Life Sciences 139 (2015) 75–82

Contents lists available at ScienceDirect

Life Sciences

journal homepage: www.elsevier.com/locate/lifescie

High-intensity interval training beneficial effects on body mass, blood

pressure, and oxidative stress in diet-induced obesity in
ovariectomized mice
Marcel Pimenta, Isabele Bringhenti, Vanessa Souza-Mello, Iara Karise dos Santos Mendes,
Marcia B. Aguila, Carlos A. Mandarim-de-Lacerda ⁎
Laboratory of Morphometry, Metabolism, and Cardiovascular Disease, Biomedical Center, Institute of Biology, State University of Rio de Janeiro, Brazil

a r t i c l e i n f o a b s t r a c t

Article history: Aims: To investigate the possible beneficial effect of high-intensity interval training (HIIT) on skeletal muscle
Received 4 March 2015 oxidative stress, body mass (BM) and systolic blood pressure (SBP) in ovariectomized mice fed or not fed a
Received in revised form 27 July 2015 high-fat diet.
Accepted 1 August 2015 Main methods: Three-month-old female C57BL/6 mice were bilaterally ovariectomized (OVX group) or submit-
Available online 15 August 2015
ted to surgical stress without ovariectomy (SHAM group) and separated into standard chow (SHAM-SC; OVX-
SC) and high-fat diet (SHAM-HF; OVX-HF) groups. After 13 weeks, an HIIT program (swimming) was carried
Keywords:
Swimming
out for 8 weeks in non-trained (NT) and trained (T) groups.
High fat diet Key findings: The significant reduction of uterine mass and the cytological examination of vaginal smears in the
Ovariectomy OVX group confirmed that ovariectomy was successful. Before the HIIT protocol, the ovariectomized groups
Oxidative stress showed a greater BM than the SHAM group, irrespective of the diet they received. The HIIT minimized BM
Menopause gain in animals fed an HF diet and/or ovariectomized. SBP and total cholesterol were increased in the OVX and
Molecular biology HF animals compared to their counterparts, and the HIIT efficiently reduced these factors. In the HF and OVX
mice, the muscular superoxide dismutase and catalase levels were low while their glutathione peroxidase and
glutathione reductase levels were high and the HIIT normalized these parameters.
Significance: Diet-induced obesity maximizes the deleterious effects of an ovariectomy. The HIIT protocol signif-
icantly reduced BM, SBP and oxidative stress in the skeletal muscle indicating that HIIT diminishes the cardiovas-
cular and metabolic risk that is inherent to obesity and menopause.
© 2015 Elsevier Inc. All rights reserved.

1. Introduction combination of ovariectomy and a high-fat (HF) diet exacerbates the

Accumulation of visceral fat is strongly associated with many ad-
verse health conditions, such as metabolic syndrome, inflammation,
dyslipidemia, insulin resistance (IR), diabetes mellitus type 2 (DM2),
cardiovascular disease, some cancers and death [1]. In addition, the ab-
sence of estrogens, aside from the cessation of a protective health con-
dition, has a significant effect on obesity in menopausal women [2].
A reduced muscle mass (sarcopenia) with increased oxidative stress
(OS) is characterized by a negative imbalance in the production of free
radicals and a reduced antioxidant capacity in the body [3]. Experimen-
tal studies have shown increased levels of OS in ovariectomized animals,
which leads to IR in the liver and skeletal muscle [4]. Therefore, the
⁎ Corresponding author at: Laboratory of Morphometry, Metabolism & Cardiovascular
Disease, Biomedical Centre, State University of Rio de Janeiro, Av 28 de Setembro 87 fds,
Rio de Janeiro, RJ 20551-030, Brazil.
E-mail address: mandarim@uerj.br (C.A. Mandarim-de-Lacerda).
URL: http://www.lmmc.uerj.br (C.A. Mandarim-de-Lacerda).
deleterious effects of both insults and serves as a model for translational
purposes [5].
The regular practice of continuous low to moderate intensity exer-
cise has emerged as an effective non-pharmacological therapy for the
prevention or treatment of the deleterious effects of menopause [6].
Moderate intensity exercise produces the aerobic condition, which re-
quires more time of dedication during a week in order to provide bene-
fits to health [7]. Conversely, high intensity interval training (HIIT)
combines intense exercise of short duration (anaerobic condition) in-
tercalated by a short aerobic recovery period, which seems to be more
suitable in the hustle and bustle of modern life [8]. Studies involving
HIIT and the associated beneficial health effects are not abundant, but
they indicate that HIIT plays a role in prevention/rehabilitation and im-
proving VO2 peak in patients with coronary heart disease [9]. Therefore,
the experimental association of an ovariectomy with an HF diet in ani-
mals submitted to HIIT is a logical question that merits study.
The current study was undertaken to investigate the effects of HIIT
(swimming) focusing on skeletal muscle oxidative stress in mice, as
well as the body mass evolution and systolic blood pressure control in

http://dx.doi.org/10.1016/j.lfs.2015.08.004
0024-3205/© 2015 Elsevier Inc. All rights reserved.
76 M. Pimenta et al. / Life Sciences 139 (2015) 75–82

animals submitted to bilateral ovariectomy with or without the intake protocol for an additional 8 weeks (non-trained mice (NT) and trained
of a HF diet. mice (T)), for a total of eight groups (n = 10 for each group):

