biosensors
Communication
Naked-Eye Detection of Food-Borne Pathogens Using
Multiplex Hyperbranched Rolling Circle Amplification
and Magnetic Particles
Congli Tang † , Hongna Liu † , Wenjing Pan, Meiling Wang, Jie Ren, Zhu Chen, Hui Chen, Yan Deng and Song Li *
Citation: Tang, C.; Liu, H.; Pan, W.;
Wang, M.; Ren, J.; Chen, Z.; Chen, H.;
Deng, Y.; Li, S. Naked-Eye Detection
of Food-Borne Pathogens Using
Multiplex Hyperbranched Rolling
Circle Amplification and Magnetic
Particles. Biosensors 2022, 12, 1075.
https://doi.org/10.3390/
bios12121075
Received: 19 October 2022
Accepted: 19 November 2022
Published: 25 November 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Biosensors 2022, 12, 1075. https://doi.org/10.3390/bios12121075
Hunan Key Laboratory of Biomedical Nanomaterials and Devices, Hunan University of Technology,
Zhuzhou 412007, China
* Correspondence: sosong1980@gmail.com
† These authors contributed equally to this work.
Abstract: Food safety is a significant public health issue in both developed and developing coun-
tries. Previous detection methods struggle to meet the current demands. We have proposed a
new way to detect pathogens, allowing detection to be visualized by the naked eye. Using our
newly developed assay, when target genes are present in the reaction, corresponding padlock
probes form closed-loop molecules. Each reaction tube contains a pair of universal primers for
identifying target genes. The ring padlock probes and corresponding universal primers start
hyperbranched rolling circle amplification (HRCA) under the action of the polymerase, so as to
gain branched chain amplification products, which are irreversibly entangled with magnetic par-
ticles to form aggregated magnetic particle clusters, and the detection results are visible to naked
eyes. On the contrary, by using linear probes, the clustering of magnetic particles will not be
produced. This method was applied to the detection of five food-borne pathogens enterohemor-
rhagic Escherichia coli (EHEC), enterotoxigenic Escherichia coli (ETEC), enteropathogenic Escherichia coli
(EPEC), enteroinvasive Escherichia coli (EIEC) and Escherichia coli (E. coli), with detection limits of
1 × 103 , 1 × 104 , 1 × 103 , 1 × 104 and 1 × 102 CFU/mL, respectively. This method can realize mul-
tiplex automatic detection of nucleic acid and shows great development potential in the field of
molecular diagnosis.
Keywords: food-borne pathogens; magnetic particles; hyperbranched rolling circle amplification;
multiple detection; naked-eye detection
1. Introduction
Food is the most important necessity for the survival of living organisms. Unfortunately,
many high-risk pathogens spread through various foods causing human sickness [1]. Food-
borne diseases are a major public health matter around the world [2,3]. Pathogens are
transmitted through food every day and have become a life-threatening issue affecting
millions of people [4], in both developed and developing countries. According to data
from the Centers for Disease Control and Prevention, more than 48 million people are ill,
128,000 are hospitalized and 3000 die from food-borne diseases in the United States every
year [5]. The potential of a disease outbreak increases as international food trade increases [6].
This is a continuing threat to public health, especially for children, the elderly and pregnant
women who have more vulnerable immune systems [7]. Therefore, food safety has become
an essential worldwide concern for consumers, industries and regulatory agencies.
In recent years, the simplicity of portable field detection devices and the fact that the
detection results are visible to the naked eye have led researchers to study visual detection
in depth. Hu et al. established a method for detecting Staphylococcus aureus based on recom-
binase polymerase amplification and polymer flocculation sedimentation [8]. Vidya et al.
used gold nanoparticles to detect E. coli by colorimetry [9], while Donghoon et al., used
https://www.mdpi.com/journal/biosensors
Biosensors 2022, 12, 1075 2 of 11

platinum-coated magnetic nanoparticle clusters (Pt/MNCs) [10]. In Sang et al., visible

detection resulted from a gold enhancement process following the electrostatic interaction
between gold nanoparticles and target DNA [11]. Lin et al. proposed a new method for
nucleic acid sequence specificity and naked eye detection through isothermal amplification
and magnetic particle-mediated aggregation [12]. Although the visualization methods
proposed by the above researchers simplify the detection and reduce the dependence on the
instrument, these methods can only detect one pathogen at a time, not allowing detection
of multiple samples in one experiment.
Therefore, in order to achieve multiplex detection, Mohammadali et al. showed a
new type of portable point of care (POC) diagnostic device, which detected both E. coli
and Staphylococcus aureus (S. aureus) by colorimetry [13]. Seung-Ho et al. developed
and optimized an optical fiber sensor, which can detect three kinds of pathogenic bac-
teria from food at the same time (E. coli, S. aureus and Listeria monocytogenes) [14]. The
principle behind this method is antibody antigen reaction, and the signal needs specific
detectors and computers. Shi et al. was also able to simultaneously detect three pathogens
(Salmonella typhimurium, S. aureus and L. monocytogenes) in one experiment by using mul-
tiplex PCR amplification [15]. Similarly, researchers Maier et al., Li et al., Sun et al.
and Zhong et al. adopted multiplex PCR to detect multiple pathogens at once [16–19].
Suo et al. combined multiple PCR amplifications with microarray technology [20]. A major
disadvantage to the Suo et al. method was requiring temperature cycling systems, gel elec-
trophoresis systems and gel imaging systems, which is costly and requires professionally
trained personnel. Zhao established a lateral flow detection method based on 10-channel
up-conversion fluorescence technology [21]. This method used a laser scanning disk and
was able to detect 10 popular food-borne pathogens quickly and simultaneously. Although
the above-mentioned methods were able to execute the multiplex detection of pathogens,
they are highly dependent on costly instruments and professionally trained operators.
In our research, taking advantage of some excellent properties of functional magnetic
nanoparticles (NPs), we will propose a new method of multiple hyperbranched rolling
circle amplification based on the naked eye detection of magnetic particles to detect five
food-borne pathogens. The method only needs a simple temperature control system to
realize constant temperature visual detection of nucleic acid, which is beneficial to the
automation and high-throughput detection of nucleic acid.

