Aquaculture 510 (2019) 84–89

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Molecular serotyping and antimicrobial susceptibility of Streptococcus T

agalactiae isolated from fish in China
⁎
Lishuang Denga, Yajun Lia, Yi Genga, , Liping Zhenga, Tayyab Rehmana, Ruoxuan Zhaoa,
Kaiyu Wanga, Ping OuYanga, Defang Chenb, Xiaoli Huangb, Changliang Hea, Zexiao Yanga,
Weiming Laia
a
College of Veterinary Medicine, Sichuan Agricultural University, Wenjiang, Sichuan 611130, China
b
Department of Aquaculture, Sichuan Agricultural University, Wenjiang, Sichuan 611130, China

A R T I C LE I N FO A B S T R A C T

Keywords: Streptococcus agalactiae (group B streptococcus, GBS) is a major pathogenic bacterium frequently associated with
Streptococcus agalactiae septicemia and meningoencephalitis in fish. In this study, we used molecular typing and the disc diffusion
Serotyping method to determine serotypes and antimicrobial susceptibilities of 28 S. agalactiae isolates from diseased
Antimicrobial susceptibility farmed fish (tilapia, Schizothorax prenanti and Schizopygopsis pylzovi) in China. We found that the 28 S. agalactiae
Antibiotic-resistance genes
isolates belonged only to two serotypes (Ia and III), with serotype Ia being significantly more prevalent than
Fish
China
serotype III. Antimicrobial susceptibility results showed that all of the isolates were susceptible to vancomycin,
cephalexin and florfenicol. The S. agalactiae isolates examined showed resistance to erythromycin (42.9%),
penicillin (35.7%), clindamycin (28.6%), enrofloxacin (35.7%), tetracycline (32.1%), gentamicin (28.6%) nor-
floxacin (28.6%), ofloxacin (14.3%) and doxycycline (7.14%), but the serotype III isolates showed higher pro-
portions of antibiotic resistance than serotype Ia isolates. The macrolide resistance gene (ermB) was detected in
all the 28 isolates and the tetracycline resistance gene (tetM) was detected in 78.6% isolates. All quinolone-
resistant S. agalactiae isolates carried mostly double point mutations in DNA with inferred amino acid sub-
stitutions including the change of Ser-81 to Leu in the product of gyrA and Ser-79 to Tyr in the product of parC.
Our study is a valuable reference for effective antibiotic application of S. agalactiae infections of farmed fish in
China, and illustrates the importance of better use of antibiotics to prevent the widespread emergence of re-
sistance S. agalactiae.

1. Introduction Understanding the serotype distribution of a pathogen is a key

Streptococcus agalactiae (group B streptococcus, GBS) is a Gram
positive coccus and was first defined as a cause of bovine mastitis in
1887. Lancefield and Hare subsequently identified it in vaginal swabs in
1935 (Lancefield and Hare, 1935). S. agalactiae is an essential patho-
genic bacterium frequently associated with septicemia and me-
ningoencephalitis in fish (Evans et al., 2008). It causes significant
morbidity and mortality among freshwater, estuarine, and marine fish
species, including gulf killifish, tilapia, sliver pomfret, golden pomfret,
barcoo grunter, ya-fish (Schizothorax prenanti) and cyprinid fish(Schi-
zopygopsis pylzovi) (Geng et al., 2012; Pridgeon and Klesius, 2013; Liu
et al., 2014; Chong et al., 2016; Deng et al., 2017). Additionally, studies
show that S. agalactiae cause neonatal meningitis in humans, mastitis in
cattle and acute sepsis in rabbits (Bisharat et al., 2004; Merl et al., 2010;
Ren et al., 2014).
prerequisite to formulate serotype-based vaccines for disease preven-
tion. So far, S. agalactiae can be classified into 10 serotypes (Ia, Ib, and
II to IX), depending on the specificity of its strain capsular poly-
saccharide, each one being antigenically and structurally unique
(Slotved et al., 2007). Among them, serotypes Ia, Ib and III are regarded
as the most predominant in fish S. agalactiae infection (Li et al., 2013),
and have the capability of infecting multiple host species (Delannoy
et al., 2013).
Streptococcosis outbreaks associated with S. agalactiae infection in
commercial fish farms have been reported worldwide, causing huge
economic loss to the aquaculture industry annually. At present, no
approved vaccines are provided to prevent S. agalactiae infections in
farmed fish. Antibiotics continue to be widely used for treatment or
prevention of Streptococcus infections in farmed fish. S. agalactiae has
shown an increasing resistance to some antibiotics during the last

⁎
Corresponding author at: Huimin Road No. 211, Wenjiang, Sichuan Province, 611130, China.
E-mail address: gengyisicau@126.com (Y. Geng).

