Article

Small-Molecule-Targeting Hairpin Loop of hTERT

Promoter G-Quadruplex Induces Cancer Cell Death
Graphical Abstract Authors
Jin H. Song, Hyun-Jin Kang,
Libia A. Luevano, ...,
H.-H. Sherry Chow, Laurence H. Hurley,
Andrew S. Kraft

Correspondence
jinsong@email.arizona.edu (J.H.S.),
hurley@reglagene.com (L.H.H.),
akraft@uacc.arizona.edu (A.S.K.)

In Brief
Small-molecule targeting of the
cooperative folding process in the hTERT
G-quadruplex promoter element
produces telomerase-independent
events, which impair mitochondrial
processes resulting in apoptotic cell
death and inhibition of prostate cancer
cell growth.

Highlights
d Small molecule targets hairpin in G-quadruplex structure,
controls hTERT expression

d hTERT G-quadruplex exerts telomere-independent

mechanisms of cancer cell death

d hTERT inhibition mediates mitochondrial defects, oxidative

stress, and DNA damage

d hTERT downregulation by the small molecule kills specifically

cancer cells

Song et al., 2019, Cell Chemical Biology 26, 1110–1121

August 15, 2019 ª 2019 Elsevier Ltd.
https://doi.org/10.1016/j.chembiol.2019.04.009
 Cell Chemical Biology

Article

Small-Molecule-Targeting Hairpin Loop

of hTERT Promoter G-Quadruplex
Induces Cancer Cell Death
Jin H. Song,1,2,6,* Hyun-Jin Kang,3,4 Libia A. Luevano,2 Vijay Gokhale,4,5 Kui Wu,3 Ritu Pandey,1,2 H.-H. Sherry Chow,2
Laurence H. Hurley,3,4,* and Andrew S. Kraft2,*
1Department of Cellular and Molecular Medicine, University of Arizona, 1515 North Campbell Avenue, Tucson, AZ 85724, USA
2University of Arizona Cancer Center, 1515 North Campbell Avenue, Tucson, AZ 85724, USA
3College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721, USA
4Reglagene LLC, 1703 East Mabel Street, Tucson, AZ 85721, USA
5BIO5 Institute, University of Arizona, 1657 East Helen Street, Tucson, AZ 85721, USA
6Lead Contact

*Correspondence: jinsong@email.arizona.edu (J.H.S.), hurley@reglagene.com (L.H.H.), akraft@uacc.arizona.edu (A.S.K.)

https://doi.org/10.1016/j.chembiol.2019.04.009

SUMMARY including melanoma, glioblastoma, and bladder cancer (Borah

Increased telomerase activity is associated with ma-
lignancy and poor prognosis in human cancer, but
the development of targeted agents has not yet pro-
vided clinical benefit. Here we report that, instead of
targeting the telomerase enzyme directly, small
molecules that bind to the G-hairpin of the hTERT
G-quadruplex-forming sequence kill selectively ma-
lignant cells without altering the function of normal
cells. RG260 targets the hTERT G-quadruplex
stem-loop folding but not tetrad DNAs, leading to
downregulation of hTERT expression. To improve
physicochemical and pharmacokinetic properties,
we derived a small-molecule analog, RG1603, from
the parent compound. RG1603 induces mitochon-
drial defects including PGC1a and NRF2 inhibition
and increases oxidative stress, followed by DNA
damage and apoptosis. RG1603 injected as a
single agent has tolerable toxicity while achieving
strong anticancer efficacy in a tumor xenograft
mouse model. These results demonstrate a unique
approach to inhibiting the hTERT that functions by
impairing mitochondrial activity, inducing cell death.
INTRODUCTION
Telomerase is an essential enzyme to cancer cells in maintaining
telomere function (Harley et al., 1994; Wellinger et al., 1996).
Human cancer cells acquire telomerase activity by activating
or upregulating the normally silent human telomerase reverse
transcriptase gene (hTERT) (Nugent and Lundblad, 1998).
hTERT gene is usually silenced in somatic cells but expressed
at high levels in
90% of human cancers (Blasco and Hahn,
2003; Kim et al., 1994). Recent studies have shown that key mu-
tations in hTERT promoter region elevate hTERT expression,
telomerase activity, and telomere length in various cancer types,
et al., 2015; Horn et al., 2013; Killela et al., 2013). In these studies,
patients with tumors expressing high levels of hTERT showed
significantly worse overall survival rates than those with lower
expression of hTERT, directly suggesting the role of the pro-
moter in controlling patient outcomes.
Telomeric DNA is capable of folding into four-stranded gua-
nine quadruplex (G4) structures (Bochman et al., 2012; Palumbo
et al., 2009). Starting from single-stranded DNA, the hTERT G4 at
the 30 end nearest the transcription start site presents an unusual
26-base hairpin loop, which is proposed to act as the initiation
point for cooperative folding of the G4 (Kang et al., 2016; Yu
et al., 2012). This sequence is critical to the inhibition of hTERT
transcription because somatic mutations found naturally in the
same hairpin of the G4 resulted in disruption of G4 folding, lead-
ing to overexpression of hTERT (Kang et al., 2016). Targeting the
major G4 in the hTERT promoter with the guanidine-substituted
acridine compound GTC365 resulted in inhibition of hTERT ac-
tivity. GTC365 acted as a pharmacological chaperone by rest-
eering the folding process such that the effect of misfolding of
the silencer G4 caused by somatic mutations could be reversed.
The generation of G4 drugs that target the unique heteroduplex
hairpin loop without targeting the G4 tetrad would be predicted
to increase selectivity because tetrads are the conserved fea-
tures of G4s found in many other genes, such as BCL2, MYC,
KRAS, and PDGFR-b (Bugaut et al., 2010; Burger et al., 2005;
Zhang et al., 2017a). Sequence variability and associated struc-
tural variability in the loops provide the opportunity for both bet-
ter selectivity and drug-like properties.
We set out to discover whether we could identify a different set
of molecules that lacked the acridine moiety but still possessed
the chaperone properties of GTC365. We find that the folding
pattern of the final G-quadruplex formed from binding of com-
pounds that lack the tetrad targeting moiety leads to a different
folded product than with GTC365, which can be rationalized
based on the initial drug-binding site and subsequent folding
steps that most probably mimic the natural folding process.
This singular mechanism of action permits reduced telomerase
production and telomere shortening. However, the early onset
of anticancer effects, for example, inhibition of cell proliferation

1110 Cell Chemical Biology 26, 1110–1121, August 15, 2019 ª 2019 Elsevier Ltd.
Figure 1. Identification and Characterization of RG260 as an hTERT Downregulator by Stabilizing the hTERT Promoter G4
(A) Principle of compound screening by FRET assay. The ends of the 5–12 G-tract were labeled with fluorescein amidite (FAM) at the 50 end and tetrame-
thylrhodamine (TAMRA) at the 30 end, and the folding of the oligomer brings each end closer. Subsequently, FAM fluorescence is quenched by TAMRA. A
representative result of screening of the NCI Diversity Set III is shown.
(B) Chemical structures of GTC365 and RG260 (NSC654260).
(C and D) DMS footprinting showing the different folding pattern of the 1–12 full-length G-quadruplex by RG260 (20 equiv) and GTC365 (20 equiv) with 5 mM KCl
(C) or 100 mM CaCl2 (D). Image quality is a reflection of the reduced intensity and partial cleavages.
(E) Dose-dependent decrease of hTERT core promoter activity by RG260. MCF7 cells were transfected with pGL3 constructs and pRL-TK for 6 h and then treated
with RG260 for 24 h. A dual-luciferase assay was performed to obtain luciferase activity of firefly and renilla for normalization. Data are shown as mean ± SD of four
replicates.
(F) Dose-dependent inhibition of telomerase activity by RG260. MCF7 cells were treated with RG260 for 72 h before being subjected to TRAP assay. Quantitation
showed a clear decrease in FRET signal of RG260 treated in comparison to control.

and induction of apoptosis, are driven by telomere-independent
mechanisms. In vivo studies demonstrate that systemic admin-
istration of small molecules stabilizing hTERT G4s significantly
delays tumor growth. These studies provide data supporting
hTERT as an important cancer drug target.
RESULTS
Discovery of a Small Molecule that Selectively Targets
the Hairpin Stem Loop of the WT hTERT G4 to
Downregulate hTERT Expression
Single-stranded oligomer for the full-length (FL)-G4 in the hTERT
promoter element can form a tandem G-quadruplex containing
an unusually large 26-base hairpin stem loop (Figure S1A) (Boch-
man et al., 2012; Palumbo et al., 2009). We carried out a fluores-
cence resonance energy transfer (FRET) assay-based screening
of
1,500 compounds in the NCI diversity set (Kang et al., 2016)
and identified two sets of structurally distinct compounds that
quenched the fluorescence in the FRET assay (Figure 1A). The
subsequent dimethylsulfate (DMS) footprinting experiments on
hTERT G4 in presence of GTC365 were performed with 5 mM
KCl buffer rather than the 140 mM KCl buffer. The results of these
experiments show that the footprinting on the GTC365-bound
wild-type (WT) G4 in 5 mM KCl is similar to the footprinting ob-
tained on the hTERT WT sequence in 140 mM KCl. This indicates
that GTC365 interacts with the same final folding pattern for the
tandem G4s with the 26-base hairpin contained in the 50 -G4 (Fig-
ure S1A). GTC365 consists of an acridine-derived moiety similar
to BRACO19 that binds to G-quadruplexes through the recogni-
tion of the G-tetrad and a guanidino group that binds to the lower
part of the 26-base hairpin loop (Kang et al., 2016).
From this same FRET screening assay we identified a second
set of structurally distinct compounds (Figure 1A), typified by
RG260 (NSC654260). These compounds are the subject of this
contribution, and the characterization of their effect on the
folding pattern of the hTERT G4 was determined by DMS foot-
printing in 5 mM KCl, as was the WT G4 complex with
GTC365. RG260 contains a benzoylphenylurea (BPU) moiety
but lacks the tetrad-binding acridine moiety found in GTC365
(Figure 1B). We initially speculated that the BPU moiety might
mimic the guanidino moiety of GTC365, which has been shown
by chemical footprinting to bind to the base of the 26-base
hairpin stem loop rather than the 30 tetrad in the G4. Unexpect-
edly, RG260 showed no significant change of conformation of

