Received: 24 June 2019 | Revised: 23 August 2019 | Accepted: 4 September 2019

DOI: 10.1111/jfbc.13049

FULL ARTICLE

Berberine chloride ameliorated PI3K/Akt‐p/SIRT‐1/PTEN

signaling pathway in insulin resistance syndrome induced in
rats

Marwa El‐Zeftawy1,2 | Doaa Ghareeb2,3 | Eman R. ElBealy4 | Rasha Saad2 |

Salma Mahmoud2 | Nihal Elguindy5 | Attalla F. El‐kott6,7 | Mohamed El‐Sayed5

1
Biochemistry Department, Faculty of
Veterinary Medicine, The New Valley Abstract
University, New Valley, Egypt The liver is the main organ involved in lipid metabolism process and it helps in drug
2
Biological Screening and Preclinical Trial
detoxification. Insulin resistance is considered one of risk reasons which lead to sev‐
Lab, Biochemistry Department, Faculty of
Science, Alexandria University, Alexandria, eral metabolic diseases. Currently, berberine (BER) occupies a huge challenge against
Egypt
multiple diseases with no toxic effect. The present work was aimed to identify, does
3
Pharmaceutical and Fermentation
Industries Development Center, General
BER‐chloride has a poisonous influence on the liver? and investigating the outcome
Authority of City of Scientific Research and of BER‐chloride on PI3K/Akt‐p/SIRT‐1/PTEN pathway during insulin resistance syn‐
Technology Applications, Alexandria, Egypt
4
drome. The insulin resistance model was achieved in experimental female rats via
Biology Department, College of Science
for girls, King Khalid University, Abha, Saudi high‐fat diet (HFD). Glucose, insulin, lipid profiles, and hepatic oxidative stress pa‐
Arabia rameters were assessed. PI3K, AKt‐p, SIRT‐1, and PTEN levels in hepatic tissue were
5
Biochemistry Department, Faculty of
determined at genome and protein levels. Further adiponectin concentration was
Science, Alexandria University, Alexandria,
Egypt performed in serum, hepatic, and white adipose tissues. Molecular study of fold al‐
6
Biology Department, College of teration in insulin, insulin receptor, and retinol binding protein‐4 (RBP4) in liver was
Science, King Khalid University, Abha, Saudi
Arabia done.
Practical applications
7
Zoology Department, College of
Science, Damanhour University, Damanhour,
Egypt Obesity syndrome causes multiple obstacles in modern years. The current results
revealed elevation the body weight of rats, plasma glucose, homeostatic model as‐
Correspondence
Marwa El‐Zeftawy, Biochemistry sessment, glycated hemoglobin, insulin, and lipid profiles concentrations in a group
Department, Faculty of Veterinary Medicine, of rats, which nourished HFD for 8 weeks and this rise, was diminished after 2 weeks
The New Valley University, New Valley,
Egypt. from BER‐chloride administration. Further, BER‐chloride improved transaminases
Email: marwa@vetnv.au.edu.eg, enzymes, pro‐oxidant, and antioxidant defense system, PI3K, AKt‐p, SIRT‐1, and
marwa_3_1983@yahoo.com
PTEN in the liver, with downregulation of hepatic RBP4. Hence, these data provide a
Funding information crucial message that BER‐chloride enhanced both hepatic function and insulin signal‐
deanship of Scientific Research at
King Khalid University, Abha, KSA for ing pathways that might be of therapeutic importance to insulin resistance with no
supported this work under grant number harmful effect on the liver. BER‐chloride is predicted to be a drug of choice for obe‐
(R.G.P.1/117/40), Grant/Award Number:
R.G.P.1/117/40 sity complications cure.

KEYWORDS
berberine chloride, hepatotoxicity, insulin receptor, liver

J Food Biochem. 2019;00:e13049. wileyonlinelibrary.com/journal/jfbc © 2019 Wiley Periodicals, Inc. | 1 of 11