a) Sham-standard chow-non-trained (SHAM-SC-NT),

2. Materials and methods b) Sham-standard chow-trained (SHAM-SC-T),
c) Sham-high-fat diet-non-trained (SHAM-HF-NT),
2.1. Animals and diets d) Sham-high-fat diet-trained (SHAM-HF-T),
e) Ovariectomy-standard chow-non-trained (OVX-SC-NT),
The handling protocols and experiments were approved by the f) Ovariectomy-standard chow-trained (OVX-SC-T),
Ethics Committee on Animal Experiments at the State University of g) Ovariectomy-high-fat diet-non-trained (OVX-HF-NT),
Rio de Janeiro (CEUA/072/2012). All of the procedures were per- h) Ovariectomy-high-fat diet-trained (OVX-HF-T).
formed in accordance with the precepts of the “Guide for the use of
laboratory animal care” (NIH Publication No. 85-23, revised in
1996, USA). The animals were maintained in a ventilated caging sys- The body mass (BM) was measured weekly during the experiment.
tem (Nexgen Ecoflo, Allentown, Inc., USA) with a controlled temper- The total experimental time was 21 weeks. For biometrical parameters,
ature (21 ± 2 °C), humidity (60 ± 10%), and light/dark cycle (12-h blood pressure, food intake and carbohydrate metabolism assessment,
light–dark). the original sample (n = 10) was used. Instead, for plasma analyses,
Three-month-old female C57BL/6 mice (n = 80) were used in the Western blotting and PCR evaluations, five animals per group were
study. The mice were anesthetized (intraperitoneal injection of a 1:1 mix- evaluated.
ture of ketamine chloride [50 mg/kg] and xylazine chloride [5 mg/kg])
under aseptic conditions and were randomly subjected to ovariectomy 2.2. High-intensity interval training protocol (swimming)
(OVX group; n = 40) or a surgical procedure without ovary removal
(SHAM group; n = 40). The OVX was performed with a small incision The animals were adapted to the pool without any load before
along the ventral abdominal midline. The ovaries were bilaterally starting the HIIT protocol (15 min/day for three days). The glass tank
clamped and removed through the incision. The uterine horns were was 40 × 30 × 80 cm with a controlled water temperature of 32 ±
tied, and the uterus was left intact. In the SHAM group, the animals 2 °C. The NT animals were adapted to the pool in order to be submitted
were anesthetized, the abdominal wall was opened similar to the OVX to an environment similar to the T animals, which were subjected to the
mice, and the ovaries were exteriorized to create similar stress but were HIIT protocol. The maximum swimming time (MST) was the time the
not removed. The cytology (vaginal smears) was analyzed after an initial animal was more than 10-cm submerged in the water and incapable
2-week rest period, and again on the eve of the euthanasia to ensure that of returning to the water surface to breathe after 10 s [11]. We conduct-
the effect of the ovariectomy and the all of the SHAM animals were being ed a maximum number of tests (20 s of active exercise using 10% of the
sacrificed at the same stage of the estrous cycle. BM increment in the tail with 10 s of passive recovery). Therefore, for
After a recovery period of 1-week, the SHAM and OVX mice were the protocol, 50% of the maximum number of series determined in the
randomized into two groups each, based on their diet: standard chow test was used, and the exercise protocol was performed three times a
(SHAM-SC, n = 20; OVX-SC, n = 20) and high-fat diet (SHAM-HF, week for eight weeks. The lead weights were attached to the tail adding
n = 20; OVS-HF, n = 20). The diets were produced by Pragsolucoes 10% of the BM of the mouse, and every two weeks it was increased by
(São Paulo, Brazil) in accordance with the American Institute of Nutri- 1%, ending at 14% of the BM in the eighth week. Of note, the exercise
tion 93M recommendations [10]. The mineral and vitamin contents of was executed in the darkest period owing to the nocturnal habits of
the two diets were identical. The detailed diet compositions are provid- rodents.
ed in Table 1. Animals had free access to food and water throughout the
experiment, and food intake was measured daily. The energy intake was 2.3. Systolic blood pressure
measured as the product of food intake (g/day) by the energy content of
the diet (kJ/day). Food intake was daily-evaluated (9:00 a.m.). The animals were trained in constraint conditions for two weeks be-
After 13 weeks on the experimental diets, both the SHAM and OVX fore the systolic blood pressure (SBP) measurement was performed to
mice were separated into two new groups according to their exercise minimize their stress. At the end of the experiment, the SBP was mea-
sured in conscious mice via tail-cuff plethysmography (Storage Pressure
Meter model LE 5002, Panlab Harvard Apparatus, Barcelona, Spain).
Table 1
Diet compositions. 2.4. Oral glucose tolerance test
Nutrients (g/kg) SC HF
One week prior the euthanasia, animals were fasted for 6 h and then
Casein 190.00 230.00
submitted to the oral glucose tolerance test (OGTT). Briefly, after the de-
Corn starch 539.50 299.50
Sucrose 100.00 100.00 termination of fasting glycemia each animal received a glucose load (1
Soybean oil 70.00 70.00 g/kg) through orogastric gavage. The blood glucose levels were evaluat-
Lard – 200.00 ed after 15, 30, 60 and 120 min from the glucose load by milking the tail
Fiber 50.00 50.00 vein after the tail tip cut. The glucose tolerance was analyzed consider-
Vitamin Mixture (mg) 10.00 10.00
ing the area under the curve (AUC) at the end of the test (Graph Pad
Mineral Mixture (mg) 35.00 35.00
Cysteine 3.00 3.00 Prism version 6.05 for Windows, San Diego, CA, USA).
Choline 2.50 2.50
Antioxidants 0.01 0.01 2.5. Euthanasia
Total mass (g) 1.00 1.00
Energy (kcal/kg) 3.95 4.95
Carbohydrates (%) 64.00 32.00 Seventy-two hours after the last exercise training session, the ani-
Protein (%) 19.00 19.00 mals were fasted for 6 h and then deeply anesthetized (intraperitoneal
Lipids (%) 17.00 49.00 sodium pentobarbital, 150 mg/kg). The blood samples were obtained by
SC: standard chow and HF: high fat diet (based on the AIN93M, see the Material and cardiac puncture and were centrifuged at 120 g for 15 min at room tem-
methods section). perature, and the plasma was stored at − 80 °C until assayed. In
 M. Pimenta et al. / Life Sciences 139 (2015) 75–82 77

addition, the uterus was removed and weighed. The inguinal fat pad Table 2
(subcutaneous fat located between the lower part of the rib cage and RT-qPCR primers and respective sequences.