Cell Chemical Biology 26, 1110–1121, August 15, 2019 1111

the G4 as measured by circular dichroism (CD) at a pH of 7.5
(Figure S1B). To gain some insight into how RG260 interacts
with the 5–12 G4, we first checked whether changes in pH would
affect the protonation status of cytosine and adenine, but not
guanine, thereby inducing a change of Watson-Crick base pair-
ings in the stem loop but not G-tetrads. The maximum CD signal
at around 262 nm at pH 6.8 was significantly decreased with a
small increase in a shoulder at around 290 nm compared with
the spectra at pH 7.5 (Figure S1C). This change in CD is indica-
tive of a conformational change just in the hairpin stem-loop
structure. When RG260 was added, the Tm was increased by
2 C (Figure S1D), which confirms our hypothesis that at a lower
pH, conformational change of the hairpin stem loop is specif-
ically induced by addition of the drug so that the entire structure
is stabilized. This result is in line with the role of the hairpin stem
loop of the 5–12 G4 as a nucleation site for folding of hTERT G4,
as proposed previously (Kang et al., 2016).
In the next series of experiments, we compared the DMS foot-
printing pattern of the FL-G4 in the presence of GTC365 and
RG260 using the 5 mM KCl buffer that we had used in the previ-
ous experiments with GTC365 (Figure 1C). We were surprised to
see that the GTC365- and RG260-bound DMS footprints were
quite distinct and that the WT footprint in 5 mM KCl buffer was
different to that found in the initial DMS footprinting previously
carried out in 140 mM KCl buffer. This clearly shows that the
KCl buffer concentration was a determinant of the final folding
pattern, which is most likely determined by the initial folding in-
termediates. In reflection, this is not too surprising because the
higher concentration of KCl (140 mM) used in the earlier experi-
ments is more likely to initially favor formation of the G4s,
whereas the lower concentration of KCl (5 mM) used in the later
experiments is more likely to favor initial formation of the hairpin
loop. The similar footprinting pattern in the dimethylsulfoxide
(DMSO) control and with RG260 suggests that either RG260
was not binding to the hTERT G4 or that the drug was binding
without significant change in the DMS footprinting pattern. If
the latter was the case, this suggests that the binding of the
two different drugs results in two different G4 folded products,
and only in the case of GTC365 is the WT folding pattern
changed in 5 mM KCl. At this point it became important to deter-
mine whether RG260 was binding to the hTERT G4, especially
since the DMS footprinting did not confirm this.
Tm and CD results (Figures S1B and S1C) support the idea that
RG260 is bound to the hTERT G4 and that the structure retains
two G4s, but the arrangement of the intervening G-runs (5–10)
was different in the two drug-bound species. Indeed G-runs
5–10 have distinctly different DMS footprinting patterns in the
presence of either GTC365 or RG260 (Figure 1C). This leads us
to suspect that G-runs 5–8 might form a similar heteroduplex
in the control and in the presence of RG260, but that in the pres-
ence of GTC365 G-runs 7–10 were utilized to form the heterodu-
plex. Furthermore, this suggests that while the origin of the 50 -G4
is the same for both GTC365 and RG260 (G-runs 1–4), the 30 -G4
is formed from G-runs 9–12 for RG260 or from G-runs 6–7 and
11–12 for GTC365. A critical structural difference between
GTC365 and RG260 is that GTC365 contains an acridine ring,
the G-tetrad binding moiety, while RG260 lacks this recognition
feature, which could be instrumental in defining the early inter-
mediates in the different folding pathways. Since the DMS foot-
1112 Cell Chemical Biology 26, 1110–1121, August 15, 2019
printing in 5 mM KCl buffer did not reveal any significant differ-
ence between the control and the RG260-bound species, we
explored the effect of different buffer conditions. In this regard
we were particularly interested in the effect of calcium ion on
the DMS footprinting pattern of the FL-G4 in the presence of
GTC365 and RG260, because calcium ion is known to stabilize
the G-triplex (Jiang et al., 2015), an intermediate that could
form in an early step during the formation of the stem loop
involving G-runs 5–8. Indeed, with a 100 mM CaCl2 buffer we
found that G-runs 6–8 showed a somewhat enhanced DMS
cleavage in the presence of RG260, whereas there was no signif-
icant change in DMS footprinting pattern by GTC365 compared
with the DMSO (Figure 1D). These results show that different
buffers (KCl versus CaCl2) result in different folding patterns,
and in the 100 mM CaCl2 buffer it is clearly demonstrated that
RG260 indeed binds to the hTERT G4. The enhanced DMS
cleavage in G-runs 6–8 in the presence of RG260 in 100 mM
CaCl2 buffer suggests this might be the binding site for the
BPU moiety of the RG260 compound, in contrast to G-runs
7–10 for the guanidino moiety of GTC365.
To evaluate whether this structural change of the hTERT G4
induced by RG260 affects hTERT promoter activity, we conduct-
ed a luciferase assay in human breast cancer MCF7 cells. RG260
reduced the luciferase activity in a dose-dependent manner by
25% at 2 mM, indicating that RG260 inhibited hTERT promoter
activity (Figure 1E). The effect on the telomerase activity by
RG260 was also evaluated by a modified telomeric repeat ampli-
fication protocol (TRAP) assay. As shown in Figure 1F, 72-h
treatment of RG260 decreased the telomerase activity in a
dose-dependent manner by 70% at 60 nM.
Determination of the Binding Site for RG260 Series
Compounds on the hTERT G4
To support the role of the BPU structure of RG260 for conforma-
tional change in the hairpin stem-loop structure, we set out to
design and synthesize new analogs (Figure 2A). We then deter-
mined the comparative effects of RG260 and other similar ana-
logs on hTERT mRNA expression and hTERT promoter lucif-
erase activity (Figures 2B and 2C). While RG1533 was inactive
in both assays, RG1534, RG1601, and RG1603 were more
potent than RG260. Likewise, in a cytotoxicity experiment using
human prostate cancer (PCa) PC3-LN4 cells, RG1533 was also
inactive (Figure 2D). We next designed a series of three different
size oligomers for FRET experiments with the objective of deter-
mining the drug-binding site for the RG260 series compounds. In
descending order of size they represented the heteroduplex plus
the 30 -G4 (42-mer), the full heteroduplex (31-mer), and what we
predicted would be the first intermediate in the folding pathway
(18-mer) (Figure 2E). The FRET measurements on RG260
and this series of analogs (RG1533, RG1534, RG1601, and
RG1603) are shown for each oligomer. The FRET measurement
is the average of the full set of equilibrating species in each
experiment. The results demonstrate that the 18-mer overall
shows the most significant reduction in FRET measurement
upon addition of the RG260 analogs, while the 31-mer interme-
diate and the 42-mer have the least reduction in FRET. The
most biologically active RG260 analogs (i.e., RG1603) show
the most potent effect on FRET with the shorter oligomers
(31-mer and 18-mer). This set of data suggests that the
Figure 2. Site-Specific Binding of Small Molecules with hTERT G4
(A) A series of compounds based on the initial hit RG260.
(B and C) Relative hTERT mRNA level change (B) and promoter activity change (C) by RG260 analogs. MCF7 cells were treated with 250 nM RG260 analogs for
48 h and then subjected to qRT-PCR. For luciferase assay, MCF7 cells were transfected with pGL3-hTERT construct and pRL-TK for 6 h and then treated with
500 nM RG260 analogs for 18 h.
(D) Dose-response effects of PC3-LN4 cells to RG260, RG1534, RG1601, RG1603, and RG1533 (72 h). Data are shown as mean ± SD of four replicates.
(E) Identification of G-runs 5–7 with 18-mer as a binding site of RG260 analogs by FRET assay. FRET probes with FAM and TAMRA at each end of oligomers were
annealed with compounds at an indicated concentration in a buffer containing 10 mM Na-cacodylate (pH 7.5) and 100 mM CaCl2 before the measurement of
fluorescence intensity of FAM. The relative fluorescence intensity was obtained compared with the DMSO sample.
(F and G) Determination of G-hairpin as a binding target of RG1603 (left) and dose-dependent FRET change (F). WT or a mutant with G-to-A of G-run 6 was
annealed with indicated concentration of RG1603 in a buffer containing 10 mM Na-cacodylate (pH 7.5) and 100 mM CaCl2 before the measurement of fluo-
rescence intensity of FAM (G).
(H) Annealed mixture of FAM-labeled 18-mer and RG1603 in a buffer including 100 mM CaCl2 was subjected to DMS footprinting. Image quality is a reflection of
the reduced intensity and partial cleavages.
Data are shown as mean ± SD of four replicates. p values (**p < 0.01, ***p < 0.001, ****p < 0.0001) were obtained by two-tailed t test. ns, not significant.

