Mol Genet Genomics
DOI 10.1007/s00438-015-1123-6
ORIGINAL ARTICLE
GDSL esterase/lipase genes in Brassica rapa L.: genome‑wide
identification and expression analysis
Xiangshu Dong1,4 · Hankuil Yi1 · Ching‑Tack Han2 · Ill‑Sup Nou3 · Yoonkang Hur1
Received: 8 June 2015 / Accepted: 18 September 2015
© Springer-Verlag Berlin Heidelberg 2015
Abstract GDSL esterase/lipase proteins (GELPs), a very
large subfamily of lipolytic enzymes, have been identified
in microbes and many plants, but only a few have been
characterized with respect to their roles in growth, develop-
ment, and stress responses. In Brassica crops, as in many
other species, genome-wide systematic analysis and func-
tional studies of these genes are still lacking. As a first step
to study their function in B. rapa ssp. pekinensis (Chinese
cabbage), we comprehensively identified all GELP genes
in the genome. We found a total of 121 Brassica rapa
GDSL esterase/lipase protein genes (BrGELPs), forming
three clades in the phylogenetic analysis (two major and
one minor), with an asymmetrical chromosomal distribu-
tion. Most BrGELPs possess four strictly conserved resi-
dues (Ser-Gly-Asn-His) in four separate conserved regions,
along with short conserved and clade-specific blocks, sug-
gesting functional diversification of these proteins. Detailed
Communicated by S. Hohmann.
Electronic supplementary material The online version of this
article (doi:10.1007/s00438-015-1123-6) contains supplementary
material, which is available to authorized users.
* Yoonkang Hur
ykhur@cnu.ac.kr
1 conserved residues Ser-Gly-Asn-His present in four con-
Department of Biological Sciences, College of Biological
Science and Biotechnology, Chungnam National University,
Taejon, Republic of Korea
2
Department of Life Science, Sogang University,
Seoul 100‑611, Republic of Korea
3
Department of Horticulture, Sunchon National University,
Suncheon, Jeonnam, Republic of Korea
4
School of Agriculture, Yunnan University, Kunming, Yunnan,
China
expression profiling revealed that BrGELPs were expressed
in various tissues, including floral organs, implying that
BrGELPs play diverse roles in various tissues and during
development. Ten percent of BrGELPs were specifically
expressed in fertile buds, rather than male-sterile buds,
implying their involvement in pollen development. Analy-
ses of EXL6 (extracellular lipase 6) expression and its co-
expressed genes in both B. rapa and Arabidopsis, as well
as knockdown of this gene in Arabidopsis, revealed that
this gene plays an important role in pollen development in
both species. The data described in this study will facilitate
future investigations of other BrGELP functions.
Keywords BrGELP subfamily · SGNH hydrolase ·
Extracellular lipase 6 · Brassica rapa · Pollen development
Introduction
GDSL esterases/lipase proteins (GELPs) usually have a
Ser-His-Asp active site, with the serine-containing motif
located closer to the N terminus (Brick et al. 1995; Upton
and Buckley 1995). GELPs are an important subfam-
ily of lipolytic enzymes with various biochemical activi-
ties (Akoh et al. 2004; Leščić Ašler et al. 2010). They are
also referred to as SGNH hydrolases in reference to the
served blocks (I, II, III, and V) (Brick et al. 1995; Upton
and Buckley 1995; Mølgaard et al. 2000; Akoh et al. 2004).
The GELP genes can be found throughout all kingdoms
of life. The characteristics and features of GELP genes
have been analyzed in plants at the genomic level in Arabi-
dopsis, Sorghum bicolour, Populus tricholarpa, Oryza
sativa, maize and others (Ling 2008; Volokita et al. 2011;
Chepyshko et al. 2012). Among them, several GELP genes
13