2. Materials and Methods

In this study, using characteristics of functional magnetic particles (MPs), we put for-
ward a new method using multiplex hyperbranched rolling circle amplification (MHRCA-
MPND) resulting in naked-eye detection of five food-borne pathogens: E. coli, EPEC, ETEC,
EHEC and EIEC.
The principle of this assay is demonstrated in Figure 1. A padlock probe with a
length of about 90 nucleotides consists of a target gene recognition sequence, a universal
primer recognition sequence, a random sequence and a phosphorylated 5’ end (Figure 1c).
First, all the padlock probes are connected in a tube. When target genes are present, the
corresponding padlock probes form closed ring molecules; otherwise they will stay as
linear probes. Then the product is distributed to different amplification reaction tubes,
each tube containing a pair of universal primers to detect a specific target gene. Looped
padlock probes and corresponding universal primers start hyperbranched rolling circle
amplification (HRCA) under the action of polymerase, thus obtaining branched chain
amplification products. The amplified products interact with the magnetic particles to
form aggregated magnetic particle clusters, allowing the detection results to be visible to
the naked eye (Figure 1a). On the contrary, no aggregated magnetic particle clusters are
generated with linear probes, meaning no target gene was present and thus no bacteria
was detected (Figure 1b).
 ked eye. This research idea reduces the equipment relied on for temperature cycling re-
action and detection signal processing, which greatly simplifies required equipment, al-
lows automation and can be detected by the naked eye. This new method combined with
a portable apparatus can be utilized in developing countries and under-resourced areas
Biosensors 2022, 12, 1075 to allow quick and accurate visual detection on site. 3 of 11

(a)

(b)

Figure 1. Cont.
 Biosensors 2022, 12, x FOR PEER REVIEW
Biosensors 2022, 12, 1075 4 of 11

(c)
Figure 1.
Figure 1. Schematic Schematic
illustration of illustration
MHRCA-MPND. of MHRCA-MPND. (a) gene
(a) When the target When the target
exists, gene exists, t
the padlock
probes is linked into a loop, and it is amplified with the universal primer by a hyperbranched rollingby a hyp
probes is linked into a loop, and it is amplified with the universal primer
rolling circle
circle amplification. amplification.
The product The product
is irreversibly is irreversibly
agglomerated agglomerated
with magnetic particles,with
and magnetic
the pa
the isdetection
detection result visible toresult is visible
the naked toWhen
eye. (b) the naked eye.gene
the target (b) non-exists,
When the thetarget genereaction
linking non-exists, the
actionreaction
and amplification and amplification
are not carried reaction
out, no are
HRCA notproduct
carriedisout, no HRCA
entangled product
with the is entangle
magnetic
magnetic particles and the magnetic particles are re-suspended in the
particles and the magnetic particles are re-suspended in the solution. (c) Padlock probe structure. solution. (c) Pad
structure.
HRCA increases the target sequence exponentially, and a large number of amplified
products can beExperimental
2.1. obtained in a Sample
short time during one experiment at a constant temperature.
The application of magnetic particles makes the detection results visible to the naked
All strains used in this study were purchased from the China Center of
eye. This research idea reduces the equipment relied on for temperature cycling reaction
Culture
and detection signalCollection
processing, (CICC).
which Each
greatlyofsimplifies
the bacteria strains
required was cultured
equipment, allowsfollowing
ufacturer’s instruction, and a plate count was used to determine
automation and can be detected by the naked eye. This new method combined with a the stock conc
The stock
portable apparatus canofbeeach reference
utilized strain was
in developing heat lysed
countries at 95 °C for 10 areas
and under-resourced min. to
The refere
allow quickand
and gene targets
accurate visualselected
detectionfor
oneach
site. category are listed in Table 1. Table 2 sho
quence information of probes and primers used in the experiment.
2.1. Experimental Sample
All strains
Tableused in thistarget
1. Specific studymolecules
were purchased from the
corresponding to China Center
pathogenic of Industrial
bacteria.
Culture Collection (CICC). Each of the bacteria strains was cultured following the manufac-
Reference
turer’s instruction, and aStrain
plate count wasStrain uidAthe stock
used to determine rfbeconcentration.
stx1 eaeTheipaH
stock of each reference strain was heat lysed at 95 ◦ C for 10 min. The reference strain and
E. coli CICC 10305 + - - - -
gene targets selected for each category are listed in Table 1. Table 2 shows the sequence
EIEC CICC 10661 + - - - +
information of probes and primers used in the experiment.
EPEC CICC 10664 + - - + -
ETEC
Table 1. Specific target CICC 10667
molecules corresponding +
to pathogenic bacteria. - - - -
EHEC CICC 21530 + + + + -
Reference Strain Strain uidA rfbe stx1 eae ipaH LT ST
E. coli CICC 10305 + - - - - - -
EIEC CICC 10661 + - - - + - -
EPEC CICC 10664 + - - + - - -
ETEC CICC 10667 + - - - - + +
EHEC CICC 21530 + + + + - - -
Biosensors 2022, 12, 1075 5 of 11

Table 2. Probes and primers design.