https://doi.org/10.1016/j.aquaculture.2019.05.046
Received 9 October 2018; Received in revised form 26 February 2019; Accepted 19 May 2019
Available online 20 May 2019
0044-8486/ © 2019 Elsevier B.V. All rights reserved.
L. Deng, et al.
Table 1
Oligonucleotide sequences used as primers of resistance genes.
Class Gene Primer sequence (5′–3′)
Macrolide ermB-F GAAAAGGTACTCAACCAAATA
ermB-R AGTAACGGTACTTAAATTGTTTAC
Quinolone parC-F CCGGATATTCGTGATGGCTT
parC-R TGACTAAAAGATTGGGAAAGGC
gyrA-F GGTTTAAAACCTGTTCATCGTCGT
gyrA-R GCAATACCAGTTGCACCATTGACT
Tetracycline tetM-F GTGGAGTACTACATTTACGAG
tetM-R GAAGCGGATCACTATCTGAG
decade in many parts of the world (Betriu et al., 2003; Diekema et al.,
2003). There is little information on the resistance mechanisms in S.
agalactiae. The tetracycline resistance is governed by tet genes, which
are involved in either active efflux of the drug, ribosomal protection or
enzymatic drug modification (Giovanetti et al., 2003). Resistance to
erythromycin involves the erm and mef gene family that are responsible
for modification of the ribosomal target by methylation or mutation and
active efflux of the drug. (Sapkota et al., 2006). Quinolones have a
bactericidal effect when they bind to their target enzymes, DNA gyrase
(encoded by the gyrA and gyrB) and topoisomerase IV (encoded by parC
and parE), both essential for DNA replication (Drlica and Zhao, 1997).
In this study, we investigated the serotypes and antimicrobial sus-
ceptibilities of 28 S. agalactiae isolates collected from diseased farmed
fish (tilapia, Schizothorax prenanti and Schizopygopsis pylzovi) in China.
These strains were classified as two serotypes and antimicrobial re-
sistance of both serotypes were evaluated. The result will provide a
valuable reference for operational antibiotic application of S. agalactiae
infections of farmed fish in China.
2. Materials and methods
2.1. Bacterial isolates and preparation of bacterial genomic DNA
A total of 28 S. agalactiae isolates previously recovered from dis-
eased Schizothorax prenanti (n = 10) and Schizopygopsis pylzovi (n = 8)
in Sichuan and from tilapia (n = 10) in Hainan were used in this study
(Table 2). This bacterial collection series had been preserved at −80 °C
at Sichuan Agricultural University (Sichuan, China). For bacterial cul-
ture, the preserved stock solution was streaked on brain heart infusion
agar (BHIA, Difco, and Detroit, MI, USA) and incubated at 28 °C for
36–48 h. The isolated bacteria were subjected to a Gram stain. Genomic
DNA was extracted from each isolate by TIANamp bacteria DNA kit
(TIANGEN Biotech Inc. Beijing, China). Collected DNA was washed and
dissolved in 50 μL of buffer TE and stored at −20 °C for further ex-
periments.
2.2. Identification of bacteria
All strains were confirmed by PCR analysis using specific primers
(F:5′−AAGTACATGCTGATCAAGT−3′; R:5′−TCTTGATCAACTTGTTG
TAC−3′), which target the S. agalactiae-specific dltS gene to identify the
strains (Poyart et al., 2007). PCR amplification contained 12.5 μL
2 × Taq PCR Master Mix (TIANGEN Biotech Inc. Beijing, China), 1 μL of
10 pmol/μL each primer and 2 μL (20 ng) template DNA in a final of 25-
μL reaction volume. The PCR amplification procedure was: 5 min at
94 °C, 35 cycles at 94 °C, 66 °C for 45 s, and 72 °C for 1.5 min, and one
cycle at 72 °C for 5 min. The amplified PCR products were visualized on
1% agarose gel using a gel documentation system. Amplicons of the dltS
gene were purified using a gel extraction kit according to the manu-
facturer's instructions. And the BLAST program (http://blast.ncbi.nlm.
nih.gov/blast) was used for sequence homology analysis.
85
Aquaculture 510 (2019) 84–89
Amplicon size (bp) Reference
638 (Park et al., 2009)
403 (Murayama et al., 2009)
407 (Murayama et al., 2009)
359 (Poyart et al., 2003)
2.3. Serotype identification
The capsular polysaccharide serotypes were identified by multiplex
PCR using the previously reported method (Imperi et al., 2010). The
PCR reaction system is in agreement with the previously described. The
PCR amplification procedure was: initial denaturation at 94 °C for
5 min; 35 cycles of denaturation at 94 °C for 45 s, annealing at 58 °C for
60 s, and extension at 72 °C for 60 s; and final extension at 72 °C for
10 min. The amplified PCR products were visualized on 1% agarose gel
using a gel documentation system.
2.4. Antimicrobial susceptibility test
Antibiotic susceptibility of each isolate was determined using the
disc diffusion method and the criteria specified by the National
Committee for Clinical Laboratory Standards (NCCLS). Discs (Hangzhou
Taihe Microbiological Reagent, Hangzhou, China) of 12 anti-microbial
agents were used, including erythromycin, clindamycin, enrofloxacin,
norfloxacin, penicillin, ofloxacin, tetracycline, gentamicin, doxycycline,
vancomycin, cephalexin and florfenicol. Sensitivity and resistance of
each isolate were determined following the manufacturer's instructions.
The Escherichia coli (ATCC 25922) was invoked as a quality control
strain, and the quality control result was within the recommended
quality ranges.
2.5. Detection and sequencing of antibiotic resistance genes
Oligonucleotide primer sets used to detect common macrolide re-
sistance genes (ermB), quinolone resistance genes (parC and gyrA), and
tetracycline resistance genes (tetM) were derived from published se-
quences (Table 1). Amplification of the ermB, parC, gyrA and tetM genes
was performed using a modification of the PCR assay (Poyart et al.,
2003; Murayama et al., 2009; Park et al., 2009). The amplified PCR
products were visualized on 1% agarose gel using a gel documentation
system and purified for sequencing. DNA and protein sequences of gyrA
and parC were analyzed using DNAMAN software (Lynnon, Quebec,
Canada). S. agalactiae GD201008-001 (accession number: CP003810.1)
was used as a reference strain for comparative analysis.
3. Results
3.1. Identification of bacteria
Twenty eight isolates showed pinpointed and whitish round co-
lonies with smooth edges on BHI agar (Fig. 1A). The diameter of a
single colony was about 0.5–1.0 mm. All the isolates were Gram-posi-
tive cocci appearing in pairs and chains (Fig. 1B). Following PCR with
the dltS primer pair, all the strains yielded the expected 952 bp frag-
ments (Fig. 2), which confirmed that corresponding strains were S.
agalactiae. BLAST searches of the sequences of the 28 strains revealed
99% to 100% sequence identities to S. agalactiae.
L. Deng, et al. Aquaculture 510 (2019) 84–89