drug-binding site for the RG260 series is within the 18-mer, most
likely in proximity to the set of four G-G base pairs and the adja-
cent G-C base pair. To further define the binding site, we
mutated G-run 6 in the 18-mer, which is positioned at the top
of the hairpin. As expected, if this G-run is not involved directly
in the binding of RG1603, drug binding to the mutant sequence
still caused significant reduction of the FRET signal upon addi-
tion of RG1603, which was almost as much as the parent WT
sequence (Figure 2F). Furthermore, using the WT 18-mer
sequence, we demonstrated a dose dependency in reduction
of FRET signal upon addition of RG1603 (Figure 2G). To further
support the 18-mer as the drug-binding site for RG1603, we car-
ried out DMS footprinting. In a comparison of the gel lanes of the
treated versus non-treated samples, G-runs 5 and 7 that showed
the most change in extent of DMS cleavage, confirming that the
G-G base pairing along with the adjacent G-C base pair is the
site for drug occupancy (Figure 2H). Differential binding sites
and pathways for folding of the G-quadruplexes for RG1603
and GTC365 are illustrated in the diagram in Figure S2.
Overall, these results from DMS footprinting on the 18-mer,
together with the FRET studies on the RG260 analogs, strongly
suggest that RG260 only binds to the hairpin stem loop, and
this is sufficient to induce a folding of the 5–12 G4 to inhibit the
transcription of hTERT. However, in the absence of direct evi-
dence for the binding site, this conclusion must remain tentative.
Although attempts were made by nuclear magnetic resonance to
directly determine the binding site in the 18-mer hairpin, these
were unsuccessful due to the weak binding of these compounds.
Treatment of Prostate Cancer Cells with RG260 Results
in Selective Toxicity to Cells Expressing hTERT
Having identified RG260 as a downregulator of hTERT that
works by a mechanism similar to that of GTC365, we sought to
evaluate anticancer efficacy of RG260 focusing on PCa. The crit-
ical oncogenic function of TERT in PCa during tumorigenesis has
been demonstrated by others using genetically engineered
mouse knockin models inducing expression of TERT in normal
prostate epithelium (Hu et al., 2012). The RG260 activity was
characterized in a culture system using human PCa lines
including DU145, PC-3, and LNCaP, and mouse prostate epithe-
lial cancer (mPrEC) cells. Because the unique G4 DNA is present
in the core promoter region of human TERT but not in mouse
TERT, we hypothesized that RG260 possessed selectivity to-
ward human cancers. After exposure of RG260, morphological

Cell Chemical Biology 26, 1110–1121, August 15, 2019 1113

Figure 3. Selective Cytotoxicity of RG260 to hTERT-Expressing Prostate Cancer Cells
(A) Representative dose-response effects of human PCa cells (DU145, PC-3, and LNCaP) and mPrEC cells to RG260 (72 h of treatment). Data are shown as
mean ± SD of four replicates.
(B) The hTERT mRNA level in RWPE-1 cells and PC3-LN4 cells. qRT-PCR was conducted to obtain the relative mRNA level of hTERT to b-ACTIN. Additionally,
HK2, COXII, and MYC mRNA levels were compared.
(C) Cell viability of RWPE1-and PC3-LN4 cells after 72 h of treatment with RG260. Data are shown as mean ± SD of four replicates.
(D) Immunoblot analysis of cleavages of caspase-9 (Casp-9), caspase-3 (Casp-3), and PARP-1 in PCa cells following treatment with RG260.
(E) Relative telomere-length changes induced by RG260. Human PCa cells were treated with 0.1 mM RG260 for 72 h. Genomic DNA was extracted and then
subjected to qPCR. Ct values of telomeres were normalized to that of 36B4 (single copy gene) to obtain DCt (triplicates/group).
(F) Relative mRNA expression changes induced by RG260 were assessed by qPCR analysis. MCF7 cells were treated with 0, 0.13, 0.25, or 0.5 mM RG260 for 24 h.
****p < 0.001 compared to vehicle (0); ns, not significant.

examination and MTT assay showed cell death across all human
PCa lines tested, but not the mPrEC cells. These later cells were
resistant even after prolonged incubation (Figure 3A). Similarly,
the RWPE1 cell line, which is immortalized but does not express
elevated hTERT, was not growth inhibited by this compound
(Figures 3B and 3C). Previously reported telomerase-targeting
compounds, including BRACO-19 and BIBR1532 (Kleideiter
et al., 2007), exerting their effects through telomeric G4s or the
RNA component of the telomerase holoenzyme, showed acute
toxicity to hTERT-negative RWPE1 cells.
To characterize the antineoplastic effects of RG260 in
both DU145 and LNCaP cells, RG260 treatment in a dose-
dependent manner caused the cleavage of caspase-9
(Asp330), producing a p37 fragment that is known to amplify
the apoptotic response (Figure 3D). Cleaved caspase-9 led to
caspase-3 cleavage to trigger poly(ADP-ribose)polymerase-1
(PARP-1) cleavage. Next, we measured telomere length in cells
treated with RG260 using genomic DNA extracts by PCR ampli-
fication with oligonucleotide primers designed to hybridize to the
telomere repeats (Cawthon, 2002). RG260 treatment resulted in
significant reduction in telomere length in both DU145 and
LNCaP (Figure 3E). This change, followed by hTERT downregu-
lation, was not mediated by altering expression of c-MYC that
binds to the E-box of the hTERT promoter and contains G4 tet-
rads (Figure 3F). These results indicate that RG260 binding to the
heteroduplex loop, not the conserved tetrads, induces selectivity
toward cancer cells, resulting in downregulation of hTERT
expression and apoptotic cell death.
Synthetically Derived Analogs of RG260 Interacting with
the Hairpin Stem Loop in the hTERT G4 Element Induce
Apoptotic Cell Death Selectively in Cancer Cells without
Harming Normal Epithelial Cells
To improve the molecular properties of RG260 and achieve a
more bioavailable small-molecule drug, we synthesized RG260
analogs with the following considerations: molecular weight
(<500), cLogP (<4.0), PSA (<140 A2), and number of rotatable
bonds (<8). The design of analogs with varying groups at R1,
R2, and R3 resulted in compounds RG1534, RG1601, and
RG1603, and these analogs showed improved potency to inhibit
hTERT promoter activity (Figures 2A–2C). Because the MTT
assay after 72-h exposure to these analogs indicated that
RG1534 has superior effects on growth inhibition when
compared with RG1601 and RG260 (Figure 2D) and caused a
striking downregulation of hTERT expression and robust cleav-
age of caspase-9 and PARP-1, apoptotic markers, in PCa cells
(Figure S3A), pharmacokinetics studies were carried out
showing that both peak plasma concentration (Cmax) and area
under the plasma concentration curve (AUC) were proportional
to dose and increased in a roughly linear fashion (Figure S3B).
Using a subcutaneous mouse DU145 model, when RG1534
was dosed intraperitoneally (i.p.) every other day at 2 and

1114 Cell Chemical Biology 26, 1110–1121, August 15, 2019

Figure 4. Selective Cancer Cell Death Induced by RG1603
(A) Dose-response effects on proliferation of RG1603 after 72-h treatment of PCa cell lines and normal prostate epithelial RWPE-1 cells. Data are shown as
mean ± SD of four replicates.
(B) Immunoblot analysis of hTERT, p53, and p21 in PCa cells. Cells were treated with RG1534 for 24 h and total lysates were subjected to immunoblotting.
(C) hTERT mRNA levels change in response to RG1603 doses in DU145 and RWPE-1 cells. qRT-PCR was conducted to obtain the relative mRNA of hTERT to
b-ACTIN.
(legend continued on next page)

Cell Chemical Biology 26, 1110–1121, August 15, 2019 1115

5 mg/kg, RG1534 induced moderate tumor growth inhibition in a
dose-dependent manner (Figure S3C) without significant weight
loss (<5%). Treatment with RG1534 at 10 mg/kg (i.p., every other
day) induced complete response in all RG1534-treated animals.
However, weight loss was higher than 10% in all animals that
received this dose (Figure S3D).
Since RG1534 produced weight loss in animals and RG1603
showed a dose-dependent anticancer activity in a broad range
of PCa lines without killing normal prostate epithelial cells (Fig-
ure 4A), we next set out to evaluate RG1603 as an alternative
lead candidate. Regardless of p53 status in PCa cells, RG1603
increased p21 expression, a cell-cycle inhibitor, followed by
downregulation of hTERT expression (Figure 4B). Since metasta-
tic PCa harbor frequent mutations in p53 and loss of p53 causes
genomic instability and chemoresistance, RG1603 might be an
alternative option for treating metastatic PCa. Real-time qPCR
analysis showed downregulation of hTERT mRNA expression
by RG1603 in PCa cells (Figure 4C). To show whether the strong
growth-inhibitory effects of RG1603 were mediated through in-
duction of cell death, we stained cells with annexin V/7-AAD
(7-aminoactinomycin D) and subjected them to flow-cytometry
analysis. In these PCa cells, cells positive for annexin V/7-AAD
staining were increased with RG1603 treatment in a time-depen-
dent manner (Figure 4D). After RG1603 treatment, cleavage of
both caspase-3 and PARP-1 were also detected by immunoblot-
ting (Figure 4E). Consistent with this result, examination of cyto-
solic fraction from the cells treated with RG1603 showed an
increased cytochrome c level in cytosol (Figure 4F), a known
component of the electron transfer chain in mitochondria.
Once cytochrome c is released to cytosol, it binds to a partner
protein Apaf-1 and procaspase-9 to trigger apoptotic cell death
through caspase cleavages (Li et al., 1997; Song et al., 2003).
Collectively, our data indicated that RG1603 triggers apoptotic
cell death selectively in cancer cells while sparing normal cells.
Molecular Mechanism(s) By Which RG1603 Inhibits the
Survival and Growth of Prostate Cancer Cells
In addition to dysfunction and shortening of telomeres and DNA
damage, TERT knockout in mice causes mitochondrial dysfunc-
tion and elevated oxidative stress (Sahin et al., 2011). This result
suggests that the action of this hTERT promoter inhibitor could
also involve these specific pathways. RG1603 treatment mark-
edly downregulated the expression of peroxisome proliferator-
activated receptor-gamma coactivator alpha (PGC1a), a tran-
scription factor important for mitochondrial biogenesis, and
expression of NQO1 and HMOX1 (Figure 5A). The latter two pro-
teins are targets of the nuclear factor erythroid 2-related factor 2
(NRF2)-mediated antioxidant/electrophile-responsive element
(ARE/ERE) signaling. This result together with increased cyto-
chrome c release in RG1603-treated PCa cells suggests that
RG1603 triggers catastrophic damage to mitochondria.
Docetaxel (Taxotere) is the only chemotherapeutic agent used
to treat prostate cancer that extends life. However, every patient
(D) Time-dependent increase of annexin V binding by RG1603. Human prostate cancer DU145 and PC3-LN4 cells were treated with RG1603 for 24 and 48 h
before annexin V binding assay using flow cytometry.
(E) Immunoblot analysis of cleavages of caspase-3 (Casp-3) and PARP-1 in DU145 and LNCaP cells. Cells were treated with RG1603 for 24 h and total lysates
were subjected to immunoblotting.
(F) Immunoblot analysis of cytochrome c release in cytosolic fraction of cells from the treatment of (E).
1116 Cell Chemical Biology 26, 1110–1121, August 15, 2019
treated with this therapy eventually becomes resistant. To
explore whether the ability of RG1603 to damage mitochondria
and induce apoptosis can overcome specific chemoresistance,
we studied LNCaP cells induced to become Taxotere resistant
(Tx-R) by culturing in increased doses of this chemotherapeutic
agent (Domingo-Domenech et al., 2012; Vidal et al., 2015). Real-
time qPCR analysis confirmed that expression of hTERT mRNA
was increased in Tx-R cells (Figure S4), and these cells had
elevated expression of CK44 and CK9, previously identified
markers of Tx-R (Domingo-Domenech et al., 2012). Tx-R LNCaP
cells have increased expression in both HMOX1 and PGC1a
(Figure 5B) (Vidal et al., 2015) when compared with the WT con-
trol. As shown in Figure 5A, RG1603 treatment reversed the
PGC1a increase found in Tx-R cells. Similarly, expression of
NQO1 and HMOX1, two targets of the NRF2 transcription factor,
was also decreased by RG1603 treatment. To determine
whether NRF2 signaling is regulated by hTERT, we depleted
hTERT expression in PCa cells by the transduction of small inter-
fering RNA (siRNA). Depletion of hTERT expression led to down-
regulation of NRF2 as well as targets of NRF2, NQO1, and
HMOX1 (Figure 5C). NRF2 depletion inhibited both the survival
and growth of Tx-R cells, suggesting the importance of this tran-
scription factor to growth of these cells (Figure 5D). To examine
whether killing of Tx-R cells by RG1603 is mediated by inhibition
of cellular redox mechanisms, we examined the levels of pro-
teins controlling cellular redox, catalase, superoxide dismutase
1 (SOD1), and thioredoxin by immunoblotting. Expression of all
of these reactive oxygen species (ROS) scavengers was reduced
in cells treated with RG1603 (Figure 5E). In a similar fashion to the
results seen with the knockdown of hTERT, marked decreases in
expression of ROS scavengers was induced by RG1603 treat-
ment. This change would permit accumulation of oxidative
stress in the RG1603 treated cells (Sahin et al., 2011). Consistent
with the ability of this agent to decrease ROS scavenger pro-
teins, after RG1603 treatment MitoSox red staining demon-
strates that RG1603-mediated hTERT downregulation increases
mitochondrial superoxide anion production (Figure 5F). Similarly,
after RG1603 treatment 20 ,70 -dichlorodihydrofluorescein diace-
tate (H2DCF-DA) staining followed by flow analysis demon-
strates elevated levels of total cellular ROS (Figures 5G and
5F). The marked induction of g-H2AX expression by RG1603
treatment (Figure 5H), and the detection of cleavage products
of DNA fragmentation factor 45 (DFF45/ICAD) (Figure 5I) implies
that RG1603 is inducing cell death through inhibiting hTERT syn-
thesis, which in turn blocks mitochondrial function and leads to
oxidative DNA damage.
In Vivo Evaluation of Anticancer Efficacy and Safety of
RG1603 in a Tumor Xenograft Mouse Model
Following a single dose of RG1603 (25 mg/kg) by i.p. administra-
tion, plasma samples were collected to measure pharmacoki-
netics. The plasma concentration of RG1603 was maintained
at higher levels for 4 h and then gradually decreased by 12 h