Target Gene Sequence Name Sequence

Padlock probe p-ATCACCATTCCCGGCGCGTCTCGTGGCTGAGAGCCTGGTAGTCGGAACTGGCAGGCAGGACGCACGCGTAAGCCGTTTTCATCGGTA
Primer 1 CGTCTCGTGGCTGAGAG
uidA Primer 2 TTACGCGTGCGTCCTGC
Simulate target CGCCGGGAATGGTGATTACCGATGAAAACGGC
Padlock probe p-CATGCTTTCAGGACTACGCTCCATGATAGGCACGCCTGGTAGTCGGAACGTGGCAGGATTAGCTAGCCGATGTCCGCAGTAATTGCTACTATT
Primer 1 GCTCCATGATAGGCACG
ST Primer 2 GGACATCGGCTAGCTAATC
Simulate target GTAGTCCTGAAAGCATGAATAGTAGCAATTACTGC
Padlock probe p-GTTCCTCTCGCGTGATCTAACGGAGGCTAAGTTCCCTGGTAGTCGGAACGTGGCAGCGCAAGGCACCTCCTGCCAAAGCCGGTTTGT
Primer 1 TAACGGAGGCTAAGTTC
LT Primer 2 AGGAGGTGCCTTGCG
Simulate target GATCACGCGAGAGGAACACAAACCGGCTTTGGC
Padlock probe p-GGAAAGGCGGTCAAGGAACCACGTAAGGCCGTATCGACCTGGTAGTCGGAACGTGGCAGGTGTCAAGGCTTCACGCTGCTGGCAGAGACGGTATC
IpaH Primer 1 CACGTAAGGCCGTATCGA
Primer 2 GCGTGAAGCCTTGACAC
Simulate target GTTCCTTGACCGCCTTTCCGATACCGTCTCTGCCAGCA
Padlock probe p-CCGTTCCATAATGTTGTTGTGAAGCGTAGGCACCTGGTAGTCGGAACGTGGCAGAGTAAGGTCCTACCGGTCTGCAGATTAACCTCTG
eae Primer 1 TTGTGAAGCGTAGGCA
Primer 2 CCGGTAGGACCTTACT
Simulate target CAACATTATGGAACGGCAGAGGTTAATCTGCAGA
Padlock probe p-GTAATAGTTTTATTTCCAGAGCAGTCCTACCTTGCCCTGGTAGTCGGAACGTGGCAGAGGCAAGCGCGCATCTCCACCTTCACCTGTAG
Primer 1 GAGCAGTCCTACCTTGC
rfbE Primer 2 AGATGCGCGCTTGCCT
Simulate target TGGAAATAAAACTATTACTACAGGTGAAGGTGG
Padlock probe p-CAGACAATGTAACCGCTGCCAAGCCTGATCGTCTGCCTGGTAGTCGGAACGTGGCAGGTGTTCGAGCACGCTCCGTGGTATAGCTACTGTCAC
Primer 1 CCAAGCCTGATCGTCTG
Stx1 Primer 2 GGAGCGTGCTCGAACAC
Simulate target CAGCGGTTACATTGTCTGGTGACAGTAGCTATACCAC
Padlock probe p-GCTGACCTCGGCATGGACGCATGCCTTCTAACCCTGGTAGTCGGAACGTGGCAGCGCTTAGTAGCTCCACAGGTAGCACTATGCC
Negative Primer 1 ACGCATGCCTTCTAAC
Control Primer 2 GTGGAGCTACTAAGCG
Simulate target CCATGCCGAGGTCAGCGGCATAGTGCTACCT
Biosensors 2022, 12, 1075 6 of 11

2.2. Ligation
A simulated target of each gene was designed to evaluate the feasibility of this method.
The ligation mixture totaled 20 µL and contained 10 × Taq DNA Ligase Buffer 2 µL,
10 µM padlock probe 2 µL, Taq DNA Ligase 1 µL, 10 µM simulated target 2 µL or pre-
heated reference strain sample; nuclease-free water was added to the reaction system to a
total of 20 µL. The reaction mixture was incubated at 55 ◦ C for 1 h.

2.3. HRCA Reaction

The HRCA was performed in a 40 µL volume containing 2 µL ligation product,
10 × Buffer 4 µL, 10 µM universal primer 2 µL, 10 mg/mL BSA 0.8 µL, 10 µM dNTP 1.6 µL,
Phi29 DNA polymerase 1 µL and nuclease-free water to total the reaction system to 40 µL.
The reaction mixture was incubated at 30 ◦ C for 1 h.