the mid-thigh) and the intra-abdominal fat pad were dissected (a retro- Name 5–3′ Primers
peritoneal fat connected to the posterior abdominal wall near the kid- MnSOD FW GGTCTCCAACATGCCTCTCT
neys plus the genital fat located in the lower part of the abdomen and MnSOD RV AACCATCCACTTCGAGCAGA
connected to the ovaries in the females). The fat pads were dissected GPx1 FW TCTGCAGATCGTTCATCTCG
and weighed, and additionally, the adiposity index was determined as GPx1 RV GTCCACCGTGTATGCCTTCT
CAT FW CAAGTTTTTGATGCCCTGGGT
the ratio between the sum of the fat masses divided by the total BM
CAT RV ACATGGTCTGGGACTTCTGG
[12]. The medial gastrocnemius muscle was dissected, weighed and im- GSR FW CAGCATAGACGCCTTTGACA
mediately frozen in liquid nitrogen and stored at −80 °C until further GSR RV CACGACCATGATTCCAGATG
analysis. Beta-actin FW CTCCGGCATGTGCAA
Beta-actin RV CCCACCATCACACCCT

2.6. Plasma biochemistry
The plasma total cholesterol (TC) and triacylglycerol (TG) levels
were measured on an automatic spectrophotometer using colorimetric
enzymatic kits (Bioclin, Quibasa, Belo Horizonte, MG, Brazil).
2.7. Western blots
The expression of superoxide dismutase (SOD — Santa Cruz Biotech-
nology, sc-30080, CA, USA), glutathione peroxidase (GPx — Santa Cruz
Biotechnology, sc-133160, CA, USA), glutathione reductase (GR —
Santa Cruz Biotechnology, sc-133245, CA, USA) and catalase (Santa
Cruz Biotechnology sc-50508, CA, USA) were detected by immunoblot-
ting using rabbit polyclonal antibodies. Approximately 150 mg of the
skeletal muscle were homogenized in lysis buffer (50 mM Tris,
150 mM NaCl) (pH 6.4) containing protease inhibitors. The protein con-
centration in the supernatant was determined using a BCA protein assay
kit (Thermo Scientific, Rockford, IL, USA). Thirty micrograms of the pro-
tein was separated by electrophoresis on a 10% polyacrylamide gel
(SDS-PAGE) and transferred to a PVDF membrane (GE Healthcare
BioSciences). The membranes were blocked using 5% non-fat dry
milk in Tris-buffered saline (TBS) (Amersham Biosciences, Uppsala,
Sweden) containing 0.05% Tween-20 (Bio-Rad, CA, USA) and were
then incubated overnight at 4 °C with anti-SOD (1:500), anti-GPx
(1:500), anti-GR (1:500) and anti-catalase (1:500). Subsequently, the
membranes were washed 3 times with TBS containing 0.05% Tween-
20 and were incubated with a secondary antibody for 1 h. The structural
protein β-actin (Santa Cruz Biotechnology, code sc-81178, CA, USA) was
obtained by stripping the muscle proteins from each PVDF membrane
and was used to correct the expression of the above-mentioned pro-
teins. The bands were detected by chemiluminescence using the ECL re-
agent kit (GE Healthcare BioSciences) and were obtained using the
ChemiDoc imaging system (Bio-Rad, USA). The density of the signals
was analyzed using Image J software version 1.47q (Wyne Rasband,
National Institutes of Health, USA).
Abbreviations: Manganese Superoxide Dismutase (MnSOD); glutathione peroxidase
(GPx1); catalase (CAT) and glutathione reductase (GSR).
10 s and 60 °C for 15 s, were followed by a melting curve program
(60 to 95 °C with a heating rate of 0.1 °C/s). The negative controls
consisted of wells in which the cDNA was substituted with deion-
ized water. The relative expression ratio (RQ) of the mRNA was cal-
culated using the equation 2 − ΔΔCt, in which − ΔCT represents the
difference between the number of cycles (CT) of the target genes
and the beta-actin. The primer sequences used for the gene quanti-
fication are described in Table 2.
2.9. Data analysis
All of the samples were tested for normality and homogeneity of the
variances, and the data are reported as means and their standard errors.
The differences between the groups before the HIIT protocol were test-
ed using a one-way analysis of variance (ANOVA) and the Holm–Sidak
posthoc test (Graph Pad Prism version 6.05 for Windows, San Diego,
CA, USA). In addition, a 3-way ANOVA (2 × 2 × 2 factorial) was per-
formed to take the interactions between effects (diet, OVX, and HIIT)
into account (Statistica, version 10; StatSoft Inc., Tulsa, OK, USA). A
P-value ≤ 0.05 was considered as statistically significant.
3. Results
3.1. Part 1 — effects of menopause and high-fat diet
3.1.1. Uterine mass
The confirmation of successful OVX-induced suppression of the en-
dogenous estrogen production was made by comparing the uterine
mass between the SHAM group (618.8 g ± 44.9 g) and the OVX group
(166.8 g ± 14.6 g), which showed a significant reduction in the OVX
group (−270%, P b 0.0001).