(Figure 6A). Pharmacokinetics studies demonstrated that admin-
istration of 25 mg/kg RG1603 to mice produced peak plasma
drug concentrations of RG1603 of
8.4 mM, corresponding to
the doses that effectively killed PCa cells in culture. When en-
grafted DU145 tumors were grown on the flank of SCID mice
and reached a size of
150 mm3, mice were randomly assigned
to two groups: vehicle control and RG1603. Mice were then
treated with either vehicle or 25 mg/kg RG1603 (i.p., every other
Figure 5. Mechanism of Action Responsible
for RG1603-Induced Cell Death
(A and B) Immunoblot analysis of PGC1a, NQO1, and
HMOX1 expression in Taxotere-naive LNCaP cells
and Taxotere-resistant (Tx-R) cells. Cells were either
treated with RG1603 or 100 nM Taxotere for 24 h and
total lysates were subjected to immunoblotting.
(C) DU145 cells were transfected with scramble
control (si-C) or hTERT siRNAs. After 72 h, total ly-
sates were subjected to immunoblot analysis of
hTERT, NRF2, NQO1, and HMOX1.
(D) Representative images of crystal violet-stained
Tx-R cells expressing either short hairpin RNA
(shRNA) scramble control or shRNA NRF2. Cells
were infected with lentiviruses containing scramble
control or shNRF2 for 48 h and then further treated
with or without 1 mM RG1603 for 72 h.
(E) An immunoblot with the oxidative stress defense
western blot cocktail. Tx-R cells were treated with
DMSO or 1 mM RG1603 for 24 h and the resulting total
lysates were subjected to immunoblotting. Relative
changes of catalase (60 kDa), smooth muscle actin
(42 kDa), superoxide dismutase 1 (16 kDa), and thi-
oredoxin (12 kDa) are shown on the one blot.
Morphological cell death induced by RG1603 is de-
picted in phase-contrast images (Scale bar, 200 mm).
(F) Detection of superoxide anion and reactive ox-
ygen species (ROS). DU145 cells were treated with
DMSO or 0.3 mM RG1603 for 24 h and then stained
with MitoSox red or H2DCF-DA for 15 min prior to
flow-cytometry analysis. Number of events on the y-
axis of histogram is 200.
(G) Representative fluorescence images (Scale bar,
200 mm) of dichlorofluorescein (DCF) (ROS) and
nuclear (Hoechst 33342) staining in Taxotere-naive
and -resistant (Tx-R) cells at 0, 6, or 16 h treatment
with 0.3 mM RG1603. Relative fluorescent intensity
(RFI) was counted using a fluorescent microplate
reader (excitation wavelength at 485 nm and emis-
sion wavelength at 535 nm). Data are shown as
mean ± SD of triplicates.
(H and I) Immunoblot analysis of g-H2AX (S139) (H)
and DFF45 expression (I) in DU145, LNCaP, and
Tx-R cells. Cells were treated with RG1603 as
indicated for 24 h.
day) and tumor burden was evaluated for
21 days. RG1603 treatment caused signif-
icant growth inhibition of established PCa
tumors in in vivo xenografts (Figures 6B–
6D). Blood chemistry analyses including
alkaline phosphatase, alanine aminotrans-
ferase, blood urea nitrogen, glucose,
and total protein were not significantly
different between vehicle, RG1603 treat-
ment groups, and normal mice (Figure S5). Hematological pro-
files disclosed that the RG1603-treated group had a mild
hypochromia (two mice) or polychromasia (three mice). To verify
whether tumor suppression was the result of hTERT inhibition, at
the end of treatment we dissected tumor tissues from xenograft
mice and used them for preparation of tumor extracts and
immunohistochemistry (IHC) analysis. Immunoblot analysis of
tumor extracts revealed a striking decrease of hTERT expression
Cell Chemical Biology 26, 1110–1121, August 15, 2019 1117