Fig. 1. S. agalactiae colony morphology and Gram's microscopy.

3.2. Serotype identification Table 2

Serotype, fish species and geography location of 28 S. agalactiae strains.
The result of serotype identification showed that the serotype of the Isolates No. Time Serotype Fish species Geography location
28 S. agalactiae isolates were either serotype Ia or III (Table 2). Serotype
III isolates yield the expected 352 bp and 688 bp fragments, while ser- 1–3 2006 Ia Tilapia Hannan province
4 2009 Ia
otype Ia isolates yielded the expected 272 bp and 688 bp fragments
5–8 2011 Ia
(Fig. 3). Serotype Ia was most vulgar, accounting for 85.7% of the 9–10 2014 Ia
isolates. 11–12 2012 Ia Schizothorax prenanti Sichuan province
13 2012 III
14 2012 Ia
3.3. Antimicrobial susceptibility test 15–16 2013 III
17–19 2015 Ia
The result showed that 42.9% (12/28) of the isolates were resistant 20 2015 III
21–28 2015 Ia Schizopygopsis pylzovi
to erythromycin, 14.3% (4/28) to ofloxacin, 32.1% (9/28) to tetra-
cycline, 35.7% (10/28) to enrofloxacin and penicillin, 28.6% (8/28) to
clindamycin, norfloxacin and gentamicin, and 7.14% (2/28) to dox- which were subsequently used for sequence comparison in this study.
ycycline (Table 3). However, all the isolates were susceptible to van- Sequence analysis revealed that all quinolone-resistance isolates carried
comycin, cephalexin and florfenicol. Besides, there were significant an identical Ser-to-Leu mutation (S81L) at codon 81 of gyrA and one of
differences in antibiotics resistance phenotype between serotype Ia and two separate mutations in parC: A Ser-to-Tyr mutation (S79Y) at codon
serotype III isolate. Apparently, serotype III showed higher proportions 79 or an Arg-to-Leu mutation (R95L) at codon 95 (Table 4).
of antibiotics resistance than serotypes Ia. Compared to serotype Ia,
about 16.7% (4/24) of the isolates resistant to both clindamycin and
4. Discussion
norfloxacin, both the rate of serotypes III resistance to the two anti-
biotics is 100% (4/4).
S. agalactiae is recognized as a major etiological agent of strepto-
coccal disease in the aquaculture industry of Southeast Asia and other
3.4. Detection and sequencing of antibiotics resistance genes continents (Kannika et al., 2017). It is recognized as a highly invasive
bacterium that causes inflammation, sepsis and death in infected ani-
All S. agalactiae isolates were screened for ermB gene (Fig. 4). mals (Evans et al., 2002), and results in huge economic losses to the
Among the 28 S. agalactiae isolates, 78.6% (22/28) of the strains carried aquaculture industry worldwide. At present, all five serotypes (Ia, Ib, II,
tetM gene. Briefly, about 75% (18/24) of the serotype Ia isolates pre- III and IX) that have ever been found in fish were studied (Vandamme
sented tetM gene, which was found in all the serotypes III isolates. et al., 1997; Suanyuk et al., 2008; Zhang et al., 2018). In this study,
Relatively DNA sequencing results of gyrA and parC were obtained from serotypes of S. agalactiae were distinguished by PCR using the 19 spe-
strain number 2, 6, 7, 10, 11, 13, 14, 15, 20 and 24 of the 28 isolates, cific primers (Imperi et al., 2010). Only serotype Ia (85.7%) and III

Fig. 2. Electrophoresis of dltS gene PCR amplification of 28 strains. M: DL2000 DNA marker; 0: negative control; 1–28: PCR amplification of 28 S. agalactiae dltS
genes; 29: positive control (ATCC 51487).

86
L. Deng, et al. Aquaculture 510 (2019) 84–89

Fig. 3. The electrophoresis of multiplex PCR amplification for serotype of 28 S. agalactiae strains. M: DL2000 DNA marker; 1–28: PCR amplification of 28 S. agalactiae
serotypes.