in Arabidopsis have been cloned and characterized (Oh
et al. 2005; Zhang et al. 2006; Agee et al. 2010). Despite
the fact that they play important roles in development, mor-
phogenesis, lipid metabolism, abiotic stress responses, and
pathogen defense (Hong et al. 2008; Kim et al. 2008; Kwon
et al. 2009; Lee et al. 2009; Updegraff et al. 2009; Chepy-
shko et al. 2012; Tan et al. 2014), only a small fraction of
plant GELPs have been characterized, and to date no sys-
tematic study of Brassicaceae GELPs has been reported.
The pollen coat protects pollen grains from excess desic-
cation after dehiscence, and also plays a key role in medi-
ating early contact between pollen grains and the stigma,
thus contributing to pollen adhesion to the stigma and
facilitating hydration (Edlund et al. 2004; Updegraff et al.
2009). The pollen coat consists of a lipid-rich compound
that is synthesized by tapetal cells during pollen mitotic
divisions (Quilichini et al. 2014). The oleosin domain pro-
tein GRP17, the first pollen coat protein to be isolated, is
required for rapid hydration of pollen grains after landing
on the stigma (Mayfield and Preuss 2000). Besides oleo-
sin domain-containing proteins, pollen coat proteins con-
sist primarily of GDSL lipases/extracellular lipases (EXLs)
(Mayfield et al. 2001). Arabidopsis has six EXLs (EXL
1–6), which are clustered in the genome and all belong
to GELPs subfamily; two of them, EXL4 and EXL6, are
enriched in the pollen coat (Mayfield et al. 2001). EXL4 is
required for efficient hydration of Arabidopsis pollen, and
loss-of-function mutation in this gene causes a delay in pol-
len hydration (Updegraff et al. 2009). The function and role
of EXL6 have not been well characterized, although the
gene is known to be a target of a key transcription factor
involved in Arabidopsis pollen development, ABORTED
MICROSPORES (AMS) (Xu et al. 2014).
In this study, we systematically analyzed the phyloge-
netic relationships and expression patterns of Brassica rapa
GELPs. In addition, we found that knockdown of EXL6
in Arabidopsis led to a male-sterile phenotype. Further-
more, co-expression analysis suggested that EXL6 plays
a role during pollen exine formation in both B. rapa and
Arabidopsis.
Materials and methods
Plant materials and growth condition
Arabidopsis thaliana (L.) Heynh var. Columbia (Col-
0) was used for transformation. Both Chinese cabbage
(Brassica rapa ssp. pekinensis, inbred line Chiifu) and
Arabidopsis plants were grown at 22 ± 0.5 °C with a
light intensity of 140 ± 2 μmol/m2/s on a long-day cycle
(16 h L/8 h D). For Arabidopsis, seeds were sown in
60 mm × 60 mm × 55 mm pots containing potting soil,
13
Mol Genet Genomics
stratified for 3 days at 4 °C, and then placed in the growth
room. The plants were then kept under a lid of transpar-
ent polythene for 5–6 days to maintain high humidity and
support simultaneous germination. For in vitro culture,
seeds were sterilized with 30 % bleach with 0.1 % Triton
X-100 (Sigma, USA), stratified for 3 days at 4 °C, and
sown in square dishes (100 mm × 100 mm × 20 mm)
containing half-strength MS media (Duchefa Bioche-
mie, The Netherlands) supplemented with 1 % sucrose
and 0.8 % PhytoAgar. For B. rapa, seeds were sown in
55 mm × 55 mm × 90 mm pots containing potting soil,
and 3-week-old seedlings were transferred into a 4 °C cold
room for vernalization to induce flowering. After 60 days
of vernalization, the plants were returned to the 22 °C
growth room.
Identification of GELP genes in B. rapa
The full genome sequence of B. rapa was downloaded
from BRAD (http://brassicadb.org/brad/; V1.5) (Wang
et al. 2011), and 3537 novel genes recently identified by
deep RNA-Seq were also added for analysis (Devisetty
et al. 2014). Protein sequences of these genes were used as
queries to search against the profile Hidden Markov Model
(HMM) (version 3.1b2 with Pfam HMM library Pfam
28.0) (Finn et al. 2011). In total, 153 protein sequences
with PF00657 (E value below 0.1) were obtained. Among
them, only 124 proteins contain the catalytic triad serine,
aspartate, and histidine in the GDSL and WDXXH motifs
found at the N- and C- termini. The genes without cata-
lytic triad were considered as the pseudoenzymes (Table
S1). Subsequently, three genes Bra016151, Bra017133, and
Bra028825 were excluded from our analyses, because these
genes also have other protein domain(s) besides PF00657
