Received: 17 March 2020 | Revised: 8 May 2020 | Accepted: 20 May 2020

DOI: 10.1111/anu.13124

ORIGINAL ARTICLE

Influences of dietary antimicrobial peptide APSH-07 on the

growth performance, immune response and vibriosis resistance
of abalone Haliotis discus hannai Ino

Feiyang Chen | Xinxin Li | Yanjiao Wu | Dong Huang | Yanlin Guo |

Yanjiao Zhang | Wenbing Zhang | Kangsen Mai

The Key Laboratory of Aquaculture

Nutrition and Feeds (Ministry of Agriculture
and Rural Affairs), The Key Laboratory
of Mariculture (Ministry of Education),
Fisheries College, Ocean University of
China, Qingdao, China
Correspondence
Wenbing Zhang, Fisheries College, Ocean
University of China, 5 Yushan Road, Qingdao
266003, China.
Email: wzhang@ouc.edu.cn
Funding information
National Key R & D Program of China,
Grant/Award Number: 2018YFD0900400;
Earmarked Fund for Modern Agro-industry
Technology Research System, Grant/Award
Number: CARS-49
Abstract
A 115-day feeding trial and subsequently a 10-day challenge test with Vibrio para-
haemolyticus were conducted to investigate the effects of dietary antimicrobial pep-
tide APSH-07 on growth performance, immune response, antioxidative status and
vibriosis resistance of abalone Haliotis discus hannai (initial body weight: 2.06 ± 0.01 g;
initial shell length: 25.42 ± 0.18 mm). Four artificial diets were designed with 0 (artifi-
cial diet control), 7.5, 15.0 and 22.5 mg/kg of APSH-07, respectively. The brown alga
Laminaria japonica was used as the live food control. Results showed that the specific
growth rates of abalone in the groups with 7.5 and 15.0 mg/kg dietary APSH-07
were significantly higher than those in the controls (p < .05). The total haemocyte
counts and respiratory burst activity in haemolymph of abalone in the group with
7.5 mg/kg of dietary APSH-07 were significantly higher than those in the groups with
0 and 22.5 mg/kg of dietary APSH-07 (p < .05). The gene expression levels of Mn-
superoxide dismutase and thioredoxin peroxidase 2, and the activities of glutathione
peroxidase in the group with 7.5 mg/kg of dietary APSH-07 were significantly higher
than those in the other groups (p < .05). Cumulative mortality of abalone after the
challenge test was significantly decreased in the group with 7.5 mg/kg of dietary
APSH-07 supplementation. Supplementation of 22.5 mg/kg dietary APSH-07 sig-
nificantly increased the cumulative mortality. In conclusion, 7.5 mg/kg of dietary
APSH-07 supplementation had the better growth performance, higher antioxidation,
immune and disease resistance capacity of abalone. Excessive supplementation of
dietary antimicrobial peptide APSH-07 (22.5 mg/kg) had significantly negative ef-
fects. Further studies are needed to determine the optimal level of dietary APSH-07
supplementation for abalone.

KEY WORDS
abalone, antimicrobial peptide, disease resistance, growth, Haliotis discus hannai, immune

Aquaculture Nutrition. 2020;00:1–12. wileyonlinelibrary.com/journal/anu © 2020 John Wiley & Sons Ltd | 1
2 | CHEN Et al.

1 | I NTRO D U C TI O N TA B L E 1 Ingredient and proximate composition of the basal diet

Contents
Abalone of the archaeogastropod genus is known for its nutritional Ingredients (g/kg)
value. With the production of 163,169 metric tons in 2018 (Fishery
Caseina 260.0
Bureau, Ministry of Agriculture, People’s Republic of China, 2019), b
Gelatin 65.0
China is the largest abalone producing country in the world. Abalone
Dextrinb 275.0
Haliotis discus hannai is the most popular species farmed in China (Li
SO/MFOc 30.0
et al., 2017). Due to the high farming density, environment stress and
Sodium alginateb 160.0
diseases outbreaks, high mortality has been increasingly reported
Microcrystalline celluloseb 50.0
in abalone. This caused serious economic losses and affected the
Choline chlorideb 95.0
sustainable development of abalone farming in China (Jiang, Fang,
Carboxymethyl celluloseb 5.0
Li, Jiang, & Chen, 2017).
Vitamin mixd 20.0
Antibiotics have been used to avoid the diseases caused by bac-
Mineral mixe 40.0
teria in aquaculture (Xin, Chen, Lin, & Lin, 2015). Although many an-
Proximate analysis (dry weight g/kg)
tibiotics have roles in treating diseases and promoting growth, they
Crude protein 350.7
are considered unfriendly on the environment and human health
Crude lipid 31.3
because of their potential harmful impact, such as drug residues and
Crude ash 88.6
intestinal flora disorder (Liu, Lu, Guo, Xi, & Wang, 2018; Lv, Yuan,
a
Sigma Chemical.
Zhu, & Yin, 2012). Therefore, it is very important to find safe and b
Shanghai Chemical.
environmental-friendly feed additives that can replace antibiotics in c
Soybean oil (SO) and menhaden fish oil (MFO) (1:1).
aquaculture. d
Vitamin mix, each 1,000 g of diet contained: thiamin HCl, 120 mg;
Antimicrobial peptides are effector molecules of the innate riboflavin, 100 mg; folic acid, 30 mg; pyridoxine HCl, 40 mg; niacin,
immune system (Koczulla & Bals, 2003). Compared with tradi- 800 mg; Ca pantothenate, 200 mg; inositol, 4,000 mg; biotin, 12 mg;
tional antibiotics, antimicrobial peptides have higher selective ascorbic acid, 4,000 mg; B12, 0.18 mg; vitamin E, 450 mg; menadione,
80 mg; retinol acetate, 100,000 IU; cholecalciferol, 2,000 IU.
toxicity, and extensive as well as rapid killing action (Hancock & e
Mineral mix, each 1,000 g of diet contained: NaCl, 0.4 g; MgSO4.7H2O,
Annett, 2002; Michael, 2002; Xin et al., 2015). Apart from inter-
6.0 g; NaH2PO4·2H2O, 10.0 g; KH2PO4, 12.8 g; Ca(H2PO4)2·H2O, 8.0 g;
acting directly with pathogens and breaking down cell membranes Fe-citrate, 1.0 g; ZnSO4·7H2O, 141.2 mg; CoCl2·6H2O, 0.4 mg; KIO3,
by interacting with certain bacterial components (Chou, Wen, 1.2 mg; CuSO4·5H2O, 12.4 mg; Na2SeO3·5H2O, 0.61 mg.
Kuo, Lin, & Chen, 2010), antimicrobial peptides also play a role by
modulating the adaptive immune response (Chou et al., 2010; Liu 2 | M ATER I A L S A N D ME TH O DS
et al., 2018; Lu, 2018; Oppenheim, Biragyn, Kwak, & Yang, 2003)
or acting as chemokines to recruit other effector cells (Chertov 2.1 | Experimental diets
et al., 1996). In addition, some beneficial effects of antimicrobial
peptides on growth performance and non-specific immunity have The basal diet formulation was based on Wu et al. (2010) with some
been reported in aquaculture animals, such as shrimp Litopenaeus modifications. The diet was formulated with purified ingredients
vannamei and tilapia (Oreochromis niloticus × O. aureus, and O. ni- (Table 1) to provide about 350 g/kg crude protein from casein and
loticus) (Shi et al., 2014; Xin et al., 2015; Zhai, Shi, & Chen, 2016). gelatin, and about 30 g/kg of crude lipid from soybean oil and men-
Up to now, growing number of commercial antimicrobial pep- haden fish oil (1:1), which could be considered to be sufficient to
tides have been produced, such as penaeidins (Destoumieux, maintain optimal growth for abalone (Mai, Mercer, & Donlon, 1995).
Munoz, Bulet, & Bachère, 2000), apidaecin (Zhou, Wang, & Antimicrobial peptide APSH-07 used in the present study was a
Li, 2008), magainins (Dennison, Harris, & Phoenix, 2014) and ce- polypeptide (4.6 kDa, 45 amino acids) from large yellow croaker and
cropin (Lin, Chen, Lin, & Luo, 2015). Even though there have been was expressed in lactic acid bacteria by fermentation. The commer-
many reports on the effects of antimicrobial peptides on aquatic cial product S100 was prepared and supplied by the Shandong Sci-
animals, few reports on molluscs. Antimicrobial peptide APSH-07 health Biotechnology Co. Ltd (Shandong, China). APSH-07 was the
in this study was extracted from bacteria. Ge et al. (2019) found active ingredient of the commercial product S100, and the active
that the inclusion of antimicrobial peptide APSH-07 in diet had a component content is 15 g/kg. Based on the basal diet, three levels
potential positive effect on growth, immunity and stress resistance of APSH-07 (7.5, 15.0 and 22.5 mg/kg) were added to make the three
of large yellow croaker Larimichthys crocea. The present study was experimental diets, which were named as P1, P2 and P3, respectively.
conducted to investigate the effects of dietary antimicrobial pep- In addition, the basal diet was used as a control diet, and the brown
tide APSH-07 on growth performance, immune response and dis- alga Laminaria japonica was used as the other control. Procedures for
ease resistance of abalone H. discus hannai. diet preparation and storage were prepared as previously described
CHEN Et al.
(Zhang et al., 2007). Proximate analyses of crude protein, crude lipid
and crude ash in diets were conducted following the standard pro-
cedures (Horwitz, Allee, Latimer, & Kenneth, 1980).
2.2 | Feeding trial
Abalone juveniles (initial body weight: 2.06 ± 0.01 g; initial shell length:
25.42 ± 0.18 mm) were obtained from a spawning at Li Island (Weihai
Shandong, China). Prior to the feeding trial, animals were acclimated to
the laboratory conditions in a re-circulating water system for 15 days.
During the acclimatization period, the control diet was used to feed the
abalone. After that, the feeding trial was conducted with a completely
randomized design for 115 days. There were 3 triplicated treatments,
and each tank (90 L, 60 abalones) was used as a replicate. Diets were
hand-fed to abalone at a rate equalling 50 g/kg-100 g/kg of wet body
weight once daily at 17:00. Every morning, faeces and excess feeds
were removed to maintain water quality. During the feeding trial, the
water temperature was 20–25°C, salinity 31–33 g/L, pH 7.5–8.0, and
the dissolved oxygen was not less than 6.8 mg/L.
2.3 | Sampling and growth parameters
Before sampling, all the abalones were fasted for 3 days, and then
counted and weighed. Abalones in one tank were weighted as a group.
Twelve abalones (four from each replicate tank) from each treatment
were taken randomly for body composition measurement. Six abalones
(two from each replicate tank) were taken randomly from each treat-
ment to collect the haemolymph to assess non-specific immune param-
eters. Meanwhile, haemolymph of another 30 abalones (per tank) was
collected and immediately centrifuged by 3,000 g at 4°C for 10 min and
stored at −20°C for subsequent analysis. After that, the hepatopan-
creas was sampled with scissors and forceps, and then stored at −80°C
until the analysis of the expressions of the related genes.
Growth performances were expressed as survival rate (%), the spe-
cific growth rate (SGR, %/day), the daily increment in shell length (DISL,
µm/day), condition factor (CF, g/mm) (Britz, 1996) and the soft body-to-
shell ratio (SB/S, %) (Mai et al., 1995). They were calculated as follows:
  