(14.3%) were found in 28 of S. agalactiae strains isolated from different
diseased fish, with serotype Ia being significantly more prevalent than
serotype III. Our result was the same as the previous report that ser-
otype Ia and III are the predominant serotypes of S. agalactiae in
Thailand (Dangwetngam et al., 2016). Besides, all the isolates from ti-
lapia belonged to serotype Ia, which corresponded to the previous re-
port in China (Ye et al., 2011). The differences among these strains of
the serotype prevalence remain unclear. The diversity in serotype dis-
tribution might be linked to the area of the isolates.
In this study, all of the S. agalactiae isolates were susceptible to
vancomycin, cephalexin and florfenicol, which are somewhat similar to
the previous report (Beigverdi et al., 2014; Liu et al., 2014). Among the
sensitive antibiotics, florfenicol was recommended for use in aqua-
culture because of its effectiveness and relative safety (Kosoff et al.,
2009). However, the S. agalactiae in this study showed resistance to
erythromycin (42.9%), penicillin (35.7%), clindamycin (28.6%), enro-
floxacin (35.7%), tetracycline (32.1%), gentamicin (28.6%) norfloxacin
(28.6%), ofloxacin (14.3%) and doxycycline (7.14%). In contrast to the
findings of this study, it is reported that S. agalactiae showed suscept-
ibility to penicillin, clindamycin, enrofloxacin, ofloxacin, and tetra-
cycline (Amal et al., 2012; Liu et al., 2014; Kannika et al., 2017). In the
current study, serotype III showed higher proportions of antibiotic re-
sistance than serotype Ia. We found that the rate of norfloxacin re-
sistance is 41.7% among serotype Ia isolates, but all of the serotype III
isolates were resistant to it. The result differed considerably from the
report that only serotype Ia strains instead of serotype III were resistant
to norfloxacin (Dangwetngam et al., 2016). The present study indicated
that 33.3% of the serotype Ia isolates showed resistance to ery-
thromycin, while the erythromycin resistance rate of serotype III is
100%. Our result was similar to those described in previous studies
(Florindo et al., 2010). Besides, serotype III but not Ia was resistant to
ofloxacin. It was pointed out that the differences in resistance and
sensitivity to antimicrobials of S. agalactiae could be due to environ-
mental variability, serotype variety, and the frequency and non-guided
use of chemotherapy in aquaculture (Abuseliana et al., 2010). To the
best of our knowledge, the exact factor is indeterminate, which requires
further research.
Streptococci utilize a major mechanism of antibiotic-resistance,
which is ribosomal protection (mediated by the tetM gene) (Tian et al.,
2004). In this study, tetM gene was detected in 75% serotype Ia isolates
but all of the serotype III isolates. 21% of the serotype Ia strains were
resistant to tetracycline, while the tetracycline resistance rate of ser-
otypes III isolates is 100%. Obviously, resistance to tetracycline was
frequently associated with the tetM gene, especially in serotypes III
isolates. The mechanism for erythromycin resistance in bacteria in-
volves modification of the ribosomal target by a methylase, which is
encoded by the ermB gene, in addition to active efflux of the drug
(Sutcliffe et al., 1996). Our study showed that the ermB gene was de-
tected in all isolates. Briefly, 33.3% of the serotype Ia strains were re-
sistant to erythromycin, while the erythromycin resistance rate of ser-
otypes III isolates is 100%. Our results suggested that the ermB gene
mediated high levels of resistance to erythromycin in serotypes III
strains. However, we had to the opposite conclusion in serotype Ia
strains. Previous study reported that the difference in the bacterial
capsule between the different genogroups of S. agalactiae could result in
different degrees of transformation or transposition involves in hor-
izontal transfers of erythromycin resistance genes (Park et al., 2009).
There are numerous reports on the association between mutations in
the quinolone-resistance determining region (QRDR) of the corre-
sponding genes gyrA and parC and resistance to fluoroquinolones in
bacteria (Nakamura et al., 1989; Trees et al., 1999; Salma et al., 2013).
Since the discovery of fluoroquinolone resistant S. agalactiae isolates
carrying a Ser-to-Leu mutation at codon 81 of gyrA and a Ser-to-Phe
mutation at codon 79 of parC in 2003 (Kawamura et al., 2003), an Asp-

Table 3
Antimicrobial susceptibilities and resistance of 28 S. agalactiae isolates.
Class Antibacterial agents % (n) of isolates

Serotype Ia (n = 24) Serotype III (n = 4)

Resistant Intermediate Sensitive Resistant Intermediate Sensitive

Macrolide Erythromycin 33.3 (8) 0 (0) 66.7 (16) 100 (4) 0 (0) 0 (0)
Clindamycin 16.7 (4) 4.2 (1) 79.2 (19) 100 (4) 0 (0) 0 (0)
Quinolone Enrofloxacin 29.2 (7) 20.8 (5) 50 (12) 75 (3) 0 (0) 25 (1)
Norfloxacin 16.7 (4) 8.3 (2) 75 (18) 100 (4) 0 (0) 0 (0)
Ofloxacin 0 (0) 0 (0) 100 (24) 100 (4) 0 (0) 0 (0)
Tetracycline Tetracycline 21 (5) 4 (1) 75 (18) 100 (4) 0 (0) 0 (0)
Doxycycline 0 (0) 12.5 (3) 87.5 (21) 50 (2) 0 (0) 50 (2)
β-Lactam Penicillin 41.7 (10) 0 (0) 58.3 (14) 0 (0) 25 (1) 75 (3)
Cephalexin 0 (0) 8.3 (2) 91.7 (22) 0 (0) 0 (0) 100 (4)
Others Vancomycin 0 (0) 0 (0) 100 (24) 0 (0) 0 (0) 100 (4)
Gentamicin 20.8 (5) 0 (0) 79.2 (19) 75 (3) 0 (0) 25 (1)
Florfenicol 0 (0) 0 (0) 100 (24) 0 (0) 0 (0) 100 (4)

87
L. Deng, et al. Aquaculture 510 (2019) 84–89

Fig. 4. Electrophoresis of resistance genes PCR amplification of 28 S. agalactiae strains. M: DL2000 DNA marker; 0: negative control; 1–28: PCR amplification of
resistance genes.