(Table S1). As in B. rapa, the GELP genes in Arabidop-
sis were identified using protein sequences from TAIR 10
(https://www.arabidopsis.org/). A total of 112 genes encod-
ing GELPs were identified from A. thaliana after HMM
search. Only 98 genes were found to contain the catalytic
triad (Table S2).
Sequence alignment and phylogenetic analysis
Sequence alignment and phylogenetic analysis were car-
ried out based on previously described criteria (Volokita
et al. 2011). Full protein sequences were aligned using
ClustalW, implemented in MEGA6 (Tamura et al. 2013),
with GONNET as the protein weight matrix, a gap-open-
ing penalty of 10, and a gap-extension penalty of 0.1.
Phylogenetic trees were constructed using two methods,
neighbor-joining (NJ) and maximum likelihood (ML).
In the NJ method, the phylogenetic tree was constructed
in MEGA6 using the Poisson model with the following
Mol Genet Genomics

options: homogeneous pattern, complete deletion, and
1000-replicate bootstrap. For ML method, the initial tree
were generated by implementing NJ/BioNJ method, and
tree improvement was achieved by nearest-neighbor-inter-
change (NNI) and branch support analysis using 1000 rep-
licates bootstrap with Poisson model.
Generation of EXL6 knockdown Arabidopsis
The full-length coding region of AtEXL6 was cloned from
first-strand cDNA using the AtEXL6-F primers (Table 1).
The amplified fragments were inserted into T&A cloning
vectors (RBC T&A Cloning Kit, Real Biotech Corporation,
Taiwan). After confirming the EXL6 sequence in the T&A
vector by sequencing, the fragment was further cloned into
pCambina 3300-35S binary vectors in the sense and anti-
sense directions, and transformed into plants to knockdown
AtEXL6 expression. Arabidopsis thaliana Col-0 was trans-
formed with Agrobacterium tumefaciens GV3101 carrying
the binary plasmids by the floral dip method (Peterson et al.
2010). The transformants were selected on plates contain-
ing 25 mg/ml glufosinate in MS medium (Sigma) and con-
firmed by genomic DNA PCR.
Reverse transcription PCR and qRT‑PCR
Various tissue organs, sampled from B. rapa and Arabi-
dopsis, were stored at −70 °C until use. RNA was iso-
lated using the TRIZOL® Reagent (Invitrogen, USA). One
microgram of total RNA from each sample was used in
reverse transcription. The first-strand cDNA was synthe-
sized using the ReverTra Ace-α kit (Toyobo, Osaka, Japan).
The concentration of synthesized cDNA was determined,
and the cDNA was diluted to 12.5 ng/μl for PCR. Semi-
quantitative RT-PCR (semi-RT-PCR) was generally per-
formed with a 5 min denaturation at 94 °C, followed by 25
or 30 cycles of 94 °C for 30 s, 54 °C for 30 s, and 72 °C for
60 s. All primer sequences used in this study are listed in
Table 1. Semi-RT-PCR products were separated on 1.5 %
agarose gels and stained with ethidium bromide.
Pollen viability
For pollen viability and pollen development progression,
flowers collected from WT and EXL6 antisense- or sense-
transgenic Arabidopsis plants were fixed in Carnoy’s fixa-
tive (6:3:1 ethanol:chloroform:acetic acid) for 2 h. After
fixation, anthers were dissected and stained with a solution
of Malachite green, acid fuchsin, and Orange G for about
12 h as previously described (Peterson et al. 2010).
Identification of genes co‑expressed with EXL6
AtEXL6 was used as a bait gene for genome-wide co-
expression analysis using Expression Angler to identify
putative genes with functions similar to that of AtEXL6
(Toufighi et al. 2005). A cutoff threshold of 0.85 was used
for the Pearson Correlation Coefficient. Expression pattern
analysis was performed using the Arabidopsis eFP browser
(http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi) (Winter
et al. 2007). To isolate genes co-expressed with BrEXL6,
previously published microarray results were used as
source data (Dong et al. 2013a, b). Three B. rapa probes,
Brapa_ESTC003525, Brapa_ESTC000535, and Brapa_
ESTC010981, were used to identify the ESTs co-expressed
with BrEXL6. Identified ESTs were used to obtain the B.
rapa gene identification number based on the BlastN result
in the BRAD database (http://brassicadb.org/brad/ with cut-
off below 1e−5). GO enrichment analysis was performed
using agriGO (http://bioinfo.cau.edu.cn/agriGO/index.php)
(Du et al. 2010).
Conserved motifs search
To identify conserved motifs in BrGELPs, the full-length
protein sequences of BrGELP genes were submitted to