Survival rate (%) = Ni − Nt ∕Ni × 100
  
SGR (%∕day) = ln Wt − ln Wi ∕t × 100
  
DISL (μm/day) = SLt − SLi ∕t × 1,000
 
CF (g∕mm) = SBt /SL2.99
t × 5,575
SB∕S (%) = SBt ∕St × 100
where Ni and Nt are the number of abalones at the beginning and end
of the culture experiment, respectively; SLi and SLt were the initial and
| 3
final shell length (mm) of abalones, respectively; Wi and Wt were the
initial and final weight (dry weight, g) of abalones, respectively. t is the
duration of the feeding trial in days; SBt was the final soft body weight
(dry weight, g); St was the final shell weight (dry weight, g).
2.4 | Analysis of immune parameters
Firstly, the anticoagulant (100 mmol/L EDTA Na2, 450 mmol/L NaCl,
10 mmol/L KCl, 10 mmol/L HEPES, pH 7.3, 850 mOs mol/kg) was
prepared with the reference of Zhang et al. (2011). Then, the haemo-
lymph was thoroughly mixed with the cooled anticoagulant solution
at 1:1 (V/V), and then, the diluted haemolymph was pooled for the
analysis of immune parameters.
2.4.1 | Total haemocyte counts
The total haemocyte count (THC) was measured by the method of
Jiang, Liu, Chang, Liu, and Wang (2013). A 100 μl diluted haemolymph
was directly counted and calculated as cells per 1 ml using a haemocy-
tometer (Qiujing Inc.) under the optical microscope (DP72, Olympus).
2.4.2 | Respiratory burst activity of haemolymph
Respiratory burst activity (RB) in haemocytes was quantified by
measuring the reduction of nitroblue tetrazolium (NBT) according to
Anderson, Brubacher, Calvo, Unger, and Burreson (1998) with slight
modifications. Briefly, three replicates of a 100 μl diluted haemo-
lymph solution were added to 1.5-ml centrifuge tube and centrifuged
at 3,000 g for 10 min at 4°C. Then, the supernatant was removed,
and then, the cells in each well were stained with 100 μl of 1 μg/ml
phorbol myristate acetate (PMA, dissolved by DMSO, Sigma) and in-
cubated at 37°C for 30 min. After that, the cells in each well were then
added with 100 μl of 0.3% NBT (dissolved by Hank's, Solarbio) at 37°C
for 30 min. At the end of incubation, centrifugation was conducted at
4°C, 560 g for 10 min. The supernatant was removed, and the reaction
was terminated by adding 200 μL absolute methanol. After standing
for 10 min, the cells were centrifuged at 700 g at 4°C for 10 min. Then,
each well was washed for three times with 70% methanol and air-
dried. Next, 120 μl of 2 mol/L KOH and 140 μl of dimethyl sulfoxide
were added and the colour was subsequently measured in a spectro-
photometer at 630 nm against a KOH/DMSO blank. The respiratory
burst levels of haemolymph were expressed as the NBT reduction per
100 μl of haemolymph (expressed in OD630).
2.4.3 | Phagocytic activity of haemolymph
Phagocytic activity of haemolymph was measured following Gao
et al. (2018). First, a 50 μl diluted haemolymph was coated on a glass
slide for 20 min until the cells had adhered to the slide. Next, the
4 |
slide was carefully washed twice with sterilized phosphate-buffered
saline (PBS), fixed with methanol after the serum was removed,
stained with Giemsa, and cells were observed and counted under
the oil immersion lens to calculate the phagocytic rate.
Phagocytic rate = Number of phagocytes/ Total number of cells
observed × 100.
2.4.4 | Enzyme activities in haemolymph
Immune assay kits (Nanjing Jiancheng Bioengineering Institute,
China) were used to evaluate the activities of lysozyme (LZM) and
acid phosphatase (ACP) in haemolymph. Activity of phenoloxidase
(PO) was measured by the method of Ashida and Söderhäll (1984)
with some modifications.
Activity of ACP was measured at 520 nm with an ultraviolet spec-
trophotometer. One unit of ACP activity was defined as 100 ml haemo-
lymph that could react with a substrate at 37°C for 30 min to produce
1 mg nitrophenol. One unit of LZM activity was defined as the amount
of lysozyme causing a decrease in absorbance of 0.001 per min at
530 nm. One unit of PO activity was defined as the amount of enzyme
causing an increase in absorbance of 0.001/min/ml of haemolymph.
2.4.5 | Antioxidation parameters
Activities of catalase (CAT) and glutathione peroxidase (GPx), and the
content of malondialdehyde (MDA) in haemolymph were analysed
using commercial kits (Nanjing Jiancheng Bioengineering Institute).
GPx activity was determined by measuring the decrease of GSH at
412 nm using H2O2 as substrate. One unit of GPx activity was de-
fined as the production of enzyme per ml haemolymph every min-
ute deduction of enzymatic reaction reduces 1 μmol/L GSH under
the assay condition. The CAT activity was calculated by assaying
the absorbance at 405 nm. One unit of CAT activity was defined as
the production of 1 μmol of H2O2 per second by the haemocyte dis-
solved matter in 1 ml of haemolymph. MDA content was measured
using the thiobarbituric acid (TBA) method, and the absorbance was
read at 532 nm. Results were converted to nm MDA per mg soluble
protein using a standard sample of 10 nm/ml MDA diethyl acetate.
2.5 | Expressions of the immune-related genes
Total RNA from the hepatopancreas of the abalone was extracted
with RNAeasy™ Animal RNA Isolation Kit with Spin Column
(Beyotime, Shanghai, China). The specific primers were designed
using the cDNA complete sequence submitted in GenBank. Mn-sod,
tpx2, hsp70 and the reference gene β-actin, genetic information, and
primer sequences are shown in Table 2. The complementary DNA
(cDNA) was synthesized from 1 mg of total RNA using PrimeScript
RT Reagent Kit with gDNA Eraser (Takara). First-strand cDNA was
CHEN Et al.
TA B L E 2 Real-time quantitative PCR primers for antioxidative
enzymes and heat shock proteins' genes of abalone Haliotis discus
hannai
Gene Sequence (5'-3') Reference
Mn-sod F: ATTTCACTCCAGCCATCCCT DQ821491
R: ACCATTTGGGCTAAGCACCT
tpx2 F: ATTATTGCATTCAGCGATCGG EF103377
R: CTTCATGTTGCCAAGACCAC
hsp70 F: CAGGACTTCTTCAACGGCAAGG DQ324856
R: CGGCAGCACCATAAGCAACAG
β-actin F: ATCTCCTTGACACGACGCTC AY380809.1
R: ACGGATATCAACATCGCACT
Note: F: forward primer; R: reverse primer.
diluted three times using sterilized double-distilled water. qPCR was
carried out in a quantitative thermal cycle (Mastercycler eprealplex;
Eppendorf, Germany). The amplification was performed in a total
volume of 25 μl, containing 0.5 μl of each primer (10 mmol/L), 1 μl of
the diluted first-strand cDNA product, 12.5 μl of 2 SYBR Premix Ex
Taq II (Trans, Japan) and 10.5 μl of sterilized double-distilled water.
The qPCR program was conducted as follows: 95°C for 2 min, fol-
lowed by 40 cycles of 95°C for 10 s, 58°C for 10 s and 72°C for 20 s.
The gene expressions were determined using the real-time PCR, Ct
(2−ΔΔCt) relative quantitative method and with the reference gene
β-actin as the quantitative standard.
2.6 | Challenge test
At the end of 115-day feeding experiment, 15 abalones per tank
were randomly selected for a challenge test with Vibrio parahaemo-
lyticus (from Laboratory of Pathology and Immunology of Aquatic
Animals, OUC). The median lethal concentration of V. parahaemolyti-
cus was determined as 1.0 × 107 CFU/ml after a 10-day pretest. The
bacterial suspension (1.0 × 107 CFU/ml) was injected with a sterilized
microsyringe through the adductor muscle to infect the abalones,
and the injection volume per abalone was 100 μl. The temperature of
the seawater during the 10-day challenge test was about 24°C, and
the death of abalone was recorded daily. The cumulative mortality
rate was calculated as follows:
Cumulative mortality rate (100%) = Dt ∕D0 × 100
where D0 and Dt are the initial number of abalones and the number of
cumulative deaths during the challenge test, respectively.
2.7 | Statistical analysis
Statistical analysis was conducted using SPSS 24.0 (SPSS). Data
were analysed by one-way analysis of variance (ANOVA). When
CHEN Et al. | 5

TA B L E 3 Effects of dietary
Diets Survival (%) SGR (%) DISL (μm/day) CF (%) SB/S (%)
supplementation of antimicrobial peptide
APSH-07 on the growth performance of Control 98.33 ± 0.01 0.33 ± 0.01 a
27.75 ± 3.53 ab
0.77 ± 0.01 ab
0.99 ± 0.06a
juvenile abalone Haliotis discus hannai
LAM 98.33 ± 0.01 0.35 ± 0.01a 29.37 ± 5.14ab 0.71 ± 0.04a 1.09 ± 0.01b

P1 96.67 ± 0.01 0.42 ± 0.01c 37.51 ± 4.57b 0.77 ± 0.03ab 1.30 ± 0.01c

P2 98.33 ± 0.00 0.41 ± 0.01bc 25.52 ± 3.98ab 0.79 ± 0.01b 1.29 ± 0.00 c

P3 97.22 ± 0.01 0.36 ± 0.01ab 21.58 ± 3.62a 0.80 ± 0.01b 1.17 ± 0.01b

Note: LAM: brown alga Laminaria japonica; P1: antimicrobial peptide APSH-07 (7.5 mg/kg); P2:
antimicrobial peptide APSH-07 (15.0 mg/kg); P3: antimicrobial peptide APSH-07 (22.5 mg/kg).
Data with different letters are significantly different at p < .05 level.
Abbreviations: CF, condition factor; DISL, daily increment in shell length; SB/S, ratio of soft body to
shell; SGR, specific growth rate.

significant differences were found, means were compared using 3.2 | Blood parameters
Tukey's test (p < .05).
3.2.1 | Total haemocyte counts

3 | R E S U LTS The total haemocyte counts of abalone in the group of P1 and P2

were significantly higher than those in the group of control and P3
3.1 | Growth performance and body composition (p < .05) (Figure 1a).

Results of the growth performance and body composition of ab-

alone fed the experimental diets for 115 days are presented in
Tables 3 and 4. There was no significant difference in survival rate
(97%–98%) among the groups. The SGR was significantly higher P1
and P2 than that in the control (p < .05). There was no significant
difference in DISL and CF between the abalone in the control and
the dietary antimicrobial peptide supplemented groups (p > .05).
Compared with that in the control group, the SB/S in P1, P2 and P3
groups was significantly higher (p < .05).
There was no significant difference in body moisture content
among all the groups (p > .05). The abalone in the control group had
the highest body crude protein content (p < .05). The highest body
crude lipid content was found in the P2 group (p < .05). And the body
crude ash content in the P3 group was significantly higher than that
in the control group (p < .05).
3.2.2 | Phagocytic activity in haemolymph
The phagocytic activities of haemolymph in abalone fed the diets
supplemented with antimicrobial peptides were significantly higher
than those in the control group (p < .05). The highest value of phago-
cytic activity was found in the group of P1 (Figure 1b).
3.2.3 | Respiratory burst activity in haemolymph
The respiratory burst activity in haemolymph of abalones in the
control group was significantly lower than those in the other groups
(p < .05). The P1 had the highest respiratory burst activity, but had
no significantly difference than P2 (p > .05) (Figure 1c).