2.8. RT-qPCR 3.1.2. Body mass and muscle mass

The RNA was extracted from approximately 30 mg of skeletal muscle
tissue using TRIzol reagent (Invitrogen, CA, USA). The RNA concentra-
tion was determined using Nanovue (GE Life Sciences) spectroscopy,
and 1 μg of the RNA was treated using DNAse I (Invitrogen). The first-
strand cDNA synthesis was performed using Oligo (dT) primers with
the mRNA and Superscript III reverse transcriptase (Invitrogen). A
quantitative real-time PCR (RT-qPCR) was performed using a StepOne
Plus Real-time PCR System (Life Technologies, CA, USA) and SYBR
Green mix (Invitrogen). The primers for the qPCR were designed
using the online software Primer3 and are indicated in Table 2.
Beta-actin (β-actin) was used to normalize the expression of the select-
ed genes. The RT-qPCR efficiencies for the target gene and the beta-actin
were approximately equal and were calculated using a cDNA dilu-
tion series. The real-time PCR reactions were conducted as follows:
after a pre-denaturation and polymerase-activation program
(4 min at 95 °C), forty-four cycles, each consisting of 95 °C for
During the first 12 weeks of the experiment, the OVX group had a
greater BM mass than the SHAM group, irrespective of the diet they re-
ceived. Both groups SHAM fed HF diet for 12 weeks (+28%, P b 0.0001),
and OVX fed SC diet (+14%, P = 0.007) were heavier than the SHAM
group fed SC diet. The OVX group fed HF diet showed a greater BM
than the OVX group fed SC diet (+18% in week 12; P b 0.0001). During
the HIIT protocol, the non-trained groups fed HF diet continued to put
on weight significantly (Fig. 1). However, the gastrocnemius muscle
mass was not altered in the HF or the OVX groups (Table 3).
3.1.3. Food and energy intake
The differences in food intake were not significant between the
groups. However, HF fed groups showed increased energy consump-
tion, regardless of OVX procedure (Table 3). In this way, the energy in-
take of the SHAM-HF-NT group surpassed that of the SHAM-SC-NT
group (+26%, P = 0.004) and the OVX-HF-NT group surpassed that of
the OVX-SC-NT group (+36%, P b 0.0001).
78 M. Pimenta et al. / Life Sciences 139 (2015) 75–82

Fig. 2. The SBP of the animals (mean and standard error of the mean, n = 10). The signif-
icant differences are indicated by different symbols (one-way ANOVA and the Holm–Sidak
posthoc test). Abbreviations: SHAM, sham procedure; OVX, ovariectomy; SC, standard
chow; HF, high-fat diet; T, trained and NT, non-trained. Symbols: [a] different from the
non-trained counterpart; [b] different from the SC counterpart and [*] different from the
SHAM counterpart.

their counterparts. Likewise, OVX led to glucose intolerance indepen-

dently of the type of diet in the OVX-SC-NT group (+25%, P = 0.007)
and in the OVX-HF-NT group (+ 22%, P = 0.004) compared to their
counterparts. These results are detailed in Table 3.

Fig. 1. The body mass of the animals (mean and standard error of the mean, n = 10). The
significant differences are indicated by different symbols (one-way ANOVA and the Holm–
Sidak posthoc test). Abbreviations: SHAM, sham procedure; OVX, ovariectomy; SC,
standard chow; HF, high-fat diet; T, trained and NT, non-trained.
3.1.4. Systolic blood pressure
The ovariectomy and the HF diet increased the SBP values in the an-
imals significantly. As shown in Fig. 2, the OVX, and HF animals had a
higher SBP than their counterparts (23% due to OVX, P = 0.001; 31%
due to HF diet, P b 0.0001).
3.1.5. Fasting glycemia and OGTT
The HF diet led to hyperglycemia in the SHAM-HF-NT group
compared to the SHAM-SC-NT group (+26%, P = 0.02). Ovariectomy
resulted in hyperglycemia in the OVX-SC-NT group compared to the
SHAM-SC-NT group (+24%, P = 0.04). The HF diet yielded glucose in-
tolerance regardless of OVX in the SHAM-HF-NT group (+ 25%, P =
0.008) and in the OVX-HF-NT group (+22%, P = 0.004) compared to
3.1.6. Plasma biochemistry and adiposity index
The HF groups had higher TC levels than the SC groups: TC was
greater in the SHAM-HF-NT group than in that the SHAM-SC-NT
group (+22%, P = 0.005), and higher in the OVX-HF-NT compared to
that in the OVX-SC-NT group (+21%, P = 0.0001). Likewise, the OVX
yielded higher TC levels in comparison with the SHAM groups: TC was
greater in the OVX-SC-NT groups compared to that in the SHAM-SC-
NT group (+18%, P = 0.02) and higher in the OVX-HF-NT group com-
pared to that in the SHAM-HF-NT group (+21%, P = 0.0008). However,
the TG levels did not differ among the groups.
The HF diet-induced an augment in the adiposity index in compari-
son with the SC diet: the SHAM-HF-NT group had an adiposity index
greater than that compared with the SHAM-SC-NT group. Likewise,
the OVX-HF-NT group showed a greater adiposity index than that of
the OVX-SC-NT group (+60%, P = 0.001). The OVX also induced a rise
of the adiposity index, and the OVX-SC-NT group showed a higher adi-
posity index than the SHAM-SC-NT group (+88%, P = 0.018), as well as
the OVX-HF-NT group, showed a greater adiposity index than that of the

Table 3
Data are the mean and standard error of the mean.

Data Groups

SHAM OVX

SC-NT SC-T HF-NT HF-T SC-NT SC-T HF-NT HF-T

Food intake, g/day/mouse, 1.9 ± 0.08 1.9 ± 0.12 1.8 ± 0.05 1.9 ± 0.07 2.0 ± 0.05 2.1 ± 0.06 2.1 ± 0.11 2.1 ± 0.08
n = 10
[b] [b] [b]
Energy intake, kJ/day/mouse, 30.5 ± 1.31 30.1 ± 2.11 38.5 ± 1.30 38.9 ± 1.72 31.8 ± 0.81 32.6 ± 1.70 43.5 ± 2.13 43.1 ± 1.70[b]
n = 10
Adiposity index, %, n = 10 4.8 ± 1.30 3.8 ± 0.41 9.2 ± 1.10[b] 3.8 ± 0.64[a] 9.1 ± 1.28[*] 3.9 ± 0.51[a] 14.8 ± 0.53[b] 8.0 ± 0.44[a],[b],[*]
Gastrocnemius mass, g, n = 10 0.13 ± 0.02 0.14 ± 0.03 0.13 ± 0.01 0.13 ± 0.01 0.12 ± 0.01 0.12 ± 0.01 0.12 ± 0.02 0.13 ± 0.03
Glycemia, mmol/L, n = 10 5.6 ± 0.60 5.8 ± 0.60 6.9 ± 0.34[b] 6.1 ± 0.72 6.9 ± 0.94[*] 6.0 ± 0.67 7.9 ± 0.39 5.7 ± 0.39[a]
OGTT, AUC, a.u., n = 10 14.3 ± 1.77 13.6 ± 0.742 17.9 ± 1.37[b] 15.2 ± 1.22 17.9 ± 1.17[*] 15.35 ± 0.86 21.8 ± 2.46[b],[*] 15.92 ± 1.41[a]
Total cholesterol, mg/dL, n = 5 101.9 ± 3.12 78.7 ± 4.21[a] 124.3 ± 4.33[b] 95.7 ± 3.61[a],[b] 120.5 ± 6.71[*] 82.4 ± 1.70[a] 150.8 ± 1.54[b],[*] 102.3 ± 4.32[a],[b]
Triacylglycerol, mg/dL, n = 5 53.8 ± 1.40 49.3 ± 1.21 60.1 ± 2.52 53.8 ± 0.91 57.9 ± 1.33 54.4 ± 0.50 57.6 ± 1.71 54.0 ± 0.92