Table 4 S. agalactiae infection over a longer time horizon. In this study, among
Susceptibility of quinolones for S. agalactiae and mutations in gyrA and parC. 28 S. agalactiae isolates, serotype Ia are considerably more prevalent
Isolates No. Susceptibility level a
Mutation in QRDR region of than serotype III. In view of antibiotics resistance status of S. agalactiae,
the serotypes III showed higher proportions of antibiotics resistance
b c d
ENR NOR OFX gyrA parC than serotypes Ia. The results will be prized as a new reference for the
effective antibiotics application of serotype Ia and III S. agalactiae in-
GD201008-001 – – – Ser81 Ser79 Arg95
2 I R S S81L S79Y R95L
fection of fish in China, and illustrates the importance of better use of
6 S S S Ser81 Ser79 Arg95 antibiotics to prevent the widespread emergence of resistance S. aga-
7 R S S S81L S79Y R95L lactiae. In addition, we found that resistance to tetracycline was fre-
10 S R S S81L S79Y R95L quently associated with the tetM gene and the levels of resistance to
11 R R R S81L S79Y R95L
erythromycin mediated by ermB gene may be involved in the bacterial
13 R R R S81L S79Y R95L
14 R R R S81L S79Y R95L capsule of S. agalactiae. All quinolone-resistant S. agalactiae isolates
15 I S I Ser81 Ser79 Arg95 carried mostly double point mutations in DNA with inferred amino acid
20 S R R S81L S79Y R95L substitutions including the change of Ser-81 to Leu in the product of
24 R S S S81L S79Y R95L
gyrA and Ser-79 to Tyr in the product of parC. We suspected that one
a novel mutation, Asp-95 to Leu, in parC was related to quinolone-re-
S = Sensitive, I = Intermediate, R = Resistant.
b
ENR = Enrofloxacin. sistance of S. agalactiae.
c
NOR = Norfloxacin.
d
OFX = Ofloxacin. Acknowledgements

to-Tyr mutation at codon 83 of parC was also identified in fluor-
oquinolone-resistant S. agalactiae isolates (Biedenbach et al., 2006). In
our study, all two quinolone-susceptible S. agalactiae strains (strain
number 6 and 15) shared the same deduced amino acid sequences for
the QRDRs of both gyrA and parC. Similarly, eight isolates of quinolone-
resistant strains (strain number 2, 7, 10, 11, 13, 14, 20 and 24) had
identical amino acid sequences. However, compared with susceptible
strains, these quinolone-resistant S. agalactiae strains carried double
point mutations of DNA with the following inferred amino acid sub-
stitutions involving the QRDRs of gyrA and parC; Ser-81 to Leu for gyrA
and Ser-79 to Tyr for parC, as similar to previous reports (Lee and Lai,
2015; Piccinelli et al., 2015). In addition, to our knowledge for the first
time one novel mutation, Asp-95 to Leu, was found to be encoded in the
parC region of S. agalactiae. We suspected this substitution was related
to quinolone-resistance of S. agalactiae.
In conclusion, S. agalactiae is widespread in areas of intensive cul-
tivation, which causes huge economic loss to the aquaculture industry.
The use of antibiotics to control S. agalactiae infections is contributing
to higher rates of antibiotics resistance. To achieve successful cultiva-
tion, the priority of management is to prevent the disease by any means,
including maintenance of appropriate culture conditions along with
enhancement of fish immunity. A better understanding of the serotype
variation and distribution of epidemic pathogenic bacteria is one of the
fundamental tools for the development of an effective vaccine.
However, inactivated vaccine based on a specific serotype of S. aga-
lactiae is not possible to provide protection for all the serotypes,
therefore effective antibiotics application is very important to prevent
This work was supported by the Sichuan Key Research and
Development Project (No 2018N0007), and Sichuan Innovation Team
Project of Agricultural Industry Technology System (No.
2017SICAD002).
References
Abuseliana, A., Daud, H., Aziz, S.A., Bejo, S.K., Alsaid, M., 2010. Streptococcus agalactiae
the etiological agent of mass mortality in farmed red tilapia (Oreochromis sp.). J.
Anim. Vet. Adv. 9, 2640–2646. https://doi.org/10.3923/javaa.2010.2640.2646.
Amal, M.N., Zamri-Saad, M., Iftikhar, A.R., Siti-Zahrah, A., Aziel, S., Fahmi, S., 2012. An
outbreak of Streptococcus agalactiae infection in cage-cultured golden pompano,
Trachinotus blochii (Lacepede), in Malaysia. J. Fish Dis. 35, 849–852. https://doi.org/
10.1111/j.1365-2761.2012.01443.x.
Beigverdi, R., Jabalameli, F., Mirsalehian, A., Hantoushzadeh, S., Boroumandi, S.,
Taherikalani, M., Emaneini, M., 2014. Virulence factors, antimicrobial susceptibility
and molecular characterization of Streptococcus agalactiae isolated from pregnant
women. Acta Microbiol. Immunol. Hung. 61, 425–434. https://doi.org/10.1556/
AMicr.61.2014.4.4.
Betriu, C., Culebras, E., Gomez, M., Rodriguez-Avial, I., Sanchez, B.A., Agreda, M.C.,
Picazo, J.J., 2003. Erythromycin and clindamycin resistance and telithromycin sus-
ceptibility in Streptococcus agalactiae. Antimicrob. Agents Chemother. 47, 1112–1114.
https://doi.org/10.1128/aac.47.3.1112-1114.2003.
Biedenbach, D.J., Toleman, M.A., Walsh, T.R., Jones, R.N., 2006. Characterization of
fluoroquinolone-resistant beta-hemolytic Streptococcus spp. isolated in North America
and Europe including the first report of fluoroquinolone-resistant Streptococcus dys-
galactiae subspecies equisimilis: report from the SENTRY Antimicro. Diagn.
Microbiol. Infect. Dis. 55, 119–127. https://doi.org/10.1016/j.diagmicrobio.2005.
12.006.
Bisharat, N., Crook, D.W., Leigh, J., Harding, R.M., Ward, P.N., Coffey, T.J., Maiden,
M.C., Peto, T., Jones, N., 2004. Hyperinvasive neonatal group B Streptococcus has
arisen from a bovine ancestor. J. Clin. Microbiol. 42, 2161–2167. https://doi.org/10.
1128/jcm.42.5.2161-2167.2004.