TA B L E 4 Effects of dietary
Crude protein Crude ash
supplementation of antimicrobial peptide
Diets Moisture (g/kg) (g/kg) Crude lipid (g/kg) (g/kg)
APSH-07 on body composition of juvenile
abalone Haliotis discus hannai Control 757.76 ± 0.01 765.54 ± 0.98c 46.58 ± 0.08b 80.55 ± 0.24a
a a
LAM 753.83 ± 0.30 737.86 ± 0.15 43.27 ± 0.14 88.43 ± 0.32b
P1 757.11 ± 0.08 753.71 ± 0.30 b 42.15 ± 0.04a 80.56 ± 0.31a
bc c
P2 756.39 ± 0.05 760.25 ± 0.22 49.13 ± 0.06 78.67 ± 0.20a
P3 755.02 ± 0.10 760.24 ± 0.32bc 47.63 ± 0.04bc 88.13 ± 0.10 b

Note: LAM: brown alga Laminaria japonica; P1: antimicrobial peptide APSH-07 (7.5 mg/kg); P2:
antimicrobial peptide APSH-07 (15.0 mg/kg); P3: antimicrobial peptide APSH-07 (22.5 mg/kg).
Data with different letters are significantly different at p < .05 level.
6 | CHEN Et al.

(a) the significantly lower LZM and CAT activities in haemolymph than
2.0
b b those in the other groups (p < .05), while no significant differences
were found among the groups of P1, P2 and P3 (p > .05). The activi-
THC×107 cells·mL–1

1.5
ties of PO, ACP and GPx in the P1 group had the significantly highest
a a values among all the treatments (p < .05).
1.0

0.5
3.2.5 | Content of MDA in haemolymph

The content of MDA in haemolymph of abalone is shown in

0.0
Figure 2. Contents of MDA in the three dietary antimicrobial pep-
Control P1 P2 P3
tides supplemented groups were significantly lower than that in
Treatment
the control (p < .05). There was no significant difference in MDA
(b)
60 content among all the antimicrobial peptides supplementeddgroups
b (p > .05).
b
Phagocytic activity %

b
40
a
3.3 | Gene expressions in hepatopancreas

The expression level of Mn-sod in hepatopancreas in the groups of

20
P1 and P2 was significantly higher than that in the groups of P3 and
control (p < .05; Figure 3a), and the gene expression of Mn-sod in
the P1 group had the highest value. The expression level of tpx2 in
0
the P1 group was significantly higher than those in the other three
Control P1 P2 P3
groups (p < .05; Figure 3b). The expression level of hsp70 in hepato-
Treatment
(c) pancreas was significantly higher in the P1 group than those in the

0.5 other three groups (p < .05; Figure 3c).

Respiratory burst(OD630/107 cells·mL–1)

c
0.4
0.3
0.2
a P3 was significantly higher than those in the other groups (p < .05).
0.1
0.0
Control P1
Treatment
F I G U R E 1 Effects of dietary supplementation of antimicrobial
peptide APSH-07 on the total haemocyte counts (THC, a), phagocytic
activity (b) and respiratory burst (c) in haemolymph of abalone Haliotis
discus hannai. Statistical analysis was performed by one-way analysis
of variance (ANOVA) followed by Tukey's test, using SPSS version
24.0. Means with the different lowercase letters are significantly
different at p < .05 level. Control: control group; P1: antimicrobial
peptide APSH-07 (7.5 mg/kg); P2: antimicrobial peptide APSH-07
(15.0 mg/kg); P3: antimicrobial peptide APSH-07 (22.5 mg/kg)
3.2.4 | Activities of enzymes
Activities of LZM, ACP, PO, CAT and GPx in haemolymph of abalone
are shown in Figure 2. The abalone fed with the control diet showed
bc
3.4 | Cumulative mortality
b
Data on the cumulative mortality after challenge test are shown in
Figure 4. At day 5 after the challenge, the cumulative mortality in
There were no significantly differences in the cumulative mortality
between the groups of P1 and control (p > .05). At day 10, the cu-
mulative mortality had the significantly highest value in the group of
P2 P3 P3, and had the significantly lowest value in the P1 group (p < .05).
There were no significantly differences in the cumulative mortality
between the groups of P2 and control (p > .05).
4 | D I S CUSS I O N
Previous studies have demonstrated that adding a certain content
of antimicrobial peptide in the feed could significantly promote the
growth of L. vannamei (Chai, Leng, Li, Shan, & Song, 2012; Gyan
et al., 2020; Shi et al., 2014). Núñez-Acuña, Marambio, Valenzuela,
Wadsworth, and Gallardo-Escárate (2016) isolated a peptide from
the skin of Salmon salar and found that it could significantly pro-
mote the development of the frontal filament of sea lice. Similarly,
dietary antimicrobial peptide supplementation can improve the
SGR and decrease the FCR of fish, such as common carp Cyprinus
CHEN Et al. | 7

(a) 300 (d) 2.5 b

b b b b
b
a 2.0
LZM activity U/mL

CAT activity U/mL

200
1.5

1.0
100

0.5

0 0.0
Control P1 P2 P3 Control P1 P2 P3
Treatment Treatment

(b) 8 (e)

c 10 c
ACP activity U/mL

GPx activity U/mL

b
b b
4 b
5
a a
2

0 0
Control P1 P2 P3 Control P1 P2 P3
Treatment Treatment

(c) 4 (f) 8 b
c
MDA content nmol/mL

b 6 a
3 a a
PO activity U/mL

a
a
2 4

1 2

0 0
Control P1 P2 P3 Control P1 P2 P3
Treatment Treatment

F I G U R E 2 Effects of dietary supplementation of antimicrobial peptide APSH-07 on activities of lysozyme (LZM) (a), acid phosphatase
(ACP) (b), phenoloxidase (PO) (c), catalase (CAT) (d) and glutathione peroxidase (GPx) (e), and content of malondialdehyde (MDA) (f) in e abalone
Haliotis discus hannai. Statistical analysis was performed by one-way analysis of variance (ANOVA) followed by Tukey's test, using SPSS version
24.0. Means with the different lowercase letters are significantly different at p < .05 level. Control: control group; P1: antimicrobial peptide
APSH-07 (7.5 mg/kg); P2: antimicrobial peptide APSH-07 (15.0 mg/kg); P3: antimicrobial peptide APSH-07 (22.5 mg/kg)

carpio (Dong, Qu, Chen, Wang, & Jiang, 2019), grouper Epinephelus
coioides (Su et al., 2019) and tilapia Oreochromis niloticus × O. aureus
(Lin et al., 2015). So far, there are few researches on abalone about
the antimicrobial peptides. In the present study, the SGR, DISL and
SB/S of abalone showed the best growth-promoting effect in the
group with 7.5 mg/kg of dietary APSH-07 supplementation. In the
previous study, it was found that 90 mg/kg of dietary antimicrobial
peptide APSH-07 supplementation had the better growth perfor-
mance of large yellow croaker (Ge et al., 2019). Meanwhile, this
study indicated that modulation of the intestine microbiota in large
yellow croaker towards a potentially more beneficial microbial com-
munity could be achieved through supplementation of antimicrobial
8 | CHEN Et al.

