FORMATIVE ASSESSMENT IN GENERAL BIOLOGY I~ STEM 11 ‘SECOND SEMESTER: |. MULTIPLE CHOICE; Select the letter of the best answer. ‘4. Which of the following genetic terms describes the observation you have about seeing someone having brown eyes? A. phenotype. C. genotype. B. allele, D. hybridization. 2. A recessive allele d is responsible for a condition called dystonia. Dystonia is a neurological movement disorder syndrome in which sustained or repetitive muscle contractions result in twisting and repetitive movements or abnormal fixed postures. If a man who has this condition marries a woman who doesn't and one of their four children has the condition, what are the possible genotypes of the man and woman? ‘A. The father is Dd; the mother is DD. C. Both parents are dd. B. The father is dd; the mother is DD. D. The father is dd; the mother is Dd. 3, Color biindness is a disease more commonly observed in:maies than females. Why are there more males with color blindness than females? ‘A. The gene for color blindness is found on the Y chromosome. B. The recessive gene is usually masked by another X chromosome in females, C. Color blindness is an X-linked dominant trait D. All the sons of an affected male will have the disorder. 4, A test was performed to determine the blood type of an individual: Based on the test, it showed that the person is type AB. By just looking at the test results, how will you know that the person is type AB? ‘A. Aggiutination with Anti-A serum and non-agglutination with Anti- B serum. B. Non- agglutination with Anti-A serum and non-agglutination with Anti- B serum. C. Agglutination with Anti-A serum and agglutination with Anti- B serum . Non- agglutination with Anti-A serum and agglutination with Anti- B serum. 5. In pea plants, a yellow-colored seed does not mean that the seed is also in round shape. Likewise, a green od color does not also mean that the seeds will be in a wrinkled shape. Which Law of Inheritance was developed by Mendel according to this observation? ‘A. Law of Dominance . Law of Independent Assortment B. Lawof Segregation D. Both B and C 6. Below is a cross between a white-coated cow and a red-coated cow which resulted in a roan coat offspring (white coat with red spots). Which type of Non-Mendelian genetics is this? | : e + = rm ‘ po A. Co-Dominance C. Incomplete Dominance B. Multiple Allele Series D. Sex-linked trait 7. A pink flower resulted from a cross between a red and a white flower. What type of Non-Mendelian genetics is illustrated by this example? ‘A. Multiple Allele Series C. Incomplete Dominance B. Co-Dominance D. Sex-linked trait 8. During the process of Translation, what happens when the ribosomes read the UGA codon? ‘A. The ribosomes stop translating C. The ribosomes disintegrate. B. The ribosomes start to translate. D. The ribosomes are not affected. 9. Jayson is color-blind. His mother and father are normal for the trait. When his Biology teacher asked him to do a family tree of his trait, he soon found out that his matemal grandfather is also color blind. What is the possible mode of inheritance of this disease? A. Autosomal Recessive Trait C. X- Linked Dominant Trait B. X- Linked Recessive Trait D. Y- Linked Trait 10. Which of the following statement is NOT a reason why you should know your blood type? A. Itcan help determine your healthiest diet. B. You could save your life and others life. C. It gives deeper insight into your genetic biueprint D. It gives you hints about possible diseases you will contract.ll. CONSTRUCTED RESPONSE: 1. Mendel is regarded as the “Father of Modem Genetics” because of his immense contribution to the ‘study of trait inheritance using garden pea plants. Through his experiments, he established the different generations. Create two monohybrid test crosses from a “pure” parent from the P generation and a hybrid ‘plant from the F2 generation. Prove your findings by making a Punnett square for each test cross and then discuss the results. (5 pts) “The Generation Gap” Allele: Plant Height T = Tall ; t= short P Generation Genotypes: Test Cross 1: Test Cross:2: Parent 1: Parent 2: ‘Which law of inheritance is illustrated here? Why? 2. A diybrid crossis. tool used to track the inheritance of two traits. This idea stems from Mendel's law of independent assortmentwhich states that each pair of alleles segregate independently during gamete formation. Create a Punnett Square based on the cross of the two’ parents given, then identify the genotypic and phenotypic ratio based on the result. (5 pts) Alleles: Seed Color: G= Yellow; g= Green Plant Height: T = Tall ; t= short Parent Genotypes: Allele Combination: Genotypic Ratio: Phenotypic Ratio:3. Parent:1\has’a genotype of AaBBDoff-and parent 2 is heterozygous for all genes. Answer the following questions by using the sum and product rules. Below are Punnett squares to help you solve the problems: 2 B Ao dean na 8 [eae wee ee 8 [ee [eb ood es D | 00] od s [rele & “Lod Tas: f [ele a. What is the probability of an offspring with a heterozygous genotype (AaBbDdF)? b. What is the probability of an offspring with a recessive phenotype (aabbddif)? cc. What is the probability of an offspring with the following genotype: AaBbDdf? dd. What is the probability of an offspring with a homozygous dominant genotype (AABBDDFF)? Ill CASE ANALYSIS: Answer the following genetic problems. Show your complete solution using the Punnett square (if possible) and answer the questions in a complete sentence. 1. A patient was rushed to the hospital and needed an immediate blood transfusion. You were the medical technologist on duty and you performed a blood test to confirm the blood type of the patient. Based on the test, it showed an agglutination to both Anti-A and B serum and a mixture with the Anti-D serum. What is the blood type of the patient? Suppose your hospital runs out of that blood type, what possible blood types can be transfused to the patient? Be specific with your answer. (4 pts) 2. Marie is a daughter of a man with hemophilia. Hemophilia, which is also known as the Royal blood disease, is the inability of the blood to clot She marries a man, Mario, who is normal for the trait. What is the chance of their daughter becoming hemophiliac? their son? (6 pts) Alleles: Cross: sz Marie's Father: Soar Marie: Mario: 3. Albinism is @ condition in which there is a mutation in one of several possible genes, each of which helps to code for the protein melanin. This gene is normally active in cells called melanocytes which are found in the skin and eyes, Albinism involves a significant reduction or absence of the production of ‘melanin, giving affected individuals a lack of normal coloration to their skin and eyes. Inheritance Pattern: Normal melanin proteins is produced by a dominant allele; albinism results from a lack of melanin and is caused by an autosomal recessive allele. Use the letter A for normal and a for albinism. Scenario: Two normally-pigmented parents have 3 children. The first child (a gis) and their second child (a boy) have normal pigmentation. The third child (a girl) has albinism. That girl (with albinism) marries a normally-pigmented male and they have four children, The first three children (two girls and one boy) have normal pigmentation. Their fourth child (a girl) has albinism like her mother. Draw a pedigree showing all the individuals described in the problem following the correct symbols. What is the mode of inheritance of albinism as shown in the pedigree?»5:Youare a Geneticist working in a laboratory.’ doctor came and hand you over an extracted human insulin. You were able to decode the DNA sequence of the sample and so below is a section of the human insulin sequence located in Row A. In Row B, give the complimentary base pair of the sequence and transcribe the DNA strand into mRNA in Row C, then, translate that strand into a polypeptide chain, identifying the codons in Row D, the anti-codons in Row E and the amino acid sequence on Row F. Use the Translation table provided as your reference. Don't forget to give the directionality of all the sequences. (10 pts) 5’ GCGTATAATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTA 3’ o| of of > Translation Table 2 g First etter 2 e : vou Uce. ‘UcA ues ‘ecu coc ‘CoA coe ACU. Ace ‘ACA ACG cu coc cca sce