https://doi.org/10.1111/jfbc.13049
2 of 11 | EL‐ZEFTAWY et al.
1 | I NTRO D U C TI O N
Obesity represents one of the severe health trouble worldwide and
normally linked with hepatic insulin resistance and hyperglycemia
(Kahn, Hull, & Utzschneider, 2006; Ren, Zhou, Huang, Wang, & Li,
2019). Multiple metabolic syndromes as hyperlipidemia, type II dia‐
betes mellitus, nonalcoholic fatty liver, and cardiovascular disorders
are accompanied to insulin resistance syndrome. All these metabolic
syndromes may lead to bad prognosis and early mortality in some
diseased individuals (David, Rifkin, Rabbani, & Ceradini, 2017). PI3K/
Akt is one of the pathways which involved in metabolic consequence
of insulin (Gao et al., 2016). Though numerous pharmaceutical drugs
are available for chronic diseases cure, but these drugs show harmful
side effects with long term of use due to their poisonous effect on
body organs (Koc et al., 2019; Peter, Basha, Giridharan, Lavinya, &
Sabina, 2017).
Berberine (BER) is a natural alkaloid isoquinoline sequestered
from different plants like Berberis vulgaris (Jiang, Li, & Li, 2015). BER
is a strong base which is usually unstable when present in free form
so it usually accompanied with chloride ion in the form of BER‐chlo‐
ride (Bodiwala, Sabde, Mitra, Bhutani, & Singh, 2011; Li, Yuan, Shang,
& Guo, 2017). BER acts as an anticancer (Liu et al., 2015), anti‐in‐
flammatory (Liu et al., 2015; Vuddanda, Chakraborty, & Singh, 2010),
anti‐leishmanial (Vuddanda et al., 2010; Zhang et al., 2016), and
anti‐immunodeficiency virus in humans (Dong et al., 2011). BER also
improved some cardiac syndromes and intestinal infections (Zhang
et al., 2016). Recently BER used as a neuroprotective agent against
some neurodegenerative disorders as it has the capability of passing
the blood–brain barrier (Jiang et al., 2015). To investigate whether
BER‐chloride has a protective influence on insulin resistance syn‐
drome, the current study sets up in vivo animal model using high‐fat
diet (HFD) feeding. The effects of BER‐chloride on the numerous
insulin signaling pathway were investigated.
2 | M ATE R I A L S A N D M E TH O DS
2.1 | Materials
BER‐chloride was got from Sigma‐Aldrich Chemical Co. (USA). Kits
of blood glucose level (BGL), protein, lipid profiles (total cholesterol
“TC,” triacylglycerol “TG,” and high density lipoprotein cholesterol
“HDL‐c”), glycated hemoglobin (HbA1C), as well as creatinine, urea,
alanine aminotransfersase (ALT), and aspartate aminotransferase
(AST) kits were purchased from Spinreact (Spain), Human (Germany),
Biosystem (Egypt), and Biolabo (France), respectively. Ribonucleic
acid (RNA) extraction kit, Maxime reverse transcription (RT) premix
kit, 2x Taq master mix, deoxyribo nucleic acid (DNA) Ladder, RNase‐
free water, and the primer sequences of β‐actin, insulin, insulin recep‐
tor (IR), and retinol binding protein‐4 (RBP4) were purchased from
Qiagen (Germany), Intron Biotechnology (Korea) and Fermentas,
Thermo fisher scientific (Germany), respectively. Additionally, prim‐
ers of phosphatidyl inositol‐3‐kinase (PI3K), phosphorylated protein
kinase B (Akt‐p), sirtuin type 1 (SIRT‐1), and phosphatase and tension
homolog (PTEN) were purchased from Biovision (USA). ELISA kit of
insulin, PI3K, AKt‐p, SIRT‐1, PTEN, and adiponectin were purchased
from DRG (USA), Wuhan Fine Biological Technology Co. (China), Ray
Biotech (Georgia), MyBiosource (USA), Abcam (USA), Bioscience
(USA), respectively. Foline reagent, thiobarbituric acid (TBA), re‐
duced glutathione (GSH), 5′5′dithio‐bis‐2‐nitrobenzoic acid (DTNB),
cumene hydroxide, methyl green, polyethylene glycol (PEG), nitro‐
cellulose membrane, sodium dodecyl sulfate, acrylamide, and BCIP/
NBT substrate solution, premixed were obtained from Sigma‐Aldrich
Chemical Co. (St. Louis, Mo, USA). Organic solvents, namely etha‐
nol 95%, methanol, and formalin solutions were of HPLC‐grade and
brought from Merck (USA). Other reagents were obtained with high
grade. Primary antibodies of β‐actin, Akt‐p, and PTEN were got from
Biotechne (USA), while PI3K and SIRT‐1 were obtained from Abcam
(USA). Also mouse and rabbit secondary antibodies were purchased
from Biotechne (USA) and Abcam (USA). Protein marker was pur‐
chased from Biovision (USA).
2.2 | Experimental animal protocol and sample
preparation
Female albino Sprague‐Dawley rats (Rattus norvegicus), with weight
ranged from 130 to 150 g and aged (10–12) weeks old, were taken
from the experimental animal house of Medical Research Institute,
Alexandria University, Egypt. Rats were kept in polycarbonate cages
(six rats per cage). They were kept under conventional environments
of temperature and humidity with a 12‐hr photoperiod. Diet and
water were provided ad libitum. The experimental rats were han‐
dled in agreement with the National Organizations of Health Guide
for the Care and Use of Laboratory Animals (NIH 1996). This work
was done in firm accordance with the approvals in the Guide for the
Care and Use of Laboratory Animals. The protocol was approved ac‐
cording to the Ethics of Animal House in Medical Technology Center,
Alexandria University, Egypt. All the animals were adapted 1 week
before the experiment begins.
After that, 30 rats were divided into 5 groups (six rats per group),
Group 1 (Sham control group) that were healthy and free from any
disease and they fed the standard food for 10 weeks, Group 2
(Control vehicle) fed on low‐fat diet (LFD) for 8 weeks then received
20% PEG by intragastric tube (10 ml/kg Bwt) for 2 weeks. Group
3 (Control BER‐chloride) fed LFD for 8 weeks, then orally given
BER‐chloride dissolved in 20% of PEG (100 mg/kg Bwt) for 2 weeks.
Group 4 (Induction group) fed on HFD for 8 weeks, then orally given
20% of PEG (10 ml/kg Bwt) for 2 weeks. Group 5 (Induction treated
group) fed HFD for 8 weeks, then orally given BER‐chloride dis‐
solved in 20% of PEG (100 mg/kg Bwt) for 2 weeks. Doses of BER‐
chloride and PEG which were used in this protocol referred to other
previous studies (El‐Sayed, Ghareeb, Talat, & Sarhan, 2013; Ghareeb
et al., 2015; Saleh, Attia, & Ghareeb, 2018).
Rat's body weights were noticed in the first and last week of ther‐
apy. Blood sampling and animal scarification were performed under
anesthesia, and all efforts were made to decrease suffering. After the
end of the experimental period, rats were fasted overnight after 8‐hr,
EL‐ZEFTAWY et al.
blood samples were collected in sodium fluoride tubes for measur‐
ing of fasting BGL. After a full fasting period (12‐hr), blood samples
were collected, and then centrifuged at 3,000 rpm for 10 min. The
obtained serum was kept at −20°C until analyzed. Hepatic tissues and
white adipose tissue from all groups were excised immediately and
washed with ice‐cold saline. Homogenization was performed in 0.1M
of sodium phosphate‐buffer, pH 7.4 (for hepatic tissue) and in 0.15M
of potassium chloride (for white adipose tissue) (Steinberg, Vaughan,
& Margolis, 1961). The homogenate was centrifuged at 4,000 rpm
for 15 min at 4°C and supernatant was kept at −80°C until analysis
(Pandian, Anuradha, & Viswanathan, 2002). In each group, part of
hepatic tissue was preserved in liquid nitrogen, and stored at −80°C
for total RNA isolation and polymerase chain reaction (PCR) analy‐
sis. Another part of liver and white adipose tissue were fixed at 10%
neutral buffered formalin solution for histopathological examination.
2.3 | Biochemical, molecular, and
histopathological studies
2.3.1 | Biochemical and molecular studies
BGL was determined by a glucose assay kit that is dependent on
glucose oxidase‐peroxidase method. Serum insulin was analyzed
through the DRG insulin ELISA kit. The insulin resistance was evalu‐
ated by calculating the HOMA‐IR as previously described (Han et al.,
2018). HbA1C % was assessed by Biosystem kit. Total protein con‐
centration was measured spectrophotometrically using Beirut assay
based kit. Serum lipid profile (TC, TG, and HDL‐c), urea, creatinine,
ALT, and AST were performed according to the instructions of their
commercial kits. LDL‐c and vLDL‐c levels were calculated according
to previous studied formula by Friedewald, Levy, and Fredrickson
(1972). Standardized methods were used to determine the concen‐
tration of thiobarbituric acid reactive substances (TBARS) (Tappel &
Zalkin, 1959) and GSH in liver (Ellman, 1959).
In addition, hepatic activities of xanthine oxidase (XO) (Litwack,
Bothwell, Williams, & Elvehjem, 1953), glutathione peroxidase (GPx)
(Chiu, Stults, & Tappel, 1976; Paglia & Valentine, 1967), and adenine
triphosphatase (ATPase) (Candeias, Abreu, Pereira, & Cruz‐Morais,
2009) were done. PI3K, Akt‐p, SIRT‐1, and PTEN concentrations in
hepatic tissue homogenate and adiponectin level in serum, liver ho‐
mogenate, and white adipose tissue were estimated using ELISA kits.
These tests employ the quantitative sandwich enzyme immunoassay
technique.
Total RNA was isolated from liver using total RNA extraction Kit
and processed according to kit manufacturer's directions. After that
the level of total RNA was measured by spectrophotometer at 260
and 280 nm. One microgram of the isolated RNA was reverse tran‐
scribed into complementary DNA (cDNA) using reverse transcrip‐
tase (Maxime RT Pre‐Mix kit, Fermentas, EU).
Primers used for PCR technique were constructed using the
known sequences for the respective genes. The gene‐specific
primer sequences were as follows: β‐actin forward primer 5′‐CAT
CACTATCGGCAATGAGC‐3′ and reverse primer 5′‐GACAG
| 3 of 11
CACTGTGTTGGCATA‐3′, RBP4 forward primer 5′‐TTTTCTGTG
GACGAGAAGGGT‐3′ and reverse primer 5′‐TGGTCATCGTTTCCT
CGCTTG‐3′, IR forward primer 5′‐TGACAATGAGGA ATGTGGGGAC‐3′
and reverse primer 5′‐GGGCAAACTTTCTGACAATGACTG‐3′, insulin
forward primer 5′‐TTCTACACACCCAAGTCCCGTC‐3′ and reverse
primer 5′‐ATCCACAATGCCACGCTTCTGC‐3′, PI3K forward primer
5′‐AACACAGAAGACCAATACTC‐3′, and reverse primer 5′‐TTCGCC
ATCTACCACTAC‐3′, Akt‐p forward primer 5′‐GTGGCAAGATGTGTAT
GAG‐3′, and reverse primer 5′‐CTGGCTGAGTAGGAGAAC‐3′, SIRT‐1
forward primer 5′‐TGAAGCTGTTCGTGGAGATATTTTT‐3′, and reverse
primer 5′‐CATGATGGCAAGTGGCTCAT‐3′, and PTEN forward primer
5′‐CCCAGTTTGTGGTCTGCCAGC‐3′ and reverse primer 5′‐ATGAGC
TTGTCCTCCCGCCG‐3′.
PCR program was optimized for the primer pair and the PCR pro‐
tocol was 40 cycles, each consisted of 30 s denaturation at 95°C, 30 s
annealing at 52.5°C, 51.5°C, 50°C, 52°C, 58°C, 58.8°C, 63.9°C, and
68.9°C for β‐actin, RBP4, IR, insulin, PI3K, Akt‐p, SIRT‐1, and PTEN,
respectively, and 60 s extension at 72°C. The primers were run on
the Mini Cycler (Eppendorf, Labcaire, Germany). The PCR products
were run on 1.5% agarose gel. Gels were stained with ethidium bro‐
mide, visualized by 30 nm Ultraviolet Radiator (Alpha‐Chem. Imager,
USA), and photographic record were made. The optical density and
the microgram content of bands were calculated by the UVIBAND
MAX software program.
Western blot was performed to determine the protein level ex‐
pression of PI3K, Akt‐p, SIRT‐1, and PTEN in hepatic tissue. After
separation of protein (100 μg of each sample was used) by sodium
dodecyl sulfate poly acrylamide gel electrophoresis (SDS‐PAGE)
technique, the gel was transferred to nitrocellulose membrane.
The membrane was incubated with labeled antibodies specific for
the protein of interest and β‐actin was used as an internal control.
Following adding the secondary antibody and incubation time, the
unbound antibody was washed off, leaving only antibody which
bounded to the protein of interest so only one band was visible and
its thickness was corresponded to the amount of protein which pres‐
ent in a sample and it was detected using BCIP/NBT substrate solu‐
tion. The intensities of obtaining bands were estimated using image
analyzing system (UVIBAND MAX software).
2.3.2 | Histopathological study
Hepatic and white adipose tissues of each rat from each group was
excised and immediately fixed at 10% neutral buffered formalin
solution after washing with ice‐cold normal saline. The resultant
fixed tissue samples were used for histopathological examination
in the Histopathology Laboratory of Medical Technology Center,
Alexandria University, using the routine procedures developed in
the respective laboratories. The tissue was cut at 3 mm thick, and
the blocks were embedded in paraffin. Using a rotary microtome,
sections of 8 µm thickness were cut. The sections were stained with
hematoxylin and eosin and examined under Olympus microscope
(Olympus, Tokyo, Japan) at (100X) magnification for any histopatho‐
logical changes.
4 of 11 | EL‐ZEFTAWY et al.