in tumors of RG1603-treated mice (Figure 6E). Compared with
the tumors of control mice, reduced NRF2 signaling was
apparent in the tumors of mice treated with RG1603 as mirrored
by evidence of lower expression of HMOX1 and SOD2 ROS
scavengers. In treated animals, IHC analysis demonstrated
increased levels of 8-hydroxydeoxyguanosine (8-OH-dG), a
marker of oxidative damage, in mice receiving RG1603 treat-
ment when compared with controls (Figure 6F). In tumors from
RG1603-treated mice, IHC analysis with an antibody specific
for cleaved caspase-3 demonstrated increased staining while
decreased staining for the tumor proliferation antigen Ki67 was
1118 Cell Chemical Biology 26, 1110–1121, August 15, 2019
Figure 6. Pharmacokinetic Analysis and Effi-
cacy of RG1603 in Prostate Tumor Xenograft
Model
(A) Pharmacokinetic profile in mouse plasma after
single dose of 25 mg/kg RG1603 i.p.
(B) SCID mice implanted subcutaneously with
DU145 cells were treated every other day with either
vehicle or 25 mg/kg RG1603 i.p. for 21 days to
measure the effect on tumor growth. Data are shown
as mean ± SEM. Significant difference in tumor
volume (***p < 0.001; Student’s t test) at day 21
between RG1603-treated or vehicle-treated mice.
(C and D) Differences in tumor size and weight at the
endpoint of (B) treatments (vehicle versus RG1603).
Significant difference in tumor weight (***p < 0.001;
Student’s t test) at day 21 between RG1603-treated
and vehicle-treated mice.
(E) Immunoblot analysis of DU145 tumors from mice
treated with 25 mg/kg RG1603 at the times shown.
(F) Representative immunohistochemical staining
for H&E, Ki67, 8-ox-dG, and cleaved caspase-3 of
tumor tissues of (C).
evident, consistent with the induction of
apoptosis. Collectively, our results show
that the hTERT inhibitor RG1603 is capable
of inducing oxidative stress, DNA damage,
and tumor apoptosis.
DISCUSSION
Telomerase activation is a hallmark of can-
cer and a target for therapeutic interven-
tion. Despite extensive studies and clinical
trials, only moderate clinical success has
been reported. Telomerase inhibition to
date requires proliferating cells over multi-
ple population doublings to induce tumor-
suppressive effects. However, long-term
telomerase inhibition may have undesir-
able effects on normal stem cells and pro-
genitor cells, which need telomerase for
survival (Hiyama and Hiyama, 2007).
hTERT, the catalytic subunit of telome-
rase, synthesizes the new telomeric DNA
from the RNA template hTR (Lai et al.,
2001; Lingner et al., 1997). While hTR is
ubiquitously expressed across cancer
and normal tissues (Yan et al., 2001),
hTERT expression is upregulated in the vast majority of cancers
including cervical carcinomas, hepatocellular carcinoma, lung,
breast carcinomas, and neuroblastomas but not in normal cells,
suggesting that there would be minimal side effects on normal
cells. Moreover, recent studies in glioblastoma, melanoma,
and bladder cancer indicated that promoter mutations or un-
usual epigenetic changes can promote constitutive activation
of hTERT (Borah et al., 2015; Horn et al., 2013; Killela et al.,
2013). Somatic mutations such as cytosine to thymine or gua-
nine to adenine mutations were shown to increase hTERT
expression and telomerase activity (Horn et al., 2013). These
mutations all occur in a G-rich region of the hTERT promoter,
which has previously been shown to form quadruplex DNA.
These mutations abrogate the G4-folding process and result in
aberrant activation of hTERT (Kang et al., 2016), suggesting a
negative function of G4 structure on hTERT promoter activity.
To avoid the toxicity associated with binding in a non-specific
manner with the external tetrads in G4s, which are widespread
through the human genome, we attempted to identify com-
pounds that lack the tetrad-binding moiety but still retain the
hairpin stem-loop binding properties. These compounds, exem-
plified by RG1603, still retain the ability to facilitate the coopera-
tive folding process leading to the silencer element in the hTERT
promoter. Thus, this approach differs radically from those previ-
ously used to target G4s because it does not rely on binding to
the core G4 structure.
RG260 and the related series of compounds described in this
contribution did not produce the same G4-folding pattern as
GTC365 in 5 mM KCl buffer. In contrast to GTC365, this new se-
ries of compounds appears to produce a folding pattern
mimicking that found naturally in the WT sequence. However,
this depends upon the buffer conditions. In 5 mM KCl buffer
DMS footprinting reveals that RG260 forms a folded form similar
to that in the control, while GTC365 forms a different folded
structure. In contrast, in CaCl2 buffer the GTC365 and control
form the same folded structure, but RG260 forms a different
folded species. The origin of the differently induced folding pat-
terns produced by the GTC365 and RG260 series of compounds
is most probably due to their initial binding interactions with the
G4-forming units or the hairpin loop, which contains multiple
G-runs that can form intermediate species such as G-triplexes
(Jiang et al., 2015). In the 5 mM KCl buffer, while RG260 binds
to the top of the hairpin loop, which is the earliest intermediate
in the folding process and thus appears to mimic the natural
folding pathway, GTC365 may bind at an artificially induced
step, which may involve preferential stabilization of the G4s
due to the presence of the acridine moiety of GTC365. In
CaCl2 buffer the intermediates in the folding pathway, such as
G-triplexes, are stabilized in the loop region. RG260 more favor-
ably binds to these early intermediates in the loop region,
whereas the presence of GTC365 favors the early folding of
the 30 -G4 and its stabilization by the acridine moiety. The differ-
ence between the two series of compounds is the presence of an
acridine G-tetrad binding moiety present solely in GTC365. The
presence of this moiety may facilitate the formation of the sec-
ond G4 using G-runs 5 and 6 alongside 11 and 12 prior to allow-
ing the hairpin to form from G-runs 7 to 10. The transcription acti-
vation of hTERT produced by the somatic mutations at 124 and
146 (G to A) can be explained by the generation of new binding
sites for GABP at the duplex level (Mancini et al., 2018). Further-
more, both these mutations and those at 124/125 and 138/
139 (GG to AA) would also be expected to compromise the natu-
rally occurring folding pathway involving such intermediates as
shown in Figure 2E, which would also lead to overexpression
of hTERT. It is intriguing and perhaps not coincidental that the
pairs of mutations at 124/125 and 138/139 are directly oppo-
site each other in the hairpin, in contrast to the less obvious mu-
tation pattern found in the hTERT G4-folding pattern induced by
GTC365. We believe that we have uncovered a DNA-folding pro-
cess that mimics RNA riboswitches, with the RGT365 and
RG260 series of compounds acting as small-molecule chaper-
ones at the initial stages of the folding process (Dethoff et al.,
2012). In this study we found that RG1603 decreased hTERT
mRNA expression and induced apoptotic cell death prior to telo-
mere shortening, which is consistent with observation by others
that hTERT loss triggers dysfunctional DNA capping. In contrast
to robust cell death in PCa cells, normal human prostate epithe-
lial RWPE-1 cells deficient in hTERT expression (Huang et al.,
2008) were insensitive to RG1603. Moreover, no growth-inhibi-
tory activity of RG1603 was observed in mouse tumor cells,
which have a lack of G4 stem loop in mouse TERT promoter.
In contrast to previous generations of G4 molecules targeting
the telomeric G4s, which exhibited acute toxicities regardless
of cell type, the improved specificity of RG1603 on the target,
while sparing normal cells, is highly desirable for the develop-
ment of clinically useful anticancer therapeutics.
Mechanistically, it is not well understood how enhancing the
hTERT G4 DNA cooperative folding process triggers apoptotic
cell death. RNAi-mediated hTERT knockdown resulted in sup-
pression of tumor cell growth and induced a variable degree of
programmed cell death prior to telomere shortening (Oliver
et al., 2017; Shen et al., 2008). These results suggest that the
hTERT enzyme has telomerase-independent activity. hTERT
was previously shown to regulate pro-survival Bcl-2 expression,
preventing mitochondrial apoptosis (Del Bufalo et al., 2005).
Mitochondrial localization of hTERT has also been associated
with oxidative stress (Singhapol et al., 2013). To understand
how hTERT promoter control regulates mitochondrial function
we examined two transcription factors, NRF2 and PGC1a,
both important to mitochondrial function and implicated in
oxidative stress regulation (Dinkova-Kostova and Abramov,
2015; Valle et al., 2005). We showed that RG1603 decreased
NRF2 expression and the expression of its transcription target
HMOX1. siRNA-mediated depletion of hTERT expression also
resulted in inhibition of NRF2 and HMOX1 expression. In our
study, DNA damage as shown by g-H2AX induction and DNA
fragmentation by RG1603 coincided with PGC1a inhibition. De-
creases in the level of NRF2 and PGC1a by RG1603 resulted in
generation of ROS, leading to mitochondrial damage and cell
death. Similarly, a previous study found that hTERT-induced
cisplatin resistance in osteosarcoma cells was associated with
an increased glutathione antioxidant defense that functioned to
reduce the ROS level (Indran et al., 2011; Zhang et al., 2017b).
In conclusion, small-molecule targeting of the cooperative
folding process in the hTERT G4 promoter element produces
telomerase-independent events, which impair mitochondrial
processes and result in oxidative stress and inhibition of prostate
cancer cell growth.
SIGNIFICANCE
We have identified small molecules targeting the unique
hTERT G4 stem loop but not tetrad DNAs, which increases
the selectivity toward hTERT DNA. These drugs act as phar-
macological chaperones facilitating the cooperative folding
of the G4 silencer element rather than acting by stabilizing
the core G4 structure. The ability of RG1603 to selectively
kill human cancer cells while sparing normal epithelial cells
demonstrates for the first time in vivo anticancer efficacy of
Cell Chemical Biology 26, 1110–1121, August 15, 2019 1119
an hTERT G4-targeting small molecule. Importantly, using REFERENCES
these drugs we uncovered the role of hTERT in NRF2 and
Blasco, M.A., and Hahn, W.C. (2003). Evolving views of telomerase and can-
PGC1a regulation of redox signaling and DNA-damage
cer. Trends Cell Biol. 13, 289–294.
response. The potential use of hTERT inhibitory following
Bochman, M.L., Paeschke, K., and Zakian, V.A. (2012). DNA secondary struc-
Tx-R of prostate cancer may provide an alternative thera-
tures: stability and function of G-quadruplex structures. Nat. Rev. Genet. 13,
peutic option to overcome tumor resistance. 770–780.
Borah, S., Xi, L., Zaug, A.J., Powell, N.M., Dancik, G.M., Cohen, S.B., Costello,
STAR+METHODS J.C., Theodorescu, D., and Cech, T.R. (2015). Cancer. TERT promoter muta-
tions and telomerase reactivation in urothelial cancer. Science 347,
Detailed methods are provided in the online version of this paper 1006–1010.
and include the following: Bugaut, A., Rodriguez, R., Kumari, S., Hsu, S.T., and Balasubramanian, S.
(2010). Small molecule-mediated inhibition of translation by targeting a native
d KEY RESOURCES TABLE RNA G-quadruplex. Org. Biomol. Chem. 8, 2771–2776.
d CONTACT FOR REAGENT AND RESOURCE SHARING Burger, A.M., Dai, F., Schultes, C.M., Reszka, A.P., Moore, M.J., Double, J.A.,
d EXPERIMENTAL MODEL AND SUBJECT DETAILS and Neidle, S. (2005). The G-quadruplex-interactive molecule BRACO-19 in-
B Cell Lines hibits tumor growth, consistent with telomere targeting and interference with
B Animal Studies telomerase function. Cancer Res. 65, 1489–1496.
d METHOD DETAILS Cawthon, R.M. (2002). Telomere measurement by quantitative PCR. Nucleic
B FRET Assay Acids Res. 30, e47.
B DMS Footprinting Del Bufalo, D., Rizzo, A., Trisciuoglio, D., Cardinali, G., Torrisi, M.R.,
B Luciferase Assay Zangemeister-Wittke, U., Zupi, G., and Biroccio, A. (2005). Involvement of
hTERT in apoptosis induced by interference with Bcl-2 expression and func-
B Circular Dichroism (CD) Analysis
tion. Cell Death Differ. 12, 1429–1438.
B Gene Transduction
Dethoff, E.A., Chugh, J., Mustoe, A.M., and Al-Hashimi, H.M. (2012).
B Cell Proliferation and Apoptosis Assays
Functional complexity and regulation through RNA dynamics. Nature 482,
B Immunoblotting 322–330.
B Immunofluorescence and Immunohistochemistry
Dinkova-Kostova, A.T., and Abramov, A.Y. (2015). The emerging role of Nrf2 in
B Measurements of Telomere Length and Telomerase mitochondrial function. Free Radic. Biol. Med. 88, 179–188.
Enzyme Activity
Domingo-Domenech, J., Vidal, S.J., Rodriguez-Bravo, V., Castillo-Martin, M.,
B Real-Time PCR Analysis Quinn, S.A., Rodriguez-Barrueco, R., Bonal, D.M., Charytonowicz, E.,
B Synthesis of RG260 Analogs Gladoun, N., de la Iglesia-Vicente, J., et al. (2012). Suppression of acquired do-
B In Vivo Studies cetaxel resistance in prostate cancer through depletion of notch- and hedge-
d QUANTIFICATION AND STATISTICAL ANALYSIS hog-dependent tumor-initiating cells. Cancer Cell 22, 373–388.
d DATA AND SOFTWARE AVAILABILITY Harley, C.B., Kim, N.W., Prowse, K.R., Weinrich, S.L., Hirsch, K.S., West, M.D.,
Bacchetti, S., Hirte, H.W., Counter, C.M., Greider, C.W., et al. (1994).
Telomerase, cell immortality, and cancer. Cold Spring Harb. Symp. Quant.
SUPPLEMENTAL INFORMATION
Biol. 59, 307–315.
Supplemental Information can be found online at https://doi.org/10.1016/j. Hiyama, E., and Hiyama, K. (2007). Telomere and telomerase in stem cells. Br.
chembiol.2019.04.009. J. Cancer 96, 1020–1024.
Horn, S., Figl, A., Rachakonda, P.S., Fischer, C., Sucker, A., Gast, A., Kadel,
ACKNOWLEDGMENTS S., Moll, I., Nagore, E., Hemminki, K., et al. (2013). TERT promoter mutations
in familial and sporadic melanoma. Science 339, 959–961.
The UACC Shared Resources provided support for histological and tissue Hu, J., Hwang, S.S., Liesa, M., Gan, B., Sahin, E., Jaskelioff, M., Ding, Z., Ying,
staining, flow-cytometry analysis, and analytical chemistry. This study was H., Boutin, A.T., Zhang, H., et al. (2012). Antitelomerase therapy provokes ALT
supported by the University of Arizona Cancer Center support grant NIH and mitochondrial adaptive mechanisms in cancer. Cell 148, 651–663.
P30CA023074, NIH award R01CA173200, and DOD award W81XWH-12-1-
Huang, P., Watanabe, M., Kaku, H., Kashiwakura, Y., Chen, J., Saika, T., Nasu,
0560 (to A.S.K.), and by NIH awards R01CA177585 and R41CA224497, and
Y., Fujiwara, T., Urata, Y., and Kumon, H. (2008). Direct and distant antitumor
Reglagene (to L.H.H.).
effects of a telomerase-selective oncolytic adenoviral agent, OBP-301, in a
mouse prostate cancer model. Cancer Gene Ther. 15, 315–322.
AUTHOR CONTRIBUTIONS
Indran, I.R., Hande, M.P., and Pervaiz, S. (2011). hTERT overexpression alle-
Conceptualization, J.H.S., L.H.H., and A.S.K.; Methodology, Analysis, and viates intracellular ROS production, improves mitochondrial function, and in-
Investigation, J.H.S., L.A.L., H.-J.K., V.G., R.P., K.W., and H.-H.S.C.; Writing, hibits ROS-mediated apoptosis in cancer cells. Cancer Res. 71, 266–276.
J.H.S., L.H.H., and A.S.K. Jiang, H.X., Cui, Y., Zhao, T., Fu, H.W., Koirala, D., Punnoose, J.A., Kong,
D.M., and Mao, H. (2015). Divalent cations and molecular crowding buffers
DECLARATION OF INTERESTS stabilize G-triplex at physiologically relevant temperatures. Sci. Rep. 5, 9255.

