diabetes research and clinical practice 155 (2019) 107801

Contents available at ScienceDirect

Diabetes Research
and Clinical Practice
journal homepage: www.elsevier.com/locat e/dia bre s

Ramadan diurnal intermittent fasting modulates

SOD2, TFAM, Nrf2, and sirtuins (SIRT1, SIRT3) gene
expressions in subjects with overweight and
obesity

Mohamed I. Madkour a, Ahmed T. El-Serafi b, Haitham A. Jahrami c, Naglaa M. Sherif d,

Rasha E. Hassan d, Samir Awadallah a, ‘‘Mo’ez Al-Islam” E. Faris e,*
a
Department of Medical Laboratory Sciences, College of Health Sciences/Research Institute of Medical and Health Sciences (RIMHS),
University of Sharjah, Sharjah, United Arab Emirates
b
Department of Basic Sciences, College of Medicine/Research Institute of Medical and Health Sciences (RIMHS), University of
Sharjah, Sharjah, United Arab Emirates and Medical Biochemistry Department, Faculty of Medicine, Suez Canal University, Ismailia, Egypt
c
Rehabilitation Services, Periphery Hospitals, Ministry of Health, College of Medicine and Medical Sciences, Arabian Gulf
University, Manama, Kingdom of Bahrain
d
Biochemistry Department, Faculty of Science, Ain Shams University, Cairo, Egypt
e
Department of Clinical Nutrition and Dietetics, College of Health Sciences/Research Institute of Medical and Health Sciences
(RIMHS), University of Sharjah, Sharjah, United Arab Emirates

A R T I C L E I N F O A B S T R A C T

Article history: Aim: A growing body of evidence supports the impact of intermittent fasting on normaliz-
Received 14 February 2019 ing body metabolism and lowering oxidative stress and inflammation. Mounting evidence
Received in revised form confirms that oxidative stress and chronic inflammation trigger the way for the develop-
23 May 2019 ment of metabolic diseases, such as diabetes. This research was conducted to evaluate
Accepted 10 July 2019 the impact of Ramadan intermittent fasting (RIF) on the expression of cellular metabolism
Available online 26 July 2019 (SIRT1 and SIRT3) and antioxidant genes (TFAM, SOD2, and Nrf2).
Methods: Fifty-six (34 males and 22 females) overweight and obese subjects and six healthy
body weight controls were recruited and monitored before and after Ramadan.
Keywords:
Results: Results showed that the relative gene expressions in obese subjects in comparison
Intermittent fasting
to counterpart expressions of controls for the antioxidant genes (TFAM, SOD2, and Nrf2)
Ramadan
were significantly increased at the end of Ramadan, with percent increments of 90.5%,
Gene expression
54.1% and 411.5% for the three genes, respectively. However, the metabolism-controlling
SIRT1
gene (SIRT3) showed a highly significant (P < 0.001) downregulation accompanied with a
SIRT3
trend for reduction in SIRT1 gene at the end of Ramadan month, with percent decrements
TFAM
of 61.8% and 10.4%, respectively. Binary regression analysis revealed significant positive
SOD2
correlation (P < 0.05) between high energy intake (>2000 Kcal/day vs. <2000 Kcal/day) and
Nrf2
expressions of SOD2 and TFAM (r = 0.84 and r = 0.9, respectively).