2.4. Naked-Eye Detection

The magnetic particles and 50 ng HRCA reaction products were used for agglomera-
tion experiments under the action of an external magnetic field. Whether HRCA products
exist in the solution or not, the magnetic field will cause aggregation of magnetic particles.
The steps of aggregation and resuspension are repeated 2–3 times by gently vortexing the
reaction solution. The experimental results were observed by the naked eye. HRCA prod-
ucts and MPs are stretched, entangled and randomly woven with each other. They form
aggregates under an external magnetic field. The strong physical adhesion and aggregation
between HRCA products and MPs is irreversible and the magnetic beads are tightly bound
together to prevent them from being re-suspended. Short-chain nucleic acids can easily
disperse aggregates by several pipetting steps. The reason may be that short DNA strands
are difficult to intertwine and form large visible coils. When HRCA product is present, the
magnetic particles will agglomerate, and the solution is clean. When the HRCA product is
not present, the magnetic particles will stay re-suspended, and the solution will be turbid.

2.5. Limit of Detection

To determine the specific concentration level at which the organisms could be correctly
and consistently identified by the assay, titered bacterial pathogens were tested to evaluate
the sensitivity. The estimate of the limit of detection was based on serial 10-fold dilution
of each reference strain in molecular H2 O range from 105 to 1 CFU/mL; each dilution
was tested with 10 replicates. The lowest concentration that has 100% performance was
selected to determine the limit of detection. HRCA and visual inspection were carried
out to observe whether the magnetic particles were resuspended, so as to determine the
detection limit of each bacterial pathogen.

3. Results and Discussion

3.1. Amplification Reaction
uidA gene was selected to use due to it being present in each reference strain. For
both rolling circle amplification (RCA) reaction and HRCA, two different padlock probes
were designed. Experiments were replicated a total of eight times to compare the results of
amplification methods (Figure 2).
The final amplification products obtained by RCA and HRCA reactions are chains
larger than 10 kb. When running these on an electrophoresis gel, the products are concen-
trated near the sample loading wells at the top of the gel. From the electrophoresis maps, it
can be seen that the HRCA reaction produced more products than the RCA reaction.
RCA reaction products can only increase linearly. After one round of amplification,
only one repeat sequence can be obtained, which greatly reduces the detection efficiency.
The HRCA reaction introduced double primers, and the amplification of rolling circle and
branched chain increased the target gene exponentially. Compared with RCA reaction,
HRCA reaction obtains more products in the same time, improves the detection sensitivity
and realizes large accumulation of products in a short time.
Biosensors 2022,
Biosensors 12,12,
2022, 1075
x FOR PEER REVIEW 78 ofof1112

Figure 2. Gel electrophoresis of RCA reaction and HRCA reaction. In the middle of the gel elec-
trophoresis map is a DNA Marker; the 8 wells left of the Marker are RCA products, and the 8 wells
right of the Marker are HRCA products.

RCA reaction products can only increase linearly. After one round of amplification,
only one repeat sequence can be obtained, which greatly reduces the detection efficiency.
The HRCA
Figure 2. Gelreaction introduced
electrophoresis of RCA double primers,
reaction and HRCA and reaction.
the amplification of rolling
In the middle of the gelcircle
elec-
Figure
and 2. Gel electrophoresis
branched of RCA reactiongene
and HRCA reaction. In the middle of the gel elec-
trophoresis mapchain increased
is a DNA Marker;thethetarget
8 wells left ofexponentially.
the Marker areCompared with
RCA products, andRCA
the 8reac-
wells
trophoresis
tion, of themap
right HRCA is a DNA
reaction
Marker Marker;
obtains
are HRCA the 8 wells
more
products. left ofinthethe
products Marker
sameare RCAimproves
time, products, and
the the 8 wells
detection
right of the Marker are HRCA products.
sensitivity and realizes large accumulation of products in a short time.
RCA reaction
3.2. Magnetic Particlesproducts
Selectioncan only increase linearly. After one round of amplification,
only
3.2. one repeat
Magnetic sequence
Particles can be obtained, which greatly reduces the detection efficiency.
Selection
To determine the best magnetic bead for agglomeration, we compared the following
The ToHRCA reaction
determine the introduced
best magnetic double
bead primers, and the amplification
for agglomeration, comparedof rolling circle
beads: Dynal MyOne (Dynabeads MyOneTM Streptavidin C1,we Invitrogen, the following
Waltham, MA,
and branched
beads:SPRI
Dynal chain
MyOne increased
(Dynabeads the target gene exponentially. Compared with RCA reac-
USA), beads (Beckman Coulter,MyOneTM
Brea, CA, USA), Streptavidin C1, Invitrogen),
Magbio beads SPRI beads
(Magbio, Gaithersburg,
tion,
(Beckman HRCA reaction
Coulter), obtains
Magbio more products
beads (Magbio) in the
and home-madesame time, improves the
magnetic particles detection
(HMP)
MD, USA) and home-made magnetic particles (HMP) [22]. The agglomeration reaction was
sensitivity
[22]. The and realizes
agglomeration large accumulation
reaction was carriedof products
out with in a
50 short
ng
carried out with 50 ng HRCA reaction product under the action of an external magnetic
time.
HRCA reaction product
under Agglomeration
field. the action of aneffects
external magnetic
of the field.
magnetic Agglomeration
particles effects before
were observed of the and
magnetic
after
3.2. Magnetic
particles were Particles
observed Selection
before and after vortexing (Figure 3).
vortexing (Figure 3).
To determine the best magnetic bead for agglomeration, we compared the following
beads: Dynal MyOne (Dynabeads MyOneTM Streptavidin C1, Invitrogen), SPRI beads
(Beckman Coulter), Magbio beads (Magbio) and home-made magnetic particles (HMP)
[22]. The agglomeration reaction was carried out with 50 ng HRCA reaction product
under the action of an external magnetic field. Agglomeration effects of the magnetic
particles were observed before and after vortexing (Figure 3).