TA B L E 1 Effect of berberine (BER) chloride on body weight, blood glucose level (BGL), serum insulin, homeostatic model assessment
insulin resistance (HOMA‐IR), and glycated hemoglobin (HbA1C) after the treatment of diabetic‐induced experimental animals

Serum insulin
Groups Body weight (g) BGL (mg/dl) (µIU/ml) HOMA‐IR (mg/dl) HbA1C (%)

Sham control 141.0 ± 7.4a 76.0 ± 1.4a 10.0 ± 0.2a 1.91 ± 0.061a 4.2 ± 0.4a
a a a a
Control vehicle (LFD + 20% PEG) 142.2 ± 8.04 73.33 ± 2.6 10.1 ± 0.6 1.9 ± 0.13 4.4 ± 0.42a
Control BER‐chloride 144.0 ± 6.07a 75.2 ± 3.31a 10.45 ± 0.33a 1.92 ± 0.12a 4.0 ± 0.24a
b c c c
Induction (HFD + 20% PEG 202.3 ± 5.39 180.1 ± 4.38 20.17 ± 2.93 8.97 ± 1.37 6.1 ± 0.39c
(10 ml/kg Bwt)
Induction treated with 200.5 ± 8.02b 97.7 ± 5.61b 15.67 ± 2.42b 3.76 ± 0.48b 5.1 ± 0.18b
BER‐chloride

Note: Values represent the mean ± SD of six rats. ANOVA (one‐way) followed by Student–Newman–keuls test.
Means with letters (a), (b), and (c) were statistical represented compared to sham control group as follow: a = p < .001, b = p < .01, c = p < .05.

2.4 | Statistical analysis

Data were analyzed using Primer of Biostatistics software program
(Version 5.0) by one‐way ANOVA. Significance of means ± SD was
detected via using the multiple comparisons Student–Newman–
keuls test at p < .05. Adiponectin correlation was analyzed by SPSS
(Version 20.0) software program, using person coefficient (r).

3 | R E S U LT S

3.1 | Body weight, BGL, and insulin resistance

parameters
Feeding of HFD for 8‐weeks leads to body weight elevation more
than control levels. Fasting BGL, homeostatic model assessment in‐
sulin receptor (HOMA‐IR), and HbA1C were also elevated 1.4, 3.7, and
45.2‐folds, in comparison to sham control rats. Moreover, elevation of
insulin concentration was noticed in HFD group 1.0‐fold in serum and
72.3‐fold in liver homogenate. Administration of BER‐chloride leads to
reduction of fasting BGL, serum insulin, HOMA‐IR, and HbA1C to 0.5,
0.2, 0.6, and 0.2‐folds, respectively, compared with HFD rats (Table 1).
Moreover, HFD up regulated expression of insulin gene in liver and
BER‐chloride therapy for 2 weeks wasn't significant (Figure 1).
F I G U R E 1 Effect of berberine (BER) chloride on the fold change
of insulin, insulin receptor (IR) and retinol binding protein‐4 (RBP4)
3.2 | Lipid profiles parameters genes. (A) Agrose gel electrophoresis of gene expression of insulin
(293 bp), IR (129 bp), and RBP4 (392 bp) compared to β‐actin
Lipid profile showed a significant rise in the HFD group than that of
(300 bp). (B) Fold change of gene expression in liver homogenate
sham control where TC increased 1.2‐fold and TG, LDL‐c, and vLDL‐c
after the treatment of diabetic‐induced experimental animals
were 0.9‐fold increase, while HDL‐c was significantly decreased by represented as 6 rats ± SE. ANOVA (one‐way) followed by Student–
43%. Lipid profiles were partially repaired after using BER‐chloride Newman–keuls test. Means with letters (a), (b), (c), and (d) were
as therapy for 2 weeks (Table 2). statistically represented compared to sham control group as a at
p < .001, b at p < .01, c at p < .05, and d at p > .05

3.3 | Oxidative stress markers, serum transaminases

activity, and kidney function tests
Experimental HFD rats exhibited an elevation of TBARS and XO (1.5
and 0.8‐folds) in comparison to sham control. Both TBARS and XO
were decreased nearly 0.4‐ and 0.2‐folds after 2 weeks of BER‐chlo‐
ride treatment. However, GSH, GPx, and ATPase were decreased by
50.9%, 41.9%, and 35.2% in the HFD group compared to sham con‐
trol and after administration of BER‐chloride therapy; those previ‐
ous parameters were increased by percentage 42.9, 33.7, and 26.1,
respectively (Table 3). Also, HFD intake increased liver transami‐
nases (ALT and AST) and kidney function tests (urea and creati‐
nine) comparing to sham control one. Administration of 100 mg/kg
EL‐ZEFTAWY et al. | 5 of 11

TA B L E 2 Effect of berberine (BER) chloride on total cholesterol (TC), triacylglycerol (TG), high‐density lipoprotein cholesterol (HDL‐c),
low‐density lipoprotein cholesterol (LDL‐c), and very low‐density lipoprotein cholesterol (vLDL‐c) after the treatment of diabetic‐induced
experimental animals

Groups TC (mg/dl) TG (mg/dl) HDL‐c (mg/dl) LDL‐c (mg/dl) vLDL‐c (mg/dl)

a a a a
Sham control 130.5 ± 2.79 110.3 ± 3.6 59.33 ± 3.14 110.33 ± 3.62 22.1 ± 0.7a
a a a a
Control vehicle (LFD + 20% PEG) 127.3 ± 4.41 110.0 ± 4.47 64.3 ± 3.01 41.0 ± 3.74 22.3 ± 1.2a
Control BER‐chloride 129.3 ± 2.25a 111.2 ± 2.40a 63.2 ± 2.56a 43.9 ± 4.24a 21.77 ± 0.5a
c c c c
Induction (HFD + 20% PEG 282.2 ± 3.31 210.5 ± 3.73 33.3 ± 2.88 206.7 ± 2.78 42.9 ± 0.4c
(10 ml/kg Bwt)
Induction treated with 164.5 ± 4.14b 141.5 ± 2.26b 42.8 ± 3.37b 93.4 ± 6.20 b 28.133 ± 0.7b
BER‐chloride

Note: Values represent the mean ± SD of six rats. ANOVA (one‐way) followed by Student–Newman–keuls test.
Means with letters (a), (b), and (c) were statistical represented compared to sham control group as follow: a = p < .001, b = p < .01, c = p < .05.

TA B L E 3 Effect of berberine (BER) chloride on hepatocyte thiobarbituric acid reactive substances (TBARS), reduced glutathione (GSH),
xanthine oxidase (XO), glutathione peroxidase (GPx), and adenine triphosphatase (ATPase) status after the treatment of diabetic‐induced
experimental animals

TBARS (mmol/mg GSH (mg/mg XO (IU/mg GPx (U/mg ATPase (µmol/pi/

Groups protein) protein) protein) protein) min/mg protein)

Sham control 2.1 ± 0.02a 0.285 ± 0.05a 128.0 ± 1.6a 7.06 ± 0.3a 0.71 ± 0.02a
Control vehicle (LFD + 20% PEG) 2.03 ± 0.04a 0.29 ± 0.06a 130.17 ± 4.26a 7.02 ± 0.55a 0.73 ± 0.01a
a a a a
Control BER‐chloride 2.12 ± 0.28 0.29 ± 0.05 129.67 ± 4.46 7.17 ± 0.22 0.71 ± 0.01a
Induction (HFD + 20% PEG 5.25 ± 0.35c 0.14 ± 0.02c 231.5 ± 7.56c 4.1 ± 0.33c 0.46 ± 0.05c
(10 ml/kg Bwt)
Induction treated with 3.15 ± 0.24b 0.20 ± 0.03b 171.3 ± 3.83b 5.48 ± 0.33b 0.58 ± 0.03b
BER‐chloride

Note: Values represent the mean ± SD of six rats. ANOVA (one‐way) followed by Student–Newman–keuls test.
Means with letters (a), (b), and (c) were statistical represented compared to sham control group as follow: a = p < .001, b = p < .01, c = p < .05.