* Corresponding author at: Department of Clinical Nutrition and Dietetics, College of Health Sciences, Sharjah Institute for Medical
Research (SIMR), University of Sharjah, Sharjah 27272, United Arab Emirates.
E-mail addresses: mfaris@sharjah.ac.ae, moezfaris@hotmail.com (‘‘Mo’ez Al-Islam” E. Faris).
https://doi.org/10.1016/j.diabres.2019.107801
0168-8227/Ó 2019 Elsevier B.V. All rights reserved.
2 diabetes research and clinical practice
Conclusion: Results suggest that RIF ameliorates the genetic expression of antioxidant and
anti-inflammatory, and metabolic regulatory genes. Thus, RIF presumably may entail a pro-
tective impact against oxidative stress and its adverse metabolic-related derangements in
non-diabetic obese patients.
1. Introduction
Intermittent fasting (IF) encompasses eating pattern in which
individuals go extended periods with little or no caloric
intake, with intervening feeding periods regularly. Different
forms of IF, including alternate-day fasting, periodic fasting,
and time-restricted feeding, in healthy and overweight
human subjects, demonstrated effectiveness in reducing
body weight and improving multiple health indicators includ-
ing reductions in cardio-metabolic risk factors [1,2].
Oxidative stress can be defined as an imbalance between
the production of reactive oxygen species (ROS) and the
antioxidative defense system in the body, which ends with
overwhelming the capacity of human body’s antioxidant
defense system [3,4]. Oxidative stress has been recognized
as a principal etiological factor in a wide range of chronic
human ailments [5]. Moreover, the prevailing oxidative and
inflammatory conditions constitute significant risk factors
for the development of several pathologies, such as diabetes
[6].
Sirtuin 1 (SIRT1), a conserved histone deacetylase with
widespread effects on cellular metabolism, mitochondrial
bioenergetics, and aging, has been found to regulate several
genes [7,8]. These genes were correlated to aging and to
increase the expression of genes that act as endogenous
ROS scavengers, protecting the cells from further ROS insult.
Mitochondria are believed to play a central role in these
events, as mitochondria are the primary site of endogenous
ROS production, and mitochondrial transcription factors are
upregulated with fasting and caloric restriction [9]. In turn,
dietary modifications, such as caloric restriction, have been
found to promote a transient state of oxidative stress, leading
to adaptive protective responses, which in the long run pro-
tect cells from future ROS harms [10].
SIRT3 is the most well described of the mitochondrial sir-
tuins and is located primarily in the mitochondrial matrix.
SIRT3, a deacetylase enzyme that affects the lysine residue
and is involved in the regulation of the proteomic and bio-
chemical activities in the mitochondria. Calorie restriction,
fasting, and exercise training have all been shown to increase
SIRT3 levels in different tissues [11]. In contrast, a recent
study reported a reduction in SIRT3 protein in skeletal muscle
of fasted mice [12].
Nuclear factor erythroid 2 related factor 2 (Nrf2) is consid-
ered a fundamental factor in resistance to oxidative stress
over the last decade [13]. Superoxide dismutase 2 (SOD2) is
one of three forms of SOD, located in the mitochondria and
plays a significant role in ROS attenuation. SOD2 is the pri-
mary mitochondrial scavenging enzyme that converts super-
oxide to hydrogen peroxide, which is finally converted to
155 (2019) 107801
Ó 2019 Elsevier B.V. All rights reserved.
water by catalase [14]. Nrf2 has been involved in maintaining
mitochondrial redox homeostasis by activating mitochon-
drial antioxidant enzymes such as SOD2 [15]. Mitochondrial
transcription factor A (TFAM) is involved in the transcrip-
tional control of mitochondrial DNA (mtDNA) [16]. Recent
reports showed that TFAM protects against diseases with
oxidative stress [17] and maintains the mitochondrial orga-
nelle genome [18]. Thus, any intervention causing an increase
in TFAM levels, and therefore mtDNA stability and enhanced
mitochondrial biogenesis [19].
Ramadan intermittent fasting (RIF) is considered a unique
model of intermittent diurnal fasting, as food and fluid
intake, becomes exclusive at the nocturnal time without
restriction on the type or amount of food intake for one
month yearly [20]. Many physiological changes occur during
RIF [21–28]. Recent systematic review and meta-analysis
unraveled that RIF is associated with reductions in important
inflammatory and oxidative stress markers after completing
diurnal RIF [29]. Up to the best of our knowledge, none of
the previous research investigated the change of
metabolism-controlling and antioxidant defense systems
gene expression concerning RIF. Further, there is a paucity
of clinical studies exploring the effect of IF and RIF in partic-
ular, on protective cellular responses in human subjects.
Based on previous studies, we hypothesized that the RIF could
incur beneficial effects on expression of genes related to aging
and metabolism, namely metabolism-controlling and aging
genes sirtuins 1 and 3 (SIRT1 and SIRT3) and the antioxidative
stress genes (TFAM, SOD2, and Nrf2).
2. Methods
2.1. Ramadan fasting and research design
The prospective study design was conducted during Ramadan
from June to July of the lunar calendar in 2016. Data were col-
lected on the baseline (T1, one week before the month of
Ramadan), and after completing 28 or 29 or 30 consecutive
days of the fasting month. During the fasting month of Rama-
dan, individuals refrain from all oral intakes (including food
and water) from dawn to sunset. The daily fasting hours were
about 15 h. Each subject served as self-control by comparing
her/his values before and at the end of Ramadan. No particu-
lar dietary regimens or recommendations were given to the
participants during any stage of the study, and all the subjects
were asked to pursue their physical exercise patterns during
the non-fasting period. According to the Islamic regulations,
females are exempted from observing Ramadan fasting dur-
ing their menstrual period; thus the intervention period for
the female subjects was less than males, and ranged from
 diabetes research and clinical practice
23 to 25 days, whereas the intervention period for the men
lasted from 28 to 30 days.
2.2. Subjects
The study protocol was designed and conducted per the Dec-
laration of Helsinki and was approved by the Research Ethics
Committee of the University of Sharjah, United Arab Emirates
(Reference no: REC-16-05-11-01). All enrolled subjects (56 in
total) were provided with an information sheet describing
the research plan, objectives, and requirements of involve-
ment. The subjects were recruited using personal communi-
cation, social media, and institutional e-mails and attended
at the University Hospital of Sharjah (UHS) for screening,
investigations, and signing the informed consent. Subjects
of both genders who were a healthy weight and overweight/
obesity (BMI > 25 kg/m2), willing to fast during Ramadan and
participate in the study were asked to sign the consent form.
Subjects with a history of diabetes or cardiovascular disease,
on regular medications, following a weight-reducing diet or
had a history of bariatric surgery within the last nine months
before Ramadan, being a pregnant woman or peri-
menopausal woman were excluded from the study. Six sub-
jects with healthy body weight were recruited as controls.
2.3. Anthropometric assessment
Anthropometric measurements were taken at the two time
points (before and after RIF). Body weight, fat mass and per-
cent, fat-free mass, and total body water were measured
using direct segmental multi-frequency bioelectrical impe-
dance analysis (DSM-BIA; TANITA, MC-980, Tokyo/Japan).
The visceral fat rating was measured by DSM-BIA machine,
and the value (from 0 to 100) was converted into a visceral
fat surface area by multiplying the obtained value by 10, as
per the instructions of the manufacturer. Height was mea-
sured using a fixed stadiometer to the nearest 0.1 cm. BMI
was calculated as kg/m2 accordingly. Waist and hip circumfer-
ences were measured to the nearest 0.01 m using a non-
stretchable measuring tape (Seca, Hamburg/Germany), and
waist: hip ratio (WHR) was calculated after that.
2.4. Dietary intake assessment
Dietary intake was assessed by 24-h recalls, collected on three
consecutive days (one weekend day and two weekdays) at the
two time points, by trained nutritionists. Two-dimensional
food models were used to help subjects approximate portion
sizes. Dietary intakes of calories and macronutrients (carbo-
hydrates, proteins, fats, fibers, and water) were estimated
using the Food Processor software (version 10.6 ESHA
Research, Salem, OR/USA).
2.5. Physical activity level
General physical activity level was assessed using the Dietary
Reference Intakes classification [30]. In this classification, the
activity level is considered sedentary if subject spends most
of the day time in living activities without additional physical
exercise. Low active level is considered when the subject
155 (2019) 107801 3
spends the day time on living activities plus 30–60 min per
day of moderate intensity exercises. The active level is con-
sidered when day time is spent on living activities plus at
least 60 min per day of moderate intensity exercise. Very
active level is considered when the subject spends day time
on living activities plus at least 120 min per day of moderate
intensity exercises or 60 min of vigorous exercise [30].
2.6. Blood sampling and blood pressure measuring
Ten milliliters of the venous blood sample was collected from
each participant after completing at least eight hours of fast-
ing at both time points; the baseline which was before RIF and
at the testing point was at the end of the fourth week of
Ramadan. The samples were collected between 11 am and
1 pm for the two time points, in order to eliminate the effect
of timing and dietary intake on the measured biochemical
parameters and to ensure the consistency in the duration of
fasting at both time points. Collected blood samples were
divided into two aliquots. The first aliquot was centrifuged
at 2500 rpm for 15 min within an hour of collection, and the
serum was aliquoted, coded, and stored at 80 °C until being
used for biochemical analysis. The second aliquot was used
for RNA extraction, as explained below. Blood pressure was
measured before blood sampling using a digital blood pres-
sure monitor (GE, USA) with subjects in erected seated posi-
tion after a 5-min resting period.
2.7. Glucose homeostasis markers
Serum glucose was assessed using the fully automated clini-
cal chemistry analyzer ‘Adaltis’ (Pchem1, Rome/Italy), accord-
ing to their recommended kits and protocols. Fasting insulin,
insulin-like growth factor-1 (IGF-1), were measured by an
enzyme-linked immunosorbent assay (ELISA; Elabscience,
USA). Homeostatic Model Assessment of Insulin Resistance
(HOMA-IR) was calculated as (fasting glucose  fasting insu-
lin)/405. Insulin sensitivity was assessed by using the quanti-
tative insulin sensitivity check index (QUICKI). All the
measurements were performed in triplicate.
2.8. RNA extraction, reverse transcription, qPCR
RNA was extracted using the column-based, Total RNA Purifi-
cation kit (Norgen, Canada) and reverse transcribed to cDNA
by the TruScript Reverse Transcriptase kit (Norgen, Canada),
according to the manufacturer’s instructions. qPCR reaction
was performed at the volume of 20 ml, including 100 ng of
cDNA with QuantiTect SYBR Green PCR mixture (Qiagen, Ger-
many). The cycling conditions included initial activation of
the polymerase for 15 min at 95 °C, followed by 45 cycles of
15-s denaturation at 94 °C, annealing at 55 °C for 30 s followed
by extension at 72 °C for 30 s. The forward and reverse pri-
mers used in the study were summarized in Table 1. For each
sample, the expression of each gene was normalized to the
housekeeping gene glyceraldehyde 3 phosphate dehydroge-
nase (GAPDH) at the same time point. The data were com-
pared to a pool of four healthy subjects with normal BMI
(18.5–24.9) at each time point. The relative expression was
shown as fold change according to Livak and Schmittgen
4 diabetes research and clinical practice
Table 1 – Forward and reverse primers used in genetic analysis for the five genes tested.
Gene Forward primer
SIRT1[72] GCCTCACATGCAAGCTCTAGTGAC
SIRT3[73] ACCCAGTGGCATTCCAGAC
SOD2[74] GCTCCGGTTTTGGGGTATCTG
TFAM[10] ATGGCGTTTCTCCGAAGCAT
Nrf2[75] ATGGATTTGATTGACATACTTT
GAPDH[76] CCAGGTGGTCTCCTCTGACTT C
[31] and was presented as mean and standard deviation as
described before [32].
2.9. Statistical analysis and sample size calculation
The primary outcome measure was the change in genetic
expressions of the five genes (SIRT1, SIRT3, SOD2, TFAM,
Nrf2), between the two time points. We estimated that 51 sub-
jects would provide 80% power to detect a significant differ-
ence of 5% in genetic expression between baseline (pre-
fasting) and post-fasting using a two-tailed paired-samples
t-test with a = 0.05. With an expected dropout rate of 10%,
56 subjects were planned for enrollment. The statistical anal-
yses were done using Stata statistical software for statistical
analysis (v.13.1 Stata Corp. USA). Tests for normality were
included in the model. The variables are expressed as the
mean ± standard deviation (SD). Two-tailed Paired sample t-
tests were used to compare within-subject changes from
baseline (pre-fasting) to post-fasting time points. Binary logis-
tic regression was calculated considering genetic expression
as dependent variables, and sex (male vs. female), caloric
intake (high, >2000 Kcal vs. low, <2000 Kcal), waist circumfer-
ence as independent variables. We recoded the waist circum-
ference variable as high waist circumference or low waist
circumference as per the corresponding sex of the partici-
pant. The following criteria were used: High, 102 cm vs. Nor-
mal <102 cm for men and High, 88 cm vs. Normal <88 cm for
women. In logistic regressions, the odds ratio, 95% confidence
interval (CI) were calculated, and result were considered sig-
nificant at P < 0.05.
3. Results
Fifty-six (34 males and 22 females, mean age of 35.72 y
± 12.35) overweight or obese subjects (BMI = 30.74 ± 3.60 kg/
m2) and six healthy body weight controls (mean age of 29.8
± 14.0 y, BMI = 21.4 ± 2.20 kg/m2) were recruited and moni-
tored before and after fasting the whole month of Ramadan.
Basic and anthropometric characteristics of the participants
are shown in Table 2. Body weight and composition, and
blood pressure changes between pre- and post-Ramadan fast-
ing are shown in Table 3. By the end of Ramadan fasting
month, body weight, BMI, fat mass, and visceral fat tissue
area were significantly (P < 0.05) decreased when compared
to pre-fasting levels. Total body water, waist circumference,
and systolic blood pressure were also significantly reduced
(P < 0.05) at the end of the fasting month (Table 3). Before
155 (2019) 107801
Reverse primer
TTCGAGGATCTGTGCCAATCATAA
GGCTTGGGGTTGTGAAAGAAG
GCGTTGATGTGAGGTTCCAG
CAGATGAAAACCACCTCGGTAA
ACTGAGCCTGATTAGTAGCAAT
TCATACCAGGAAATGAGCTTGACA
Ramadan, ninety-six percent of the subject were sedentary,
with only 4% were lightly active.
Fasting glucose, insulin, insulin resistance expressed in
homeostatic model assessment (HOMA-IR) remained
unchanged throughout the study, while IGF-1 showed a sig-
nificant (P < 0.05) reduction. By the end of Ramadan, signifi-
cant (P < 0.05) decreases in total cholesterol, triglycerides,
and, unexpectedly, HDL cholesterol were observed (Table 4).
Changes in dietary intake are shown in Table 5. Significant
(P < 0.05) increases were reported in the dietary intake of total
carbohydrates, total sugars, total water, and fluid during
Ramadan in comparison with the pre-fasting intakes, while
the total caloric intake did not significantly change.
Results of relative genetic expressions in obese subjects in
comparison to counterpart expressions of controls showed
significant upregulation in the three antioxidative stress
genes at the end of Ramadan, with percent increments of
SOD2 (+53.8%, 95% CI 1.70–2.76) and highly significant upreg-
ulation for TFAM (+90.4%, 95% CI 1.53–2.22) and Nrf2
(+411.8%, 95% CI 4.93–10.66) at the end of Ramadan month
in comparison with the pre-fasting levels (Figs. 1–3). While
the metabolism-controlling gene (SIRT3) showed a highly sig-
nificant (P < 0.001) downregulation (-61.8%, 95% CI 0.868–
1.102), this was accompanied with a slight non-significant
downregulation for SIRT1 gene ( 10.3%, 95% CI 1.36–1.94),
with percent decrements of 61.8% and 10.4%, respectively, at
the end of Ramadan month in comparison with the pre-
fasting levels (Figs. 4–5).
Binary logistic regression analysis for genetic expressions
showed only significant (P < 0.05) positive correlation between
high energy intake (>2000 Kcal vs. < 2000 Kcal) and gene
expressions of SOD2 and TFAM (r = 0.84 and r = 0.9, respec-
tively). (Data not shown here. Supplementary table file can
be seen through the general repository storage link https://
www.dropbox.com/s/v26mnu6byal2nq9/Supplementary%20
table%20fasting%20and%20gene%20expresison%202852019.
docx?dl=0).
4. Discussion
The current work is the first study conducted to examine the
impact of RIF on metabolism and oxidative stress -controlling
genes, and was designed principally to investigate the impact
of RIF on the genetic expression of metabolic and cellular reg-
ulator genes (SIRT1 and SIRT3) along with antioxidant defense
enzyme system genes (TFAM, SOD2 and Nrf2). SIRT1 and SIRT3
have been studied for its role in caloric restriction, mainte-
nance of metabolic homeostasis, and the prevention of
 diabetes research and clinical practice 155 (2019) 107801 5