Figure 3.3. Agglomeration

Figure Agglomeration reaction
reaction of
of magnetic
magnetic beads:
beads: 1~2,
1~2, Dynal
Dynal MyOne;
MyOne; 3~4,
3~4, SPRI
SPRI beads;
beads; 5~6,
5~6,
Magbio beads; 7~8, HMP; 2, 4, 6, 8 serve as negative control; (a)The agglomeration reaction before
Magbio beads; 7~8, HMP; 2, 4, 6, 8 serve as negative control; (a)The agglomeration reaction before
vortex; (b) The agglomeration reaction after vortex.
vortex; (b) The agglomeration reaction after vortex.

If HRCA products are present in the solution, magnetic beads will not resuspend in
solution after vortexing and instead stay clumped together. If HRCA products are not
present
Figure in the solution, the
3. Agglomeration magnetic
reaction beads will
of magnetic beads:resuspend
1~2, Dynaleasily,
MyOne;and3~4,
theSPRI
solution
beads;will
5~6,
beMagbio
turbid.beads; 7~8,
In the HMP;shown
result 2, 4, 6, in
8 serve as negative
Figure control;
3b, all the (a)The
negative agglomeration
controls showed reaction before
very good
vortex; (b) The agglomeration reaction after vortex.
 If HRCA products are present in the solution, magnetic beads will not resuspend in
solution after vortexing and instead stay clumped together. If HRCA products are no
present in the solution, the magnetic beads will resuspend easily, and the solution wil
Biosensors 2022, 12, 1075 8 of 11
be turbid. In the result shown in Figure 3b, all the negative controls showed very good
resuspension after vortex. As for the positive samples 1, 3, 5 and 7, all four selected
beads showed visible clumps after vortex, but obviously the HMP magnetic beads were
resuspension
the only type after vortex.
that As for thetightly
still clumped positivewithout
samplesany
1, 3, turbidity
5 and 7, allinfour
theselected
solutionbeads
(Figure 3b)
showed visible clumps after vortex, but obviously the HMP magnetic beads were the only
HRCA products tightly tie the magnetic beads together and have a strong physical at
type that still clumped tightly without any turbidity in the solution (Figure 3b); HRCA
tachment,
products preventing
tightly aggregation
tie the magnetic beadsfrom being
together andre-suspended. Therefore,
have a strong physical HMP was cho
attachment,
sen as the aggregation
preventing most suitable from option
being for visual detection.
re-suspended. Therefore, HMP was chosen as the most
suitable option for visual detection.
3.3. Magnetic Particles Amount
3.3. Magnetic Particles Amount
The number of magnetic particles is also an important factor affecting the experi
The number of magnetic particles is also an important factor affecting the experiment.
ment. If there are too many magnetic particles in the solution, they cannot entangle with
If there are too many magnetic particles in the solution, they cannot entangle with amplifi-
amplification products and disperse in the solution, resulting in a waste of magneti
cation products and disperse in the solution, resulting in a waste of magnetic particles. In
particles.
contrast, In contrast,
when when
there are too few there areparticles,
magnetic too few the
magnetic particles,
aggregates the aggregates
are too small to observe are too
small to observe the experimental results with the naked eye. All of
the experimental results with the naked eye. All of the above can lead to misjudgmentthe aboveofcan lead
to misjudgment
the of the experimental results.
experimental results.
Tocarry
To carryoutoutagglomeration,
agglomeration, wewe added
added 6000
6000 ng,ng, 4000
4000 ng, ng,
20002000
ng, ng,
10001000 ng, ng,
ng, 500 500 ng, 250
250 ng and 100 ng of HMP magnetic particles to both HRCA products and negative
ng and 100 ng of HMP magnetic particles to both HRCA products and negative controls controls.
Results
Resultswere
wereobserved
observedbefore and
before after
and agglomeration
after of magnetic
agglomeration particles
of magnetic (Figure
particles 4). 4).
(Figure

Figure4.4.Optimization
Figure Optimization of of magnetic
magnetic beads
beads input.
input. (a) Before
(a) Before the agglomeration
the agglomeration reaction;reaction;
(b) After (b) Afte
theagglomeration
the agglomeration reaction.
reaction. Numbers
Numbers 1~8 1~8 represent
represent the amount
the amount of magnetic
of magnetic beads6000
beads added: added:
ng, 6000 ng
4000 ng, 2000 ng, 1000 ng, 500 ng, 250 ng and 100 ng. Position 8 is a negative
4000 ng, 2000 ng, 1000 ng, 500 ng, 250 ng and 100 ng. Position 8 is a negative control. control.