Significant differences are indicated as [a] different from non-trained counterpart; [b] different from SC counterpart and [*] different from the SHAM counterpart (one-way ANOVA and the
posthoc test of Holm–Sidak). Abbreviations: SHAM procedure; OVX, ovariectomy; SC, standard chow; HF, high-fat diet; T, trained and NT, non-trained.
 M. Pimenta et al. / Life Sciences 139 (2015) 75–82 79

SHAM-HF-NT group (+60%, P = 0.0013). These results are summarized in the OVX-HF-NT groups compared to those in the SHAM-HF-NT
in Table 3. group (−80%, P b 0.007 for gene expression and −85%, P b 0.05). The
protein expression (Fig. 3) and the gene expression (Fig. 4) are
3.2. Skeletal muscle gene and protein expression illustrated.

3.2.1. SOD 3.3. Part 2 — effects of exercise (HIIT)

The SOD mRNA expression agreed with protein expression, which is
reduced in the HF groups than that in the SC groups: SHAM-HF-NT
group compared to the SHAM-SC-NT group (− 45%, P = 0.0009 for
gene expression, − 51%, P b 0.0001 for protein expression) and OVX-
HF-NT group compared to the OVX-SC-NT group (− 100%, P = 0.004
for gene expression, −67%, P = 0.02 for protein expression). Likewise,
ovariectomy also decreased the SOD gene and protein expressions in
the skeletal muscle: OVX-SC-NT compared to SHAM-SC-NT (− 60%,
P b 0.0001 for gene expression, − 52%, P b 0.0001 for protein expres-
sion), and OVX-HF-NT compared to SHAM-HF-NT (−100%, P b 0.0001
for gene expression, −67%, P = 0.01 for protein expression).
3.3.1. Body mass and muscle mass
In the first week after starting the HIIT protocol, all trained groups
showed weight loss compared to their non-trained counterparts
(Fig. 1). The HIIT protocol was the unique factor leading to a BM reduc-
tion in the OVX group fed a SC diet (OVX-SC-T group), with no differ-
ence in comparison with the SHAM counterparts fed SC diet. Likewise,
HIIT led to a BM normalization in the OVX groups fed HF diet. In the
end, trained animals did not show BM differences than the non-
trained SC, and both OVX and HF trained groups. Of note, exercise did
not change the gastrocnemius muscle mass significantly (Table 3).

3.2.2. GPx and GR 3.3.2. Food and energy intake

HF did not affect GPx and GR gene and protein expressions in skele-
tal muscles. However, ovariectomy led to a lower protein expression of
both GPx and GPR in the OVX-SC-NT group compared to those in the
SHAM-SC-NT group (GPx − 70%, P = 0.001; GR − 65%, P = 0.0002),
and in the OVX-HF-NT group (GPx − 70%, P = 0.04; GR − 68, P =
0.02) compared to that in the SHAM-HF-NT group (Fig. 3B, C and E).
3.2.3. Catalase
Diet diminished gene and protein catalase expressions: in the OVX-
HF-NT group (−80%, P b 0.005 for gene expression and −83% for pro-
tein expression, P b 0.001) compared to that in the OVX-SC-NT group.
The ovariectomy reduced the catalase mRNA and protein expressions
There was not a difference in food intake between trained and non-
trained groups. However, the groups fed HF diet showed a rise in energy
consumption independently of OVX and/or HIIT (Table 3). In addition,
the SHAM-HF-T group had an energy intake greater than that of the
SHAM-SC-T group (+28%, P = 0.002), as well as the OVX-HF-T group
had an energy intake higher than that of the OVX-SC-T group (+32%,
P b 0.0001).
3.3.3. Systolic blood pressure
HIIT was efficient in reducing the SBP in both OVX, and HF trained
groups: SHAM-HF-T compared to SHAM-HF-NT (− 25%, P b 0.0001);
OVX-SC-T compared to OVX-SC-NT (− 33%, P b 0.0001); OVX-SC-T

Fig. 3. The protein expression of oxidative enzymes in the skeletal muscle (mean and standard error of the mean, n = 5). An endogenous control (beta-actin) was used to normalize the
protein expression. The significant differences are indicated by different symbols (one-way ANOVA and the Holm–Sidak posthoc test). (A) The relative superoxide dismutase expression;
(B) the relative glutathione peroxidase expression; (C) the relative glutathione reductase expression; (D) the relative catalase expression; (E) representative bands (Western blotting anal-
ysis) corresponding to the proteins analyzed in the sequence: superoxide dismutase (SOD); glutathione peroxidase (GPx); glutathione reductase (GSR); catalase and beta-actin. Abbrevi-
ations: SHAM, sham procedure; OVX, ovariectomy; SC, standard chow; HF, high-fat diet; T, trained and NT, non-trained. Symbols: [a] different from the non-trained counterpart; [b]
different from the SC counterpart and [*] different from the SHAM counterpart.
80 M. Pimenta et al. / Life Sciences 139 (2015) 75–82