Table 2 – Basic and anthropometric characteristics of the study subjects according to sex variable.
Parameter Males (n = 34) Females (n = 22) Significance between males
Mean SD Mean SD and females

Weight (kg) 93.16 12.23 83.58 16.89 *

BMI (kg/m2) 30.74 3.60 31.18 7.11 NS
FM (kg) 25.69 7.97 29.80 11.35 NS
BFP (%) 27.10 5.43 35.67 6.11 NS
FFM (kg) 66.90 6.64 51.37 8.89 *
MM (kg) 63.58 6.33 48.78 8.45 *
TBW (kg) 47.83 4.74 36.84 6.311 *
VFA (cm2) 237.18 84.98 283.27 113.98 *
WC (cm) 97.41 10.95 91.27 15.77 NS
HC (cm) 104.97 8.40 107.37 13.29 NS
WHR 0.93 0.07 0.85 0.07 *
SBP (mmHg) 127.24 8.96 117.05 11.86 NS
DBP (mmHg) 74.94 9.89 64.86 7.56 NS
P-value: Independent samples t-test comparing baseline variables between men and women.
BMI, Body mass index; BFP, Body fat percent; DBP, Diastolic blood pressure; FM, Fat mass; FFM, Fat-free mass; HC, Hip circumference; MM, Muscle
mass; SBP, Systolic blood pressure; TBW, Total body water; VFA, Visceral fat area measured by DSM-BIA; WC, Waist circumference; WHR, Waist: hip
ratio.
*
P < 0.05, significant difference.

Table 3 – Difference in anthropometric variables between pre- and post-RIF (n = 56).

