Scribd Logo
Upload

Welcome to Scribd!

  • hp200561 Tnfalpha

    Uploaded by

    Linh Tran
    10 views1 page
    This document provides product information for a qPCR primer pair for the TNF alpha (TNF) gene from OriGene Technologies. The forward and reverse primer sequences are listed, along with the gene ID, accession numbers, UniProt ID, and synonyms. The product contains a vial of lyophilized primer mix sufficient for 200 reactions. Quality control testing confirms the primer pair generates satisfactory qPCR data using the specified PCR program. The primer mix should be stored at -20°C and is stable for one year.

    Original Description:

    Original Title

    hp200561 tnfalpha

    Copyright

    © © All Rights Reserved

    Available Formats

    PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document
    This document provides product information for a qPCR primer pair for the TNF alpha (TNF) gene from OriGene Technologies. The forward and reverse primer sequences are listed, along with the gene ID, accession numbers, UniProt ID, and synonyms. The product contains a vial of lyophilized primer mix sufficient for 200 reactions. Quality control testing confirms the primer pair generates satisfactory qPCR data using the specified PCR program. The primer mix should be stored at -20°C and is stable for one year.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Flag for inappropriate content
    Download as pdf or txt
    10 views1 page

    hp200561 Tnfalpha

    Uploaded by

    Linh Tran
    This document provides product information for a qPCR primer pair for the TNF alpha (TNF) gene from OriGene Technologies. The forward and reverse primer sequences are listed, along with the gene ID, accession numbers, UniProt ID, and synonyms. The product contains a vial of lyophilized primer mix sufficient for 200 reactions. Quality control testing confirms the primer pair generates satisfactory qPCR data using the specified PCR program. The primer mix should be stored at -20°C and is stable for one year.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Flag for inappropriate content
    Download as pdf or txt
    of 1

    OriGene Technologies, Inc.

    9620 Medical Center Drive, Ste 200


    Rockville, MD 20850, US
    Phone: +1-888-267-4436
    https://www.origene.com
    techsupport@origene.com

    Product datasheet for HP200561 EU: info-de@origene.com


    CN: techsupport@origene.cn

    TNF alpha (TNF) Human qPCR Primer Pair (NM_000594)


    Product data:
    Product Type: qPCR Primer Pairs
    Gene ID: 7124
    Forward Sequence: CTCTTCTGCCTGCTGCACTTTG
    Reverse Sequence: ATGGGCTACAGGCTTGTCACTC
    ACCN: NM_000594, NM_000594.1, NM_000594.2, NM_000594.3, BC028148, BC028148.1, BI908079,
    BP215875, NM_000594.4
    UniProt ID: P01375
    Synonyms: DIF; TNF-alpha; TNFA; TNFSF2; TNLG1F
    Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
    Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using
    the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10
    min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting
    curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
    Storage: Store at -20°C.
    Stability: The primer mix is stable for one year from date of shipping.

    View online »
    This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    ©2023 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1/1

    You might also like