88
L. Deng, et al.
Chong, S.M., Wong, W.K., Lee, W.Y., Tan, Z.B., Tay, Y.H., Teo, X.H., Chee, L.D.,
Fernandez, C.J., 2016. Streptococcus agalactiae outbreaks in cultured golden pomfret,
Trachinotus blochii (Lacépède), in Singapore. J. Fish Dis. 40, 971–974. https://doi.
org/10.1111/jfd.12570.
Dangwetngam, M., Suanyuk, N., Kong, F., Phromkunthong, W., 2016. Serotype dis-
tribution and antimicrobial susceptibilities of Streptococcus agalactiae isolated from
infected cultured tilapia (Oreochromis niloticus) in Thailand: nine-year perspective. J.
Med. Microbiol. 65, 247–254. https://doi.org/10.1099/jmm.0.000213.
Delannoy, C.M., Crumlish, M., Fontaine, M.C., Pollock, J., Foster, G., Dagleish, M.P.,
Turnbull, J.F., Zadoks, R.N., 2013. Human Streptococcus agalactiae strains in aquatic
mammals and fish. BMC Microbiol. 13, 41. https://doi.org/10.1186/1471-2180-
13-41.
Deng, Z.B., Zhang, Y.W., Geng, Y., Wang, K.Y., Chen, D.F., Ouyang, P., Huang, X.L., He,
C.L., Zhong, Z.J., Yang, Z.X., Tang, L., 2017. A new sequence type (ZST-1) of in-
fectious Streptococcus agalactiae from Chinese cyprinid fish, Schizopygopsis pylzovi.
Aquaculture 468, 496–500. https://doi.org/10.1016/j.aquaculture.2016.11.010.
Diekema, D.J., Andrews, J.I., Huynh, H., Rhomberg, P.R., Doktor, S.R., Beyer, J.,
Shortridge, V.D., Flamm, R.K., Jones, R.N., Pfaller, M.A., 2003. Molecular epide-
miology of macrolide resistance in neonatal bloodstream isolates of group B strep-
tococci. J. Clin. Microbiol. 41, 2659–2661. https://doi.org/10.1128/jcm.41.6.2659-
2661.2003.
Drlica, K., Zhao, X., 1997. DNA gyrase, topoisomerase IV, and the 4-quinolones.
Microbiol. Mol. Biol. Rev. 61, 377–392. https://doi.org/10.0000/PMID9293187.
Evans, J.J., Klesius, P.H., Gilbert, P.M., Shoemaker, C.A., Sarawi, M.A.A., Landsberg, J.,
Duremdez, R., Marzouk, A.A., Zenki, S.A., 2002. Characterization of β-haemolytic
Group B Streptococcus agalactiae in cultured seabream, Sparus auratus L., and wild
mullet, Liza klunzingeri (Day), in Kuwait. J. Fish Dis. 25, 505–513. https://doi.org/10.
1046/j.1365-2761.2002.00392.x.
Evans, J.J., Bohnsack, J.F., Klesius, P.H., Whiting, A.A., Garcia, J.C., Shoemaker, C.A.,
Takahashi, S., 2008. Phylogenetic relationships among Streptococcus agalactiae iso-
lated from piscine, dolphin, bovine and human sources: a dolphin and piscine lineage
associated with a fish epidemic in Kuwait is also associated with human neonatal
infections in Japan. J. Med. Microbiol. 57, 1369–1376. https://doi.org/10.1099/
jmm.0.47815-0.
Florindo, C., Viegas, S., Paulino, A., Rodrigues, E., Gomes, J.P., Borrego, M.J., 2010.
Molecular characterization and antimicrobial susceptibility profiles in Streptococcus
agalactiae colonizing strains: association of erythromycin resistance with subtype III-1
genetic clone family. Clin. Microbiol. Infect. 16, 1458–1463. https://doi.org/10.
1111/j.1469-0691.2010.03106.x.
Geng, Y., Wang, K.Y., Huang, X.L., Chen, D.F., Li, C.W., Ren, S.Y., Liao, Y.T., Zhou, Z.Y.,
Liu, Q.F., Du, Z.J., Lai, W.M., 2012. Streptococcus agalactiae, an emerging pathogen
for cultured ya-fish, Schizothorax prenanti, in China. Transbound. Emerg. Dis. 59,
369–375. https://doi.org/10.1111/j.1865-1682.2011.01280.x.
Giovanetti, E., Brenciani, A., Lupidi, R., Roberts, M.C., Varaldo, P.E., 2003. Presence of
the tet(O) gene in erythromycin- and tetracycline-resistant strains of Streptococcus
pyogenes and linkage with either the mef(A) or the erm(A) gene. Antimicrob. Agents
Chemother. 47, 2844–2849. https://doi.org/10.1128/aac.47.9.2844-2849.2003.
Imperi, M., Pataracchia, M., Alfarone, G., Baldassarri, L., Orefici, G., Creti, R., 2010. A