(a) might also be a contributory factor in better growth performance

1.5
and feed utilization of large yellow croaker (Ge et al., 2019).
Relative mRNA Mn-sod expression

Previous studies have shown that antimicrobial peptides have

c
effects on body compositions in aquatic animals. Dietary supple-
1.0 bc
mentation of antimicrobial peptide (200 mg/kg) could significantly
ab increase the protein content and decrease the lipid content in muscle
a
of M. salmoides (Li et al., 2020). Similar results have been found in
0.5 the studies of L. vannamei (Qin et al., 2016; Shi et al., 2014). Chen
et al. (2010) found that L. vannamei fed diets with 2,000–3,000 mg/
kg of antibacterial peptides had significantly higher body crude pro-
0.0 tein and ash content, but no significant difference in body crude lipid
Control P1 P2 P3 content. Chai et al. (2012) suggest that L. vannamei fed diets with an-
Treatment tibacterial peptide (400–500 mg/kg) could increase lipid contents in
(b)
1.5 muscle, but there was no significant difference in crude protein and
Relative mRNA tpx 2 expression

moisture contents. In the present study, dietary supplementation of

c antimicrobial peptide APSH-07 (7.5 mg/kg) could significantly de-
crease the lipid content in the soft body of abalone. However, the
1.0
ab detailed mechanisms on effects of antimicrobial peptide on body
compositions of aquatic animals are needed to be further studied.
a a Antimicrobial peptides play an important role in the innate im-
0.5
munity of host, which could defence against infectious microbes
such as bacteria, viruses and fungi (Lu, 2018). In addition, many
of antimicrobial peptides have been shown to interact with var-
0.0 ious receptors on lymphocytes, resulting in activation of adaptive
Control P1 P2 P3
immune responses (Oppenheim et al., 2003). It has been reported
Treatment
that antimicrobial peptides showed strong germicidal activity to the
(c)
1.5 expression host and it should participate in the immune responses
Relative mRNA hsp 70 expression