V.G., H.-J.K., and L.H.H. are a shareholder, an employee, and CSO, respec- Kang, H.J., Cui, Y., Yin, H., Scheid, A., Hendricks, W.P., Schmidt, J., Sekulic,
tively, of Reglagene, LLC. A., Kong, D., Trent, J.M., Gokhale, V., et al. (2016). A pharmacological chap-
erone molecule induces cancer cell death by restoring tertiary DNA structures
Received: June 29, 2018 in mutant hTERT promoters. J. Am. Chem. Soc. 138, 13673–13692.
Revised: January 28, 2019 Killela, P.J., Reitman, Z.J., Jiao, Y., Bettegowda, C., Agrawal, N., Diaz, L.A.,
Accepted: April 16, 2019 Jr., Friedman, A.H., Friedman, H., Gallia, G.L., Giovanella, B.C., et al. (2013).
Published: May 30, 2019 TERT promoter mutations occur frequently in gliomas and a subset of tumors

1120 Cell Chemical Biology 26, 1110–1121, August 15, 2019

derived from cells with low rates of self-renewal. Proc. Natl. Acad. Sci. U S A
110, 6021–6026.
Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L.,
Coviello, G.M., Wright, W.E., Weinrich, S.L., and Shay, J.W. (1994). Specific
association of human telomerase activity with immortal cells and cancer.
Science 266, 2011–2015.
Kleideiter, E., Piotrowska, K., and Klotz, U. (2007). Screening of telomerase in-
hibitors. Methods Mol. Biol. 405, 167–180.
Lai, C.K., Mitchell, J.R., and Collins, K. (2001). RNA binding domain of telome-
rase reverse transcriptase. Mol. Cell. Biol. 21, 990–1000.
Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S.,
and Wang, X. (1997). Cytochrome c and dATP-dependent formation of Apaf-1/
caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489.
Lingner, J., Hughes, T.R., Shevchenko, A., Mann, M., Lundblad, V., and Cech,
T.R. (1997). Reverse transcriptase motifs in the catalytic subunit of telomerase.
Science 276, 561–567.
Mancini, A., Xavier-Magalhaes, A., Woods, W.S., Nguyen, K.T., Amen, A.M.,
Hayes, J.L., Fellmann, C., Gapinske, M., McKinney, A.M., Hong, C., et al.
(2018). Disruption of the beta1L isoform of GABP reverses glioblastoma repli-
cative immortality in a TERT promoter mutation-dependent manner. Cancer
Cell 34, 513–528.e8.
Nugent, C.I., and Lundblad, V. (1998). The telomerase reverse transcriptase:
components and regulation. Genes Dev. 12, 1073–1085.
Oliver, D., Ji, H., Liu, P., Gasparian, A., Gardiner, E., Lee, S., Zenteno, A.,
Perinskaya, L.O., Chen, M., Buckhaults, P., et al. (2017). Identification of novel
cancer therapeutic targets using a designed and pooled shRNA library screen.
Sci. Rep. 7, 43023.
Palumbo, S.L., Ebbinghaus, S.W., and Hurley, L.H. (2009). Formation of a
unique end-to-end stacked pair of G-quadruplexes in the hTERT core pro-
moter with implications for inhibition of telomerase by G-quadruplex-interac-
tive ligands. J. Am. Chem. Soc. 131, 10878–10891.
Pettaway, C.A., Pathak, S., Greene, G., Ramirez, E., Wilson, M.R., Killion, J.J.,
and Fidler, I.J. (1996). Selection of highly metastatic variants of different human
prostatic carcinomas using orthotopic implantation in nude mice. Clin. Cancer
Res. 2, 1627–1636.
Sahin, E., Colla, S., Liesa, M., Moslehi, J., Muller, F.L., Guo, M., Cooper, M.,
Kotton, D., Fabian, A.J., Walkey, C., et al. (2011). Telomere dysfunction in-
duces metabolic and mitochondrial compromise. Nature 470, 359–365.
Shen, Y., Zhang, Y.W., Zhang, Z.X., Miao, Z.H., and Ding, J. (2008). hTERT-tar-
geted RNA interference inhibits tumorigenicity and motility of HCT116 cells.
Cancer Biol. Ther. 7, 228–236.
Singhapol, C., Pal, D., Czapiewski, R., Porika, M., Nelson, G., and Saretzki,
G.C. (2013). Mitochondrial telomerase protects cancer cells from nuclear
DNA damage and apoptosis. PLoS One 8, e52989.
Song, J.H., An, N., Chatterjee, S., Kistner-Griffin, E., Mahajan, S., Mehrotra, S.,
and Kraft, A.S. (2015). Deletion of Pim kinases elevates the cellular levels of
reactive oxygen species and sensitizes to K-Ras-induced cell killing.
Oncogene 34, 3728–3736.
Song, J.H., and Kraft, A.S. (2012). Pim kinase inhibitors sensitize prostate can-
cer cells to apoptosis triggered by Bcl-2 family inhibitor ABT-737. Cancer Res.
72, 294–303.
Song, J.H., Padi, S.K., Luevano, L.A., Minden, M.D., DeAngelo, D.J.,
Hardiman, G., Ball, L.E., Warfel, N.A., and Kraft, A.S. (2016). Insulin receptor
substrate 1 is a substrate of the Pim protein kinases. Oncotarget 7,
20152–20165.
Song, J.H., Song, D.K., Pyrzynska, B., Petruk, K.C., Van Meir, E.G., and Hao,
C. (2003). TRAIL triggers apoptosis in human malignant glioma cells through
extrinsic and intrinsic pathways. Brain Pathol. 13, 539–553.
Sun, H., Wang, Y., Chinnam, M., Zhang, X., Hayward, S.W., Foster, B.A.,
Nikitin, A.Y., Wills, M., and Goodrich, D.W. (2011). E2f binding-deficient Rb1
protein suppresses prostate tumor progression in vivo. Proc. Natl. Acad.
Sci. U S A 108, 704–709.
Valle, I., Alvarez-Barrientos, A., Arza, E., Lamas, S., and Monsalve, M. (2005).
PGC-1alpha regulates the mitochondrial antioxidant defense system in
vascular endothelial cells. Cardiovasc. Res. 66, 562–573.
Vidal, S.J., Rodriguez-Bravo, V., Quinn, S.A., Rodriguez-Barrueco, R.,
Lujambio, A., Williams, E., Sun, X., de la Iglesia-Vicente, J., Lee, A.,
Readhead, B., et al. (2015). A targetable GATA2-IGF2 axis confers aggressive-
ness in lethal prostate cancer. Cancer Cell 27, 223–239.
Wellinger, R.J., Ethier, K., Labrecque, P., and Zakian, V.A. (1996). Evidence for
a new step in telomere maintenance. Cell 85, 423–433.
Yan, P., Saraga, E.P., Bouzourene, H., Bosman, F.T., and Benhattar, J. (2001).
Expression of telomerase genes correlates with telomerase activity in human
colorectal carcinogenesis. J. Pathol. 193, 21–26.
Yu, Z., Gaerig, V., Cui, Y., Kang, H., Gokhale, V., Zhao, Y., Hurley, L.H., and
Mao, H. (2012). Tertiary DNA structure in the single-stranded hTERT promoter
fragment unfolds and refolds by parallel pathways via cooperative or sequen-
tial events. J. Am. Chem. Soc. 134, 5157–5164.
Zhang, L., Tan, W., Zhou, J., Xu, M., and Yuan, G. (2017a). Investigation of G-
quadruplex formation in the FGFR2 promoter region and its transcriptional
regulation by liensinine. Biochim. Biophys. Acta 1861, 884–891.
Zhang, Z., Yu, L., Dai, G., Xia, K., Liu, G., Song, Q., Tao, C., Gao, T., and Guo,
W. (2017b). Telomerase reverse transcriptase promotes chemoresistance by
suppressing cisplatin-dependent apoptosis in osteosarcoma cells. Sci. Rep.
7, 7070.
Cell Chemical Biology 26, 1110–1121, August 15, 2019 1121
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
See Table S1.
Chemicals, Peptides, and Recombinant Proteins
MitoSox Red Invitrogen Cat# M36008
CM-H2DCF-DA Invitrogen Cat# C6827
Thiazolyl blue tetrazolium bromide Sigma-Aldrich Cat# M5655
RG260 (NSC654260) NCI https://wiki.nci.nih.gov/display/NCIDTPdata/
Compound+Sets
RG1534 This paper N/A
RG1603 This paper N/A
RG1601 This paper N/A
RG1533 This paper N/A
Experimental Models: Cell Lines
Human Prostate cancer PC-3 ATCC Cat# ATCC CRL-1435
Human Prostate cancer DU145 ATCC Cat# ATCC HTB81
Human Prostate cancer LNCaP ATCC Cat# ATCC CRL-1740
Human Prostate cancer PC3-LN4 The University of Texas N/A
M. D. Anderson Cancer
Center (Pettaway et al., 1996)
Human prostate epithelial RWPE1 ATCC Cat# ATCC-CRL-11609
Human breast cancer MCF7 ATCC Cat# ATCC-HTB-22
HEK293T Dharmacon Cat# HCL4517
Mouse prostate epithelial cancer cells Roswell Park Cancer Center N/A
Experimental Models: Organisms/Strains
Tx-R LNCaP cells This paper N/A
hTERT luciferase expressing MCF7 cells (Kang et al., 2016) N/A
Oligonucleotides
Oligonucleotides used in DMS footprinting and FRET (see Table S2)
Primers for real time PCR (see Table S3)
ON-TARGETplus Human TERT (7015) siRNA Dharmacon Cat# L-003547-00-0005
ON-TARGETplus Non-targeting Pool siRNA Dharmacon Cat# D-001810-10-05
Recombinant DNA
pLKO human shRNA NFE2L2 Dharmacon Cat# RHS3979-201739828
TRC Lentiviral Non-targeting shRNA Control Dharmacon Cat. #RHS6848
VSV-G Addgene Cat# 8454
psPAX2 Addgene Cat# 12260
Software and Algorithms
Microsoft Office 365 Excel Microsoft https://www.office.com/
GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-
software/prism/