3.4.
3.4.Limits
LimitsofofDetection
Detection
Probes in the HRCA reaction were serial diluted starting at 1 µM and going down to
Probes in the HRCA reaction were serial diluted starting at 1 µ M and going down
1 pM, with a negative control in the last position. The 8 HRCA products were agglomerated
to 1 pM, with a negative control in the last position. The 8 HRCA products were ag
with 1000 ng of HMP to detect the sensitivity of the reaction. The results are shown in Figure 5.
glomerated with 1000 ng of HMP to detect the sensitivity of the reaction. The results are
shown in Figure 5.
In the higher concentration HRCA product solutions, magnetic particle aggregation
clusters are tightly wound and present a visible magnetic particle aggregate in a tube
 (Figure 5, positions 1–3); in the low concentration solution of products, the magnetic
particles cluster in a loose state (Figure 5, positions 4–7). When the probe concentration
is 10 nM (Figure 5, position 3), the magnetic particles are tightly agglomerated with
Biosensors 2022, 12, x FOR PEER REVIEW
HRCA products. However, when the concentration of the product is below 1 nM (Figure 10 of 12
Biosensors 2022, 12, 1075 9 of 11
5, position 4), a large number of suspended magnetic particles stay in the solution. The
results show that the limit of visual detection based on magnetic particles is 10 nM.
(Figure 5, positions 1–3); in the low concentration solution of products, the magnetic
particles cluster in a loose state (Figure 5, positions 4–7). When the probe concentration
is 10 nM (Figure 5, position 3), the magnetic particles are tightly agglomerated with
HRCA products. However, when the concentration of the product is below 1 nM (Figure
5, position 4), a large number of suspended magnetic particles stay in the solution. The
results show that the limit of visual detection based on magnetic particles is 10 nM.

Figure 5. Limits of detection. Numbers 1~8 represent simulated probe concentrations of 1 µ M, 100
Figure 5. Limits of detection. Numbers 1~8 represent simulated probe concentrations of 1 µM,
nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM and negative control.
100 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM and negative control.

3.5. In
Food-Borne Pathogen
the higher Detection
concentration HRCA product solutions, magnetic particle aggregation
clustersWeareapplied
tightlythiswoundmethod andto detect afive
present pathogenic
visible magnetic microorganisms.
particle aggregate Afterin diluting
a tube
each pathogenic
(Figure 5, positions bacteria
1–3); in to 10
the5, low
104, 10 3, 102, 101 and 1 CFU/mL, the HRCA reaction and
concentration solution of products, the magnetic
visual
particles detection
Figure 5.cluster
Limits inofwere performed
a loose
detection. state to determine
(Figure
Numbers 1~85,represent
positions the detection
4–7).
simulatedWhen sensitivity
probe probeof
theconcentrationseachofbacterium
concentration is
1 µ M, 100
and
10nM,
nM10each
nM, gene.
(Figure Taking
5, position
1 nM, 100 pM, 10 the
3), detection
the
pM, pM andresult
1magnetic ofcontrol.
particles
negative EHEC at the
are tightly concentration
agglomerated of HRCA
with 1 × 103
CFU/mL as
products. an example,
However, whenthe thedetection sensitivity
concentration of the of product
the method to pathogenic
is below 1 nM (Figure microor-
5,
3.5. Food-Borne
position
ganisms 4),was
a largePathogen
number
tested Detection
of suspended reaction
by agglomeration magneticwith particles
HMP; staytheinresult
the solution.
is shown Theinresults
Figure
show that
6. When the limit
We applied of visual
concentration
this method detection
of EHEC
to detect based
is 1five× on 3 magnetic
CFU/mL,particles
10pathogenic is 10 nM. products
its amplification
microorganisms. form
After diluting
aggregates with magnetic particles, so the concentration
each pathogenic bacteria to 10 , 10 , 10 , 10 , 10 and 1 CFU/mL, the HRCA reaction and
5 4 3 2 1 can then be continuously re-
3.5. Food-Borne
duced for Pathogen Detection
experiments to determine the detection limit of EHEC.
visual detection were performed to determine the detection sensitivity of each bacterium
andWe Forapplied
each each
gene. this
strain,method
Taking thetodetection
the visual detect fiveresult
detection pathogenic
is carried
of EHEC microorganisms.
out atatthethesame After
time
concentrationfordiluting
five 1 each
of different
× 103
pathogenic bacteria to 10 5 , 104 , 103 , 102 , 101 and 1 CFU/mL, the HRCA reaction and visual
bacterial concentrations.
CFU/mL as an example,The thetarget genessensitivity
detection corresponding to method
of the each strain to are shown inmicroor-
pathogenic Table 1,
detection
thus
ganisms were
determining performed
was tested the by
detectionto determine
limits of five
agglomeration thefood-borne
reaction detection sensitivity
pathogens
with HMP; of each
(Table
the result bacterium
is3).shown and
in Figure
each gene. Taking the detection result of EHEC at the concentration of 1 × 10 3 CFU/mL
6. When the concentration of EHEC is 1 × 10 CFU/mL, its amplification products form
3
asaggregates
an example, the magnetic
with detection particles,
sensitivityso of the
the concentration
method to pathogenic can thenmicroorganisms
be continuously wasre-
tested by agglomeration reaction
duced for experiments to determine with theHMP; the
detection result
limit is
of shown
EHEC. in Figure 6. When the
concentration
For eachofstrain,
EHECthe × 103 CFU/mL,
is 1visual detection is itscarried
amplification products
out at the same form
time aggregates with
for five different
magnetic particles, so the concentration can then be continuously reduced for experiments
bacterial concentrations. The target genes corresponding to each strain are shown in Table 1,
to determine the detection limit of EHEC.
thus determining the detection limits of five food-borne pathogens (Table 3).