of scallop Argopecten irradians (Zhao et al., 2007). Studies on mol-

c luscs have also shown that antimicrobial peptides (tachyplesin) can
1.0
a neutrophil, macrophage phagocytic cells, epithelial cells, mast cells,
0.5
0.0
Control P1
Treatment
F I G U R E 3 Effects of dietary supplementation of antimicrobial
peptide APSH-07 on the relative expression levels of Mn-sod, tpx2
and hsp70 in haemolymph of abalone Haliotis discus hannai. Values
are means and standard errors of three replicates (means ± SE;
n = 3). Statistical analysis was performed by one-way analysis of
variance (ANOVA) followed by Tukey's test, using SPSS version
24.0. Means with the different lowercase letters are significantly
different at p < .05 level. Control: control group; P1: antimicrobial
peptide APSH-07 (7.5 mg/kg); P2: antimicrobial peptide APSH-07
(15.0 mg/kg); P3: antimicrobial peptide APSH-07 (22.5 mg/kg)
peptide APSH-07. The inclusion of antimicrobial peptide APSH-07
led to elevated species richness, species and phylogenetic diversity.
Furthermore, it was suggested that diversity of intestine microbiota
be a suitable immunopotentiator for feed-based delivery to oysters
ab
(Dorrington & Gomez-Chiarri, 2008). Innate immunity consists of
ab a range of pre-existing rapidly mobilized host defences, including
eosinophils and natural killer cells (Medzhitov & Janeway, 1997).
Moreover, the innate immune system was the only defence weapon
of molluscs (González et al., 2017). Haemolymph is an important
component of the abalone's immune defence system and the primary
P2 P3 site. The phagocytic activity of haemolymph is an important index to
judge the defence function of haemocytes, and the reactive oxy-
gen species (ROS) produced by respiratory explosions are import-
ant mechanisms by which phagocytes kill heterologous organisms
in vivo (Gao et al., 2018). Immunocompetent mollusc haemolymph
cells can provide a rapid and robust line of defence against potential
pathogens for mussel Mytilus galloprovincialis (Venier et al., 2011). In
the present study, dietary supplementation of antimicrobial peptide
APSH-07 succeeded in improving certain cellular immunity parame-
ters in haemolymph of abalone, such as the THC, phagocytic activity
and respiratory burst activity. In summary, the addition of antimicro-
bial peptides enhances non-specific immunity on cellular immunity.
Furthermore, investigations on mollusc immunity have dealt
with not only cellular but also humoral aspect (Cooper, 1976). Acid
phosphatase and LZM have been used as indicators of the adaptive
immune responses in invertebrate (Adel, Yeganeh, Dawood, Safari,
CHEN Et al.
45.0
40.0
Cumulative mortality (%)
35.0
30.0
25.0
20.0
15.0
10.0
5.0
0.0
0 1 2 3
F I G U R E 4 Cumulative mortality of abalone Haliotis discus hannai during a 10-day Vibrio parahaemolyticus challenge test. Values are
means and standard errors of three replicates (means ± SE; n = 3). Statistical analysis was performed by one-way analysis of variance
(ANOVA) followed by Tukey's test, using SPSS version 24.0. Means with the different lowercase letters are significantly different at
p < .05 level. Control: control group; P1: antimicrobial peptide APSH-07 (7.5 mg/kg); P2: antimicrobial peptide APSH-07 (15.0 mg/kg); P3:
antimicrobial peptide APSH-07 (22.5 mg/kg)
& Radhakrishnan, 2017; Fotedar, Evans, & Jones, 2006). Lysozyme,
a kind of mucolytic enzyme, has a unique resistance to bacteria by
destroying the polysaccharide wall of bacteria (He et al., 2014). Acid
phosphatase is an important component of the lysosomes in the im-
mune system, which can effectively kill and digest pathogens when
the microbial pathogens invade the organism (Yin et al., 2014). The
activity of LZM in muscle (Chen et al., 2010), haemolymph and hepa-
topancreas (Song et al., 2010) of L. vannamei was previously reported
to be increased after feeding with the dietary antimicrobial peptide
(extractives from houseflies, Musca domestica and Penaeidins respec-
tively). Meanwhile, the promoting effect of antimicrobial peptides on
the activity of LZM in serum has been widely demonstrated in fish,
such as Asian catfish Clarias batrachu (Kumari, Swain, & Sahoo, 2003),
orange-spotted grouper E. coioides (Zhai, Sun, & Chen, 2017) and
large yellow croaker L. crocea (Ge et al., 2019). Increased activities
of ACP in serum were observed in common carp C. carpio (Nguyen
et al., 2016) and large yellow croaker L. crocea (Ge et al., 2019) fed
with dietary antimicrobial peptides. In the present study, it was also
found that dietary antimicrobial peptide APSH-07 can significantly
enhance the activity of LZM and ACP in haemolymph of abalone.
Hsp70, the primary member of HSPs, functions mostly as molecular
chaperon (Farcy, Serpentini, Fiévet, & Lebel, 2007) and involves in
immune response (Cheng, Liu, Zhang, & He, 2007). In the present
study, the expression of hsp70 gene was significantly up-regulated
by antimicrobial peptides APSH-07, which is similar to the study in
grouper (Su et al., 2019). These above results indicated that antimi-
crobial peptide APSH-07 is a potential non-specific immunomodula-
tory factor, which might induce these enzymes involved in humoral
immune, and then stimulate the non-specific immune response of
the abalone.
Activation of innate defence mechanisms in aquatic animals is
indicated by increased levels of antioxidants and various antioxida-
tive enzymes (Cetinkaya, Silig, & Demirezer, 2002; Gao et al., 2018;
Goţia, Popovici, & Hermeziu, 2001; Itou & Kawatsut, 1996;
| 9
c
bc
P1
b
P2
a P3
Control
4 5 6 7 8 9 10
Time (day)
Muruganandan, Gupta, Kataria, Lal, & Gupta, 2002), which can pro-
tect cells and tissues from being damaged. The dynamic equilibrium
between the antioxidative system and ROS is an important factor
that ensures the health of animals (Seifried, 2007). As the first line
of defence to remove superoxide anions, Mn-sod located in mito-
chondria plays an important role in maintaining the homeostasis of
redox (Qin et al., 2019). Tpx2 is a low molecular weight antioxida-
tive protein, which can protect organisms by eliminate hydroperox-
ide with thioredoxin as an immediate hydrogen donor (Pushpamali
et al., 2008). In the present study, the expression levels of Mn-sod
and tpx2, and the activities of GPx in the P1 group with 7.5 mg/kg
of dietary APSH-07 supplementation were significantly higher than
those in the other groups (p < .05). Meanwhile, the activity of CAT in
the P1 group was significantly higher than that in the control group
without dietary APSH-07 supplementation. Furthermore, the MDA
contents in haemolymph of abalone fed the diets with APSH-07
supplementation were significantly lower than that in the control