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Jin H
Song (jinsong@email.arizona.edu).

e1 Cell Chemical Biology 26, 1110–1121.e1–e4, August 15, 2019

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell Lines
The human prostate cancer cell lines LNCaP, PC-3, DU145 (ATCC), and PC-3LN4 were cultured as previously described (Pettaway
et al., 1996; Song and Kraft, 2012; Song et al., 2016). RWPE1 cells (ATCC) were maintained in keratinocyte medium supplemented
with 5 ng/mL human recombinant epidermal growth factor and 0.05 mg/mL bovine pituitary extract (Invitrogen). Mouse prostate
epithelial cells were grown in DMEM medium supplemented with 2.5% charcoal stripped FCS, 5 mg/mL of insulin/transferring/sele-
nium, 10 mg/mL of bovine pituitary extract, 10 mg/mL of epidermal growth factor, 1 mg/mL of cholera toxin as described previously
(Sun et al., 2011). HEK293T cells were cultured in 10% FBS-containing DMEM. MCF7 cells were cultured in RPMI-1640 with 10%
FBS and 1% penicillin/streptomycin. All cell lines were maintained at 37 C in 5 % CO2 and were authenticated by short tandem
repeat DNA profiling performed by the University of Arizona Genetics Core Facility. The cell lines were routinely tested for myco-
plasma and used for fewer than 50 passages.

Animal Studies
All in vivo studies were approved by and conducted in accordance with the guidelines of the Institutional Animal Care and Use Com-
mittees at the University of Arizona Cancer Center. Male SCID immune-deficient mice (C.B-Igh-1b/IcrTac-Prkdcscid) were purchased
from Taconic Laboratories and maintained by the Experimental Mouse Shared Resource in an ABSL-2 immunodeficient animal hous-
ing facility at University of Arizona. Mice of 8 weeks old were randomly assigned to treatment groups. For the pharmacokinetics
study, male FVB/NJ mice were purchased from The Jackson Laboratory (stock number #001800).

METHOD DETAILS

FRET Assay
FRET assay for compound screening and FRET probe of the 512 G4 were reported previously (Kang et al., 2016). For the FRET
assay in this study, FRET probes with FAM (Ex. 490 nm/Em. 520 nm) and TAMRA (Ex. 560 nm/Em. 580 nm) at each end were
synthesized and HPLC purified by MGW Operon Inc (sequences are provided in Table S2).
The FRET probes (100 nM) were annealed in a buffer containing 10 mM Na-cacodylate (pH 7.5) and 100 mM CaCl2 with DMSO or
compounds by heating at 95 C for 30 s and then cooled down for 1–2 min at room temperature. The fluorescence intensity at 528 nm
with excitation at 485 nm was measured by a microplate reader (BioTek Synergy HT). The data were corrected with the blank signal of
buffer and compound, and the relative fluorescence intensity compared to DMSO was obtained.

DMS Footprinting
FAM-labeled oligomers with full-length and 18-nt were synthesized by MGW Operon Inc. and PAGE purified. Sequences are provided
in Table S2. These oligomers (250 nM) and 5 mM/L of compounds were dissolved in a buffer containing 10 mM Na-cacodylate (pH 7.5),
and 5 mM KCl or 100 mM CaCl2. The mixtures were annealed by heating at 95 C for 30 s and then cooled down for 1–2 min at room
temperature. For the DMS reaction, annealed samples were incubated with 2 mg of salmon sperm DNA (Sigma, D1626) and 5% DMS in
50% ethanol for 8 min for full-length and 5 min for 18-nt, respectively, at room temperature. The reaction was stopped by 10% of b-mer-
captoethanol and then subjected to ethanol precipitation and cleavage by 10% piperidine with incubation at 93 C for 12 min. Cleaved
product was washed twice by water and then separated by 15% denaturing PAGE with 7 M urea. Fluorescent bands were scanned by
Bio-Rad PharosFX Plus.

Luciferase Assay
The pGL3 luciferase constructs used in a previous publication (Kang et al., 2016) were used for this study. MCF7 cells in a 24-well
plate were incubated with serum-free RPMI-1640 and then transfected with 200 ng of pGL3 construct and 5 ng of pRL-TK by
FuGENE HD or Lipofectamine 3000 and then incubated for 6 h. After replacing media by RPMI-1640 with 10% FBS, cells were
treated with 0.1% DMSO or indicated concentrations of compounds. After 18 h of incubation, cells were lysed by passive lysis buffer
and subjected to dual-luciferase assay (Promega, #E1910) using an FB12 luminometer or GloMax 20/20 Luminometer (Promega).
Relative ratio of firefly to renilla luciferase activity compared to the DMSO was obtained. Each experiment was performed in
quadruplicate.

Circular Dichroism (CD) Analysis

The WT 5–12 G4-forming oligomer was synthesized and HPSF-purified by MWG Operon, Inc. The concentration of oligomers dis-
solved in deionized water was determined by the Lambert–Beer law using molecular extinction coefficient, 463,850 L (mol*cm).
For CD analysis, the oligomers (5 mM) in a buffer containing 10 mM Tris-HCl (pH 6.8 or pH 7.5) with 5 mM KCl were heated at
95 C for 5 min and then cooled at room temperature. After 1–2 h of incubation of annealed oligomers with DMSO or RG260, samples
were subjected to CD spectra and melting analysis using a Jasco 810 spectropolarimeter with parameters of 2 nm band width and a
rate of 1.6 C/min. The spectra of oligomers were corrected by subtraction of the spectra of buffer with DMSO or RG260. Tm was
determined by sigmoidal curve fitting of a melting curve using GraphPad Prism software.

Cell Chemical Biology 26, 1110–1121.e1–e4, August 15, 2019 e2

Gene Transduction
Cells were transfected with SMARTpool: ON-TARGETplus TERT siRNA (Dharmacon) using lipofectamine 3000 (Thermo Fisher Sci-
entific) as previously described (Song et al., 2015, 2016). To knock down expression of NRF2, short hairpin RNAs against human
NRF2 (TRC gene set 7555) and TRC lentiviral non-targeting shRNA control were purchased from Dharmacon. Lentiviruses were pro-
duced in 293T cells coexpressing the packaging vectors (pPAX2 and VSVG), concentrated by ultracentrifugation (20,000 g for 2 h at
4 C), and resuspended with culture media for 48 h infection.