Table 1  List of primers used in this study

Primer name Primer sequence Size (bp) Usage
Forward (5′–3′) Reverse (5′–3′)

AtExl6real AAACCATTCAGAAAAATTTTGGAC CTAAGACTGAATCACCAAAAGCAA 152 Real-time PCR

AtExl4real AAACATAAGAGAGTCTAAACACTGTGG GAATCTCCAAAAGCCAAAAGC 159 Real-time PCR
BrEXL6 CGGCGACTAGTCGAACACTGAG ACAACCTGCAGTTTTCGCTTCTG 520 Semi-RT-PCR
AtEXL6 GGACTTATTTTCGATATGTTTAGGGG TCTTCCCGTCGGAAATTTATAGTCA 222 Semi-RT-PCR
AtEXL6-F GGCGGACTTATTTTCGATATGTTTAG TTAGCTAGGCAAGGCCTTTCGCTAT 1047 FCDS, vector constructs
GGG CTG
35S CAATCCACTTGCTTTGAAGAC CCATCATTGCGATAAAGGAAAG 135 gDNA PCR for transgenic
plant confirmation
At Actin7 AGTGGTCGTACAACCGGTATTGT GAGGATAGCATGTGGAACTGAGAA 96 Internal control

13

Fig. 1  Genomic distribution of the BrGELP genes and pseudoen-
zymes (red color) on Brassica rapa chromosomes. Chromosome
number is indicated at the top of each chromosome. Numbers in
parentheses indicate the number of BrGELP genes and pseudoen-
MEME (Bailey et al. 2009). For a single motif, follow-
ing criteria were used: number of repetitions, 0 or 1 per
sequence; maximum number of motifs, 100; optimum
motif width, 6–12. Only motifs with E value ≤1e−10 were
selected for further analysis.
Results
The B. rapa GDSL esterase/lipase genes
To identify the members of BrGELP gene subfamily, the
entire B. rapa genome sequence (V1.5) and 3537 novel
transcripts recently identified by deep sequencing were
downloaded from the BRAD database (Wang et al. 2011)
and UC Davis Phytonetworks Genome Browser (http://
phytonetworks.ucdavis.edu/) (Devisetty et al. 2014),
respectively. After HMM search, 121 BrGELP genes and
29 BrGELP pseudoenzymes (missing one or two residues
of the catalytic triad) were isolated. Three genes contain-
ing other protein domain(s) in addition to PF00657 were
not used in our BrGELP candidate genes analysis (Supple-
mentary Table 1).The locus ID, genome location, coding
sequence (CDS) length, and protein length of the resulting
genes are listed in Supplementary Table 1. The CDS sizes
of the BrGELP genes varied from 966 bp (Bra039701) to
2673 bp (Bra025794), with the average sequence length
of 1142 bp. The genomic sequences of the BrGELP genes
ranged from 1104 to 11,289 bp (Supplementary Table 1).
13
Mol Genet Genomics
zymes (red color) present on each chromosome. Bra035295 (pseu-
doenzyme), Bra038972, Bra040203, and Bra040640, which are cur-
rently mapped to scaffolds, are not shown. The blue color indicate the
centromere positions (color figure online)
BrGELP genes were present on all 10 B. rapa chromo-
somes, with a non-uniform distribution: except for three
BrGELPs (Bra038972, Bra040203, and Bra040640), all
other BrGELP genes could be mapped on chromosomes
A01–A10 (Fig. 1). Four chromosomes contained more than
57 % of all BrGELPs in the genome: chromosomes A07
(17.4 %), A02 (14.0 %), A08 (14.0 %), and A09 (12.4 %)
(Supplementary Table 1; Fig. 1). The pericentromere region
of chromosome A07 and the short arm of chromosome
A08 contained chromosomal regions with especially high
BrGELP density (Fig. 1).
Gene structure analysis revealed that BrGELP genes
consisted of five exons on average. Eighty-six BrGELP
genes (71.1 %) had five exons interrupted by four introns
(Supplementary Table 1, Supplementary Fig. 1), as revealed
by a global analysis of gene structure in the B. rapa
genome (5.03 exons per gene) (Wang et al. 2011); similar
results were obtained from the analysis of OsGELP genes
in rice (Chepyshko et al. 2012). The rest of the genes had
1 exon (1 gene, Bra009496), 2 exons (2 genes), 3 exons (9
genes), 4 exons (14 genes), 6 exons (6 genes), or 10 exons
(3 genes) exons.
Phylogenetic analysis, motif and orthologs identification
of the BrGELP genes
To obtain insight into the evolutionary relationship of the
BrGELP genes, we carried out a phylogenetic analysis
of the BrGELP and A. thaliana GELP (AtGELP) genes.
Mol Genet Genomics
We also analyzed the Arabidopsis genome (TAIR10) as
described above for Chinese cabbage genome. After HMM
search, 112 genes, including 98 GELP genes, 13 GELP
pseudoenzymes, and one gene with multi-protein domains,
were obtained (Table S2). The unrooted phylogenetic tree
was constructed for 121 BrGELPs and 98 AtGELPs using
the NJ method in MEGA6. The sequence alignment is
shown in Supplementary Fig. 2. In summary, the GELP
genes from B. rapa and Arabidopsis could be divided into
three clades (I–III) (Fig. 2); Clade I and II consisted of 13
and 4 subclades, respectively. The phylogenetic tree gener-
ated with ML methods also gave the same overall pattern
except some branch rotation (Supplementary Fig. 3). Pre-
vious analysis for GELP genes from land plants revealed
Fig. 2  Phylogenetic relationships of BrGELP and AtGELP gene
family. Multiple protein sequence alignment was performed using
ClustalW implemented in MEGA6. The neighbor-joining (NJ) tree
was constructed in MEGA6 using the Poisson model with the follow-
two major and one minor clade, consistent with our results
(Volokita et al. 2011).
Conserved sequences and motifs imply important
roles in the functions of enzymes. A total of 55 motifs (E
value ≤1e−10) were identified from the 121 BrGELP pro-
teins (Supplementary Table 3). Our analysis of conserved
motifs revealed that blocks I, II, III, and V were found in
all BrGELPs, and each block was included in different
motifs (2, 4, 8, and 1, respectively) (Fig. 3; Supplementary
Table 3). Beside these four conserved blocks, additional 17
well-conserved motifs (with E values below 1e−100) were
also detected in most BrGELP genes. The other motifs
were specific to individual subclades in the phylogenetic
tree (Supplementary Table S3). For instance, motifs 18, 21,
ing options: homogeneous pattern, complete deletion, and 1000-rep-
licate bootstrap. Different clades and branches (subclades) are indi-
cated by the colors of the background and branch lines, respectively
(color figure online)
13
 Mol Genet Genomics