TA B L E 4 Effect of berberine (BER) chloride on serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities and
kidney function tests after the treatment of diabetic‐induced experimental animals

Groups ALT (U/ml) AST (U/ml) Urea (mg/dl) Creatinine (mg/dl)

a a a
Sham control 33.5 ± 2.1 46.0 ± 3.2 33.4 ± 2.3 0.71 ± 0.1a
Control vehicle (LFD + 20% PEG) 34.2 ± 4.6a 49.3 ± 1.8a 31.83 ± 4.6a 0.72 ± 0.04a
a a a
Control BER‐chloride 32.2 ± 1.94 49.5 ± 3.78 29.67 ± 2.16 0.71 ± 0.04a
Induction (HFD + 20% PEG (10 ml/kg Bwt) 58.5 ± 5.09c 85.7 ± 5.68c 56.17 ± 2.14c 0.90 ± 0.05b
b b b
Induction treated with BER‐chloride 40.8 ± 3.71 62.5 ± 6.80 39.83 ± 3.49 0.75 ± 0.06a

Note: Values represent the mean ± SD of six rats. ANOVA (one‐way) followed by Student–Newman–keuls test.
Means with letters (a), (b), and (c) were statistical represented compared to sham control group as follow: a = p < .001, b = p < .01, c = p < .05.

Bwt BER‐chloride in HFD rats for 2 weeks leads to decrease liver
transaminases activities and kidney function tests nearly 0.3‐ and
0.2‐folds (Table 4).
3.4 | Insulin signaling pathway parameters
As shown in Table 5 and Figures 1‒3 the marked significant de‐
cline of PI3K, AKt‐p and SIRT‐1 by 57.1%, 42.9%, and 61.9%, was
noticed in HFD rats compared to sham control at ELISA level, also
they decreased by 76.2%, 77.5%, and 93.1% at genome level and
by 92.9%, 42.1%, and 76.0% at protein level. Administration of
BER‐chloride to that group of rats leads to increase PI3K, AKt‐p,
and SIRT‐1 to 84.4%, 49%, and 120%, respectively, at ELISA level,
also they 4.4‐, 0.78‐, 10.5‐ and 0.5‐folds increased at genome
level and also they 8.5‐, 1.7‐ and 0.5‐folds raised at protein level.
However, PTEN was increased in HFD rats by 66.6% in ELISA level
and 1.25‐ and 21‐folds elevated at genome and protein levels,
respectively. After BER‐chloride treatment PTEN diminished to
27.5% at ELISA level, 50% at genome level, and 74.2% at protein
level. Additionally, RBP4 was reduced from 1.5‐fold to 0.4‐fold
after BER‐chloride treatment. However, BER‐chloride failed to af‐
fect the HFD side effect on IR expression.
6 of 11 | EL‐ZEFTAWY et al.

TA B L E 5 Effect of berberine (BER) chloride on phosphatidyl inositol‐3‐kinase (PI3K), phosphorylated protein kinase B (Akt‐p), Sirtuin
type 1 (SIRT‐1), and phosphatase and tension homolog (PTEN) levels in hepatocyte after the treatment of diabetic‐induced experimental
animals

Groups PI3K (pg/g) Akt‐p (pg/g) SIRT‐1 (ng/g) PTEN (pg/g)

c c c
Sham control 493.0 ± 12.3 350.0 ± 23.5 105.0 ± 10.2 1,200 ± 28.9a
c c c
Control vehicle (LFD + 20% PEG) 486.0 ± 12.0 335.0 ± 19.3 110.0 ± 6.9 1,250.0 ± 25.3a
Control BER‐chloride 491.0 ± 23.5c 342.0 ± 18.9c 109.0 ± 9.7c 1,150.0 ± 65.3a
a a a
Induction (HFD + 20% PEG (10 ml/ 211.5 ± 21.5 200.0 ± 12.1 40.0 ± 1.2 2,000.0 ± 28.9c
kg Bwt)
Induction treated with BER‐chloride 390.0 ± 31.2b 298.0 ± 14.2b 86.0 ± 8.5b 1,450.0 ± 23.5b

Note: Values represent the mean ± SD of six rats. ANOVA (one‐way) followed by Student–Newman–keuls test.
Means with letters (a), (b), and (c) were statistical represented compared to sham control group as follow: a = p < .001, b = p < .01, c = p < .05.