group without dietary APSH-07 supplementation. It is suggested
that antimicrobial peptide APSH-07 could enhance the antioxidative
ability of abalone. Similar results were found in previous studies in
large yellow croaker (90 mg/kg) and largemouth bass (200 mg/kg),
in which it was confirmed that APSH-07 could improve the activities
of catalase and superoxide dismutase and the total antioxidative ca-
pacities (Ge et al., 2019; Li et al., 2020).
Dorrington and Gomez-Chiarri (2008) showed that antimicro-
bial peptides (tachyplesin) could reduce the viability of pathogens
in oyster culture. Bi (2018) revealed that the antimicrobial peptides
produced by Bacillus subtilis mutHS-301 had stable bacteriostatic
activity against V. parahaemolyticus. Zhai et al., 2016 certified that
50 mg/kg antimicrobial peptides (surfactin) supplemented in the
diet significantly decreased the number of Escherichia coli in tilapia
O. niloticus. In the present study, the cumulative mortality of abalone
after the challenge test with V. parahaemolyticus was significantly
decreased in the P1 group with 7.5 mg/kg of dietary antimicrobial
10 | CHEN Et al.
peptides APSH-07 supplementation. It is confirmed that 7.5 mg/kg
of dietary APSH-07 supplementation can improve the disease resis-
tance of abalone to V. parahaemolyticus.
In addition, in the present study, excessive supplementation of
dietary antimicrobial peptide APSH-07 (22.5 mg/kg) had signifi-
cantly negative effects on the growth, immune and antioxidation
responses and the disease resistance of abalone to V. parahaemo-
lyticus. Similar results were found in previous studies in yellow cat-
fish Pelteobagrus fulvidraco (Chen et al., 2007), common carp (Dong
et al., 2019) and tilapia (Zhai et al., 2016). However, no significant
negative effects were found on the growth, feed utilization and
anti-stress of large yellow croaker when fed diets supplemented
with antimicrobial peptide APSH-07 even up to 90 mg/kg (Ge
et al., 2019). In regard to the reasons for the disagreement between
these studies, on the one hand, the APSH-07 was originally from
large yellow croaker not abalone. On the other hand, different ani-
mal species could have different dose-dependent responses to an-
timicrobial peptides.
In conclusion, it was found in the present study that dietary
supplementation of antimicrobial peptide APSH-07 had potential
positive effects on growth, immunity, antioxidative capacity and
disease resistance of abalone to V. parahaemolyticus. These effects
were dose-dependent. Under the present experimental condition,
7.5 mg/kg of dietary supplementation of APSH-07 had the better
growth performance, higher antioxidation, immune and disease re-
sistance capacity of abalone. Excessive supplementation of dietary
antimicrobial peptide APSH-07 (22.5 mg/kg) had significantly neg-
ative effects on the growth, immune and antioxidation responses,
and the disease resistance of abalone. Further studies are needed
to determine the optimal level of dietary APSH-07 supplementation
for abalone.
AC K N OW L E D G E M E N T S
This study was financially supported by the National Key R & D
Program of China (2018YFD0900400) and the Earmarked Fund for
Modern Agro-industry Technology Research System (CARS-49).
CO N FL I C T O F I N T E R E S T
The authors declare that there are no conflicts of interest.
E T H I C A L A P P ROVA L
The present study was carried out strictly according to the recom-
mendations in the Guide for the Use of Experimental Animals of the
Ocean University of China.
DATA AVA I L A B I L I T Y S TAT E M E N T
The data that support the findings of this study are available from
the corresponding author upon reasonable request.
ORCID
Yanjiao Zhang https://orcid.org/0000-0002-7471-9021
Wenbing Zhang https://orcid.org/0000-0002-6546-3087
REFERENCES
Adel, M., Yeganeh, S., Dawood, M. A. O., Safari, R., & Radhakrishnan,
S. (2017). Effects of pediococcus pentosaceus supplementation on
growth performance, intestinal microflora and disease resistance of
white shrimp, Litopenaeus vannamei. Aquaculture Nutrition, 23(3), 1–9.
Anderson, R., Brubacher, L., Calvo, L. R., Unger, M., & Burreson, E.
(1998). Effects of tributyltin and hypoxia on the progression of
Perkinsus marinus infections and host defence mechanisms in oyster,
Crassostrea virginica (gmelin). Journal of Fish Diseases, 21(5), 371–380.
https://doi.org/10.1046/j.1365-2761.1998.00128.x
Ashida, M., & Söderhäll, K. (1984). The prophenoloxidase activating sys-
tem in crayfish. Immunological Reviews, 77(1), 21–26.
Bi, N. (2018). The experimental study of using the sea cucumberi-type lyso-
zyme and antibacterial peptides to feedsea cucumber and chicken. Dalin:
Dalian Polytechnic University.
Britz, P. J. (1996). The suitability of selected protein sources for inclu-
sion in formulated diets for the South African abalone, Haliotis
midae. Aquaculture, 140(1–2), 63–73. https://doi.org/10.1016/0044-
8486(95)01197-8
Cetinkaya, O., Silig, Y. S., & Demirezer, L. O. (2002). The effects of rumex
patientia extract on rat liver and erythrocyte antioxidant enzyme
system. Pharmazie Die, 57(7), 487–488.
Chai, X., Leng, X., Li, X., Shan, L., & Song, H. (2012). Effect of antibacterial
peptide on growth and serum non-specific immunity of Litopenaeus
vannamei. Freshwater Fisheries, 42(4), 59–62.
Chen, B., Cao, J., Chen, P., Zhao, H., Lan, H., & Zhu, X. (2010). Effects of
antibacterial peptides of musca domestica on growth performance
and immunerelated indicators in Litopenaeus vannamei. Journal of
Fishery Sciences of China, 2(11), 258–266.
Chen, P., Cao, J., Zhu, X., Chen, S., Ma, L., Lan, H., & Lin, J. (2007). Effects
of antimicrobial peptides from Musca domestica on the growth and
phagocytosis activity of white blood cells in Pelteobagrus fulvidraco.
Abstract compilation of papers of the academic annual meeting of
china fishery society and forum on aquatic microecology regulation
technology in 2007, 58.
Cheng, P., Liu, X., Zhang, G., & He, J. (2007). Cloning and expression anal-
ysis of a HSP70 gene from pacific abalone (Haliotis discus hannai). Fish
& Shellfish Immunology, 22(1–2), 77–87. https://doi.org/10.1016/j.
fsi.2006.03.014
Chertov, O., Michiel, D. F., Xu, L., Wang, J. M., Tani, K., Murphy, W. J., …
Oppenheim, J. J. (1996). Identification of defensin-1, defensin-2, and
cap37/azurocidin as t-cell chemoattractant proteins released from
interleukin-8-stimulated neutrophils. Journal of Biological Chemistry,
271(6), 2935–2940. https://doi.org/10.1074/jbc.271.6.2935
Chou, H., Wen, H., Kuo, T., Lin, C., & Chen, W. (2010). Interaction of
cationic antimicrobial peptides with phospholipid vesicles and