22, 23, 34, 38, 43, 47, 48, 51, 52, and 53 were only found Fig. 4  Heat map of expression patterns of BrGELP genes (complete▸
in clade I; motifs 25, 26, 27, 29, 30, 31, 32, 33, and 35 were catalytic triad) and pseudoenzymes (incomplete catalytic triad) based
on probe intensity (PI) (extracted from Dong et al. 2013a). S1–S3
specifically detected in clade II (Supplementary Table S3). indicate floral buds from male-sterile B. rapa before the tetrad stage
Because orthologous genes frequently retain similar (S1), at the tetrad stage (S2), and containing aberrant pollen grains
functions (Koonin 2005), identification of orthologous (S3). F1–4 represent fertile B. rapa floral buds before the tetrad stage
GELP genes between Chinese cabbage and Arabidopsis (F1), at the tetrad stage (F2), after the tetrad stage but before contain-
ing mature pollen (F3), and containing mature pollen (F4). Genes in
may allow us to predict the function of specific BrGELP the box are putatively involved in the pollen development
genes. Total 69 orthologous groups were identified using
InParanoid (O’Brien et al. 2005) (Supplementary Table 4).
Expression patterns of BrGELP genes
Among the orthologous gene groups of B. rapa and Arabi-
dopsis, a maximum of three B. rapa orthologs were sug-
The expression pattern of BrGELP genes can provide addi-
gested for each Arabidopsis gene, consistent with the
tional insight into their functions. To determine the expres-
notion that genome triplication occurred in Chinese cab-
sion patterns of BrGELP genes in different tissues, we used
bage after divergence of these two species from their com-
Illumina RNA-Seq transcriptomic data (Cheng et al. 2012).
mon ancestor. For example, the three B. rapa genes GDSL-
Of the 121 genes, 87 genes had significant RPKM (Reads
MOTIF LIPASE 3 (GLIP3: Bra030917, Bra030916, and
Per Kilobase per Million mapped reads) in roots, stems, or
Bra014375) were assigned as orthologs for AT1G53990.
leaves, and were expressed in these tissues in a preferential
For most AtGELP genes, however, only one or two
or specific manner (Supplementary Fig. 4A). We also deter-
BrGELP genes were identified, indicating gene losses dur-
mined the expression patterns of the BrGELP pseudoen-
ing speciation in the Brassica lineage. A previous study
zymes and observed that 20 of the 29 pseudoenzymes had
revealed that extracellular lipases (EXLs) 4, 5, and 6 are
significant RPKM in roots, stems, or leaves (Supplementary
involved in pollen coat development in Arabidopsis (May-
Fig. 4B). For expression patterns in flowers, we used previ-
field et al. 2001). In our analysis of the orthologous rela-
ously published microarray data (Dong et al. 2013a). Among
tionships between Arabidopsis and B. rapa, Bra008229 and
the 121 BrGELPs, 65 genes represented by 107 probes were
Bra103243 were identified as the orthologs of AtEXL4 and
expressed in different stages of floral buds (Fig. 4). Expres-
AtEXL6, respectively, suggesting that they are also involved
sion patterns could be grouped into three types: constitutive,
in pollen development in B. rapa.