F I G U R E 3 Effect of berberine (BER) chloride on the protein

F I G U R E 2 Effect of berberine (BER) chloride on the fold change
of phosphatidyl inositol‐3‐kinase (PI3K), phosphorylated protein
kinase B (Akt‐p), Sirtuin type 1 (SIRT‐1), and phosphatase and
tension homolog (PTEN) genes. (A) Agrose gel electrophoresis of
gene expression of PI3K (195 bp), Akt‐p (195 bp), SIRT‐1 (82 bp), and
PTEN (79 bp) compared to β‐actin (300 bp). (B) Fold change of gene
expression in liver homogenate after the treatment of diabetic‐
induced experimental animals represented as 6 rats ± SE. ANOVA
(one‐way) followed by Student–Newman–keuls test. Means with
letters (a), (b), (c) and (d) were statistically represented compared to
sham control group as a at p < .001, b at p < .01, c at p < .05, and d
at p > .05
3.5 | Adiponectin concentration
Adiponectin percentage in serum, liver, and white adipose tissue of
HFD rats was reduced (52%, 80%, and 45%), and this percentage was
levels of phosphatidyl inositol‐3‐kinase (PI3K), phosphorylated
protein kinase B (Akt‐p), Sirtuin type 1 (SIRT‐1), and phosphatase
and tension homolog (PTEN). (A) Western blot of protein expression
of PI3K (−85 kDa), Akt‐p (−60 kDa), SIRT‐1 (−120 kDa), and PTEN
(−54 kDa) compared to β‐actin (−45 kDa). (B) Protein levels in liver
homogenate after the treatment of diabetic‐induced experimental
animals represented as 6 rats ± SE. ANOVA (one‐way) followed by
Student–Newman–keuls test. Means with letters (a), (b), (c), and (d)
were statistically represented compared to sham control group as a
at p < .001, b at p < .01, c at p < .05, and d at p > .05
elevated after BER‐chloride administration for 2 weeks (48%, 385%,
and 65.3%), respectively (Table 6).
3.6 | Histopathological results
The biochemical and molecular alterations were confirmed by
the histopathological study in both liver and white adipose tissue
(Figures S1a–e and S2a–e).
EL‐ZEFTAWY et al.
TA B L E 6 Effect of berberine
(BER) chloride on adiponectin level in
serum, liver, and white adipose tissue
homogenates after the treatment of Groups
diabetic‐induced experimental animals
Sham control
Control vehicle (LFD + 20%
PEG)
Control BER‐chloride
Induction (HFD + 20% PEG
(10 ml/kg Bwt)
Induction treated with
BER‐chloride
Note: Values represent the mean ± SD of six rats. SPSS (Version 20.0).
Means with letters (a), (b), and (c) were statistical represented compared to sham control group as
follow: a = p < .001, b = p < .01, c = p < .05.
Figure S1a–e discovered liver's histopathological data of all stud‐
ied groups. The liver architecture in control vehicle and control BER‐
chloride was normal in comparison with a sham control group (Figure
S1a–c). On the contrary, pathological studies revealed that the liver
of the HFD group contained obvious fat droplets, necrosis, and in‐
flammation (Figure S1d). For HFD treated group with BER‐chloride,
the necrosis and inflammation sites disappeared, and the steatosis
decreased from moderate to mild grade (Figure S1e).
Further histopathological results of white adipose tissue were
demonstrated in (Figure S2, a‐e). Control rat's exposed normal tissue
(Figure S2a). Both PEG and BER‐chloride administrated groups were
similar to control rats (Figure S2b and S2c). However, adipose tissue
of HFD rats showed multiple fibrosis and degeneration for the archi‐
tecture of the adipocytes (Figure S2d). Treatment of HFD rats with
BER‐chloride for 2 weeks lead to the regeneration of the cells and
reduction of the lipid droplets in it (Figure S2e).
4 | D I S CU S S I O N
In recent years, insulin resistance has a huge challenge, it repre‐
sented one of the dangerous metabolic conditions, and in many
cases it occurs due to bad dietary habits (Haslam & James, 2005)
or due to some diseases like type II diabetes mellitus (Seko et al.,
2018). In the current study, HFD feeding for 8 weeks induced hy‐
perinsulinaemia which is attributed to inability of liver to utilize
the secreted insulin, although the normal role of pancreatic β‐cell
(Arnold et al., 2018). During this time the rats become more obese
compared to LFD controls due to elevation of insulin concentra‐
tion which inhibit fatty acid oxidation so fats accumulated mainly
in the liver because it is the main organ of oxidation process (Liu et
al., 2017). Higher levels of fasting insulin, glucose, and HOMA‐IR
index confirming the state of insulin resistance. Furthermore, in‐
creasing of HbA1c is another indicator of insulin resistance and cor‐
related with renal function parameters elevation (Fiorentino et al.,
2017). Additionally, the results of this study showed up regulation
of RBP4 expression in HFD rats. From previous hypothesis RBP4
| 7 of 11
Adiponectin (ng/ml)
White adi‐
Serum Hepatic tissue pose tissue
1.42 ± 0.49a 11.03 ± 0.97a 21.42 ± 1.65a
1.39 ± 0.49a 10.67 ± 0.97a 22.97 ± 1.12a
1.59 ± 0.26a 10.77 ± 1.15a 23.43 ± 1.51a
b b
0.682 ± 0.11 2.0 ± 0.7 11.78 ± 1.89b
1.01 ± 0.18a 9.7 ± 0.9a 19.47 ± 1.67a
elevates gluconeogenesis in the liver, so hyperglycemia is occur‐
ring (Hutchison, Harrison, Stepto, Meyer, & Teede, 2008), hinders
the insulin signaling in muscle and decreases the uptake of glucose
by reduction the action of PI3K (Yousefi & TaheriChadorneshin,
2018). Defects in PI3K reported in other findings (Jiang & Zhang,
2002). Preceding studies showed the highest concentration of
RBP4 are accompanied by increase in body mass index, insulin
resistance, and hypertriglyceridemia (Domingos, Queiroz, Lotufo,
Bensenor, & Titan, 2017). Study of PTEN had a significant impor‐
tance, PTEN is a lipid phosphatase inhibits insulin signaling by
dephosphorylating phosphatidylinositol (3,4,5) triphosphate (PIP 3)
to phosphatidylinositol (4,5) diphosphate (PIP 2) (Cully, You, Levine,
& Mak, 2006). Hence, PTEN is antagonizing the action of PI3K and
inhibits Akt as appear in current results, where HFD rats exhibited
an elevation in PTEN concentration and the decline of PI3K (Yao
& Nyomba, 2008).
It is known that, SIRT1 is a key regulator of lipid mobilization
through its action together with adenosine monophosphate‐acti‐
vated protein kinase (AMPK) through increasing fatty acid metab‐
olism (Merksamer et al., 2013). So, decrease in SIRT1 concentration
in HFD rats is linked by hyperlipidemia and insulin resistance due
to reduction of phosphorylated and/or activated AMPK is resulting
in lipid synthesis increase (Boulet et al., 2015). The results of the
present study are in agreement with previous works (Deng, Chen, &
Li, 2007). Further, SIRT1 has numerous roles in insulin signaling path‐
way it regulates insulin secretion from β‐cell of pancreas via reduc‐
tion uncoupling protein‐2 (UCP2) gene expression and improvement
the depolarization in β‐cell of pancreas (Liang, Kume, & Koya, 2009)
and regulates the insulin signaling pathway through deacetylation
of insulin receptor substrate‐2 (IRS2) and activation of Akt in cells
(Yoshizaki et al., 2009). From those mentioned mechanisms of SIRT1
and PTEN, the current study exhibited decreased of Akt‐p concen‐
tration in hepatic cells of HFD rats. Moreover adiponectin has a vital
role in the insulin resistance pathway; it has a regulating influence
on insulin sensitivity (Wu, Ni, & Lu, 2016). It was noticed that dis‐
turbance in lipid metabolism and excessive fat deposition leads to
abnormal synthesis of adiponectin (Burnstock & Gentile, 2018). HFD
8 of 11 | EL‐ZEFTAWY et al.
rats associated with decline of adiponectin concentration in serum,
hepatic, and adipose tissues which may be attributed to disruption
of both adiponectin receptors‐1 and 2 leading to elevation of glucose
concentration and reduce the action of peroxisome proliferator acti‐
vated receptor α‐signaling pathways, respectively, and finally insulin
resistance occurs (S. Li, Shin, Ding, & van Dam, 2009). Further, there
are some theories suggesting the role of SIRT1 in the regulation of