Figure 6. EHEC detection results. The concentration of EHEC is 1 × 103 CFU/mL. 1–8: ST, LT, ipaH,
eae, Stx1, rfbE, uidA gene and negative control, respectively.

Figure6.6.EHEC
Figure EHECdetection
detectionresults.
results.The
Theconcentration
concentration
ofof EHEC
EHEC is is
1× 1 ×1010 3 CFU/mL. 1–8: ST, LT, ipaH,
3 CFU/mL. 1–8: ST, LT, ipaH,
eae, Stx1, rfbE, uidA gene and negative control, respectively.
eae, Stx1, rfbE, uidA gene and negative control, respectively.

For each strain, the visual detection is carried out at the same time for five different
bacterial concentrations. The target genes corresponding to each strain are shown in Table 1,
thus determining the detection limits of five food-borne pathogens (Table 3).
Biosensors 2022, 12, 1075 10 of 11

Table 3. Limit of detection for each Bacteria strain.

Strain Gene Detection Limit (CFU/mL)

EHEC 1000
eae 1000
uidA 1000
rfbe 10
stx1 100
ETEC 10,000
LT 10,000
ST 10,000
uidA 1000
EPEC 1000
eae 1000
uidA 100
EIEC 10,000
ipaH 10,000
uidA 100
E. coli 100
uidA 100

The detection limit of each strain is the maximum detection limit of the corresponding
gene. The results show that the detection sensitivity of EHEC, ETEC, EPEC, EIEC and
E. coli are 1 × 103 CFU/mL, 1 × 104 CFU/mL, 1 × 103 CFU/mL, 1 × 104 CFU/mL, and
1 × 102 CFU/mL, respectively.

4. Conclusions
In conclusion, the naked-eye detection method of nucleic acids based on magnetic
particles in HRCA greatly reduces the amount of equipment and reagents needed in the lab,
thus reducing cost and trained professionals, allowing this user-friendly method to be used
worldwide. HRCA technology allows a large amount of products to be accumulated in a
short period of time. The amplicons in HRCA are wound with magnetic particles, and the
detection results are visible to the naked eye. The method simplifies nucleic acid detection
equipment and can achieve high throughput and automation. This method allows for a
simple and low-cost nucleic acid detection technology to be developed for the detection of
large-scale infectious diseases and genetic diseases and greatly reduces laboratory costs.

Author Contributions: Conceptualization, methodology, S.L.; validation, H.L. and M.W.; formal
analysis, J.R. and Z.C.; investigation, H.C.; resources, Y.D.; data curation, W.P.; writing—original draft
preparation, C.T.; writing—review and editing, C.T., H.L., W.P., M.W., J.R., Z.C., H.C., Y.D. and S.L.;
supervision, H.L.; project administration, S.L.; funding acquisition, S.L. All authors have read and
agreed to the published version of the manuscript.
Funding: This research was funded by the National Key R&D Program of China (No. 2021YFE0191400,
2021YFE0200400, 2019YFE0191000), the National Natural Science Foundation of China (No. 61971187,
61871180), Hunan Provincial Natural Science Foundation of China (No. 2019JJ50122), and Hunan
Key R&D Projects (No. 2021SK2003, 2022SK2115).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Acknowledgments: Congli Tang, Hongna Liu, Wenjing Pan, Meiling Wang, Jie Ren, Zhu Chen, Hui
Chen, Yan Deng and Song Li are grateful to Hunan University of Technology.
Conflicts of Interest: The authors declare no conflict of interest.
Biosensors 2022, 12, 1075 11 of 11

