAGTGGTTACAGG‑3’
Reverse: 5’‑GCAGTACATAATTTACACAGAAGCAAT‑3’
miR‑22‑3p: MicroRNA‑22‑3p, CMKLR1: Chemokine‑like receptor 1
202
primary antibodies were utilized: CMKLR1 (1:500, Abcam,
Cambridge, MA, USA) and β‑actin (1:1000, Cell Signaling
Technology, Danvers, MA, USA). Bands were visualized with
a chemiluminescence kit (Millipore) and then quantified by
densitometric analysis (Bio‑Rad, USA).[23]
Luciferase activity assay
To validate the targeting relationship between miR‑22‑3p
and CMKLR1, the downstream regulatory site of miR‑22‑3p
was predicted. The 3’‑UTR sequence of the CMKLR1
gene (wild type, WT) was amplified, and the mutant
sequence of the 3’‑UTR binding site of miR‑22‑3p and
CMKLR1 gene (mutant, Mut) was synthesized and cloned
into pGL3‑Control vector (Promega, Madison, WI, USA),
respectively, and then cotransfected with miR‑22‑3p mimic
and mimic NC, respectively, into mouse ovarian granulosa
cells (Wuhan Procell Life Science and Technology Co., Ltd.,
Wuhan, China). To detect dual luciferase activity, a dual
luciferase assay kit (Promega) was utilized.[24]
Statistics
SPSS 22.0 software (SPSS, Inc., IBM, Armonk, New York,
NY, USA) and GraphPad Prism 6 (GraphPad Software,
San Diego, CA, USA) were utilized for statistical analysis.
All experimental data were expressed as mean ± standard
deviation, and a t‑test was applied for comparison between the
two groups. P < 0.05 is an indicator of statistically significant
differences.
Results
Successful establishment of premature ovarian failure
mouse models
The main causes of POF include genetic, immunological,
medical (chemotherapy and radiotherapy), and other
idiopathic factors. With the development and application of
chemotherapeutic drugs, the incidence of chemotherapy‑induced
POF is increasing, and among the various chemotherapeutic
drugs, CTX possesses strong reproductive toxicity.[18,25]
Therefore, we implemented the intraperitoneal injection
of the CTX method to induce POF models. The main
manifestations of POF were apoptosis of ovarian granulosa
cells, shortening of ovarian atresia, disturbance of sex hormone
secretion, and structural and functional damage to ovarian
tissues. Therefore, we conducted ELISA to measure the
levels of serum sex hormones (E2, FSH, and AMH) in mice,
and HE staining was performed to observe the changes in
histopathological characteristics and the number of follicles at
each stage (primordial follicles, primary follicles, secondary
follicles, and atresia follicles) in mice’s ovaries. Apoptosis in
ovarian tissues was assessed by TUNEL staining. The results
revealed that E2 and AMH levels were lower [Figure 1a and b]
and FSH was higher in POF mice compared with those in
normal mice [Figure 1c]. The weight of ovaries in POF mice
was reduced in comparison to normal mice [Figure 1d]. It was
found by HE staining that, follicles of different developmental
stages were visible in the ovaries of normal mice under
Chinese Journal of Physiology ¦ Volume 66 ¦ Issue 4 ¦ July-August 2023
[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.113]

Pan: miR‑22‑3p/CMKLR1 axis functions in POF

a b c d

e f g

h i j
Figure 1: Successful establishment of POF mouse models. (a‑c) The levels of E2, AMH, and FSH in normal and POF mice were determined by ELISA. (d)
The ovarian weight of normal and POF mice was weighed. (e) HE staining results of ovarian tissues in normal and POF mice (arrows indicate developing
follicles). (f) The number of follicles at each stage in normal and POF mice was observed under a microscope. (g and h) The expression levels of
apoptotic genes Bax and Bcl2 and their ratios in normal and POF mice were measured by RT‑qPCR. (i and j) Ovarian cell apoptosis rate in normal
and POF mice was assessed by TUNEL staining (arrows indicate apoptotic ovarian cells); n = 6. *versus P < 0.05. miR‑22‑3p: MicroRNA‑22‑3p,
CMKLR1: Chemokine‑like receptor 1, RT‑qPCR: Reverse transcription‑quantitative polymerase chain reaction, POF: Premature ovarian failure.