adiponectin secretion from the adipocytes by deacetylating of fork
head transcription factor O1 (FOXO‐1) protein and enhance the
transcription of gene that encodes adiponectin in adipocytes (Qiao &
Shao, 2006). Hence, SIRT1 decline effect on adiponectin secretion.
The role of SIRT1 is extended to control the production of reac‐
tive oxygen species (ROS) (Colak et al., 2011) as SIRT1 is considered
one of the important proteins that protect cells from stress damage
(Deng et al., 2007). Under normal condition the hepatocyte balance
the oxidative stress through the action of antioxidant enzymes such
as GPx which converts hydrogen peroxide (H2O2) to water (Flores,
Adhami, & Martins‐Green, 2016). Rats have insulin resistance are
showing low GPx activity so H2O2 accumulated and hepatic cells
damaged. These results were confirmed by elevation of liver trans‐
aminases (ALT and AST). H2O2 accumulation also affected on renal
tissue, which confirmed by an increase both urea and creatinine lev‐
els. Another cause of the elevation of ROS in case of insulin resis‐
tance is attributed to the dysregulated production of adipocytokines
where plasma adiponectin concentration is inversely correlated with
systemic oxidative stress (Furukawa et al., 2004).
F I G U R E 4 Schematic diagram for the effect of berberine (BER) chloride on insulin signaling in high‐fat diet (HFD) insulin resistance
induced rats
In recent years with regard to the side effects of artificial med‐
icines, increasing attention has been paid by researchers to herbal
medicines. Our in vivo study revealed that treatment with BER‐
chloride has negative influence on insulin resistance through ac‐
tivating two proteins involved in several physiological processes,
SIRT‐1 and AMPK (Lin et al., 2018). Those two proteins able to
activate each other, AMPK activate SIRT‐1 by elevation the con‐
centration of nicotinamide phosphoribosyltransferase and SIRT‐1
stimulates AMPK through deacetylation of serine‐threonine
kinase LKB1 (Hardie, 2015; Sun et al., 2014). Also, BER has the
capacity to recover insulin resistance syndrome through other
mechanisms, where it protects β‐cell of islets of Langerhans from
damage, allows glucose uptake by skeletal muscle, improves he‐
patic gluconeogenesis and decreases the concentration of lipids
in the blood (Pirillo & Catapano, 2015; Yang et al., 2014). As a
result of SIRT‐1 and AMPK pathway activation, adiponectin con‐
centration was restored after BER‐chloride therapy in our study
which similar to previous results (Wu et al., 2015). Elevation of
adiponectin concentration is linked by regulation of β‐oxidation of
fatty acids and glucose metabolism (Lin & Li, 2012; Yamauchi et al.,
2002). Hence, treated rats with BER‐chloride showed significant
decline of lipid profiles and BGL.
Also, BER‐chloride ameliorates hyperlipidemia results from in‐
sulin resistance via different mechanisms, BER lowers blood cho‐
lesterol levels through inhibiting cholesterol uptake and absorption
in the intestine (Wang et al., 2014), reduces TC secretion from
EL‐ZEFTAWY et al.
enterocytes to the circulation by down regulation acetyl CoA trans‐
ferase II enzyme (Wang et al., 2017) and increases the regulation of
LDL‐receptor and hence, BER decreases the concentration of LDL‐c
(Abidi, Zhou, Jiang, & Liu, 2005). Moreover, BER chloride is able to
improve glucose control by stimulation the glycolysis in peripheral
tissue, inhibition of FOXO‐1 and hepatic nuclear factor 4, lead to
suppression of glucose‐6‐phosphatase and phosphoenolpyruvate
carboxykinase enzymes which responsible for liver gluconeogenesis
(Kim et al., 2009; Xia et al., 2011) and activation of glucose trans‐
port‐1 (GLUT1) (Cok et al., 2011).
The current study revealed BER‐chloride has the ability to
raise the concentration of antioxidant enzymes (GSH, GPx, and
XO) by reducing the high level of lipid peroxidation (Lao‐ong,
Chatuphonprasert, Nemoto, & Jarukamjorn, 2012). Also BER has
the ability to prevent nicotinamide adenine dinucleotide phosphate
(NADPH) oxidase, which is the main source of ROS production
(Cheng et al., 2013). These results are in agreement with previous
theories which proved that BER is a strong antioxidant molecule due
to its ability to scavenge free radicals (Kumar et al., 2015). Moreover,
BER‐chloride exerts protective effect against ROS through SIRT‐1
activation where SIRT‐1 is capable to modulate NOX4/NADPH ox‐
idative subunit (Karbasforooshan & Karimi, 2018). Fall of ROS pro‐
duction lead to decrease the level of liver transaminases activity in
rats, group administrated BER‐chloride. In the present study, BER‐
chloride down regulates RBP4 which acts as an effective insulin sen‐
sitizing function (Zhang, Xu, Guo, Meng, & Li, 2008). From previous
studies, it was noticed that reduction of RBP4 concentration is re‐
lated to elevation of HDL‐c and decrease TG levels in some patients.
Also, as a result of the decline of SIRT‐1 in HFD rats, elevation of
TBARS and XO, and decrease in GPx and GSH was reported and this
was improved after BER‐chloride administration. From this study, we
conclude that BER‐chloride can be considered one of therapeutics
used to help the treatment of insulin resistance syndrome through
its influence on multiple insulin signaling pathways. A schematic rep‐
resentation was designed (Figure 4) to summarize the modification
of insulin resistance by BER‐chloride.
AC K N OW L E D G M E N T S
The authors extend their appreciation to the deanship of Scientific
Research at King Khalid University, Abha, KSA for supported this
work under grant number (R.G.P.1/117/40)
C O N FL I C T O F I N T E R E S T
The authors declared that they have no conflict of interest.
ORCID
Marwa El‐Zeftawy https://orcid.org/0000-0002-2884-8148
Doaa Ghareeb https://orcid.org/0000-0003-3327-4377
Nihal Elguindy https://orcid.org/0000-0002-5705-1349
Attalla F. El‐kott https://orcid.org/0000-0001-5060-0790
| 9 of 11
REFERENCES
Abidi, P., Zhou, Y., Jiang, J. D., & Liu, J. (2005). Extracellular signal‐regu‐
lated kinase‐dependent stabilization of hepatic low‐density lipopro‐
tein receptor mRNA by herbal medicine berberine. Arteriosclerosis,
Thrombosis, and Vascular Biology, 25(10), 2170–2176. https​://doi.
org/10.1161/01.ATV.00001​81761.16341.2b
Arnold, S. E., Arvanitakis, Z., Macauley‐Rambach, S. L., Koenig, A. M.,
Wang, H.‐Y., Ahima, R. S., … Nathan, D. M. (2018). Brain insulin re‐
sistance in type 2 diabetes and Alzheimer disease: Concepts and
conundrums. Nature Reviews Neurology, 14(3), 168–181. https​://doi.
org/10.1038/nrneu​rol.2017.185
Bodiwala, H. S., Sabde, S., Mitra, D., Bhutani, K. K., & Singh, I. P. (2011).
Synthesis of 9‐substituted derivatives of berberine as anti‐HIV
agents. European Journal of Medicinal Chemistry, 46(4), 1045–1049.
https​://doi.org/10.1016/j.ejmech.2011.01.016
Boulet, M. M., Chevrier, G., Grenier‐Larouche, T., Pelletier, M., Nadeau,
M., Scarpa, J., … Tchernof, A. (2015). Alterations of plasma me‐
tabolite profiles related to adipose tissue distribution and car‐
diometabolic risk. American Journal of Physiology‐Endocrinology and
Metabolism, 309(8), E736–E746. https​://doi.org/10.1152/ajpen​
do.00231.2015
Burnstock, G., & Gentile, D. (2018). The involvement of purinergic
signalling in obesity. Purinergic Signal, 14(2), 97–108. https​://doi.
org/10.1007/s11302-018-9605-8
Candeias, M. F., Abreu, P., Pereira, A., & Cruz‐Morais, J. (2009). Effects of
strictosamide on mouse brain and kidney Na+, K+‐ATPase and Mg2+‐
ATPase activities. Journal of Ethnopharmacology, 121(1), 117–122.
https​://doi.org/10.1016/j.jep.2008.08.032
Cheng, F., Wang, Y., Li, J., Su, C., Wu, F., Xia, W.‐H., … Tao, J. (2013).
Berberine improves endothelial function by reducing endothelial
microparticles‐mediated oxidative stress in humans. International
Journal of Cardiology, 167(3), 936–942. https​://doi.org/10.1016/j.