Fig. 3  Motif logo of four conserved blocks found in BrGELP proteins: I (a), II (b), III (c), and V (d). Conserved residues Ser-Gly-Asn-His in
blocks are indicated with red triangles (color figure online)

13
Mol Genet Genomics

13

stage-specific during flower development, and fertile bud-
specific. BrEXL4 (Bra008229, containing complete cata-
lytic triad, and Bra014533, a pseudoenzymes without
Serine residue) and BrEXL6 (Bra103243 for three ESTs),
the predicted orthologs of AtEXL4 and AtEXL6, respec-
tively, were specifically expressed in fertile floral buds of
B. rapa. In addition, 14 BrGELPs genes (27 probes) were
also expressed in a fertile bud-specific manner. Among
these, expression patterns for two orthologous BrGELPs for
each Arabidopsis gene were supported by multiple probes:
Bra016475 (Brapa_ESTC001010, Brapa_ESTC010869,
Brapa_ESTC047743) and Bra025794 (Brapa_ESTC000842,
Brapa_ESTC003502, Brapa_ESTC011093) for AT1G20132;
and Bra017361 (Brapa_ESTC009337, Brapa_ESTC019325,
Brapa_ESTC030427) and Bra026529 (Brapa_ESTC009284,
Brapa_ESTC025896, Brapa_ESTC026051) for AT2G03980.
These results suggest that a large number of BrGELP genes,
including BrEXL6, might also be involved in pollen develop-
ment in B. rapa.
Conserved function of GELPs in pollen development
in B. rapa and Arabidopsis
To investigate the function of Bra103243 (BrEXL6), one
of the GELPs specifically expressed in fertile floral buds
but not in male-sterile flower buds, we carried out co-
expression analysis using previously published microarray
data (Dong et al. 2013a, b). ESTs that were co-expressed
with three probes for BrEXL6, Brapa_ESTC003525,
Brapa_ESTC000535 and Brapa_ESTC010981, were con-
sidered to be co-expressed ESTs. The B. rapa gene ID
was obtained for these ESTs using the BlastN service in
BRAD. To identify genes co-expressed with AtEXL6, we
used Expression Angler (http://bar.utoronto.ca/ntools/cgi-
bin/ntools_expression_angler.cgi) (Toufighi et al. 2005).
When the threshold value for Pearson’s correlation coef-
ficient (PCC) was set at 0.85, 36 B. rapa genes (70 ESTs)
and 25 Arabidopsis genes were identified as co-expressed
with BrEXL6 and AtEXL6, respectively (Supplementary
Tables 5, 6). The expression patterns of these genes/ESTs
were reconstructed using previously published micro-
array data and the Arabidopsis eFP browser (http://bar.
utoronto.ca/efp/cgi-bin/efpWeb.cgi) (Winter et al. 2007;
Dong et al. 2013a). BrEXL6 and its co-expressed ESTs
were specifically expressed in fertile floral buds, with
the highest expression in floral buds, at and after the tet-
rad stage, but before containing mature pollen (Fig. 5a).
In Arabidopsis, the highest expression levels of AtEXL6
and its co-expressed genes were observed at floral stage
10–12, representing the microspore pollen development
stage (Table 5B). GO enrichment analysis of the co-
expressed genes using agriGo (Du et al. 2010) revealed
that genes involved in pollen exine formation were highly
13
Mol Genet Genomics
overrepresented among genes co-expressed with AtEXL6
and BrEXL6 (Fig. 5c, d). Taken together, our analyses sug-
gested that EXL6 may be required for proper pollen devel-
opment, especially pollen exine formation, in both B. rapa
and Arabidopsis.
To confirm the expression patterns, we validated
BrEXL6 and AtEXL6 expression by RT-PCR (Fig. 6).
AtEXL6 was specifically expressed before floral stage
12, and BrEXL6 was highly expressed in fertile bud 3.
The RT-PCR results were consistent with our expression
pattern analysis (Fig. 5a, b), which revealed specific or
high expression in floral buds at the later stage. To eluci-
date gene function, we generated knockdown mutants of
AtEXL6 by antisense expression and sense co-suppression
driven by the CaMV35S promoter (Fig. 7a). In total, four
independent transgenic plants (out of 26 plants obtained)
exhibited down-regulation of AtEXL6 and shared similar
defects in pollen grains (Fig. 7, Supplementary Fig. 5A).
However, these transgenic plants exhibited normal veg-
etative growth relative to wild-type plants (Supplementary
Fig. B). To explore whether the mutant phenotypes in the
transgenic plants correlated with AtEXL6 expression lev-
els, we performed semi-RT-PCR. As shown in Fig. 7b,
AtEXL6 expression was almost completely suppressed in
the sense-16 line, which exhibited severe pollen defective
phenotypes. Compared to wild-type and sense-16 plants,
lines antisense-3 and antisense-9 (with moderate reduc-
tion in AtEXL6 expression) exhibited intermediate levels
of pollen development (Fig. 7b, Supplementary Fig. 5A).
These results indicate that sufficient expression of AtEXL6
is required for normal pollen development in Arabidopsis.
To narrow down the stage at which EXL6 functions,
we monitored the pollen development process in WT and
AtEXL6 transgenic plants, and observed significant differ-
ences after the tetrad stage. At this stage, cytoplasm deg-
radation was observed in microspore pollen of transgenic
plants, whereas no similar phenotype was observed in WT
plants (Fig. 7c). Based on the results obtained from expres-
sion analysis and transgenic knockdown of AtEXL6, we
conclude that AtEXL6 is involved in pollen development
after the tetrad stage in Arabidopsis, and BrEXL6 may have
a similar function in Chinese cabbage.
Discussion
Identification and analysis of BrGELPs
Recently, genome-wide analyses have been performed
on several gene superfamilies in Brassica species; these
include B. rapa phytocyanins (BrPCs) (Li et al. 2013),
AP2/ERF in B. rapa (Song et al. 2013) and B. olera-
cea (Thamilarasan et al. 2015), B. rapa non-specific
Mol Genet Genomics
Fig. 5  Expression pattern and GO enrichment analysis of EXL6s and
their co-expressed genes. a Expression patterns of BrEXL6 and its
co-expressed genes in sterile and fertile B. rapa floral buds, based on
previously published microarray data (Dong et al. 2013a). S1–3 indi-
cate the floral buds from male-sterile B. rapa, before the tetrad stage
(S1), after the tetrad stage (S2), and containing aberrant pollen grains
(S3). F1–4 represent fertile B. rapa floral buds before the tetrad stage
(F1), at the tetrad stage (F2), after the tetrad stage but before contain-
ing mature pollen (F3), and containing mature pollen (F4). Red, blue
Fig. 6  Expression levels of EXL6. a Analysis of BrEXL6 expression
in various tissues of B. rapa. Shoots were sampled from 3-week-old
Chiifu seedlings. F1–4 represent fertile B. rapa floral buds before the
tetrad stage (F1), at the tetrad stage (F2), after the tetrad stage but
before containing mature pollen (F3), and containing mature pollen
(F4). b Analysis of AtEXL6 expression in various tissues of wild-type
(Col-0) Arabidopsis using semi-RT-PCR. FS1–12 flower stage 1 to
stage 12, FS13–16 flower stage 13 to stage 16
and purple lines indicate expression patterns of three BrEXL6 ESTs,
Brapa_ESTC010981, Brapa_ESTC000535, and Brapa_ESTC003525.
b Expression pattern of AtEXL6 and its co-expressed genes in various
tissues of Arabidopsis, performed using the Arabidopsis eFP Browser
(http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi). FS stands for “flower
stage”. Red line indicates the expression pattern of AtEXL6. c, d GO
enrichment analysis of genes co-expressed with BrEXL6 and AtEXL6,
respectively (color figure online)
lipid transfer proteins (BrnsLtp) (Li et al. 2014), B. rapa
expansin (BrEXP) (Krishnamurthy et al. 2014), and the
B. rapa MADS-box genes (Duan et al. 2015). Previously,
the analysis of GELP subfamily in plants has been reported
for Arabidopsis, rice and other land plants (Ling 2008;
Volokita et al. 2011; Chepyshko et al. 2012; Jiang et al.
2012). However, a detailed analysis of the GELP subfam-
ily in Brassica has not been reported to date. In this study,
we carried out genome-scale identification and expression
analysis of B. rapa GELPs, and characterized the function
of AtEXL6, a possible Arabidopsis ortholog of BrEXL6.
As in Arabidopsis, the 121 BrGELP genes identified here
were asymmetrically distributed on chromosomes 1–10,
with several densely populated regions on certain chromo-
somes (Fig. 1) (Ling 2008). These genes can be phyloge-
netically grouped into two major and one minor subfamily
(Fig. 2), as in Arabidopsis and other species (Ling 2008;
Chepyshko et al. 2012; Volokita et al. 2011), consistent
13