the microscope, with more primordial follicles and normal
follicle morphology, while the number of primordial follicles,
primary follicles, and secondary follicles in the ovaries of
POF mice was reduced and the number of atresia follicles was
elevated [Figure 1e and f].
RT‑qPCR findings displayed that Bax expression was raised
and Bcl2 expression was reduced [Figure 1g], and the Bax/Bcl2
ratio was raised [Figure 1h] in POF mice in comparison to
normal mice. Cell apoptosis was tested by TUNEL staining,
and it was found that the apoptosis rate in POF mice was
elevated versus normal mice [Figure 1i and j]. The above
results demonstrated that POF model mouse models were
successfully established.
miR‑22‑3p overexpression ameliorates the symptoms of
premature ovarian failure in mice
A previous study has reported that miR‑22‑3p expression is
down‑regulated in the plasma of POF patients.[26] To further
probe the role of miR‑22‑3p in POF mice, we performed
RT‑qPCR to detect miR‑22‑3p expression in the ovaries of
POF mice and found that the POF mice had reduced miR‑22‑3p
expression in the ovaries versus normal mice [Figure 2a].
To probe the effects of miR‑22‑3p up‑regulation on the ovaries
of POF mice, lentivirus containing miR‑22‑3p was injected
into the ovaries of both sides of POF mice, and RT‑qPCR
demonstrated that miR‑22‑3p was significantly elevated in
the ovarian tissues of POF mice [Figure 2b]. Subsequently,
we measured serum sex hormone (E2, FSH, and AMH) levels
in POF mice by ELISA, and the findings suggested that the
contents of sex hormones E2 and AMH were raised [Figure 2c
and d] and FSH levels were decreased [Figure 2e] in POF
mice after miR‑22‑3p overexpression. Moreover, the ovaries
were weighed and HE staining was utilized to observe the
pathological changes in the ovaries. The ovarian mass of POF
mice was larger after overexpressing miR‑22‑3p [Figure 2f], and
HE staining unraveled that after miR‑22‑3p overexpression, the
number of primordial follicles, primary follicles, and secondary
follicles was elevated, and the number of atresia follicles in the
ovaries of POF mice was reduced [Figure 2g and h].
Afterward, RT‑qPCR and TUNEL staining were implemented
to evaluate the apoptosis of ovarian cells in each group of
mice. RT‑qPCR found a reduction in Bax expression and an
increase in Bcl2 expression in POF mice after overexpressing
miR‑22‑3p [Figure 2i], and there was an obvious decrease
in the Bax/Bcl2 ratio [Figure 2j]. Apoptosis was measured
by TUNEL staining, and it was found that there were
fewer TUNEL apoptosis‑positive cells in POF mice after
overexpressing miR‑22‑3p [Figure 2k and l]. The above results
unraveled that miR‑22‑3p overexpression could improve the
symptoms of POF in mice.
Chemokine‑like receptor 1 is a target gene of miR‑22‑3p
To explore the mechanism by which miR‑22‑3p affects the
symptoms of POF, we predicted potential target genes of
miR‑22‑3p using the bioinformatics website (https://starbase.
sysu.edu.cn/). It is predicted by the bioinformatics website
that miR‑22‑3p could bind to CMKLR1 [Figure 3a]. To

Chinese Journal of Physiology ¦ Volume 66 ¦ Issue 4 ¦ July-August 2023 203

[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.113]