Fig. 4. The relative mRNA expression levels of oxidative enzymes (mean and standard error of the mean, n = 5). An endogenous control (beta-actin) was used to normalize the expression
of the selected genes. The significant differences are indicated by different symbols (one-way ANOVA and the Holm–Sidak posthoc test). (A) The relative superoxide dismutase expression;
(B) the relative glutathione peroxidase expression; (C) the relative glutathione reductase expression and (D) the relative catalase expression. Abbreviations: SHAM, sham procedure; OVX,
ovariectomy; SC, standard chow; HF, high-fat diet; T, trained and NT, non-trained. Symbols: [a] different from the non-trained counterpart; [b] different from the SC counterpart and [*]
different from the SHAM counterpart.

compared to OVX-SC-NT (−33%, P b 0.0001), and OVX-HF-T compared
to OVX-HF-NT (−28%, P b 0.0001) (Fig. 2).
3.3.4. Fasting glycemia and OGTT
HIIT normalized fasting glycemia in the OVX-HF-T group in compar-
ison with the OVX-HF-NT group (−27%, P = 0.0001). Likewise, the HIIT
protocol reduced the glucose intolerance in the OVX-HF-T compared to
the OVX-HF-NT group (−27%, P b 0.0001).
3.3.5. Adiposity index and plasma biochemistry
HIIT was capable of decreasing the adiposity index in the groups, re-
gardless of OVX and/or diet (SHAM-HF-T) compared to that of SHAM-
HF-NT (−58%, P = 0.002), OVX-SC-T compared to that of OVX-SC-NT
(− 57%, P = 0.002), and OVX-HF-T compared to that of OVX-HF-NT
(−45%, P b 0.0001).
HIIT decreased the TC in all trained groups (SHAM-SC-T compared to
SHAM-SC-NT (−23%, P = 0. 004), SHAM-HF-T compared to SHAM-HF-
NT (−23%, P = 0.0003), OVX-SC-T compared to OVX-SC-NT (−32%, P b
0.0001), and OVX-HF-T compared to OVX-HF-NT (−32%, P b 0.0001).
The TG levels were not significantly different between the groups
(Table 3).
3.4. Skeletal muscle gene and protein expression
3.4.1. SOD
HIIT protocol led to a significant rise in both gene and protein
expressions: SOD was raised in the SHAM-HF-T group compared to
the SHAM-HF-NT group (+ 70%, P = 0.006 for gene expression and
+ 76%, P = 0.04 for protein expression); SOS was also higher in the
OVX-SC-T group than that in the OVX-SC-NT group (+80%, P = 0.02
for gene expression and + 63%, P = 0.03 for protein expression), as
well as SOD was greater in the OVX-HF-T group than that in the
OVX-HF-NT group (+65%, P b 0.0001 for gene expression and +336%,
P b 0.0001 for protein expression).
3.4.2. GPx and GR
GPx and GR were augmented in the ovariectomized HIIT animals:
they were greater in the OVX-SC-T group compared to those in the
OVX-SC-NT group (GPx +1170%, P b 0.0001; GR +1165%, P b 0.0001,
for gene expression and GPx + 182%, P = 0.02; GR +122%, P = 0.02,
for protein expression). They were also greater in the OVX-HF-T group
compared to those the OVX-HF-NT group (GPx + 890%, P b 0.0001;
GR +885%, P b 0.0001 for gene expression and GPx +250%, P = 0.03;
GR +188%, P = 0.04 for protein expression). However, the mRNA ex-
pressions of both GPx and GR were lower in SHAM and HIIT animals:
in the SHAM-SC-T group compared to the SHAM-SC-NT group we saw
GPx − 90% (P b 0.0001), GR − 90%, (P b 0.0001), and in the OVX-HF-
NT group compared to the SHAM-HF-NT group, we saw GPx and GR
−90% (P b 0.0001).
3.4.3. Catalase
The catalase protein expression was lower in the OVX-HF-NT group
compared to the OVX-HF-T group (−82%, P b 0.02), and in the SHAM-
HF-NT group compared to the OVX-HF-NT group (− 83%, P b 0.01),
highlighting the significance of HIIT in augmenting the expression of
this enzyme also observed in the OVX-HF-T group vs. the OVX-HF-NT
group (+ 431%, P b 0.03). Meanwhile, the catalase mRNA expression
was increased in the OVX-HF-T group compared to the OVX-HF-NT
group (+430%, P b 0.02) (Figs. 3 and 4).
 M. Pimenta et al. / Life Sciences 139 (2015) 75–82
3.5. Part 3 — three-way ANOVA interactions
We found a significant interaction between OVX and HF diet in the
data: BM (P = 0.01), adiposity index (P = 0.005). OVX and HIIT also
interacted significantly to modify SBP levels (P b 0.0001), TC levels
(P = 0.004), fasting glycemia (P = 0.005), OGTT (P = 0.009), SOD
gene and protein expressions (P = 0.04), GPx gene and protein expres-
sions (P = 0.003) and GR gene and protein expressions (P = 0.02).
HIIT and HF diet interacted significantly to modify BM (P = 0.002),
SBP (P = 0.004), fasting glycemia (P = 0.005), OGTT (P = 0.007),
adiposity index (P = 0.004), SOD gene and protein expressions (P =
0.006), catalase gene and protein expressions (P = 0.005).
4. Discussion
The current study evaluated the beneficial effects of HIIT (swim-
ming) in female mice submitted to a HF diet and/or ovariectomy. Sever-
al benefits included diminished BM, SBP, glucose intolerance, total
cholesterol levels and amelioration of the OS response of obese and
ovariectomized mice, but the non-trained mice did not show any bene-
ficial effects. The impact of HIIT on these benefits was confirmed by the
three-way ANOVA, and it is important to highlight that that HIIT proto-
col lasted for just seven weeks (35% of the duration of the experiment).
The observations in Fig. 1 lead us to hypothesize that the continuation of
the HIIT program would give rise to a greater BM reduction, and, in fact,
this is a large advantage for overweight or obese individuals, strongly
reducing the risk for cardiovascular and metabolic diseases.
Our results show that HIIT was responsible for the significant BM re-
duction in HF fed animals and in OVX animals. This observation agrees
with various training protocols that yield BM and plasma lipid reduction
in ovariectomized animals fed a HF diet and placed on continuous tread-
mill training [13] or continuous swimming training [14]. In addition,