Parameter Before Ramadan After Ramadan Significance as
compared to baseline
Mean SD Mean SD
**
Weight (kg) 89.39 14.87 88.24 14.56
BMI (kg/m2) 30.91 5.21 30.45 5.09 *
FM (kg) 27.31 9.56 26.09 9.24 *
BFP (%) 30.47 7.06 29.64 7.11 *
FFM (kg) 60.80 10.73 60.39 10.58 NS
MM (kg) 57.77 10.22 57.37 10.08 NS
TBW (kg) 43.51 7.62 43.23 7.52 NS
VFA (cm2) 104.96 71.17 99.14 69.02 *
WC (cm) 95.0 13.27 91.9 11.37 *
HC (cm) 105.91 10.54 104.65 10.42 NS
WHR 0.89 0.08 0.89 0.07 NS
SBP (mmHg) 123.24 11.27 119.02 9.46 *
DBP (mmHg) 70.98 10.25 69.05 9.25 NS
Paired t-test comparing end of RIF (T2) with pre-fasting baseline (T1).
BMI, Body mass index; BFP, Body fat percent; DBP, Diastolic blood pressure; FM, Fat mass; FFM, Fat-free mass; HC, Hip circumference; MM, Muscle
mass; SBP, Systolic blood pressure; TBW, Total body water; VFA, Visceral fat area measured by DSM-BIA; WC, Waist circumference; WHR, Waist: hip
ratio.
*
P < 0.05, significant difference.
**
P < 0.001, highly significant difference.

aging-related diseases [33]. We assessed the expression of
these genes in obese subjects upon intermittent fasting, as
these genes have been implicated from previous reports in
mediating diet-induced benefits on metabolism, oxidative
stress and inflammation [4,10,13,34–36]. Only a single pub-
lished study examined the impact of RIF on genetic expres-
sion conducted by Ajabnoor and colleagues [37] who
examined the impact of RIF on genes related to circadian
rhythm control.
Considering that physical activity is one of the influential
factors on gene expression [38], this factor is minimized in
the current work. During Ramadan, fasting subjects are doing
their daily jobs and routine works during the day fasting
hours, while spending the night hours in eating and perform-
ing the ritual and social activities. Thus, fasting subjects tend
to be less active during the fasting month in comparison to
the non-fasting periods [39].
Sirtuins (SIRT) are epigenetic and metabolic regulators.
Mounting evidence supports that sirtuins family (SIRT1–7)
guard homeostasis by sensing bioenergy needs and respond-
ing by making alterations in the cell nutrients, and play a crit-
ical role in restoring homeostasis during stress responses [40].
Because sirtuins integrate metabolism, bioenergetics, and
immunity during inflammation, the expression of sirtuins
becomes more pronounced upon acute/chronic inflamma-
tion. This fact could also explain the decreased expression
6 diabetes research and clinical practice 155 (2019) 107801

Table 4 – Glucose homeostasis before and at the end of Ramadan (n = 56).

Parameter Before Ramadan After Ramadan Significance as
Mean SD Mean SD compared to baseline

Fasting glucose (mg/dl) 95.94 21.52 98.01 13.74 NS

Fasting insulin (ng/ml) 14.5 14.18 19.3 13.5 NS
Insulin resistance (HOMA-IR) 1.24 1.09 1.58 1.01 NS
QUICKI Insulin sensitivity 0.35 0.06 0.33 0.03 NS
IGF-1 (ng/ml) 1.07 0.79 0.80 0.62 *
**P < 0.001.
Paired t-test comparing end of RIF (T2) with pre-fasting baseline (T1).
QUICKI, quantitative insulin sensitivity check index; HOMA-IR, homeostasis model assessment of insulin resistance; IGF-1, Insulin-like growth
factor-1.
*
P < 0.05.

Table 5 – Dietary intakes before and at the end of Ramadan. (n = 56).

Parameter Before Ramadan After Ramadan Significance as
compared to baseline
Mean SD Mean SD

Energy (kcal/d) 1760.87 477.29 1920.79 694.60 NS

Fat calories (kcal/day) 604.79 208.86 614.42 274.19 NS
Protein (g/d) 69.74 17.02 74.52 32.90 NS
Total carbohydrates (g/d) 225.49 70.76 258.86 97.79 *
**
Total sugars (g/d) 77.50 39.91 102.42 54.83
Total fats (g/d) 67.39 23.21 68.26 30.54 NS
**
Total water (ml/day) 1102.12 721.13 1824.91 745.76
MUFA (g/d) 14.22 6.40 15.59 10.58 NS
PUFA (g/d) 7.11 3.04 9.87 9.02 *
Significant at P < 0.05, Paired t-test comparing end of RIF (T2) with pre-fasting baseline (T1).
MUFA, Monounsaturated fat; PUFA, Polyunsaturated fat.
*
P < 0.05, significant difference.
**
P < 0.001, highly significant difference.

SITR1 before RIF SITR1 after RIF SITR3 before RIF SITR3 after RIF

Fig. 1 – Relative gene expression in obese subjects in Fig. 2 – Relative gene expression in obese subjects in
comparison to counterpart expressions of controls for SIRT1 comparison to counterpart expressions of controls for SIRT3
at the end of Ramadan fasting month in comparison to pre- at the end of Ramadan fasting month in comparison to pre-
fasting level using qPCR. fasting level using qPCR. * Significantly different at P < 0.001.