Pan: miR‑22‑3p/CMKLR1 axis functions in POF

c d e
a b

f g h i

j k l
Figure 2: miR‑22‑3p overexpression ameliorates the symptoms pf POF in mice. (a) miR‑22‑3p expression in the ovaries of normal and POF mice was
tested by RT‑qPCR. (b) The successful injection of lentiviral vectors containing miR‑22‑3p in POF mice was determined by RT‑qPCR. (c‑e) The levels
of E2, AMH, and FSH in POF mice after overexpressing miR‑22‑3p were measured by ELISA. (f) The ovarian weight of POF mice after overexpressing
miR‑22‑3p. (g) HE staining results of ovarian tissues of in POF mice after overexpressing miR‑22‑3p (arrows indicate developing follicles). (h) The
number of follicles at each stage in POF mice after overexpressing miR‑22‑3p was observed by a microscope. (i and j) The expression of apoptotic
genes Bax and Bcl2 and their ratios in POF mice after overexpressing miR‑22‑3p were measured by RT‑qPCR. (k and l) The level of apoptosis in
ovarian cells of in POF mice after overexpressing miR‑22‑3p was tested by TUNEL staining (arrows indicate apoptotic ovarian cells); n = 6. *versus
P < 0.05. miR‑22‑3p: MicroRNA‑22‑3p, CMKLR1: Chemokine‑like receptor 1, RT‑qPCR: Reverse transcription‑quantitative polymerase chain reaction,
POF: Premature ovarian failure.

verify this prediction, a dual luciferase reporter gene assay
was performed, which demonstrated that overexpression of
miR‑22‑3p decreased luciferase activity in the CMKLR1‑WT
group, but had no significant impact on the CMKLR1‑Mut
group [Figure 3b], indicating that miR‑22‑3p could bind
to CMKLR1. CMKLR1 expression after overexpressing
miR‑22‑3p was tested by RT‑qPCR and western blot, and
the experimental results demonstrated that CMKLR1
expression was reduced in POF mice after overexpressing
miR‑22‑3p [Figure 3c and d], which indicated that miR‑22‑3p
negatively modulated CMKLR1 expression. In summary,
miR‑22‑3p negatively regulated CMKLR1 expression.
Silencing chemokine‑like receptor 1 improves the
symptoms of premature ovarian failure in mice
To explore the influence of the CMKLR1 gene on POF mice,
the changes in CMKLR1 in POF mice were tested by RT‑qPCR
and western blot, and the expression of CMKLR1 was elevated
in POF mice [Figure 4a and b].
To better understand the role of CMKLR1 in the symptoms
of POF, lentivirus containing inhibited CMKLR1 was
injected into the ovaries of both sides of POF mice and
RT‑qPCR demonstrated that CMKLR1 was notably reduced
in the ovarian tissues of POF mice [Figure 4c and d]. Next,
we measured serum sex hormone (E2, FSH, and AMH)
levels in POF mice by ELISA, and the findings displayed
that the contents of sex hormones E2 and AMH were raised
[Figure 4e and f] and FSH levels were diminished in POF
mice upon suppression of CMKLR1 [Figure 4g]. Besides,
the ovaries were weighed and HE staining was utilized
to observe the pathological changes in the ovaries. There
was a larger ovarian mass of POF mice after silencing
CMKLR1 [Figure 4h], and HE staining indicated that the
number of primordial follicles, primary follicles, secondary
follicles, and sinus follicles in POF mice’s ovaries was
increased and the number of atresia follicles was decreased
after silencing CMKLR1 [Figure 4i and j].
Furthermore, RT‑qPCR and TUNEL staining were
implemented to evaluate the apoptosis of ovarian cells in
each group of mice. The findings of RT‑qPCR revealed
that Bax expression was reduced and Bcl2 expression
was elevated [Figure 4k], and the Bax/Bcl2 ratio was
decreased [Figure 4l] in POF mice after silencing
CMKLR1. TUNEL staining unveiled that the TUNEL
apoptosis‑positive cells were reduced in POF mice after
silencing CMKLR1 [Figure 4m and n]. Taken together, the
above results suggested that silencing CMKLR1 could also
effectively improve the symptoms of POF in mice.