their antibacterial activity. Peptides, 31(10), 1811–1820. https://doi.
org/10.1016/j.peptides.2010.06.021
Cooper, E. L. (1976). Immunity and neoplasia in mollusks. Israel Journal of
Medical Sciences, 12(4–5), 479–494.
Dennison, S. R., Harris, F., & Phoenix, D. A. (2014). Magainins-a model
for development of eukaryotic antimicrobial peptides (AMPs), Germany:
Novel Antimicrobial Agents and Strategies. Wiley-VCH Verlag GmbH
& Co. KGaA.
Destoumieux, D., Munoz, M., Bulet, P., & Bachère, E. (2000). Penaeidins,
a family of antimicrobial peptides from penaeid shrimp (Crustacea,
Decapoda). Cellular & Molecular Life Sciences, 57(8–9), 1260–1271.
https://doi.org/10.1007/PL00000764
Dong, X., Qu, G., Chen, Y., Wang, G., & Jiang, D. (2019). Effects of an-
timicrobial peptides on growth, morphology of foregut villi and re-
lated genes mrna expression in the common carp (Cyprinus carpio).
Aquaculture Research, 50(7), 1752–1761.
Dorrington, T., & Gomez-Chiarri, M. (2008). Antimicrobial peptides for
use in oyster aquaculture: Effect on pathogens, commensals, and
CHEN Et al.
eukaryotic expression systems. Journal of Shellfish Research, 27(2),
365–373. https://doi.org/10.2983/0730-8000(2008)27[365:APFUI
O]2.0.CO;2
Farcy, E., Serpentini, A., Fiévet, B., & Lebel, J.-M. (2007). Identification of
cDNAs encoding HSP70 and HSP90 in the abalone Haliotis tubercu-
lata: Transcriptional induction in response to thermal stress in hemo-
cyte primary culture. Comparative Biochemistry and Physiology Part
B: Biochemistry and Molecular Biology, 146(4), 540–550. https://doi.
org/10.1016/j.cbpb.2006.12.006
Fishery Bureau, Ministry of Agriculture, People’s Republic of China
(2019). China fishery statistical yearbook 2019. Beijing, China: China
Agriculture Press.
Fotedar, S., Evans, L., & Jones, B. (2006). Effect of holding duration
on the immune system of western rock lobster, panulirus cyg-
nus. Comparative Biochemistry & Physiology Part A Molecular &
Integrative Physiology, 143(4), 479–487. https://doi.org/10.1016/j.
cbpa.2006.01.010
Gao, X., Zhang, M., Li, X., Han, Y., Wu, F., & Liu, Y. (2018). Effects of a
probiotic (Bacillus licheniformis) on the growth, immunity, and disease
resistance of Haliotis discus hannai Ino. Fish & Shellfish Immunology,
76, 143–152. https://doi.org/10.1016/j.fsi.2018.02.028
Ge, H., Wang, Q., Chen, H., Liu, G., Pan, Y., Chen, J., … Mai, K. (2019).
Effects of antimicrobial peptide APSH-07 on the growth perfor-
mance, anti-oxidation responses, stress resistance and intestine
microbiota in large yellow croaker Larimichthys crocea. Aquaculture
Nutrition, 1–12.
González, R., Brokordt, K., Cárcamo, C. B., Coba de la Peña, T., Oyanedel,
D., Mercado, L., & Schmitt, P. (2017). Molecular characterization and
protein localization of the antimicrobial peptide big defensin from
the scallop Argopecten purpuratus after Vibrio splendidus challenge.
Fish & Shellfish Immunology, 68, 173–179. https://doi.org/10.1016/j.
fsi.2017.07.010
Goţia, S., Popovici, I., & Hermeziu, B. (2001). Antioxidant enzymes lev-
els in children with juvenile rheumatoid arthritis. Revista Medico-
chirurgicala a Societatii de Medici si Naturalisti Din Iasi, 105(3),
499–503.
Gyan, W. R., Yang, Q., Tan, B., Jan, S. S., Jiang, L., Chi, S., … Shuang, Z.
(2020). Effects of antimicrobial peptides on growth, feed utilization,
serum biochemical indices and disease resistance of juvenile shrimp,
Litopenaeus vannamei. Aquaculture Research, 51(3), 1–10.
Hancock, R. E. W., & Annett, R. (2002). Role of membranes in the ac-
tivities of antimicrobial cationic peptides. Fems Microbiology Letters,
206(2), 143–149. https://doi.org/10.1111/j.1574-6968.2002.tb110
00.x
He, Y., Liu, B., Xie, J., Ge, X., Xu, P., Lu, Y., … Lu, Z. (2014). Effects of anti-
bacterial peptide extracted from bacillus subtilis fmbj on the growth,
physiological response and disease resistance of megalobrama am-
blycephala. The Israeli Journal of Aquaculture-Bamidgeh, 66, 1–10.
Horwitz, W., Allee, G., Latimer, G., & Kenneth, H. (1980). Official meth-
ods of analysis of the association of official analytical chemists.
Journal of Pharmaceutical Sciences, 60(4), 334.
Itou, T., lida, T., & Kawatsut, H. (1996). Kinetics of oxygen metabolism
during respiratory burst in Japanese eel neutrophils. Developmental
& Comparative Immunology, 20(5), 323–330. https://doi.org/10.1016/
S0145-305X(96)00028-6
Jiang, H., Liu, X., Chang, Y., Liu, M., & Wang, G. (2013). Effects of di-
etary supplementation of probiotic shewanella colwelliana WA64,
shewanella olleyana WA65 on the innate immunity and disease
resistance of abalone, Haliotis discus hannai Ino. Fish & Shellfish
Immunology, 35(1), 86–91. https://doi.org/10.1016/j.fsi.2013.04.009
Jiang, W., Fang, J., Li, J., Jiang, Z., & Chen, Q. (2017). Effects of tempera-
ture change on physiological and biochemical activities of Haliotis
discus hannai Ino. Journal of Fishery Sciences of China, 24(2), 220–230.
Koczulla, A. R., & Bals, R. (2003). Antimicrobial peptides. Drugs, 63(4),
389–406. https://doi.org/10.2165/00003495-200363040-00005
| 11
Kumari, J., Swain, T., & Sahoo, P. (2003). Dietary bovine lactoferrin in-
duces changes in immunity level and disease resistance in Asian cat-
fish Clarias batrachus. Veterinary Immunology and Immunopathology,
94(1–2), 1–9. https://doi.org/10.1016/S0165-2427(03)00065-5
Li, J., Wang, M., Fang, J., Liu, X., Mao, Y., Liu, G., & Bian, D. (2017).
Reproductive performance of one-year-old pacific abalone (Haliotis
discus hannai) and its crossbreeding effect on offspring growth and
survival. Aquaculture, 473, 110–114. https://doi.org/10.1016/j.aquac
ulture.2017.01.034
Li, S., Chi, S. Y., Cheng, X., Wu, C., Xu, Q., Qu, P., … Liu, Y. (2020). Effects
of antimicrobial peptides on the growth performance, antioxidant
and intestinal function in juvenile largemouth bass, Micropterus
salmoides. Aquaculture Reports, 16, https://doi.org/10.1016/j.
aqrep.2019.100252
Lin, X., Chen, W., Lin, S., & Luo, L. (2015). Effects of dietary cecropin
on growth, non-specific immunity and disease resistance of tilapia
(O reochromis niloticus× O. Aureus). Aquaculture Research, 46(12),
2999–3007.
Liu, X., Lu, S., Guo, W., Xi, B., & Wang, W. (2018). Antibiotics in the
aquatic environments: A review of lakes, China. Science of the
Total Environment, 627, 1195–1208. https://doi.org/10.1016/j.scito
tenv.2018.01.271
Lu, W. (2018). Antimicrobial peptides. Seminars in Cell & Developmental
Biology, 88, 105–106.
Lv, Z., Yuan, X., Zhu, Z., & Yin, Z. (2012). Effects of antimicrobial peptides
extract on the laying performance, egg quality, serum biochemical
parameters and intestinal microbial flora of laying hens. Chinese
Journal of Animal Science, 48(15), 47–51.