of sirtuins (SIRT1 and SIRT3) upon intermittent fasting of
Ramadan where inflammatory markers are modulated while
anti-inflammatory markers are augmented.
SIRT3 is one of the sirtuins localize primarily in the mito-
chondria and is one of the major mitochondrial deacetylase
enzymes involved in the activation of fatty acid breakdown
upon prolonged fasting. In the current study, the expression
of SIRT1 gene showed an insignificant reduction at the end
of RIF, while SIRT3 behaved differently and significantly
reduced at the end of the month. This finding could be
 diabetes research and clinical practice
TFAM before RIF TFAM after RIF
Fig. 3 – Relative gene expression in obese subjects in
comparison to counterpart expressions of controls for TFAM
at the end of Ramadan fasting month in comparison to pre-
fasting level using qPCR. * Significantly different at P < 0.001.
SOD2 before RIF SOD2 after RIF
Fig. 4 – Relative gene expression in obese subjects in
comparison to counterpart expressions of controls for SOD2
at the end of Ramadan fasting month in comparison to pre-
fasting level using qPCR. * Significantly different at P < 0.05.
Nrf2 before RIF Nrf2 after RIF
Fig. 5 – Relative gene expression in obese subjects in
comparison to counterpart expressions of controls for Nrf2
at the end of Ramadan fasting month in comparison to pre-
fasting level using qPCR. * Significantly different at P < 0.001.
155 (2019) 107801 7
explained by the lack of significant difference in total energy
and fat intake along with the excessive simple sugar intake
during feeding night hours of Ramadan month reported in
the current work. SIRT1 and SIRT3 were reported to be overex-
pressed upon prolonged fasting and excessive caloric restric-
tion [41,42], which is not the case in Ramadan. RIF is
considered as a partial or short-term intermittent fasting or
time-restricted feeding that ranges from 12 to 17 h/day, with
the rest of night hours available for eating without restriction
[1].
The lack of significant changes in glucose homeostasis
markers (serum insulin and HOMA-IR) is consistent with
the lack of significant changes in SIRT1, which is involved in
the regulation of glucose homeostasis and insulin resistance
[43]. Evidence shows that SIRT1 counters insulin resistance
and increased SIRT1 expression and activation of elevating
insulin secretion. The lack of insulin, as in SIRT1-deficient
mice, shows blunted insulin response to glucose stimulation
[44,45]. From a mechanistic point of view, SIRT1 triggers insu-
lin secretion from pancreatic b-cells by suppressing the
expression of uncoupling protein (UCP)-2 [46]. This relation-
ship was further supported in the animal models of diabetes
when SIRT1 activation improved insulin sensitivity and
increased energy expenditure [47,48].
On the other hand, both SIRT1 and SIRT3 gene are involved
in triggering fatty acid oxidation upon fasting, which contra-
dicts with the increased fatty acid oxidation and significant
reduction of body and visceral fat upon Ramadan fasting. This
discrepancy could be explained by the impact of other genetic
and hormonal regulations in triggering fatty acid oxidation
rather than sirtuins. Expression of the SIRT3 gene is highly
responsive for the prevailing nutrient availability of the cell.
Fasting, calorie restriction, and exercise training have all been
reported to trigger the expression of SIRT3 in different tissues
[11,49,50]. However, a recent study revealed a reduction in
SIRT3 in skeletal muscle during fasting [51].
In contrast, the expression or activity of SIRT3 has been
shown to decrease in high fat fed rodents and human sub-
jects with metabolic syndrome [52–54]. In the current work,
there was a clear trend toward increased consumption of total
fats during Ramadan night hours, which may help in explain-
ing the significant reduction in SIRT3 gene expression upon
Ramadan fasting. It is noteworthy to indicate that caloric
restriction is different from fasting; the former entails a sig-
nificant reduction in caloric intake by about 20–40% of the
total daily intake, while the latter entails a continuous or
intermittent abstinence from eating or drinking for specific
periods of time, with different health and metabolic implica-
tions are reported for the two types of dietary restriction
[55,56].
Furthermore, overexpression of antioxidant defense sys-
tem genes (SOD2, TFAM, and Nrf2) implying their role in coun-
teracting the increased oxidative stress generated by the
nutritional stresses faced upon fasting. Such pattern of
expression could explain, at the genetic level, the reported
reduction in inflammatory and oxidative stress markers at
the end of RIF recently revised and meta-analyzed by Faris
and colleagues [29]. This overexpression of the three antiox-
idative stress genes entails a kind of loop feedback mecha-
nisms that hinder the need for SIRT3 to be upregulated,
8 diabetes research and clinical practice
providing that SIRT3 is well known for its ability to eliminate
ROS and to prevent the development of cancerous cells or
apoptosis [57]. As a connection between SIRT3 and SOD2
genes, the latter is a downstream mediator of the former,
and protects nuclear and mtDNA as well as other cellular
macromolecules from ROS-related damage [14]. The discrep-
ancy between the downregulation of SIRT3 and the upregula-
tion of its downstream mediator SOD2 in the current study
could be explained by the negative feedback mechanism that
renders SIRT3 less demanded in the presence of sufficient
amount of the antioxidant enzyme SOD2 in body tissues.
The significance of SOD2 in counteracting the damaging effect
of ROS generated by mitochondria upon cellular respiration is
confirmed in the current study by the binary logistic regres-
sion analysis. No significant correlations were reported
between genetic expressions of the five tested genes and
any of the independent variables (sex, waist circumference,
caloric intake and BMI) except for SOD2 and TFAM toward
caloric intake, where SOD2 and TFAM expressions were signif-
icantly (P < 0.05) and directly associated with increased caloric
intake (>2000 Kcal/day vs. <2000 Kcal per day) among fasting
subjects during Ramadan. This finding is similar to a previous
report indicated that overnutrition and excessive caloric
intake are associated with increased expression of SOD2 [58]
and TFAM [59]. Providing that mounting evidence confirms
that oxidative stress and chronic inflammation trigger the
way for the development of metabolic diseases, such as dia-
betes, and prevailing oxidative and inflammatory conditions
constitute major risk factors for the development of a number
of pathologies such as diabetes [6]; it can be postulated that
such overexpression for the aforementioned anti-oxidative
stress genes during RIF presumably may entail a kind of
short-term protection against the development of diabetes
in obese subjects.
The upregulation of the antioxidant defense enzyme
genes (TFAM, SOD2, and Nrf2) augments the anti-
inflammatory status of the fasting subjects, and hence makes
the expression of sirtuins less demanded. Accumulating body
of evidence supports an overall protective effect of SIRT1 acti-
vation on the chronic inflammation associated with
atherosclerosis; thus the expression of this gene becomes less
demanding in our healthy subjects free of cardiovascular dis-
eases and not exposed to caloric restriction [60–62].
It has been proposed that fasting state, such as intermit-
tent fasting practiced during Ramadan month, includes the