204 Chinese Journal of Physiology ¦ Volume 66 ¦ Issue 4 ¦ July-August 2023

[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.113]

Pan: miR‑22‑3p/CMKLR1 axis functions in POF

a b

c d
Figure 3: CMKLR1 is a target gene of miR‑22‑3p. (a) Bioinformatics website predicted that there were binding sites between miR‑22‑3p and
CMKLR1. (b) The targeting relationship between miR‑22‑3p and CMKLR1 was verified by dual luciferase reporter gene assay. (c and d) CMKLR1
expression in POF mice after overexpressing miR‑22‑3p was tested by RT‑qPCR and western blot; b: n = 3, c and d: n = 6. *versus P < 0.05.
miR‑22‑3p: MicroRNA‑22‑3p, CMKLR1: Chemokine‑like receptor 1, RT‑qPCR: Reverse transcription‑quantitative polymerase chain reaction, POF:
Premature ovarian failure.

Chemokine‑like receptor 1 overexpression reverses the Discussion

ameliorative effects of miR‑22‑3p expression on the
symptoms of premature ovarian failure
To elucidate the impacts of the miR‑22‑3p/CMKLR1
axis in POF mice, the miR‑22‑3p + oe‑NC group and the
miR‑22‑3p + oe‑CMKLR1 group were set up. The expression
of CMKLR1 in the ovarian tissues of POF mice was tested
by RT‑qPCR and western blot. The results indicated that
the expression of CMKLR1 was raised in the ovarian
tissues of POF mice in the miR‑22‑3p + oe‑CMKLR1
group in comparison with that in the miR‑22‑3p + oe‑NC
group [Figure 5a and b].
The levels of serum sex hormones (E2, FSH, and AMH)
in POF mice were measured by ELISA. The ovaries were
weighed and HE staining was implemented to observe the
pathological changes in the ovaries. Subsequently, RT‑qPCR
and TUNEL staining were employed to determine the apoptosis
of ovarian cells in each group of mice. The results demonstrated
that compared with those in the miR‑22‑3p + oe‑NC group,
E2 and AMH levels were decreased [Figure 5c and d], FSH
levels were increased [Figure 5e], the ovarian weight was
decreased [Figure 5f], the number of primordial follicles,
primary follicles, and secondary follicles was decreased; the
number of atresia follicles was increased [Figure 5g and h],
the apoptosis‑related gene Bax expression was increased,
while Bcl2 expression was decreased [Figure 5i], and the Bax/
Bcl2 ratio was increased [Figure 5j], and apoptosis rate was
increased [Figure 5k and l] in the miR‑22‑3p + oe‑CMKLR1
group. In summary, CMKLR1 overexpression could reverse
the ameliorative effects of miR‑22‑3p expression on the
symptoms of POF.
POF can be considered as a series of symptoms of
perimenopausal hot flashes, vaginal dryness, reduced
menstruation, insomnia, night sweats, amenorrhea, and even
infertility due to ovarian function decline, which is a prevalent
and harsh disease in gynecology.[27] This study focused on
the ameliorative effects of the miR‑22‑3p/CMKLR1 axis on
the symptoms of POF, and we discovered that miR‑22‑3p
ameliorated the symptoms of POF in mice by repressing
CMKLR1 expression.
As previously reported, miRNAs take part in the post-transcription
modulation of gene expression. Meanwhile, miRNA deregulation
has an epigenetic component and abnormal miRNA expression is
often involved in the form of EOC tumor, prognosis, histological
grade, and the International Federation of Gynecology and
Obstetrics stage.[28] It is reported that miR‑22‑3p is lowly
expressed in POF and is efficient in distinguishing POF from
control subjects, which may reflect the down‑regulated ovarian
reserve and act as a consequence of the POF pathologic
process.[26] Besides, the pathogenic factors of POF include
autoimmune factors,[29] and a previous study has suggested that
miR‑22‑3p has the ability to modulate the function of several
types of immune cells and may be implicated in autoimmune
disease development.[30] In addition, overexpressed miR‑22‑3p
inhibits cell activity and promotes cell apoptosis via modulating
apoptosis‑related genes.[31] Similar to the above references, we
found in our research that the expression of miR‑22‑3p was
reduced in POF mice, and overexpression of miR‑22‑3p could
improve the symptoms of POF in mice.
Increasing evidence has indicated that miRs are associated with
a diversity of biological signaling pathways and have a critical