Mai, K., Mercer, J. P., & Donlon, J. (1995). Comparative studies on the
nutrition of two species of abalone, Haliotis tuberculata L. and Haliotis
discus hannai Ino. IV. Optimum dietary protein level for growth.
Aquaculture, 136(1–2), 165–180.
Medzhitov, R., & Janeway, C. A. (1997). Innate immunity: The virtues of
a nonclonal system of recognition. Cell, 91(3), 295–298. https://doi.
org/10.1016/S0092-8674(00)80412-2
Michael, Z. (2002). Antimicrobial peptides of multicellular organisms.
Nature, 415(6870), 389–395.
Muruganandan, S., Gupta, S., Kataria, M., Lal, J., & Gupta, P. K. (2002).
Mangiferin protects the streptozotocin-induced oxidative damage to
cardiac and renal tissues in rats. Toxicology, 176(3), 165–173. https://
doi.org/10.1016/S0300-483X(02)00069-0
Nguyen, H. V., Caruso, D., Lebrun, M., Nguyen, N. T., Trinh, T. T., Meile,
J. C., … Sarter, S. (2016). Antibacterial activity of litsea cubeba (lau-
raceae, may chang) and its effects on the biological response of
common carp Cyprinus carpio challenged with Aeromonas hydrophila.
Journal of Applied Microbiology, 121(2), 341–351.
Núñez-Acuña, G., Marambio, J. P., Valenzuela, T., Wadsworth, S.,
& Gallardo-Escárate, C. (2016). Antimicrobial peptides from
salmon salar skin induce frontal filament development and olfac-
tory/cuticle-related genes in the sea louse Caligus rogercresseyi.
Aquaculture, 464, 171–177. https://doi.org/10.1016/j.aquac
ulture.2016.06.023
Oppenheim, J. J., Biragyn, A., Kwak, L. W., & Yang, D. (2003). Roles of an-
timicrobial peptides such as defensins in innate and adaptive immu-
nity. Annals of the Rheumatic Diseases, 62 (Suppl. Ⅱ), ii17–ii21. https://
doi.org/10.1136/ard.62.suppl_2.ii17
Pushpamali, W. A., De Zoysa, M., Kang, H.-S., Oh, C. H., Whang, I., Kim,
S. J., & Lee, J. (2008). Comparative study of two thioredoxin per-
oxidases from disk abalone (Haliotis discus discus): Cloning, recom-
binant protein purification, characterization of antioxidant activities
and expression analysis. Fish & Shellfish Immunology, 24(3), 294–307.
https://doi.org/10.1016/j.fsi.2007.11.016
Qin, S., He, Y., Kuang, J., Fan, S., Huang, P., & Wang, W. (2019). Research
progress on the extraction and application of Mn-sod. Science and
Technology of Food Industry, 15, 365–367.
12 | CHEN Et al.
Qin, Z., Liang, J., Long, S., Niu, Z., He, C., & Huang, J. (2016). Effects
of antibacterial peptides on growth performance and body com-
position of Penaeus vannamei. Journal of Southern Agriculture, 47(4),
674–678.
Seifried, H. E. (2007). Oxidative stress and antioxidants: A link to disease
and prevention. The Journal of Nutritional Biochemistry, 18(3), 168–
171. https://doi.org/10.1016/j.jnutbio.2006.12.003
Shi, G., Sun, L., Wang, Y., Liu, H., Xu, D., Nie, F., … Ye, R. (2014). Effects
of antibacterial lipopeptides produced by Bacillus subtilis NT-6 in
solid-state fermentation on growth performance and non-specific
immunity of Litopenaeus vannamei. Guangdong Agricultural Sciences,
22(10), 99–103.
Song, L., Hu, B., Wang, A., Mao, Q., Zhang, Y., & Pan, X. (2010). Effects of
antibacterial peptide on growth and immunity of Penaeus vannamei.
Journal of Zhanjiang Ocean University, 30(03), 28–30.
Su, Y.-L., Chen, G., Chen, L.-S., Li, J.-Z., Wang, G., He, J.-Y., … Sun, H.-Y.
(2019). Effects of antimicrobial peptides on serum biochemical pa-
rameters, antioxidant activity and non-specific immune responses
in Epinephelus coioides. Fish & Shellfish Immunology, 86, 1081–1087.
https://doi.org/10.1016/j.fsi.2018.12.056
Venier, P., Varotto, L., Rosani, U., Millino, C., Celegato, B., Bernante, F., …
Pallavicini, A. (2011). Insights into the innate immunity of the med-
iterranean mussel Mytilus galloprovincialis. BMC Genomics, 12(1), 69.
https://doi.org/10.1186/1471-2164-12-69
Wu, C., Zhang, W., Mai, K., Liang, X., Xu, W., Wang, J., & Ma, H. (2010).
Molecular cloning, characterization and mrna expression of seleni-
um-binding protein in abalone (Haliotis discus hannai Ino): Response
to dietary selenium, iron and zinc. Fish & Shellfish Immunology, 29(1),
117–125. https://doi.org/10.1016/j.fsi.2010.02.028
Xin, L., Chen, W., Lin, S., & Lin, L. (2015). Effects of dietary cecropin on growth,
non-specific immunity and disease resistance of tilapia (Oreochromis ni-
loticus × O. Aureus). Aquaculture Research, 46(12), 2999–3007.
Yin, F., Dan, X., Sun, P., Shi, Z., Gao, Q., Peng, S., & Li, A. (2014). Growth,
feed intake and immune responses of orange-spotted grouper
(Epinephelus coioides) exposed to low infectious doses of ectopar-
asite (Cryptocaryon irritans). Fish & Shellfish Immunology, 36(1), 291–
298. https://doi.org/10.1016/j.fsi.2013.11.019
Zhai, S., Shi, Q., & Chen, X. (2016). Effect of dietary antimicrobial pep-
tides-surfactin supplementation on parameters of intestinal health
indices of genetically improved farmed tilapia (gift, Oreochromis ni-
loticus). Acta Hydrobiologica Sinica, 40(4), 823–829.
Zhai, S., Sun, X., & Chen, X. (2017). Effects of antimicrobial peptides
surfactin administration on growth performance, intestinal diges-
tive enzymes activities and some serum biochemical parameters of
orange-spotted grouper (Epinephelus coioides) juveniles. The Israeli
Journal of Aquaculture-Bamidgeh, 69, 1–7.
Zhang, Q., Tan, B., Mai, K., Zhang, W., Ma, H., Ai, Q., … Liufu, Z. (2011).
Dietary administration of bacillus (B. Licheniformis and B. Subtilis)
and isomaltooligosaccharide influences the intestinal microflora,
immunological parameters and resistance against vibrio alginolyti-
cus in shrimp, Penaeus japonicus (decapoda: Penaeidae). Aquaculture
Research, 42(7), 943–952.
Zhang, W., Mai, K., Xu, W., Tan, B., Ai, Q., Liufu, Z., … Wang, X. (2007).
Interaction between vitamins a and d on growth and metabolic re-
sponses of abalone Haliotis discus hannai Ino. Journal of Shellfish
Research, 26(1), 51–58. https://doi.org/10.2983/0730-8000(2007)2
6[51:IBVAAD]2.0.CO;2
Zhao, J., Song, L., Li, C., Ni, D., Wu, L., Zhu, L., … Xu, W. (2007). Molecular
cloning, expression of a big defensin gene from bay scallop Argopecten
irradians and the antimicrobial activity of its recombinant protein.
Molecular Immunology, 44(4), 360–368. https://doi.org/10.1016/j.
molimm.2006.02.025
Zhou, X. X., Wang, Y. B., & Li, W. F. (2008). Effect of feeding apidaecin
on common carp (Cyprinus carpio) growth performances and immune
function. Aquaculture, 279(1), 108–112. https://doi.org/10.1016/j.
aquaculture.2008.04.024
How to cite this article: ChenF, Li X, Wu Y, et al. Influences of
dietary antimicrobial peptide APSH-07 on the growth
performance, immune response and vibriosis resistance of
abalone Haliotis discus hannai Ino. Aquacult Nutr. 2020;00:1–
12. https://doi.org/10.1111/anu.13124