multiplex PCR assay for the direct identification of the capsular type (Ia to IX) of
Streptococcus agalactiae. J. Microbiol. Methods 80, 212–214. https://doi.org/10.
1016/j.mimet.2009.11.010.
Kannika, K., Pisuttharachai, D., Srisapoome, P., Wongtavatchai, J., Kondo, H., Hirono, I.,
Unajak, S., Areechon, N., 2017. Molecular serotyping, virulence gene profiling and
pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by
multiplex PCR. J. Appl. Microbiol. 122, 1497–1507. https://doi.org/10.1111/jam.
13447.
Kawamura, Y., Fujiwara, H., Mishima, N., Tanaka, Y., Tanimoto, A., Ikawa, S., Itoh, Y.,
Ezaki, T., 2003. First Streptococcus agalactiae isolates highly resistant to quinolones,
with point mutations in gyrA and parC. Antimicrob. Agents Chemother. 47,
3605–3609. https://doi.org/10.1128/aac.47.11.3605-3609.2003.
Kosoff, R.E., Chen, C.Y., Wooster, G.A., Getchell, R.G., Bowser, P.R., Clifford, A., Craig,
J.L., Lim, P., Wetzlich, S.E., Craigmill, A.L., 2009. Florfenicol residues in three species
of fish after 10-day oral dosing in feed. J. Aquat. Anim. Health 21, 8–13. https://doi.
org/10.1577/H08-013.1.
Lancefield, R.C., Hare, R., 1935. The serological differentiation of pathogenic and non-
pathogenic strains of hemolytic streptococci from parturient women. J. Exp. Med. 61,
335. https://doi.org/10.1084/jem.61.3.335.
Lee, W.T., Lai, M.C., 2015. High prevalence of Streptococcus agalactiae from vaginas of
women in Taiwan and its mechanisms of macrolide and quinolone resistance. J.
Microbiol. Immunol. Infect. 48, 510–516. https://doi.org/10.1016/j.jmii.2014.03.
002.
Li, L., Wang, R., Liang, W., Gan, X., Huang, T., Huang, Y., Li, J., Shi, Y., Chen, M., Luo, H.,
2013. Rare serotype occurrence and PFGE genotypic diversity of Streptococcus aga-
lactiae isolated from tilapia in China. Vet. Microbiol. 167, 719–724. https://doi.org/
10.1016/j.vetmic.2013.09.001.
89
Aquaculture 510 (2019) 84–89
Liu, L., Li, Y.W., He, R.Z., Xiao, X.X., Zhang, X., Su, Y.L., Wang, J., Li, A.X., 2014.
Outbreak of Streptococcus agalactiae infection in barcoo grunter, Scortum barcoo
(McCulloch & Waite), in an intensive fish farm in China. J. Fish Dis. 37, 1067–1072.
https://doi.org/10.1111/jfd.12187.
Merl, K., Abdulmawjood, A., Lämmler, C., Zschöck, M., 2010. Determination of epide-
miological relationships of Streptococcus agalactiae isolated from bovine mastitis.
FEMS Microbiol. Lett. 226, 87–92. https://doi.org/10.1016/s0378-1097(03)
00564-0.
Murayama, S.Y., Seki, C., Sakata, H., Sunaoshi, K., Nakayama, E., Iwata, S., Sunakawa, K.,
Ubukata, K., Invasive Streptococcal Disease Working G, 2009. Capsular type and
antibiotic resistance in Streptococcus agalactiae isolates from patients, ranging from
newborns to the elderly, with invasive infections. Antimicrob. Agents Chemother. 53,
2650–2653. https://doi.org/10.1128/AAC.01716-08.
Nakamura, S., Nakamura, M., Kojima, T., Yoshida, H., 1989. gyrA and gyrB mutations in
quinolone-resistant strains of Escherichia coli. Antimicrob. Agents Chemother. 33,
254–255. https://doi.org/10.1128/AAC.33.2.254.
Park, Y.K., Nho, S.W., Shin, G.W., Park, S.B., Jang, H.B., Cha, I.S., Ha, M.A., Kim, Y.R.,
Dalvi, R.S., Kang, B.J., 2009. Antibiotic susceptibility and resistance of Streptococcus
iniae and Streptococcus parauberis isolated from olive flounder (Paralichthys olivaceus).
Vet. Microbiol. 136, 76–81. https://doi.org/10.1016/j.vetmic.2008.10.002.
Piccinelli, G., Gargiulo, F., Corbellini, S., Ravizzola, G., Bonfanti, C., Caruso, A., De
Francesco, M.A., 2015. Emergence of the first levofloxacin-resistant strains of
Streptococcus agalactiae isolated in Italy. Antimicrob. Agents Chemother. 59,
2466–2469. https://doi.org/10.1128/AAC.05127-14.