Chinese Journal of Physiology ¦ Volume 66 ¦ Issue 4 ¦ July-August 2023 205

[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.113]

Pan: miR‑22‑3p/CMKLR1 axis functions in POF

a b c d

e f g h i

j k l m n
Figure 4: Silencing CMKLR1 improves the symptoms of POF in mice. (a and b) CMKLR1 expression in the ovaries of normal and POF mice was
assessed by RT‑qPCR and western blot. (c and d) Lentiviral vectors containing sh‑CMKLR1 injection success was assessed by RT‑qPCR and western
blot. (e‑g) E2, AMH, and FSH levels in POF mice after silencing CMKLR1 were measured by ELISA. (h) Ovarian weight in POF mice after silencing
CMKLR1 was weighed. (i) H and E staining results of ovarian tissues in POF mice after silencing CMKLR1 (arrows indicate developing follicles). (j)
The number of follicles at each stage in POF mice after silencing CMKLR1 was observed under a microscope. (k and l) The expression of apoptotic
genes Bax and Bcl2 and their ratios in POF mice after silencing CMKLR1 were tested by RT‑qPCR. (m and n) The level of apoptosis in ovarian cells of
POF mice after silencing CMKLR1 was determined by TUNEL staining (arrows indicate apoptotic ovarian cells); n = 6. *versus P < 0.05. miR‑22‑3p:
MicroRNA‑22‑3p, CMKLR1: Chemokine‑like receptor 1, RT‑qPCR: Reverse transcription‑quantitative polymerase chain reaction, POF: Premature
ovarian failure.

role in the development of several diseases, including not only
oncological but also non-oncological diseases. In addition,
these small non-coding RNAs can block translation, leading to
lowly‑expressed target genes.[32] Besides, miRNAs are capable
of modulating gene expression via targeting the binding sites
of mRNAs, thus influencing multiple biological processes.[33]
To further explore the mechanism of miR‑22‑3p affecting
the symptoms of POF, we predicted that miR‑22‑3p could
bind to CMKLR1 through the bioinformatics website, and
further assays revealed that there was a targeting relationship
between miR‑22‑3p and CMKLR1, and miR‑22‑3p had a
negative regulation with CMKLR1 expression. CMKLR1,
as a receptor for chemerin, has a broad range of functions
in both physiological and pathological activities, such as
inflammation, innate and adaptive immunity, metabolism, as
well as reproduction.[34] As previously demonstrated, CMKLR1
expression is elevated in the polycystic ovary syndrome
model,[35] which is in accordance with our experimental results.
In our study, we found that CMKLR1 was up‑regulated in POF.
Moreover, increasing evidence has displayed that CMKLR1
is correlated with the regulation of ovarian functions.[36] We
conducted some assays to evaluate the role of CMKLR1 in
POF, and found that silencing CMKLR1 could also effectively
improve the symptoms of POF in mice. Furthermore, our
paper also revealed that overexpression of CMKLR1 could
reverse the ameliorative effects of miR‑22‑3p expression on
the symptoms of POF. Similarly, a study has demonstrated that
the regulatory impact of miR‑7‑5p on osteogenic differentiation
of human mesenchymal stem cells was reversed by CMKLR1
overexpression.[37] This signifies that CMKLR1 overexpression
can reverse the influences of miRNAs on different diseases.
Nevertheless, the specific mechanism needs further validation.
Conclusion
In conclusion, our research demonstrates that miR‑22‑3p
could improve the symptoms of POF in mice by suppressing
CMKLR1 expression. This study offers a foundation for the
future and further investigation of the miR‑22‑3p/CMKLR1
axis in treating the symptoms of POF. Nevertheless, further
evidence is still needed to explore the role of the miR‑22‑3p/
CMKLR1 axis in POF. This study is based on animal trials
without clinical data, which is the major limitation of our
study. In addition, the regulatory mechanism of CMKLR1 on
miR‑22 should be validated to further confirm our findings.
Acknowledgment
We would like to thank Ebubechukwu Orji for English
language editing.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.