ijcard.2012.03.090
Chiu, D. T., Stults, F. H., & Tappel, A. L. (1976). Purification and properties of
rat lung soluble glutathione peroxidase. Biochimica et Biophysica Acta,
445(3), 558–566. https​://doi.org/10.1016/0005-2744(76)90110-8
Cok, A., Plaisier, C., Salie, M. J., Oram, D. S., Chenge, J., & Louters, L.
L. (2011). Berberine acutely activates the glucose transport activity
of GLUT1. Biochimie, 93(7), 1187–1192. https​://doi.org/10.1016/j.
biochi.2011.04.013
Colak, Y., Ozturk, O., Senates, E., Tuncer, I., Yorulmaz, E., Adali, G., … Enc,
F. Y. (2011). SIRT1 as a potential therapeutic target for treatment
of nonalcoholic fatty liver disease. Medical Science Monitor, 17(5),
HY5‐9. https​://doi.org/10.12659/​MSM.881749
Cully, M., You, H., Levine, A. J., & Mak, T. W. (2006). Beyond PTEN mu‐
tations: The PI3K pathway as an integrator of multiple inputs during
tumorigenesis. Nature Reviews Cancer, 6(3), 184–192. https​://doi.
org/10.1038/nrc1819
David, J. A., Rifkin, W. J., Rabbani, P. S., & Ceradini, D. J. (2017). The Nrf2/
Keap1/ARE Pathway and Oxidative Stress as a Therapeutic Target in
Type II Diabetes Mellitus. Journal of Diabetes Research, 2017, 1–15.
https​://doi.org/10.1155/2017/4826724
Deng, X. Q., Chen, L. L., & Li, N. X. (2007). The expression of
SIRT1 in nonalcoholic fatty liver disease induced by high‐fat
diet in rats. Liver International, 27(5), 708–715. https​://doi.
org/10.1111/j.1478-3231.2007.01497.x
Domingos, M. A. M., Queiroz, M., Lotufo, P. A., Bensenor, I. J., & Titan,
S. M. O. (2017). Serum RBP4 and CKD: Association with insulin re‐
sistance and lipids. Journal of Diabetes and Its Complications, 31(7),
1132–1138. https​://doi.org/10.1016/j.jdiac​omp.2017.04.013
Dong, S. F., Hong, Y., Liu, M., Hao, Y. Z., Yu, H. S., Liu, Y., & Sun, J. N.
(2011). Berberine attenuates cardiac dysfunction in hyperglycemic
and hypercholesterolemic rats. European Journal of Pharmacology,
660(2–3), 368–374. https​://doi.org/10.1016/j.ejphar.2011.03.024
10 of 11 | EL‐ZEFTAWY et al.
Ellman, G. L. (1959). Tissue sulfhydryl groups. Archives of
Biochemistry and Biophysics, 82(1), 70–77. https​://doi.
org/10.1016/0003-9861(59)90090-6
El‐Sayed, M. M., Ghareeb, D. A., Talat, H. A., & Sarhan, E. M. (2013). High
fat diet induced insulin resistance and elevated retinol binding pro‐
tein 4 in female rats; treatment and protection with Berberis vulgaris
extract and vitamin A. Pakistan Journal of Pharmaceutical Sciences,
26(6), 1189–1195.
Fiorentino, T. V., Marini, M. A., Succurro, E., Sciacqua, A., Andreozzi, F.,
Perticone, F., & Sesti, G. (2017). Elevated hemoglobin glycation index
identify non‐diabetic individuals at increased risk of kidney dysfunc‐
tion. Oncotarget., 8(45), 79576–79586. https​://doi.org/10.18632/​
oncot​arget.18572​
Flores, C., Adhami, N., & Martins‐Green, M. (2016). THS tox‐
ins induce hepatic steatosis by altering oxidative stress and
SIRT1 levels. Journal of Clinical Toxicology, 6, 318. https​ ://doi.
org/10.10.4172/2161-0495.1000318
Friedewald, W. T., Levy, R. I., & Fredrickson, D. S. (1972). Estimation of
the concentration of low density lipoprotein cholesterol in plasma
without use of the preparative ultracentrifuge. Clinical Chemistry,
18(6), 499–502.
Furukawa, S., Fujita, T., Shimabukuro, M., Iwaki, M., Yamada, Y., Nakajima,
Y., … Shimomura, I. (2004). Increased oxidative stress in obesity and
its impact on metabolic syndrome. Journal of Clinical Investigation,
114(12), 1752–1761. https​://doi.org/10.1172/jci21625
Gao, Y. F., Zhang, M. N., Wang, T. X., Wu, T. C., Ai, R. D., & Zhang, Z.
S. (2016). Hypoglycemic effect of D‐chiro‐inositol in type 2 diabe‐
tes mellitus rats through the PI3K/Akt signaling pathway. Molecular
and Cellular Endocrinology, 433, 26–34. https​ ://doi.org/10.1016/j.
mce.2016.05.013
Ghareeb, D. A., Khalil, S., Hafez, H. S., Bajorath, J., Ahmed, H. E. A.,
Sarhan, E., … El‐Demellawy, M. A. (2015). Berberine reduces neu‐
rotoxicity related to nonalcoholic steatohepatitis in rats. Evidence‐
Based Complementary and Alternative Medicine, 2015, 1–13. https​://
doi.org/10.1155/2015/361847
Han, S. J., Boyko, E. J., Kim, S. K., Fujimoto, W. Y., Kahn, S. E., &
Leonetti, D. L. (2018). Association of Thigh Muscle Mass with Insulin
Resistance and Incident Type 2 Diabetes Mellitus in Japanese
Americans. Diabetes & Metabolism Journal, 42(6), 488–495. https​://
doi.org/10.4093/dmj.2018.0022
Hardie, D. G. (2015). AMPK: Positive and negative regulation, and its role
in whole‐body energy homeostasis. Current Opinion in Cell Biology,
33, 1–7. https​://doi.org/10.1016/j.ceb.2014.09.004
Haslam, D. W., & James, W. P. (2005). Obesity. Lancet, 366(9492), 1197–
1209. https​://doi.org/10.1016/S0140-6736(05)67483-1
Hutchison, S. K., Harrison, C., Stepto, N., Meyer, C., & Teede, H. J. (2008).
Retinol‐binding protein 4 and insulin resistance in polycystic ovary
syndrome. Diabetes Care, 31(7), 1427–1432. https​://doi.org/10.2337/
dc07-2265
Jiang, G., & Zhang, B. B. (2002). Pi 3‐kinase and its up‐ and down‐stream
modulators as potential targets for the treatment of type II diabetes.
Frontiers in Bioscience, 7, d903–907. https​://doi.org/10.2741/jiang​
Jiang, W., Li, S., & Li, X. (2015). Therapeutic potential of berberine against
neurodegenerative diseases. Science China Life Sciences, 58(6), 564–
569. https​://doi.org/10.1007/s11427-015-4829-0
Kahn, S. E., Hull, R. L., & Utzschneider, K. M. (2006). Mechanisms linking
obesity to insulin resistance and type 2 diabetes. Nature, 444(7121),
840–846. https​://doi.org/10.1038/natur​e 05482
Karbasforooshan, H., & Karimi, G. (2018). The role of SIRT1 in diabetic
retinopathy. Biomedicine & Pharmacotherapy, 97, 190–194. https​://
doi.org/10.1016/j.biopha.2017.10.075
Kim, W. S., Lee, Y. S., Cha, S. H., Jeong, H. W., Choe, S. S., Lee, M.‐R., …
Kim, J. B. (2009). Berberine improves lipid dysregulation in obesity by
controlling central and peripheral AMPK activity. American Journal of
Physiology‐Endocrinology and Metabolism, 296(4), E812–819. https​://
doi.org/10.1152/ajpen​do.90710.2008
Koc, K., Cerig, S., Ozek, N. S., Aysin, F., Yildirim, S., Cakmak, O., …
Geyikoglu, F. (2019). The efficacy of oleuropein against non‐ste‐
roidal anti‐inflammatory drug induced toxicity in rat kidney.
Environmental Toxicology, 34(1), 67–72. https​://doi.org/10.1002/
tox.22658​
Kumar, A., Ekavali, Chopra, K., Mukherjee, M., Pottabathini, R., & Dhull,
D. K. (2015). Current knowledge and pharmacological profile of ber‐
berine: An update. European Journal of Pharmacology, 761, 288–297.
https​://doi.org/10.1016/j.ejphar.2015.05.068
Lao‐ong, T., Chatuphonprasert, W., Nemoto, N., & Jarukamjorn, K.
(2012). Alteration of hepatic glutathione peroxidase and superox‐
ide dismutase expression in streptozotocin‐induced diabetic mice
by berberine. Pharmaceutical Biology, 50(8), 1007–1012. https​://doi.
org/10.3109/13880​209.2012.655377
Li, J.‐W., Yuan, K., Shang, S.‐C., & Guo, Y. (2017). A safer hypoglyce‐
mic agent for type 2 diabetes—Berberine organic acid salt. Journal
of Functional Foods, 38, 399–408. https​ ://doi.org/10.1016/j.
jff.2017.09.031
Li, S., Shin, H. J., Ding, E. L., & van Dam, R. M. (2009). Adiponectin levels
and risk of type 2 diabetes: A systematic review and meta‐analysis.
JAMA, 302(2), 179–188. https​://doi.org/10.1001/jama.2009.976
Liang, F., Kume, S., & Koya, D. (2009). SIRT1 and insulin resistance. Nature
Reviews Endocrinology, 5(7), 367–373. https​://doi.org/10.1038/
nrendo.2009.101
Lin, H., & Li, Z. (2012). Adiponectin self‐regulates its expression and
multimerization in adipose tissue: An autocrine/paracrine mecha‐
nism? Medical Hypotheses, 78(1), 75–78. https​://doi.org/10.1016/j.
mehy.2011.07.063
Lin, Y., Sheng, M., Ding, Y., Zhang, N., Song, Y., Du, H., … Yu, W. (2018).
Berberine protects renal tubular cells against hypoxia/reoxygenation