elevation in free fatty acids and ketone bodies which in turn
may serve to impose damage upon the metabolically active
mitochondria within the neurons of the fasting organism.
However, this damage can be corrected by several mecha-
nisms, including upregulation of the antioxidant defense
genes and enhanced mtDNA repair [63].
Silencing SIRT1 and SIRT3 in H9C2 cell line was found to
induce no changes in the expression of TFAM and NRF1, while
found a reduction in the activity of TFAM in SIRT3 silenced
cells rather than in SIRT1 silenced cells. Thus, it was found
that silencing SIRT3 increases the acetylation of TFAM and
reduces its DNA binding activity [64]. This could explain the
current findings of a simultaneous reduction in SIRT3 and
increment in TFAM genetic expressions in the current study.
Further, overexpression of TFAM in the current work of one-
155 (2019) 107801
month intermittent fasting with ad libitum night eating is con-
sistent with the overexpression reported after six months of
25% caloric restriction in healthy overweight subjects [65].
Interestingly, a similar trend was observed for SIRT1, where
six-month caloric restriction failed to induce SIRT1 protein
expression, suggesting that additional factors may regulate
SIRT1 content during caloric restriction.
Nrf2 is an important mechanistic link between the stress
response-induced antioxidant gene expression and cell sur-
vival. Much of the protective antioxidant response of Nrf2 is
mediated through upregulation and activation of the Nrf2
gene. Nrf2 regulates a coordinated transcriptional program
that maintains cellular redox homeostasis and protects the
cell from oxidative injury. Nrf2 regulates several enzymes that
are important in the antioxidant response [66]. These include
‘‘direct‘‘ response enzymes such as SOD2, or ‘‘indirect”
enzymes such as heme oxygenase-1, glutathione, and thiore-
doxin generating enzymes [67]. Thus, it becomes logic that
SOD2 is upregulated concomitantly with the upregulation of
the Nrf2 gene upon RIF and could be explained by the direct
effect of Nrf2 on SOD2 expression and activity.
Insulin-like growth factor (IGF)-1 is synthesized by almost
all tissues and is an essential mediator of cell growth, differ-
entiation, and transformation. Activation of the insulin/IGF-1
signaling pathway has been associated with increased levels
of oxidative stress and subsequently increased levels of
pathogenesis for cancer and atherosclerosis [68]. Interest-
ingly, caloric restriction has been reported as one of the main
factors that hinder the activation of this pathway [69]. The
significant reduction in IGF-1 in the current study is a reflec-
tion of the significant activation for the antioxidative stress
genes (TFAM, SOD2, and Nrf2), and incur a positive transient
protective impact on fasting people against oxidative stress
and subsequent pathological conditions. Sophisticated and
complex interactive pathways for the impact of dietary
restrictions on mitochondrial function and aging concerning
the studied sirtuins (SIRT1 and SIRT3) and antioxidative stress
genes (TFAM, SOD2, and Nrf2), along with IGF-1, were critically
revised by Ruetenik and Barrientos [69].
One possible argument was that increased expression of
antioxidative stress genes (TFAM, SOD2, and Nrf2) during
Ramadan month implies that RIF is accompanying with
increased levels of ROS production, and thus may entail
adverse effects of oxidative stress on fasting people. Ristow
and Schmeisser defended this argument in their review
‘‘Extending life span by increasing oxidative stress” [70]. The
authors reported that several longevity-promoting interven-
tions, such as caloric restriction and intermittent fasting,
may converge by causing activation of mitochondrial oxygen
consumption to promote the increased formation of ROS.
These dietary interventions may serve as molecular signals
to exert downstream effects to ultimately induce endogenous
defense mechanisms culminating in increased stress resis-
tance and longevity, an adaptive response more specifically
named mitohormesis or mitochondrial hormesis [70].
In conclusion, the current work showed that RIF might
entail a short-term protective impact against oxidative stress
in obese subjects, and may help in delaying the development
of diabetes and other metabolic derangements associated
with increased oxidative stress and low-grade inflammation.
 diabetes research and clinical practice
The current work entails more than one limitation that
should be considered when discussing the current findings.
As an observational prospective study, causality cannot be
inferred in the current work, and undetected confounding fac-
tors could be implicated in the upregulation or downregulation
of the tested genes upon Ramadan fasting month. Other con-
founding factors that may be implicated include changes in cir-
cadian rhythm and sleep pattern that have been reported to
affect the expression of some genes [37]. Although the physical
exercise was controlled by asking the subjects to maintain
their habitual physical exercise pattern during Ramadan
month, providing that the vast majority (96%) of the recruited
subjects were sedentary to inactive in comparison to before
Ramadan; more precise and subjective measurements have
to be applied in measuring physical exercise levels.
Author declaration
‘‘Authors: All research done by the authors”.
‘‘Financial support: yes”.
‘‘Conflict of interest: none.”
Funding sources
This work received a grant from the University of Sharjah
(VCRG/R1061/2016).
Author contribution
MF contributed to the conception and design of the work; MF,
MM, and AS participated in the acquisition, analysis, and inter-
pretation of data for the work; MF contributed to drafting the
work; HJ contributed in statistical analysis; SA, NS, and RH con-
tributed to critically revising the manuscript and suggested fur-
ther tests. All authors were involved in writing the paper and
had final approval of the submitted and published version.
Declaration of Competing Interest
The authors declared no conflicts of interest.
Acknowledgments
This work was supported by a Vice-Chancellor Research and
Graduate Studies Office/University of Sharjah grant no.
(VCRG/R1061/2016). The authors extend their thanks for Dr
Abdulmonhem Obaideen, Medical Diagnostic Imaging
Department at University Hospital Sharjah for their great
assistance. The authors would like to thank. The authors
would like to thank the subjects for their enthusiasm and
commitment. We are grateful to May Abdul-Aziz, Arwa Faw-
zan, Heba Al-Saafin, Sumer Al-Ani, Hiba Yousif and Marwa
Hilali for assistance in data collection.
Appendix A. Supplementary material
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.diabres.2019.107801.
155 (2019) 107801 9
R E F E R E N C E S
[1] Patterson RE, Sears DD. Metabolic effects of intermittent
fasting. Annu Rev Nutr 2017;37:371–93. https://doi.org/
10.1146/annurev-nutr-071816-064634.
[2] Patterson RE, Laughlin GA, LaCroix AZ, Hartman SJ,
Natarajan L, Senger CM, et al. Intermittent fasting and
human metabolic health. J Acad Nutrit Dietetics
2015;115:1203–12. https://doi.org/10.1016/j.jand.2015.02.018.
[3] Mattson MP, Longo VD, Harvie M. Impact of intermittent
fasting on health and disease processes. Ageing Res Rev
2017;39:46–58. https://doi.org/10.1016/j.arr.2016.10.005.
[4] Merksamer PI, Liu Y, He W, Hirschey MD, Chen D, Verdin E.
The sirtuins, oxidative stress and aging: an emerging link.
Aging (Albany NY). 2013;5(3):144–50. https://doi.org/10.18632/