206 Chinese Journal of Physiology ¦ Volume 66 ¦ Issue 4 ¦ July-August 2023

[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.113]

Pan: miR‑22‑3p/CMKLR1 axis functions in POF

a b c d

e f g h

i j k l
Figure 5: CMKLR1 overexpression reverses the ameliorative effects of miR‑22‑3p expression on the symptoms of POF. (a and b) CMKLR1 expression
was measured after treatment of miR‑22‑3p and CMKLR1 overexpression by RT‑qPCR and western blot. (c‑e) E2, AMH, and FSH levels after treatment
of miR‑22‑3p and CMKLR1 overexpression were tested by ELISA. (f) The ovarian weight after treatment of miR‑22‑3p and CMKLR1 overexpression
was weighed. (g) HE staining results of ovarian tissues in each group of mice after treatment of miR‑22‑3p and CMKLR1 overexpression (arrows
indicate developing follicles). (h) The number of follicles at each stage after treatment of miR‑22‑3p and CMKLR1 overexpression was observed under
a microscope. (i and j) Apoptotic genes Bax and Bcl2 expression and their ratios after treatment of miR‑22‑3p and CMKLR1 overexpression were
determined by RT‑qPCR. (k and l) Apoptosis rate in ovarian cells of each group of mice after treatment of miR‑22‑3p and CMKLR1 overexpression
was determined by TUNEL staining (arrows indicate apoptotic ovarian cells); n = 6. *versus P < 0.05. miR‑22‑3p: MicroRNA‑22‑3p, CMKLR1:
Chemokine‑like receptor 1, RT‑qPCR: Reverse transcription‑quantitative polymerase chain reaction, POF: Premature ovarian failure.