Poyart, C., Jardy, L., Quesne, G., Berche, P., Trieucuot, P., 2003. Genetic basis of anti-
biotic resistance in Streptococcus agalactiae strains isolated in a French hospital.
Antimicrob. Agents Chemother. 47, 794–797. https://doi.org/10.1128/AAC.47.2.
794-797.2003.
Poyart, C., Tazi, A., Reglier-Poupet, H., Billoet, A., Tavares, N., Raymond, J., Trieu-Cuot,
P., 2007. Multiplex PCR assay for rapid and accurate capsular typing of group B
streptococci. J. Clin. Microbiol. 45, 1985–1988. https://doi.org/10.1128/JCM.
00159-07.
Pridgeon, J.W., Klesius, P.H., 2013. Development of live attenuated Streptococcus aga-
lactiae as potential vaccines by selecting for resistance to sparfloxacin. Vaccine 31,
2705–2712. https://doi.org/10.1016/j.vaccine.2013.03.066.
Ren, S.Y., Geng, Y., Wang, K.Y., Zhou, Z.Y., Liu, X.X., He, M., Peng, X., Wu, C.Y., Lai,
W.M., 2014. Streptococcus agalactiae infection in domestic rabbits, Oryctolagus cuni-
culus. Transbound. Emerg. Dis. 61, 92–95. https://doi.org/10.1111/tbed.12073.
Salma, R., Dabboussi, F., Kassaa, I., Hamze, M., Dabboussi, F., Hamze, M., Khudary, R.,
2013. gyrA and parC mutations in quinolone-resistant clinical isolates of Pseudomonas
aeruginosa from Nini Hospital in north Lebanon. J. Infect. Chemother. 19, 77–81.
https://doi.org/10.1007/s10156-012-0455-y.
Sapkota, A.R., Ojo, K.K., Roberts, M.C., Schwab, K.J., 2006. Antibiotic resistance genes in
multidrug-resistant Enterococcus spp. and Streptococcus spp. recovered from the in-
door air of a large-scale swine-feeding operation. Lett. Appl. Microbiol. 43, 534–540.
https://doi.org/10.1111/j.1472-765X.2006.01996.x.
Slotved, H.C., Kong, F., Lambertsen, L., Sauer, S., Gilbert, G.L., 2007. Serotype IX, a
proposed new Streptococcus agalactiae serotype. J. Clin. Microbiol. 45, 2929–2936.
https://doi.org/10.1128/JCM.00117-07.
Suanyuk, N., Kong, F., Ko, D., Gilbert, G.L., Supamattaya, K., 2008. Occurrence of rare
genotypes of Streptococcus agalactiae in cultured red tilapia Oreochromis sp. and Nile
tilapia O. niloticus in Thailand—relationship to human isolates? Aquaculture 284,
35–40. https://doi.org/10.1016/j.aquaculture.2008.07.034.
Sutcliffe, J., Taitkamradt, A., Wondrack, L., 1996. Streptococcus pneumoniae and
Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common
resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 40,
1817–1824. https://doi.org/10.0000/PMID8843287.
Tian, Y., Aarestrup, F.M., Lu, C.P., 2004. Characterization of Streptococcus suis serotype 7
isolates from diseased pigs in Denmark. Vet. Microbiol. 103, 55–62. https://doi.org/
10.1016/j.vetmic.2004.07.009.
Trees, D.L., Sandul, A.L., Peto-Mesola, V., Aplasca, M.R., Leng, H.B., Whittington, W.L.,
Knapp, J.S., 1999. Alterations within the quinolone resistance-determining regions of
GyrA and ParC of Neisseria gonorrhoeae isolated in the Far East and the United States.
Int. J. Antimicrob. Agents 12, 325–332. https://doi.org/10.1016/S0924-8579(99)
00081-3.
Vandamme, P., Devriese, L.A., Pot, B., Kersters, K., Melin, P., 1997. Streptococcus difficile
is a nonhemolytic group B, type Ib Streptococcus. Int. J. Syst. Bacteriol. 47, 81–85.
https://doi.org/10.1099/00207713-47-1-81.
Ye, X., Li, J., Lu, M., Deng, G., Jiang, X., Tian, Y., Quan, Y., Jian, Q., 2011. Identification
and molecular typing of Streptococcus agalactiae isolated from pond-cultured tilapia in
China. Fish. Sci. 77, 623–632. https://doi.org/10.1007/s12562-011-0365-4.
Zhang, Z., Lan, J., Li, Y., Hu, M., Yu, A., Zhang, J., Wei, S., 2018. The pathogenic and
antimicrobial characteristics of an emerging Streptococcus agalactiae serotype IX in
Tilapia. Microb. Pathog. 122, 39–45. https://doi.org/10.1016/j.micpath.2018.05.
053.