mice with diet-induced obesity submitted to high- and moderate-
intensity training showed normalization of their ventricular function
and mechanoenergetics [15].
The HF diet has noxious effect in the metabolism and immunological
system in the mouse [16,17]. In women, obesity induced by a high-fat
diet promotes insulin resistance in the ovaries and hyperinsulinemia
[18], which may be the causal pathway linking hyperinsulinism
with ovarian hyperandrogenism and infertility due to obesity [19]. In
addition, the absence of estrogens has a significant effect on obesity in
postmenopausal women [2]. Experimental studies often consider an
ovariectomy associated with a HF diet as an attempt to mimic meno-
pause, and the results resemble the metabolic alterations observed in
women [20,21].
The decline in the estrogen levels, observed in postmenopausal
women and in ovariectomized animals, raises BP. Estrogen regulates
the production of NO synthase, liberating the NO that acts as a potent
vasodilator to reduce BP. Furthermore, the estrogen hormone preserves
endothelial functions, acting as an antioxidant to reduce lipid peroxida-
tion [22,23]. The hypothesis that underlies the obesity–hypertension as-
sociation may be related to adipose tissue dysfunction, which generates
inflammatory cytokines and enhances inflammatory status [17]. In the
current study, we observed a significant increase in SBP, especially in
the OVX animals fed HF diet. A continuous training may be responsible
for the SBP reduction in OVX rats because of the decrease in the OS,
which can be accounted for by the increase in NO bioavailability [24].
In obese humans, HIIT plays a role in reducing BP [25]. Therefore, it is ac-
ceptable to hypothesize that the same occurs in the present study.
OS is responsible for the pathophysiology of numerous chronic dis-
eases, including atherosclerosis, DM2, neurodegenerative disorders
and cancer [26]. Due to the reduction of estrogen production, meno-
pause is accompanied by an increase in OS [27]. Various therapeutic
strategies are used to reduce the deleterious effects of obesity and men-
opause, including a low calorie diet, drugs and exercise [28]. The OS
81
framework resulting from a HF diet is believed to cause a reduction in
antioxidant enzymes and high levels of TBARS [29].
The skeletal muscle is subjected to a higher level of OS during
exercise compared to other organs (i.e., liver and heart) due to the
increased production of reactive oxygen species (ROS). Therefore,
the muscles need greater antioxidant protection against potential
oxidative damage that occurs during and immediately after exercise
[30]. The present results showed low protein expression levels of the
antioxidant enzymes in the groups fed a HF diet, in the OVX groups
and in the association between the HF diet and OVX. The HF diet
led to low SOD protein expression in the SHAM group, which was
lower than that in the HF diet and OVX groups. This reduction in
the SOD protein expression could be due to the presence of SOD at
the first barrier to increase free radical production, as it is responsi-
ble for catalyzing the conversion of the superoxide radical (O2) into
hydrogen peroxide (H2O2) [31].
The glutathione redox cycle (GPx and GR enzymes) had low protein
expression in the OVX and the OVX plus HF diet groups. The GPx
enzyme is the most important antioxidant enzyme involved in the
removal of H2O2. It catalyzes the reaction between a free H2O and O2
radical because it has more affinity for the free radical than catalase
and acts at low H2O2 concentrations [31]. Similar to SOD, GPx may be in-
ducible in the skeletal muscle, and it is reported to enhance skeletal
muscle fibers that are actively recruited during regular exercise [32]. It
is important to highlight that the action of antioxidant enzymes in OS
is variable, and it depends directly on the organ analyzed because the
same enzyme may show different results in different organs [33].
Studies have shown that ovariectomy is responsible for generating
OS in different organs by increasing lipid peroxidation and reducing an-
tioxidant enzymes [34,35]. This happens due to a decrease in estrogen,
which generates an increase in OS that is dependent on the chemical
structure and the concentration of estrogen. Specifically, at high concen-
trations, estrogen tends to have a beneficial antioxidant effect by
inhibiting the 8-hydroxylation of the guanine bases in DNA. However,
at lower concentrations, estrogen has a pro-oxidant effect, particularly
when its chemical structure contains a catechol. These effects include
breaks in the genetic material, the formation of DNA adducts, and the
oxidation of bases [36]. Additionally, there is an increase in serum con-
centrations of inflammatory cytokines and pro-oxidant factors due to
menopause, suggesting the onset of OS [37,38].
HIIT improved the OS condition that developed due to OVX and
the HF diet. This improvement was characterized by a reduction in
the TBARS levels, increased protein levels of antioxidant enzymes
in the muscle and, therefore, increased mRNA expression of antioxi-
dant enzymes in the trained animals. The best strategy to increase
the levels of endogenous antioxidants may actually be physiological-
ly transient pulses of OS itself [39]. HIIT may increase the acute effect
of OS, but the system adapts when it is a chronic stimulus [40]. Al-
though the literature has confirmed the enhancement of the oxida-
tive profile with exercise training [24], the little exercise training
contribution in regards to improving oxidative profiles has been re-
ported [41,42]. In the present study, HIIT positively altered the pro-