References Ahmadian Heris J, Soltani‑Zangbar MS, et al. Role of miRNAs

1. Jankowska K. Premature ovarian failure. Prz Menopauzalny
2017;16:51‑6.
2. Wang J, Liu W, Yu D, Yang Z, Li S, Sun X. Research progress on the
treatment of premature ovarian failure using mesenchymal stem cells:
A literature review. Front Cell Dev Biol 2021;9:749822.
3. Ghahremani‑Nasab M, Ghanbari E, Jahanbani Y, Mehdizadeh A,
Yousefi M. Premature ovarian failure and tissue engineering. J Cell
Physiol 2020;235:4217‑26.
4. Shareghi‑Oskoue O, Aghebati‑Maleki L, Yousefi M. Transplantation
of human umbilical cord mesenchymal stem cells to treat premature
ovarian failure. Stem Cell Res Ther 2021;12:454.
5. Laissue P. Aetiological coding sequence variants in non‑syndromic
premature ovarian failure: From genetic linkage analysis to next
generation sequencing. Mol Cell Endocrinol 2015;411:243‑57.
6. Guo Y, Sun J, Lai D. Role of microRNAs in premature ovarian
insufficiency. Reprod Biol Endocrinol 2017;15:38.
7. Yang X, Zhou Y, Peng S, Wu L, Lin HY, Wang S, et al. Differentially
expressed plasma microRNAs in premature ovarian failure patients and
the potential regulatory function of mir‑23a in granulosa cell apoptosis.
Reproduction 2012;144:235‑44.
8. Muralidhar GG, Barbolina MV. The miR‑200 family: Versatile players
in epithelial ovarian cancer. Int J Mol Sci 2015;16:16833‑47.
9. Bahmyari S, Jamali Z, Khatami SH, Vakili O, Roozitalab M,
Savardashtaki A, et al. microRNAs in female infertility: An overview.
Cell Biochem Funct 2021;39:955‑69.
10. Nouri N, Shareghi‑Oskoue O, Aghebati‑Maleki L, Danaii S,
interference on ovarian functions and premature ovarian failure. Cell
Commun Signal 2022;20:198.
11. Qi X, Yu C, Wang Y, Lin Y, Shen B. Network vulnerability‑based and
knowledge‑guided identification of microRNA biomarkers indicating
platinum resistance in high‑grade serous ovarian cancer. Clin Transl
Med 2019;8:28.
12. Serafin DS, Allyn B, Sassano MF, Timoshchenko RG, Mattox D,
Brozowski JM, et al. Chemerin‑activated functions of CMKLR1 are
regulated by G protein‑coupled receptor kinase 6 (GRK6) and β‑arrestin
2 in inflammatory macrophages. Mol Immunol 2019;106:12‑21.
13. Lin Y, Cai Q, Luo Y, Li B, Chen Y, Yang X, et al. Epithelial
chemerin‑CMKLR1 signaling restricts microbiota‑driven colonic
neutrophilia and tumorigenesis by up‑regulating lactoperoxidase. Proc
Natl Acad Sci U S A 2022;119:e2205574119.
14. Treeck O, Buechler C, Ortmann O. Chemerin and cancer. Int J Mol Sci
2019;20:3750.
15. Yang X, Yao J, Wei Q, Ye J, Yin X, Quan X, et al. Role of chemerin/
CMKLR1 in the maintenance of early pregnancy. Front Med
2018;12:525‑32.
16. Estienne A, Mellouk N, Bongrani A, Plotton I, Langer I, Ramé C, et al.
Involvement of chemerin and CMKLR1 in the progesterone decrease by
PCOS granulosa cells. Reproduction 2021;162:427‑36.
17. Zhang Q, Xiao Z, Lee CL, Duan YG, Fan X, Yeung WS, et al. The
regulatory roles of chemerin‑chemokine‑like receptor 1 axis in placental
development and vascular remodeling during early pregnancy. Front
Cell Dev Biol 2022;10:883636.
18. Li J, Yu Q, Huang H, Deng W, Cao X, Adu‑Frimpong M, et al. Human