Fig. 7  Analysis of AtEXL6-knockdown transgenic plants. a Sche-
matic representation of AtEXL6 gene structure and DNA regions used
for the antisense and sense constructs. White boxes indicate untrans-
lated regions (UTRs), gray boxes represent exons, lines connecting
boxes represent introns, and dashed arrows indicate the orientation of
antisense and sense fragments in the transgenic constructs. AtEXL6-
F and -R indicate the positions of primers used for semi-RT-PCR.
with a high degree of similarity in the genome structures
of Arabidopsis and Brassica species (Krishnamurthy et al.
2015; Thamilarasan et al. 2014). Among the GELPs, the
well-characterized genes belong to Clade I and II (Fig. 2).
For example, Arabidopsis bacterial resistance genes (GLIP1
13
Mol Genet Genomics
b Expression levels of AtEXL6 in floral buds of WT and transgenic
plants. c Comparisons of pollen development among WT and T1
AtEXL6 transgenic plants. ‘Antisense’ and ‘sense’ indicate transgenic
lines derived from antisense and sense constructs, respectively. The
green arrows indicate the defects. The numbers after FS indicates flo-
ral development stages. Bar 20 μm (color figure online)
and GLIP2) are in Clade II (subclade II-b) (Kwon et al.
2009; Lee et al. 2009), and hot pepper pathogen- and stress-
responsive genes (CaGLIP1 and CaGL1) are in Clade I
(subclade I-m) (Hong et al.2008; Kim et al. 2008). BnLIP2,
involved in rapeseed germination, morphogenesis, and
Mol Genet Genomics
flowering, is in Clade II (subclade II-d) (Ling et al. 2006).
By contrast, the pollen fertility-related genes EXL4–6
(Updegraff et al. 2009; Xu et al. 2014) are grouped in Clade
I (subclade I-b), along with many other genes specifically
expressed in male-fertile floral buds (Fig. 2).
Compared with other fully sequenced plant genomes
so far (Ling 2008; Volokita et al. 2011; Chepyshko et al.
2012), the Chinese cabbage genome contains among the
highest number of BrGELPs (121). The high number of
GELP subfamily members in this vegetable crop could
be related to functional diversification in order to use a
wide range of substrates (Volokita et al. 2011), as well as
the genome triplication event in this lineage (Wang et al.
2011). The presence of conserved motifs in most of the 121
BrGELPs (Fig. 3; Supplementary Table 3), in particular the
four strictly conserved residues Ser-Gly-Asn-His in blocks,
I, II, III, and V (Akoh et al. 2004), strongly suggests that
most of the identified genes encode functional GELP
enzymes, and that these motifs play specific roles in diver-
sity of substrate selection or multifunctionality. Functional
information about unknown genes can be deduced from the
study of orthologs with known functions (Volokita et al.
2011), although the presence of several copies of B. rapa
orthologs corresponding to each Arabidopsis gene may
imply functional divergence, redundancy, or degeneration
(Fig. 2). The phylogenetic grouping suggests that a subset
of BrGELP genes are orthologous to the Arabidopsis pol-
len fertility-related genes EXL4–6.
Expression characteristics of BrGELPs
Because only a few plant GELPs have been functionally
characterized so far, we analyzed BrGELP expression
patterns to obtain additional clues about their functions
(Fig. 4, Supplementary Fig. 4). Many BrGELPs are prefer-
entially or specifically expressed in roots, stems, or leaves
(Supplementary Fig. 4), implying that they play specific
roles required in these tissue types.
Three distinct types of expression patterns (constitu-
tive, stage specific during floral bud development, and
male-fertile bud-specific) were observed in the floral bud,
which includes both sporophytic and gametophytic tissues
(Fig. 4). The identification of many BrGELP genes, includ-
ing the putative orthologs of AtEXL4 and AtEXL6s, which
in contrast to their male-sterile counterparts are specifi-
cally expressed in fertile floral buds, raises the possibility
that these BrGELPs are involved in pollen development. In
Arabidopsis, AtEXL6 is a target of AMS, a master regulator
that coordinates pollen wall development and sporopollenin
biosynthesis (Xu et al. 2014). The pollen coat protein EXL4
affects lipid composition of the pollen coat and is important
for efficient pollination (Updegraff et al. 2009).
Functional analysis of EXL6
EXL6 and its co-expressed genes in Arabidopsis and
B. rapa, which are enriched in pollen exine formation and
lipase genes, are transcriptionally activated during the early
stage of pollen development and significantly downregu-
lated at the final stage of pollen maturation (Figs. 5, 6; Sup-
plementary Tables 5, 6) (Dong et al. 2013a). To elucidate
the function of AtEXL6, for which no T-DNA knockout
mutant lines were available in Arabidopsis, we generated
knockdown mutants by over-expression of EXL6 sense and
antisense transcripts (Fig. 7, Supplementary Fig. 5). We
found that several AtEXL6 knockdown transgenic plants
exhibited defective pollen grain phenotypes that were well
correlated with the reduction in AtEXL6 expression level.
A detailed analysis of pollen development revealed that
cytoplasmic degradation occurred after the tetrad stage in
the AtEXL6 knockdown lines (Fig. 7c). In summary, we
demonstrated that AtEXL6 plays an essential role in Arabi-
dopsis pollen development; based on phylogenetic analysis
and expression profiling, we propose that BrEXL6 is an
ortholog of AtEXL6.
Acknowledgments This research was supported by research grants
from Golden Seed Project (Center for Horticultural Seed Develop-
ment, nos. 213003-04-3-CG100 and 213003-04-3-SB230), Ministry
of Agriculture, Food and Rural Affairs (MAFRA), Ministry of Oceans
and Fisheries (MOF), and Rural Development Administration (RDA).
Compliance with ethical standards
Conflict of interest Dong X declares that he has no conflict of inter-
est. Yi H declares that he has no conflict of interest. Han C-T declares
that he has no conflict of interest. Nou I-S declares that he has no con-
flict of interest. Hur Y declares that he has no conflict of interest.
References
Agee AE, Surpin M, Sohn EJ, Girke T, Rosado A, Kram BW et al
(2010) MODIFIED VACUOLE PHENOTYPE1 is an Arabidop-
sis myrosinase-associated protein involved in endomembrane
protein trafficking. Plant Physiol 152:120–132
Akoh CC, Lee GC, Liaw YC, Huang TH, Shaw JF (2004) GDSL fam-
ily of serine esterases/lipases. Prog Lipid Res 43:534–552
Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L et al
(2009) MEME SUITE: tools for motif discovery and searching.
Nucleic Acids Res 37:W202–W208
Brick DJ, Brumlik MJ, Buckley JT, Cao JX, Davies PC, Misra S et al
(1995) A new family of lipolytic plant enzymes with members in
rice, arabidopsis and maize. FEBS Lett 377:475–480
Cheng F, Wu J, Fang L, Sun S, Liu B, Lin K et al (2012) Biased gene
fractionation and dominant gene expression among the subge-
nomes of Brassica rapa. PLoS One 7:e36442
Chepyshko H, Lai CP, Huang LM, Liu JH, Shaw JF (2012) Multi-
functionality and diversity of GDSL esterase/lipase gene family
in rice (Oryza sativa L. japonica) genome: new insights from
bioinformatics analysis. BMC Genom 13:309
13