References
1. Riley, L.W. Extraintestinal Foodborne Pathogens. Annu. Rev. Food Sci. Technol. 2020, 11, 275–294. [CrossRef] [PubMed]
2. Ishaq, A.R.; Manzoor, M.; Hussain, A.; Altaf, J.; Rehman, S.U.; Javed, Z.; Afzal, I.; Noor, A.; Noor, F. Prospect of microbial food
borne diseases in Pakistan: A review. Braz. J. Biol. 2021, 81, 940–953. [CrossRef]
3. Nelluri, K.D.D.; Thota, N.S. Challenges in Emerging Food-Borne Diseases. In Book Food Safety and Preservation, 2nd ed.; Alexandru,
M.G., Alina, M.H., Eds.; Elsevier: Amsterdam, The Netherlands, 2018; pp. 231–268.
4. Matle, I.; Mbatha, K.R.; Madoroba, E. A review of Listeria monocytogenes from meat and meat products: Epidemiology, virulence
factors, antimicrobial resistance and diagnosis. Onderstepoort J. Vet. Res. 2020, 87, e1–e20. [CrossRef] [PubMed]
5. Jokerst, J.C.; Adkins, J.A.; Bisha, B.; Mentele, M.M.; Goodridge, L.D.; Henry, C.S. Development of a Paper-Based Analytical
Device for Colorimetric Detection of Select Foodborne Pathogens. Anal. Chem. 2012, 84, 2900–2907. [CrossRef] [PubMed]
6. Rohr, J.R.; Barrett, C.B.; Civitello, D.J.; Craft, M.E.; Delius, B.; DeLeo, G.A.; Hudson, P.J.; Jouanard, N.; Nguyen, K.H.;
Ostfeld, R.S.; et al. Emerging human infectious diseases and the links to global food production. Nat. Sustain. 2019, 2,
445–456. [CrossRef]
7. Aboubakr, H.; Goyal, S. Involvement of Egyptian Foods in Foodborne Viral Illnesses: The Burden on Public Health and Related
Environmental Risk Factors: An Overview. Food. Environ. Virol. 2019, 11, 315–339. [CrossRef]
8. Hu, J.; Wang, Y.; Ding, H.; Jiang, C.; Geng, Y.; Sun, X.; Jing, J.; Gao, H.; Wang, Z.; Dong, C. Recombinase polymerase amplification
with polymer flocculation sedimentation for rapid detection of Staphylococcus aureus in food samples. Int. J. Food Microbiol. 2020,
331, 108691. [CrossRef]
9. Raj, V.; Vijayan, A.N.; Joseph, K. Cysteine capped gold nanoparticles for naked eye detection of E. coli bacteria in UTI patients.
Sens. Bio-Sens. Res. 2015, 5, 33–36. [CrossRef]
10. Kwon, D.; Lee, S.; Ahn, M.M.; Kang, I.S.; Park, K.-H.; Jeon, S. Colorimetric detection of pathogenic bacteria using platinum-coated
magnetic nanoparticle clusters and magnetophoretic chromatography. Anal. Chim. Acta 2015, 883, 61–66. [CrossRef]
11. Kim, S.K.; Cho, H.; Jeong, J.; Kwon, J.N.; Jung, Y.; Chung, B.H. Label-free and naked eye detection of PNA/DNA hybridization
using enhancement of gold nanoparticles. Chem. Commun. 2010, 46, 3315–3317. [CrossRef]
12. Lin, C.; Zhang, Y.; Zhou, X.; Yao, B.; Fang, Q. Naked-eye detection of nucleic acids through rolling circle amplification and
magnetic particle mediated aggregation. Biosens. Bioelectron. 2013, 47, 515–519. [CrossRef]
13. Safavieh, M.; Ahmed, M.U.; Sokullu, E.; Ng, A.; Braescuac, L.; Zourob, M. A simple cassette as point-of-care diagnostic device for
naked-eye colorimetric bacteria detection. Analyst 2014, 139, 482–487. [CrossRef]
14. Ohk, S.-H.; Bhunia, A.K. Multiplex fiber optic biosensor for detection of Listeria monocytogenes, Escherichia coli O157:H7 and
Salmonella enterica from ready-to-eat meat samples. Food Microbiol. 2013, 33, 166–171. [CrossRef]
15. Shi, X.; Yu, L.; Lin, C.; Li, K.; Chen, J.; Qin, H. Biotin exposure-based immunomagnetic separation coupled with sodium dodecyl
sulfate, propidium monoazide, and multiplex real-time PCR for rapid detection of viable Salmonella typhimurium, Staphylococcus
aureus, and Listeria monocytogenes in milk. J. Dairy Sci. 2021, 104, 6588–6597. [CrossRef]
16. Maier, C.; Hofmann, K.; Huptas, C.; Scherer, S.; Wenning, M.; Luecking, G. Simultaneous quantification of the most common and
proteolytic Pseudomonas species in raw milk by multiplex qPCR. Appl. Microbiol. Biotechnol. 2021, 105, 1693–1708. [CrossRef]
17. Li, F.; Ye, Q.; Chen, M.; Shang, Y.; Zhang, J.; Ding, Y.; Xue, L.; Wu, S.; Wang, J.; Pang, R.; et al. Real-time PCR identification of
Listeria monocytogenes serotype 4c using primers for novel target genes obtained by comparative genomic analysis. LWT—Food Sci.
Technol. 2021, 138, 110774. [CrossRef]
18. Sun, J.; Shi, Y.; Du, Y.; Wang, Z.; Liu, Z.; Wang, H.; Zhao, G.; Ma, Y.; Zheng, M. Rapid Detection of Diarrheagenic Escherichia coli by
a New Multiplex Real-Time Quantitative PCR Assay. Appl. Biochem. Microbiol. 2020, 56, 748–757. [CrossRef]
19. Zhong, Y.; Wang, Y.; Zhao, T.; He, X.; Ke, Y.; Liu, W.; Zou, D. Multiplex real-time SYBR Green I PCR assays for simultaneous
detection of 15 common enteric pathogens in stool samples. Mol. Cell Probes 2020, 53, 101619. [CrossRef]
20. Suo, B.; He, Y.; Tu, S.-I.; Shi, X. A Multiplex Real-Time Polymerase Chain Reaction for Simultaneous Detection of Salmonella spp.,
Escherichia coli O157, and Listeria monocytogenes in Meat Products. Foodborne Pathog. Dis. 2010, 7, 619–628. [CrossRef]
21. Zhao, Y.; Wang, H.; Zhang, P.; Sun, C.; Wang, X.; Wang, X.; Yang, R.; Wang, C.; Zhou, L. Rapid multiplex detection of 10 foodborne
pathogens with an up-converting phosphor technology-based 10-channel lateral flow assay. Sci. Rep. 2016, 6, 1–8. [CrossRef]
22. Li, G.; Shen, B.; He, N.; Ma, C.; Elingarami, S.; Li, Z. Synthesis and Characterization of Fe3 O4 @SiO2 Core–Shell Magnetic
Microspheres for Extraction of Genomic DNA from Human Whole Blood. J. Nanosci. Nanotechnol. 2011, 11, 10295–10301.
[CrossRef] [PubMed]