injury via the Sirt1/p53 pathway. Journal of Natural Medicines, 72(3),
715–723. https​://doi.org/10.1007/s11418-018-1210-1
Litwack, G., Bothwell, J. W., Williams, J. N. J., & Elvehjem, C. A. (1953).
A colorimetric assay for xanthine oxidase in rat liver homogenates.
Journal of Biological Chemistry, 200(1), 303–310.
Liu, Q., Xu, X., Zhao, M., Wei, Z., Li, X., Zhang, X., … Shao, C. (2015).
Berberine induces senescence of human glioblastoma cells by down‐
regulating the EGFR‐MEK‐ERK signaling pathway. Molecular Cancer
Therapeutics, 14(2), 355–363. https​://doi.org/10.1158/1535-7163.
MCT-14-0634
Liu, R., Li, H., Fan, W., Jin, Q., Chao, T., Wu, Y., & Yang, X. (2017). Leucine
supplementation differently modulates branched‐chain amino acid
catabolism, mitochondrial function and metabolic profiles at the dif‐
ferent stage of insulin resistance in rats on high‐fat diet. Nutrients,
9(6), https​://doi.org/10.3390/nu906​0565
Merksamer, P. I., Liu, Y., He, W., Hirschey, M. D., Chen, D., & Verdin, E.
(2013). The sirtuins, oxidative stress and aging: An emerging link.
Aging, 5(3), 144–150. https​://doi.org/10.18632/​aging.100544
Paglia, D. E., & Valentine, W. N. (1967). Studies on the quantitative and
qualitative characterization of erythrocyte glutathione peroxidase.
Journal of Laboratory and Clinical Medicine, 70(1), 158–169.
Pandian, R. S., Anuradha, C. V., & Viswanathan, P. (2002).
Gastroprotective effect of fenugreek seeds (Trigonella foe‐
num graecum) on experimental gastric ulcer in rats. Journal
of Ethnopharmacology, 81, 393–397. https​ ://doi.org/10.1016/
S0378-8741(02)00117-4
Peter, S. J., Basha, S. K., Giridharan, R., Lavinya, B. U., & Sabina, E. P.
(2017). Suppressive effect of Spirulina fusiformis on diclofenac‐in‐
duced hepato‐renal injury and gastrointestinal ulcer in Wistar al‐
bino rats: A biochemical and histological approach. Biomedicine
& Pharmacotherapy, 88, 11–18. https​
://doi.org/10.1016/j.
biopha.2017.01.032
EL‐ZEFTAWY et al.
Pirillo, A., & Catapano, A. L. (2015). Berberine, a plant alkaloid with lipid‐
and glucose‐lowering properties: From in vitro evidence to clinical
studies. Atherosclerosis, 243(2), 449–461. https​://doi.org/10.1016/j.
ather​oscle​rosis.2015.09.032
Qiao, L., & Shao, J. (2006). SIRT1 regulates adiponectin gene expression
through Foxo1‐C/enhancer‐binding protein alpha transcriptional
complex. Journal of Biological Chemistry, 281(52), 39915–39924.
https​://doi.org/10.1074/jbc.M6072​15200​
Ren, L., Zhou, X., Huang, X., Wang, C., & Li, Y. (2019). The IRS/PI3K/
Akt signaling pathway mediates olanzapine‐induced hepatic insu‐
lin resistance in male rats. Life Sciences, 217, 229–236. https​://doi.
org/10.1016/j.lfs.2018.12.015
Saleh, S. R., Attia, R., & Ghareeb, D. A. (2018). The ameliorating effect of
berberine‐rich fraction against gossypol‐induced testicular inflam‐
mation and oxidative stress. Oxid Med Cell Longev, 2018, 1056173.
https​://doi.org/10.1155/2018/1056173
Seko, Y., Sumida, Y., Tanaka, S., Mori, K., Taketani, H., Ishiba, H., … Itoh, Y.
(2018). Insulin resistance increases the risk of incident type 2 diabetes
mellitus in patients with non‐alcoholic fatty liver disease. Hepatology
Research, 48(3), E42–E51. https​://doi.org/10.1111/hepr.12925​
Steinberg, D., Vaughan, M., & Margolis, S. (1961). Studies of triglyceride
biosynthesis in homogenates of adipose tissue. Journal of Biological
Chemistry, 236(6), 1631–1637.
Sun, Y., Li, J., Xiao, N. A., Wang, M., Kou, J., Qi, L., … Liu, K. (2014).
Pharmacological activation of AMPK ameliorates perivascular ad‐
ipose/endothelial dysfunction in a manner interdependent on
AMPK and SIRT1. Pharmacological Research, 89, 19–28. https​://doi.
org/10.1016/j.phrs.2014.07.006
Tappel, A. L., & Zalkin, H. (1959). Inhibition of lipid peroxidation in mi‐
tochondria by vitamin E. Archives of Biochemistry and Biophysics, 80,
333–336. https​://doi.org/10.1016/0003-9861(59)90259-0
Vuddanda, P. R., Chakraborty, S., & Singh, S. (2010). Berberine: A po‐
tential phytochemical with multispectrum therapeutic activities.
Expert Opinion on Investigational Drugs, 19(10), 1297–1307. https​://
doi.org/10.1517/13543​784.2010.517745
Wang, H., Zhu, C., Ying, Y., Luo, L., Huang, D., & Luo, Z. (2017). Metformin
and berberine, two versatile drugs in treatment of common metabolic
diseases. Oncotarget, 9(11), 10135–10146. https​://doi.org/10.18632/​
oncot​arget.20807​
Wang, Y., Yi, X., Ghanam, K., Zhang, S., Zhao, T., & Zhu, X. (2014). Berberine
decreases cholesterol levels in rats through multiple mechanisms,
including inhibition of cholesterol absorption. Metabolism ‐ Clinical
and Experimental, 63(9), 1167–1177. https​://doi.org/10.1016/j.metab​
ol.2014.05.013
Wu, Q. M., Ni, H. X., & Lu, X. (2016). Changes of adipocytokine expres‐
sion after diabetic rats received sitagliptin and the molecular mecha‐
nism. Asian Pacific Journal of Tropical Medicine, 9(9), 893–897. https​://
doi.org/10.1016/j.apjtm.2016.07.014
Wu, U., Cha, Y., Huang, X., Liu, J., Chen, Z., Wang, F., & Ding, H. (2015).
Protective effects of berberine on high fat‐induced kidney damage
by increasing serum adiponectin and promoting insulin sensitivity.
International Journal of Clinical and Experimental Pathology, 8(11),
4486–4492.
| 11 of 11
Xia, X., Yan, J., Shen, Y., Tang, K., Yin, J., Zhang, Y., … Weng, J. (2011).
Berberine improves glucose metabolism in diabetic rats by inhibi‐
tion of hepatic gluconeogenesis. PLoS ONE, 6(2), e16556. https​://doi.
org/10.1371/journ​al.pone.0016556
Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., …
Kadowaki, T. (2002). Adiponectin stimulates glucose utilization and
fatty‐acid oxidation by activating AMP‐activated protein kinase.
Nature Medicine, 8(11), 1288–1295. https​://doi.org/10.1038/nm788​
Yang, T. C., Chao, H. F., Shi, L. S., Chang, T. C., Lin, H. C., & Chang, W.
L. (2014). Alkaloids from Coptis chinensis root promote glucose
uptake in C2C12 myotubes. Fitoterapia, 93, 239–244. https​://doi.
org/10.1016/j.fitote.2014.01.008
Yao, X. H., & Nyomba, B. (2008). Hepatic insulin resistance induced
by prenatal alcohol exposure is associated with reduced PTEN
and TRB3 acetylation in adult rat offspring. American Journal of
Physiology‐Regulatory, Integrative and Comparative Physiology, 294(6),
R1797–R1806. https​://doi.org/10.1152/ajpre​gu.00804.2007
Yoshizaki, T., Milne, J. C., Imamura, T., Schenk, S., Sonoda, N., Babendure,
J. L., … Olefsky, J. M. (2009). SIRT1 exerts anti‐inflammatory effects
and improves insulin sensitivity in adipocytes. Molecular and Cellular
Biology, 29(5), 1363–1374. https​://doi.org/10.1128/MCB.00705-08
Yousefi, M. R., & TaheriChadorneshin, H. (2018). The effect of moder‐
ate endurance training on gastrocnemius retinol‐binding protein
4 and insulin resistance in streptozotocin‐induced diabetic rats.
Interventional Medicine and Applied Science, 10(1), 59–63. https​://doi.
org/10.1556/1646.9.2017.34
Zhang, S., Wang, X., Yin, W., Liu, Z., Zhou, M. I., Xiao, D., … Peng, D. (2016).
Synthesis and hypoglycemic activity of 9‐O‐(lipophilic group substi‐
tuted) berberine derivatives. Bioorganic & Medicinal Chemistry Letters,
26(19), 4799–4803. https​://doi.org/10.1016/j.bmcl.2016.08.027
Zhang, W., Xu, Y. C., Guo, F. J., Meng, Y., & Li, M. L. (2008). Anti‐dia‐
betic effects of cinnamaldehyde and berberine and their impacts
on retinol‐binding protein 4 expression in rats with type 2 diabetes
mellitus. Chinese Medical Journal, 121(21), 2124–2128. https​://doi.
org/10.1097/00029​330-20081​1010-00003​
S U P P O R T I N G I N FO R M AT I O N
Additional supporting information may be found online in the
Supporting Information section at the end of the article.
How to cite this article: El‐Zeftawy M, Ghareeb D, ElBealy
ER, et al. Berberine chloride ameliorated PI3K/Akt‐p/SIRT‐1/
PTEN signaling pathway in insulin resistance syndrome
induced in rats. J Food Biochem. 2019;00:e13049. https​://doi.
org/10.1111/jfbc.13049​