aging.100544.
[5] Liguori I, Russo G, Curcio F, Bulli G, Aran L, Della-Morte D,
et al. Oxidative stress, aging, and diseases. Clin Interv Aging
2018;13:757–72. https://doi.org/10.2147/CIA.S158513.
[6] Rani V, Deep G, Singh RK, Palle K, Yadav UC. Oxidative stress
and metabolic disorders: Pathogenesis and therapeutic
strategies. Life Sci 2016;148:183–93. https://doi.org/10.1016/j.
lfs.2016.02.002.
[7] Nogueiras R, Habegger KM, Chaudhary N, Finan B, Banks AS,
Dietrich MO, et al. Sirtuin 1 and sirtuin 3: physiological
modulators of metabolism. Physiol Rev 2012;92(3):1479–514.
https://doi.org/10.1152/physrev.00022.2011.
[8] Tang BL. Sirt1 and the mitochondria. Mol Cells 2016;39
(2):87–95. https://doi.org/10.14348/molcells.2016.2318.
[9] Starkov AA. The role of mitochondria in reactive oxygen
species metabolism and signaling. Ann N Y Acad Sci
2008;1147:37–52. https://doi.org/10.1196/annals.1427.015.
[10] Wegman MP, Guo MH, Bennion DM, Shankar MN,
Chrzanowski SM, Goldberg LA, et al. Practicality of
intermittent fasting in humans and its effect on oxidative
stress and genes related to aging and metabolism.
Rejuvenation Res 2015;18(2):162–72. https://doi.org/10.1089/
rej.2014.1624.
[11] Palacios OM, Carmona JJ, Michan S, Chen KY, Manabe Y, Ward
Iii JL, et al. Diet and exercise signals regulate SIRT3 and
activate AMPK and PGC-1a in skeletal muscle. Aging (Albany
NY). 2009;1(9):771–83. https://doi.org/10.18632/aging.100075.
[12] Osborne B, Bentley NL, Montgomery MK, Turner N. The role
of mitochondrial sirtuins in health and disease. Free Radical
Biol Med 2016;100:164–74. https://doi.org/10.1016/j.
freeradbiomed.2016.04.197.
[13] Ma Q. Role of nrf2 in oxidative stress and toxicity. Annu Rev
Pharmacol Toxicol 2013;53:401–26. https://doi.org/10.1146/
annurev-pharmtox-011112-140320.
[14] Katwal G, Baral D, Fan X, Weiyang H, Zhang X, Ling L, et al.
SIRT3 a Major Player in Attenuation of Hepatic Ischemia-
Reperfusion Injury by Reducing ROS via Its Downstream
Mediators: SOD2, CYP-D, and HIF-1a. Oxid Med Cell Longev
2018. https://doi.org/10.1155/2018/2976957.
[15] Ryoo I, Kwak M-K. Regulatory crosstalk between the
oxidative stress-related transcription factor Nfe2l2/Nrf2 and
mitochondria. Toxicol Appl Pharmacol 2018;359:24–33.
https://doi.org/10.1016/j.taap.2018.09.014.
[16] Kang I, Chu CT, Kaufman BA. The mitochondrial
transcription factor TFAM in neurodegeneration: emerging
evidence and mechanisms. FEBS Lett 2018;592(5):793–811.
https://doi.org/10.1002/1873-3468.12989.
[17] Campbell CT, Kolesar JE, Kaufman BA. Mitochondrial
transcription factor A regulates mitochondrial transcription
initiation, DNA packaging, and genome copy number.
Biochimica et Biophysica Acta (BBA) - Gene Reg Mech
10 diabetes research and clinical practice
2012;1819(9–10):921–9. https://doi.org/10.1016/j.
bbagrm.2012.03.002.
[18] Kaufman BA, Durisic N, Mativetsky JM, Costantino S,
Hancock MA, Grutter P, et al. The mitochondrial transcription
factor TFAM coordinates the assembly of multiple DNA
molecules into nucleoid-like structures. Mol Biol Cell 2007;18
(9):3225–36. https://doi.org/10.1091/mbc.E07-05-0404.
[19] Onyango IG. Modulation of mitochondrial bioenergetics as a
therapeutic strategy in Alzheimer’s disease. Neural Regener
Res 2018;13(1):19–25. https://doi.org/10.4103/1673-
5374.224362.
[20] Trepanowski JF, Bloomer RJ. The impact of religious fasting
on human health. Nutr J 2010;22(9):57. https://doi.org/
10.1186/1475-2891-9-57.
[21] Meo SA, Hassan A. Physiological changes during fasting in
Ramadan. J Pak Med Assoc 2015;65:S6–S14.
[22] Azizi F. Islamic fasting and health. Ann Nutr Metab 2010;56
(4):273–82. https://doi.org/10.1159/000295848.
[23] Sadeghirad B, Motaghipisheh S, Kolahdooz F, Zahedi MJ,
Haghdoost AA. Islamic fasting and weight loss: a systematic
review and meta-analysis. Public Health Nutr 2014;17
(2):396–406. https://doi.org/10.1017/S1368980012005046.
[24] Faris MAIE, Hussein RN, Al-Kurd R, Al-Fararjeh MA, Bustanji
YK, Mohammad MK. Impact of Ramadan Intermittent
Fasting on Oxidative Stress Measured by Urinary 15–
Isoprostane. J Nutr Metab 2012:2012. https://doi.org/10.1155/
2012/802924.
[25] Faris MAIE, Kacimi S, Ref’at A, Fararjeh MA, Bustanji YK,
Mohammad MK, et al. Intermittent fasting during Ramadan
attenuates proinflammatory cytokines and immune cells in
healthy subjects. Nutr Res 2012;32(12):947–55. https://doi.org/
10.1016/j.nutres.2012.06.021.
[26] Ibrahim WH, Habib HM, Jarrar AH, Al Baz SA. Effect of
Ramadan fasting on markers of oxidative stress and serum
biochemical markers of cellular damage in healthy subjects.
Ann Nutr Metab 2008;53(3–4):175–81. https://doi.org/10.1159/
000172979.
[27] Asemi Z, Samimi M, Taghizadeh M, Esmaillzadeh A. Effects
of Ramadan fasting on glucose homeostasis, lipid profiles,
inflammation and oxidative stress in women with polycystic
ovary syndrome in Kashan, Iran. Arch Iran Med 2015;18
(12):806–10. doi: 0151812/AIM.003.
[28] Chaouachi A, Coutts AJ, Wong DP, Roky R, Mbazaa A, Amri M,
et al. Haematological, inflammatory, and immunological
responses in elite judo athletes maintaining high training
loads during Ramadan. Appl Physiol Nutr Metab 2009;34
(5):907–15. https://doi.org/10.1139/H09-095.
[29] Faris MAIE, Jahrami H, Obaideen A, Madkour M. Impact of
diurnal intermittent fasting during Ramadan on
inflammatory and oxidative stress markers in healthy
people: Systematic review and meta-analysis. J Nutr
Intermed Metab 2019;15:18–26. https://doi.org/10.1016/j.
jnim.2018.11.005.
[30] Otten JJ, Hellwig JP, Meyers LD. Dietary reference intakes: the
essential guide to nutrient requirements. National
Academies Press; 2006.
[31] Livak KJ, Schmittgen TD. Analysis of relative gene expression
data using real-time quantitative PCR and the 2 DDCT
method. Methods 2001;25(4):402–8. https://doi.org/10.1006/
meth.2001.1262.
[32] Maher S, Kolieb E, Sabik NA, Abd-Elhalim D, El-Serafi AT, El-
Wazir Y. Comparison of the osteogenic differentiation
potential of mesenchymal cells isolated from human bone
marrow, umbilical cord blood and placenta derived stem
cells. Beni-Suef Univ J Basic Appl Sci 2015;4(1):80–5. https://
doi.org/10.1016/j.bjbas.2015.02.011.
155 (2019) 107801
[33] Houtkooper RH, Pirinen E, Auwerx J. Sirtuins as regulators of
metabolism and healthspan. Nat Rev Mol Cell Biol 2012;13
(4):225–38. https://doi.org/10.1038/nrm3293.
[34] Chaudhary N, Pfluger PT. Metabolic benefits from Sirt1 and
Sirt1 activators. Curr Opin Clin Nutrit Metabolic Care 2009;12
(4):431–7. https://doi.org/10.1097/MCO.0b013e32832cdaae.
[35] Haigis MC, Yankner BA. The aging stress response. Mol Cell
2010;40(2):333–44. https://doi.org/10.1016/j.molcel.2010.10.002.
[36] Zhang H, Davies KJ, Forman HJ. Oxidative stress response and
Nrf2 signaling in aging. Free Radical Biol Med 2015;88:314–36.
https://doi.org/10.1016/j.freeradbiomed.2015.05.036.
[37] Ajabnoor GM, Bahijri S, Shaik NA, Borai A, Alamoudi AA, Al-
Aama JY, et al. Ramadan fasting in Saudi Arabia is associated
with altered expression of CLOCK, DUSP and IL-1alpha genes,
as well as changes in cardiometabolic risk factors. PLoS ONE
2017;12(4):e0174342. https://doi.org/10.1371/journal.
pone.0174342.
[38] Booth FW, Chakravarthy MV, Spangenburg EE. Exercise and
gene expression: physiological regulation of the human
genome through physical activity. J Physiol 2002;543:399–411.
https://doi.org/10.1113/jphysiol.2002.019265.
[39] Chtourou H. Effects of Ramadan fasting on health and
athletic performance. New York, NY: Omics Group
International; 2015. p. 6–14.