Cell Proliferation and Apoptosis Assays

Cells were seeded in 96-well plates and treated with drugs as indicated. At the end of treatment, the medium was removed gently and
the cells were washed once with 200 ml of PBS, then 100 ml of medium containing MTT assay solution (1 mg/mL thiazolyl blue tetra-
zolium bromide, Sigma Cat# M5655) was added to each well. The plates were placed in a water-jacketed incubator at 37 C for 2 h
and then MTT containing medium was removed. The color development was monitored by addition of 100 ml of DMSO to each well
prior to absorbance reading at 490 nm using the microplate reader (Spectra Max 190, Molecular Devices). Each drug treatment was
performed in quadruplicate and verified in three independent experiments. Apoptotic cells were quantitated by flow cytometry using
PE Annexin V Apoptosis Detection kit 1 (BD Pharmingen, Catalog # 559763).

Immunoblotting
Cells were lysed in RIPA buffer (50 mmol/L Tris-HCl pH 7.4, 150 mmol/L NaCl, 0.5 % sodium deoxycholate, 0.1 % SDS, 1% NP-40,
5 mmol/L EDTA) supplemented with complete protease/phosphatase inhibitor cocktail (Cell Signaling Cat# 5872S). After centrifuga-
tion (15,000 g for 15 min at 4 C), aliquots of total lystates were subjected to SDS-PAGE as described previously (Song et al., 2015).
The antibodies were listed in Table S1.

Immunofluorescence and Immunohistochemistry

Staining with MitoSox Red and H2DCF-DA followed by flow cytometry was as previously described (Song et al., 2015). Phase
contrast and fluorescence images were taken with EVOS FL Auto (Bio-Rad). Immunohistochemical staining of tumors tissues
were performed with anti-8-ox-dG (Trevigen, Cat # 4354-MC-050), cleaved caapse-3 (Cell Signaling, Cat # 9661) and Ki67 (Leica,
Cat # NCL-L-Ki67-MM1) antibodies. Hematoxylin 560 MX (Leica Biosystems, Cat # 3801575) and Eosin Phloxine 515 (Leica Bio-
systems, Cat# 3801606) were used for H&E staining.

Measurements of Telomere Length and Telomerase Enzyme Activity

To measure telomere length in cells, genomic DNA (gDNA) was extracted with DNA extraction kit (Qiagen). A pair of Tel1
(GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT) and Tel2 (TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA)
primers was used for amplification of the telomere region and a pair of 36B4F (CAGCAAGTGGGAAGGTGTAATCC) and 36B4R
(CCCATTCTATCATCAACGGGTACAA) primers for amplification of a single-copy gene to normalize data. The PCR was initiated at
95 C for 3 min and then 27 cycles at 95 C for 3 s and 60 C for 2 min. The fluorescence signal at 60 C was acquired. Triplicate
data were averaged and normalized to 36B4 to obtain DCt. The relative telomere length was determined compared to the DMSO.
Telomerase enzyme activity was assessed by TRAP assay as previously reported (Kang et al., 2016).

Real-Time PCR Analysis

Total RNA was extracted from cells by using Qiagen QIAshredder and RNeasy Mini kit. Equal amounts of total RNA (1 mg RNA)
was subjected to first-strand cDNA synthesis using iScript cDNA synthesis kit according to the manufacturer’s protocol. Real-
time PCR reactions with Bio-Rad SsoAdvanced Universal SYBR Green Supermix were performed using a Bio-Rad CFX96 Touch
System. Samples were assayed in triplicate and the data were normalized to 18S mRNA levels. The primer sets for TERT, NRF2,
HK2, MYC, COX2, and b-ACTIN genes were purchased from Sigma-Aldrich to measure gene expression (see Table S3 for primer
sequences).

Synthesis of RG260 Analogs

RG260 is a benzoylphenyl urea derivative in which two aromatic rings are connected by the urea functionality. RG1534, RG1601, and
RG1603 are structural analogs of RG260 (Scheme S1). Oxalyl chloride (0.5 g) was added to 2-nitrobenzamide (0.2 g) in toluene at 0 C.
The solution was warmed to room temperature, then refluxed with stirring for 24 h. The solvent was evaporated and product 2-nitro-
benzoyl isocyanate was used directly without further purification for the next reaction. A solution of 2,5-dichloropyrimidine (382 mg),
4-amino-2-methylphenol (319 mg), and K2CO3 (718 mg) in dry DMSO (20 mL) was stirred at 120 C for 2.5 h. After cooling to room
temperature, the reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with
water, saturated brine and then dried. The organic solvent was evaporated to give a residue that was purified using silica gel column
chromatography (ethyl acetate-hexane 1:3) to give product 190 mg of 4-((5-chloropyrimidin-2-yl)oxy)-3-methylaniline. 1H NMR (400
MHz, Chloroform-d) d 8.46 (s, 2H), 6.87 (d, J = 8.4 Hz, 1H), 6.60 – 6.49 (m, 2H), 3.66 (s, 1H), 2.08 (s, 3H). A solution of 2-nitrobenzoyl
isocyanate (115 mg) in 15 mL dry dioxane was added dropwise to a solution of 4-((5-chloropyrimidin-2-yl)oxy)-3-methylaniline
(141 mg) in dry 1,4-dioxane with stirring at room temperature. The reaction mixture was stirred for 18 h and then diluted with water.
The precipitated solid was collected by filtration and washed with water. The solid was dissolved in ethyl acetate, and the organic

e3 Cell Chemical Biology 26, 1110–1121.e1–e4, August 15, 2019

layer was washed with (3 3 30 mL) water, dried and concentrated to give 180 mg of N-((4-((5-chloropyrimidin-2-yl)oxy)-3-methyl-
phenyl)carbamoyl)-2-nitrobenzamide. 1H NMR (400 MHz, DMSO-d6) d 11.29 (s, 1H), 10.22 (s, 1H), 8.80 (s, 2H), 8.22 (ddd, J = 8.1,
1.2, 0.6 Hz, 1H), 7.94 – 7.88 (m, 1H), 7.83 – 7.76 (m, 2H), 7.47 (d, J = 19.8 Hz, 2H), 7.13 (d, J = 8.6 Hz, 1H), 2.08 (s, 3H). Iron powder
(160 mg) was added in portions to a mixture of N-((4-((5-chloropyrimidin-2-yl)oxy)-3-methylphenyl)carbamoyl)-2-nitrobenzamide
(256 mg) and ammonium chloride (335 mg) in ethanol at 80 C. The reaction mixture was refluxed for 30 min and then cooled to
room temperature and diluted with water. The precipitated solid was collected by filtration. The solid was dissolved in excess ethyl
acetate and filtered. The filtrate was dried and concentrated to give a residue that was purified by column chromatography (ethyl
acetate: hexane 2:3) to give 110 mg compound RG1534, 2-amino-N-((4-((5-chloropyrimidin-2-yl)oxy)-3-methylphenyl)carbamoyl)
benzamide. Nuclear magnetic resonance (NMR) data: 1H NMR (400 MHz, DMSO-d6) d 10.77 (s, 1H), 10.57 (s, 1H), 8.75 (s, 2H),
7.72 (dd, J = 8.1, 1.5 Hz, 1H), 7.53 – 7.45 (m, 2H), 7.26 (dt, J = 8.4, 1.5 Hz, 1H), 7.16 – 7.08 (m, 1H), 6.79 (dd, J = 8.4, 1.2 Hz, 1H),
6.66 – 6.50 (m, 3H), 2.09 (s, 3H). 13C NMR (101 MHz, DMSO) d 170.98, 163.48, 158.71, 151.80, 151.34, 147.42, 135.72, 134.18,
130.93, 129.84, 125.16, 122.87, 122.74, 119.21, 117.25, 115.17, 112.24, 16.43. High-Performance Liquid Chromatography
(HPLC) Purity = 97.246 % (retention time: 1.790 min). Column: Zorbax SB C18, 4.6 x150 mm, 3.5 u, Mobile phase: 35/65/0.25, Aceto-
nitrile: water: Acetic acid, Flow rate: 0.5 mL/min.
High Resolution Mass Spectra (HRMS): Found = 398.1014 (MH+) (Theoretically = 398.1020).

In Vivo Studies
To investigate the pharmacokinetics of RG1603 after a single oral dose of 25 mg/kg given by intraperitoneally (for RG1534, 10 and
50 mg/kg i.p.), at each time point the plasma concentrations were measured in three FVB mice using triplicate determinations. Blood
samples were collected from the mice via the cheek pouch or retro-orbital bleeding. Total plasma concentrations of RG1603 were
determined by high performance liquid chromatography/tandem mass spectrometry method. RG1603 was extracted from plasma
by protein precipitation with acetonitrile. After centrifugation, the supernatant was injected onto the HPLC-MS system for analysis.
HPLC separation was achieved using a C-18 column and a gradient mobile phase of 10 mM ammonium acetate and acetonitrile.
Detection was performed on a TSQ Quantum Ultra Triple Quadrupole system operating in negative polarity utilizing atmospheric
pressure chemical ionization. The instrument is operated in multiple reaction monitoring mode, monitoring the fragment mass of
117.01 from the parent mass of 395.9 at a collision energy of 44eV with argon as the collision gas. For xenograft studies, DU145 cells
(5 3 106) were implanted with Matrigel subcutaneously into the left flank of mice (male SCID, 8 weeks). When the tumor size reached

150 to 200 mm3, mice were randomly assigned and treated every other day with vehicle (0.5% hydroxypropyl methylcellulose),
RG1603 by intraperitoneal injection. Tumor volume was measured twice per week with calipers and calculated as tumor volume =
(length 3 width2) 3 0.5. The unpaired Student t test was used to evaluate the significance of differences observed between groups,
accepting P < 0.05 as a threshold of significance. All animal studies were approved by the Institutional Animal Care and Use
Committee at the University of Arizona.

QUANTIFICATION AND STATISTICAL ANALYSIS

Each drug treatment was performed in quadruplicate and verified in three independent experiments unless stated otherwise. Graphs
were generated using Microsoft Excel and GraphPad Prism. The unpaired Student t test was used to evaluate the significance of
differences observed between groups, accepting P < 0.05 as a threshold of significance. Data analyses were performed using the
Prism software (GraphPad).

DATA AND SOFTWARE AVAILABILITY

The software used in this study is listed in the Key Resources Table. Additional experimental data are provided as Supplemental In-
formation and are available from the corresponding author upon request.

Cell Chemical Biology 26, 1110–1121.e1–e4, August 15, 2019 e4