Chinese Journal of Physiology ¦ Volume 66 ¦ Issue 4 ¦ July-August 2023 207

[Downloaded free from http://www.cjphysiology.org on Friday, September 22, 2023, IP: 251.99.9.113]
Pan: miR‑22‑3p/CMKLR1 axis functions in POF
chorionic plate‑derived mesenchymal stem cells transplantation restores
ovarian function in a chemotherapy‑induced mouse model of premature
ovarian failure. Stem Cell Res Ther 2018;9:81.
19. Sun XF, Li YP, Pan B, Wang YF, Li J, Shen W. Molecular regulation of
miR‑378 on the development of mouse follicle and the maturation of
oocyte in vivo. Cell Cycle 2018;17:2230‑42.
20. Wang X, He Y, Liu M, Fu X. Lentivirus‑mediated bcl‑2 gene therapy
improves function and structure of chemotherapy‑damaged ovaries in
wistar rats. Am J Reprod Immunol 2013;69:518‑28.
21. Liu M, Qiu Y, Xue Z, Wu R, Li J, Niu X, et al. Small extracellular
vesicles derived from embryonic stem cells restore ovarian function of
premature ovarian failure through PI3K/AKT signaling pathway. Stem
Cell Res Ther 2020;11:3.
22. Devine PJ, Sipes IG, Hoyer PB. Initiation of delayed ovotoxicity by
in vitro and in vivo exposures of rat ovaries to 4‑vinylcyclohexene
diepoxide. Reprod Toxicol 2004;19:71‑7.
23. Xie Y, Huang Y, Ling X, Qin H, Wang M, Luo B. Chemerin/CMKLR1
axis promotes inflammation and pyroptosis by activating NLRP3
inflammasome in diabetic cardiomyopathy rat. Front Physiol 2020;11:381.
24. Wang Y, Lin C. Exosomes miR‑22‑3p derived from mesenchymal
stem cells suppress colorectal cancer cell proliferation and invasion by
regulating RAP2B and PI3K/AKT pathway. J Oncol 2021;2021:3874478.
25. Yang M, Lin L, Sha C, Li T, Zhao D, Wei H, et al. Bone marrow
mesenchymal stem cell‑derived exosomal miR‑144‑5p improves
rat ovarian function after chemotherapy‑induced ovarian failure by
targeting PTEN. Lab Invest 2020;100:342‑52.
26. Dang Y, Zhao S, Qin Y, Han T, Li W, Chen ZJ. MicroRNA‑22‑3p is
down‑regulated in the plasma of Han Chinese patients with premature
ovarian failure. Fertil Steril 2015;103:802‑7.e1.
27. Niu J, Yu F, Luo X, Chen S. Human umbilical cord mesenchymal
stem cells improve premature ovarian failure through cell apoptosis of
miR‑100‑5p/NOX4/NLRP3. Biomed Res Int 2022;2022:3862122.
208 Chinese Journal of Physiology ¦ Volume 66 ¦ Issue 4 ¦ July-August 2023
28. Kumar V, Gupta S, Varma K, Sachan M. MicroRNA as biomarker in
ovarian cancer management: Advantages and challenges. DNA Cell
Biol 2020;39:2103‑24.
29. Chen H, Liu C, Zhu S, Li S, Zhang Q, Song L, et al. The therapeutic
effect of stem cells on chemotherapy‑induced premature ovarian failure.
Curr Mol Med 2021;21:376‑84.
30. Wang B, Yao Q, Xu D, Zhang JA. MicroRNA‑22‑3p as a novel regulator
and therapeutic target for autoimmune diseases. Int Rev Immunol
2017;36:176‑81.
31. Lu W, Liu X, Zhao L, Yan S, Song Q, Zou C, et al. MiR‑22‑3p in
exosomes increases the risk of heart failure after down‑regulation of
FURIN. Chem Biol Drug Des 2023;101:550‑67.
32. Deng B, Tang X, Wang Y. Role of microRNA‑129 in cancer and
non‑cancerous diseases (Review). Exp Ther Med 2021;22:918.
33. Xia S, Wang X, Wu Y, Zhou T, Tian H, Liu Z, et al. miR‑22 suppresses
EMT by mediating metabolic reprogramming in colorectal
cancer through targeting MYC‑associated factor X. Dis Markers
2022;2022:7843565.
34. Huang C, Wang M, Ren L, Xiang L, Chen J, Li M, et al. CMKLR1
deficiency influences glucose tolerance and thermogenesis in mice on
high fat diet. Biochem Biophys Res Commun 2016;473:435‑41.
35. Kian M, Hosseini E, Abdizadeh T, Langaee T, Khajouei A, Ghasemi S.
Molecular docking and mouse modeling suggest CMKLR1 and INSR
as targets for improving PCOS phenotypes by minocycline. EXCLI J
2022;21:400‑14.
36. Mellouk N, Ramé C, Diot M, Briant E, Touzé JL, Guillaume D, et al.
Possible involvement of the RARRES2/CMKLR1‑system in metabolic
and reproductive parameters in Holstein dairy cows. Reprod Biol
Endocrinol 2019;17:25.
37. Chen B, Meng J, Zeng YT, Du YX, Zhang J, Si YM, et al. MicroRNA‑7‑5p
regulates osteogenic differentiation of hMSCs via targeting CMKLR1.
Eur Rev Med Pharmacol Sci 2018;22:7826‑31.