Devisetty UK, Covington MF, Tat AV, Lekkala S, Maloof JN (2014)
Polymorphism identification and improved genome annotation of
Brassica rapa through deep RNA sequencing. G3 4:2065–2078
Dong X, Feng H, Xu M, Lee J, Kim YK, Lim YP et al (2013a) Com-
prehensive analysis of genic male sterility-related genes in Bras-
sica rapa using a newly developed Br 300K oligomeric chip.
PLoS One 8:e72178
Dong X, Kim WK, Lim YP, Kim YK, Hur Y (2013b) Ogura-CMS in
Chinese cabbage (Brassica rapa ssp. pekinensis) causes delayed
expression of many nuclear genes. Plant Sci 199–200:7–17
Du Z, Zhou X, Ling Y, Zhang Z, Su Z (2010) agriGO: a GO analy-
sis toolkit for the agricultural community. Nucleic Acids Res
38:W64–W70
Duan W, Song X, Liu T, Huang Z, Ren J, Hou X et al (2015) Genome-
wide analysis of the MADS-box gene family in Brassica rapa
(Chinese cabbage). Mol Genet Genomics 290:239–255
Edlund AF, Swanson R, Preuss D (2004) Pollen and stigma struc-
ture and function: the role of diversity in pollination. Plant Cell
16:S84–S97
Finn RD, Clements J, Eddy SR (2011) HMMER web server: inter-
active sequence similarity searching. Nucleic Acids Res
39:W29–W37
Hong JK, Choi HW, Hwang IS, Kim DS, Kim NH, Choi DS et al
(2008) Function of a novel GDSL-type pepper lipase gene,
CaGLIP1, in disease susceptibility and abiotic stress tolerance.
Planta 227:539–558
Jiang Y, Chen R, Dong J, Xu Z, Gao X (2012) Analysis of GDSL
lipase (GLIP) family genes in rice (Oryza sativa). Plant Omics
5(4):351–358
Kim KJ, Lim JH, Kim MJ, Kim T, Chung HM, Paek KH (2008)
GDSL-lipase1(CaGL1) contributes to wound stress resistance by
modulation of CaPR-4 expression in hot pepper. Biochem Bio-
phys Res Commun 374:693–698
Koonin EV (2005) Orthologs, paralogs, and evolutionary genomics.
Annu Rev Genet 39:309–338
Krishnamurthy P, Hong JK, Kim JA, Jeong MJ, Lee YH, Lee SI
(2015) Genome-wide analysis of the expansin gene superfam-
ily reveals Brassica rapa-specific evolutionary dynamics upon
whole genome triplication. Mol Genet Genomics 290:521–530
Kwon SJ, Jin HC, Lee S, Nam MH, Chung JH, Kwon SI et al (2009)
GDSL lipase-like 1 regulates systemic resistance associated with
ethylene signaling in Arabidopsis. Plant J 58:235–245
Lee DS, Kim BK, Kwon SJ, Jin HC, Park OK (2009) Arabidopsis
GDSL lipase 2 plays a role in pathogen defense via negative
regulation of auxin signaling. Biochem Biophys Res Commun
379:1038–1042
Leščić Ašler I, Ivić N, Kovačić F, Schell S, Knorr J, Krauss U et al
(2010) Probing enzyme promiscuity of SGNH hydrolases.
Chembiochem 11:2158–2167
Li J, Gao G, Zhang T, Wu X (2013) The putative phytocyanin genes
in Chinese cabbage (Brassica rapa L.): genome-wide identifica-
tion, classification and expression analysis. Mol Genet Genomics
288:1–20
Li J, Gao G, Xu K, Chen B, Yan G, Li F et al (2014) Genome-wide
survey and expression analysis of the putative non-specific lipid
transfer proteins in Brassica rapa L. PLoS One 9:e84556
Ling H (2008) Sequence analysis of GDSL lipase gene family in
Arabidopsis thaliana. Pak J Biol Sci 11:763–767
Ling H, Zhao J, Zuo K, Qiu C, Yao H, Qin J et al (2006) Isolation and
expression analysis of a GDSL-like lipase gene from Brassica
napus L. J Biochem Mol Biol 39:297–303
13
Mol Genet Genomics
Mayfield JA, Preuss D (2000) Preuss, Rapid initiation of Arabidopsis
pollination requires the oleosin-domain protein GRP17. Nat Cell
Biol 2:128–130
Mayfield JA, Fiebig A, Johnstone SE, Preuss D (2001) Gene fami-
lies from the Arabidopsis thaliana pollen coat proteome. Science
292:2482–2485
Mølgaard A, Kauppinen S, Larsen S (2000) Rhamnogalacturonan
acetylesterase elucidates the structure and function of a new fam-
ily of hydrolases. Structure 8:373–383
O’Brien KP, Remm M, Sonnhammer EL (2005) Inparanoid: a com-
prehensive database of eukaryotic orthologs. Nucleic Acids Res
33:D476–D480
Oh IS, Park AR, Bae MS, Kwon SJ, Kim YS, Lee JE, Kang NY, Lee
S, Cheong H, Park OK (2005) Secretome analysis reveals an
Arabidopsis lipase involved in defense against Alternaria bras-
sicicola. Plant Cell 17:2832–2847
Peterson R, Slovin JP, Chen C (2010) A simplified method for dif-
ferential staining of aborted and non-aborted pollen grains. Int J
Plant Biol 1:e13
Quilichini TD, Douglas CJ, Samuels AL (2014) New views of tape-
tum ultrastructure and pollen exine development in Arabidopsis
thaliana. Ann Bot 114:1189–1201
Song X, Li Y, Hou X (2013) Genome-wide analysis of the AP2/ERF
transcription factor superfamily in Chinese cabbage (Brassica
rapa ssp. pekinensis). BMC Genom 14:573
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013)
MEGA6: molecular evolutionary genetics analysis version 6.0.
Mol Biol Evol 30:2725–2729
Tan X, Yan S, Tan R, Zhang Z, Wang Z, Chen J (2014) Characteriza-
tion and expression of a GDSL-like lipase gene from Brassica
napus in Nicotiana benthamiana. Protein J 33:18–23
Thamilarasan SK, Park JI, Jung HJ, Nou IS (2014) Genome-wide
analysis of the distribution of AP2/ERF transcription factors
reveals duplication and CBFs genes elucidate their potential
function in Brassica oleracea. BMC Genom 15:422
Toufighi K, Brady SM, Austin R, Ly E, Provart NJ (2005) The Botany
Array Resource: e-Northerns, Expression Angling, and promoter
analyses. Plant J 43:153–163
Updegraff EP, Zhao F, Preuss D (2009) The extracellular lipase EXL4
is required for efficient hydration of Arabidopsis pollen. Sex
Plant Reprod 22:197–204
Upton C, Buckley JT (1995) A new family of lipolytic enzymes?
Trends Biochem Sci 20:178–179
Volokita M, Rosilio-Brami T, Rivkin N, Zik M (2011) Combining
comparative sequence and genomic data to ascertain phyloge-
netic relationships and explore the evolution of the large GDSL-
lipase family in land-plants. Mol Biol Evol 28:551–565
Wang X, Wang H, Wang J, Sun R, Wu J, Liu S et al (2011) The
genome of the mesopolyploid crop species Brassica rapa. Nat
Genet 43:1035–1039
Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ
(2007) An “Electronic Fluorescent Pictograph” browser for
exploring and analyzing large-scale biological data sets. PLoS
One 2:e718
Xu J, Ding Z, Vizcay-Barrenan G, Shi J, Liang W, Yuan Z et al (2014)
ABORTED MICROSPORES acts as a mater regulator of pollen
wall formation in Arabidopsis. Plant Cell 26:1544–1556
Zhang Z, Ober JA, Kliebenstein DJ (2006) The gene controlling the
quantitative trait locus EPITHIOSPECIFIER MODIFIER1 alters
glucosinolate hydrolysis and insect resistance in Arabidopsis.
Plant Cell 18:1524–1536