[40] Vachharajani VT, Liu T, Wang X, Hoth JJ, Yoza BK, McCall CE.
Sirtuins link inflammation and metabolism. J Immunol Res
2016;2016. https://doi.org/10.1155/2016/8167273.
[41] Zhu Y, Yan Y, Gius DR, Vassilopoulos A. Metabolic regulation
of Sirtuins upon fasting and the implication for cancer. Curr
Opin Oncol 2013;25:630–6. https://doi.org/10.1097/01.
cco.0000432527.49984.a3.
[42] Zullo A, Simone E, Grimaldi M, Musto V, Mancini F. Sirtuins as
mediator of the anti-ageing effects of calorie restriction in
skeletal and cardiac muscle. Int J Mol Sci 2018;21(19):928.
https://doi.org/10.3390/ijms19040928.
[43] Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM,
Puigserver P. Nutrient control of glucose homeostasis
through a complex of PGC-1a and SIRT1. Nature 2005;434
(7029):113–8. https://doi.org/10.1038/nature03354.
[44] Moynihan KA, Grimm AA, Plueger MM, Bernal-Mizrachi E,
Ford E, Cras-Méneur C, et al. Increased dosage of mammalian
Sir2 in pancreatic b cells enhances glucose-stimulated
insulin secretion in mice. Cell Metab 2005;2:105–17. https://
doi.org/10.1016/j.cmet.2005.07.001.
[45] Imai S-i, Kiess W. Therapeutic potential of SIRT1 and NAMPT-
mediated NAD biosynthesis in type 2 diabetes. Front Biosci: A
J Virtual Library 2009;14:2983.
[46] Bordone L, Motta MC, Picard F, Robinson A, Jhala US, Apfeld J,
et al. Sirt1 regulates insulin secretion by repressing UCP2 in
pancreatic b cells. PLoS Biol 2005;4:0210–20. https://doi.org/
10.1371/journal.pbio.0040031.
[47] Sharma S, Misra CS, Arumugam S, Roy S, Shah V, Davis JA,
et al. Antidiabetic activity of resveratrol, a known SIRT1
activator in a genetic model for type-2 diabetes. Phytother
Res 2011;25(1):67–73. https://doi.org/10.1002/ptr.3221.
[48] Goh KP, Lee HY, Lau DP, Supaat W, Chan YH, Koh AFY. Effects
of resveratrol in patients with type 2 diabetes mellitus on
skeletal muscle SIRT1 expression and energy expenditure. Int
J Sport Nutr Exerc Metab 2014;24(1):2–13. https://doi.org/
10.1123/ijsnem.2013-0045.
[49] Hallows WC, Yu W, Smith BC, Devires MK, Ellinger JJ, Someya
S, et al. Sirt3 promotes the urea cycle and fatty acid oxidation
during dietary restriction. Mol Cell 2011;41:139–49. https://
doi.org/10.1016/j.molcel.2011.01.002.
[50] Schwer B, Eckersdorff M, Li Y, Silva JC, Fermin D, Kurtev MV,
et al. Calorie restriction alters mitochondrial protein
 diabetes research and clinical practice
acetylation. Aging Cell 2009;8(5):604–6. https://doi.org/
10.1111/j.1474-9726.2009.00503.x.
[51] Jing E, O’Neill BT, Rardin MJ, Kleinridders A, Ilkeyeva OR, [61]
Ussar S, et al. Sirt3 regulates metabolic flexibility of skeletal
muscle through reversible enzymatic deacetylation. Diabetes
2013;62(10):3404–17. https://doi.org/10.2337/db12-1650.
[52] Hirschey MD, Shimazu T, Jing E, Grueter CA, Collins AM, [62]
Aouizerat B, et al. SIRT3 deficiency and mitochondrial protein
hyperacetylation accelerate the development of the
metabolic syndrome. Mol Cell 2011;44(2):177–90. https://doi.
org/10.1016/j.molcel.2011.07.019. [63]
[53] Kendrick AA, Choudhury M, Rahman SM, McCURDY CE,
Friederich M, Van Hove JL, et al. Fatty liver is associated with
reduced SIRT3 activity and mitochondrial protein
hyperacetylation. Biochem J 2011;433(3):505–14. https://doi.
org/10.1042/BJ20100791.
[54] Bao J, Scott I, Lu Z, Pang L, Dimond CC, Gius D, et al. SIRT3 is
regulated by nutrient excess and modulates hepatic [64]
susceptibility to lipotoxicity. Free Radical Biol Med 2010;49
(7):1230–7. https://doi.org/10.1016/j.
freeradbiomed.2010.07.009.
[55] Anson RM, Guo Z, de Cabo R, Iyun T, Rios M, Hagepanos A,
et al. Intermittent fasting dissociates beneficial effects of [65]
dietary restriction on glucose metabolism and neuronal
resistance to injury from calorie intake. Proc Natl Acad Sci
2003;100(10):6216–20. https://doi.org/10.1073/
pnas.1035720100. [66]
[56] Klempel MC, Kroeger CM, Bhutani S, Trepanowski JF, Varady
KA. Intermittent fasting combined with calorie restriction is
effective for weight loss and cardio-protection in obese
women. Nutr J 2012;11:98. https://doi.org/10.1186/1475-2891-
11-98. [67]
[57] Ansari A, Rahman MS, Saha SK, Saikot FK, Deep A, Kim KH.
Function of the SIRT 3 mitochondrial deacetylase in cellular
physiology, cancer, and neurodegenerative disease. Aging
Cell 2017;16(1):4–16. https://doi.org/10.1111/acel.12538.
[58] Boden G, Homko C, Barrero CA, Stein TP, Chen X, Cheung P, [68]
et al. Excessive caloric intake acutely causes oxidative stress,
GLUT4 carbonylation, and insulin resistance in healthy men.
Sci Transl Med 2015;7(304):304re7. https://doi.org/10.1126/
scitranslmed.aac4765. [69]
[59] Lim S, Won H, Kim Y, Jang M, Jyothi K, Kim Y, et al.
Antioxidant enzymes induced by repeated intake of excess
energy in the form of high-fat, high-carbohydrate meals are
not sufficient to block oxidative stress in healthy lean [70]
individuals. Br J Nutr 2011;106(10):1544–51. https://doi.org/
10.1017/S0007114511002091.
[60] Zeng HT, Fu YC, Yu W, Lin JM, Zhou L, Liu L, et al. SIRT1
prevents atherosclerosis via liver-X-receptor and NF-jB
155 (2019) 107801 11
signaling in a U937 cell model. Mol Med Rep 2013;8(1):23–8.
https://doi.org/10.3892/mmr.2013.1460.
Bai B, Vanhoutte PM, Wang Y. Loss-of-SIRT1 function during
vascular ageing: hyperphosphorylation mediated by cyclin-
dependent kinase 5. Trends Cardiovasc Med 2014;24(2):81–4.
https://doi.org/10.1016/j.tcm.2013.07.001.
Toniolo A, Warden EA, Nassi A, Cignarella A, Bolego C.
Regulation of SIRT1 in vascular smooth muscle cells from
streptozotocin-diabetic rats. PLoS ONE 2013;8(5):e65666.
https://doi.org/10.1371/journal.pone.0065666.
Tapia PC. Sublethal mitochondrial stress with an attendant
stoichiometric augmentation of reactive oxygen species may
precipitate many of the beneficial alterations in cellular
physiology produced by caloric restriction, intermittent
fasting, exercise and dietary phytonutrients:‘‘Mitohormesis”
for health and vitality. Med Hypotheses 2006;66(4):832–43.
https://doi.org/10.1016/j.mehy.2005.09.009.
Bagul P, Katare P, Bugga P, Dinda A, Banerjee SK. SIRT-3
Modulation by Resveratrol Improves Mitochondrial Oxidative
Phosphorylation in Diabetic Heart through Deacetylation of
TFAM. Cells 2018;7(12):235. https://doi.org/
10.3390/cells7120235.
Civitarese AE, Carling S, Heilbronn LK, Hulver MH, Ukropcova
B, Deutsch WA, et al. Calorie restriction increases muscle
mitochondrial biogenesis in healthy humans. PLoS Med
2007;4(3):e76. https://doi.org/10.1371/journal.pmed.0040076.
Osburn WO, Yates MS, Dolan PD, Chen S, Liby KT, Sporn MB,
et al. Genetic or pharmacologic amplification of nrf2
signaling inhibits acute inflammatory liver injury in mice.
Toxicol Sci 2008;104(1):218–27. https://doi.org/10.1093/toxsci/
kfn079.
Cano M, Thimmalappula R, Fujihara M, Nagai N, Sporn M,
Wang AL, et al. Cigarette smoking, oxidative stress, the anti-
oxidant response through Nrf2 signaling, and Age-related
Macular Degeneration. Vision Res 2010;50:652–64. https://doi.
org/10.1016/j.visres.2009.08.018.
Higashi Y, Sukhanov S, Anwar A, Shai S-Y, Delafontaine P.
IGF-1, oxidative stress and atheroprotection. Trends
Endocrinol Metab 2010;21(4):245–54. https://doi.org/10.1016/j.
tem.2009.12.005.
Ruetenik A, Barrientos A. Dietary restriction, mitochondrial
function and aging: from yeast to humans. Biochimica et
Biophysica Acta (BBA)-Bioenergetics 2015;1847(11):1434–47.
https://doi.org/10.1016/j.bbabio.2015.05.005.
Ristow M, Schmeisser S. Extending life span by increasing
oxidative stress. Free Radical Biol Med 2011;51(2):327–36.
https://doi.org/10.1016/j.freeradbiomed.2011.05.010.