tein and gene expression of several antioxidant enzymes, which is
in agreement with the literature [43,44].
5. Conclusions
The current findings demonstrated that diet-induced obesity maxi-
mizes the deleterious effects of an ovariectomy. The HIIT program re-
quires a few weekly sessions, with a short duration of each training
session, which is a significant argument to motivate people to include
training in their daily lives. HIIT has several beneficial effects, including
reducing BM, SBP, glucose intolerance and OS. Therefore, we suggest
that HIIT diminishes the increased risk of cardiovascular and metabolic
disorders that are inherent to obesity and menopause.
82 M. Pimenta et al. / Life Sciences 139 (2015) 75–82
Author contributions
MP performed the experiment and care of animals, acquisition of
data, and analysis and interpretation of data. IKSM, IB, and VSM per-
formed the analysis and interpretation of data. MBA made substantial
contributions to the concept and design of the work and revised the
manuscript critically for important intellectual content. CAML con-
ceived the work and was critically involved in writing, revising and pre-
paring the manuscript, and approved the final version. All authors read
and approved the final manuscript.
Conflict of interest
The authors declare that there are no conflicts of interest.
Acknowledgments
The authors would like to thank Mrs. Aline Penna for her technical
assistance, Mr. Guilherme Sa for his help in executing the training to
the CNPq (Brazilian Council of Science and Technology, www.cnpq.br,
grant # 302.154/2011-6 to CAML) and FAPERJ (Rio de Janeiro State
Foundation for Scientific Research, www.faperj.br, grant # E-26/
201.186/2014 to CAML) agencies.
References
[1] S.H. Chang, T.S. Beason, J.M. Hunleth, G.A. Colditz, A systematic review of body fat
distribution and mortality in older people, Maturitas 72 (3) (2012) 175–191.
[2] F. Lizcano, G. Guzman, Estrogen deficiency and the origin of obesity during meno-
pause, Biomed. Res. Int. 2014 (2014) 757461.
[3] R. Sandhir, N. Sethi, A. Aggarwal, A. Khera, Coenzyme Q10 treatment ameliorates
cognitive deficits by modulating mitochondrial functions in surgically induced men-
opause, Neurochem. Int. 74 (2014) 16–23.
[4] Y. Wang, B. Li, W. Zhang, et al., Impaired PI3 K Akt expression in liver and skeletal
muscle of ovariectomized rats, Endocrine 44 (3) (2013) 659–665.
[5] A. Ludgero-Correia Jr., M.B. Aguila, C.A. Mandarim-de-Lacerda, T.S. Faria, Effects of
high-fat diet on plasma lipids, adiposity, and inflammatory markers in ovariecto-
mized C57BL/6 mice, Nutrition 28 (3) (2012) 316–323.
[6] S. Jeong, M. Yoon, Swimming's prevention of ovariectomy-induced obesity through
activation of skeletal-muscle PPARalpha, Int. J. Sport Nutr. Exercise Metab 22 (1)
(2012) 1–10.
[7] F. Iellamo, G. Caminiti, B. Sposato, et al., Effect of high-intensity interval training ver-
sus moderate continuous training on 24-h blood pressure profile and insulin resis-
tance in patients with chronic heart failure, Intern. Emerg. Med. 9 (5) (2014)
547–552.
[8] M.J. Gibala, J.P. Little, M.J. Macdonald, J.A. Hawley, Physiological adaptations to low-
volume, high-intensity interval training in health and disease, J. Physiol. 590 (Pt 5)
(2012) 1077–1084.
[9] T. Moholdt, E. Madssen, O. Rognmo, I.L. Aamot, The higher the better? Interval train-
ing intensity in coronary heart disease, J. Sci. Med. Sport 17 (5) (2014) 506–510.
[10] P.G. Reeves, F.H. Nielsen, G.C. Fahey Jr., AIN-93 purified diets for laboratory rodents:
final report of the American Institute of Nutrition ad hoc writing committee on the
reformulation of the AIN-76A rodent diet, J. Nutr 123 (11) (1993) 1939–1951.
[11] V.F. Motta, M.B. Aguila, C.A. Mandarim-De-Lacerda, High-intensity interval training
(swimming) significantly improves the adverse metabolism and comorbidities in
diet-induced obese mice. J. Sports Med. Phys. Fitness (2015) (PMID: 25665746,
http://www.minervamedica.it/en/journals/sports-med-physical-fitness/article.
php?cod=R40Y9999N00A150034).
[12] S. Barbosa-da-Silva, J.C. Fraulob-Aquino, J.R. Lopes, C.A. Mandarim-de-Lacerda, M.B.
Aguila, Weight cycling enhances adipose tissue inflammatory responses in male
mice, PLoS One 7 (7) (2012), e39837.
[13] N. Zoth, C. Weigt, S. Zengin, et al., Metabolic effects of estrogen substitution in com-
bination with targeted exercise training on the therapy of obesity in ovariectomized
Wistar rats, J. Steroid Biochem. Mol. Biol 130 (1-2) (2012) 64–72.
[14] S.A. Melton, M. Hegsted, M.J. Keenan, et al., Swimming eliminates the weight gain
and abdominal fat associated with ovariectomy in the retired breeder rat despite
high-fat diet selection, Appetite 35 (1) (2000) 1–7.
[15] A.D. Hafstad, J. Lund, E. Hadler-Olsen, A.C. Hoper, T.S. Larsen, E. Aasum, High-
and moderate-intensity training normalizes ventricular function and
mechanoenergetics in mice with diet-induced obesity, Diabetes 62 (7)
(2013) 2287–2294.
[16] J.C. Fraulob, R. Ogg-Diamantino, C.F. Santos, M.B. Aguila, C.A. Mandarim-de-Lacerda,
A mouse model of metabolic syndrome: insulin resistance, fatty liver and non-
alcoholic fatty pancreas disease (NAFPD) in C57BL/6 mice fed a high fat diet, J.
Clin. Biochem. Nutr. 46 (3) (2010) 212–223.
[17] M. Catta-Preta, M.A. Martins, T.M. Cunha Brunini, A.C. Mendes-Ribeiro, C.A.
Mandarim-de-Lacerda, M.B. Aguila, Modulation of cytokines, resistin, and distribu-
tion of adipose tissue in C57BL/6 mice by different high-fat diets, Nutrition 28 (2)
(2012) 212–219.
[18] E.H. Akamine, A.C. Marcal, J.P. Camporez, et al., Obesity induced by high-fat diet pro-
motes insulin resistance in the ovary, J. Endourol. 206 (1) (2010) 65–74.
[19] S. Wu, S. Divall, A. Nwaopara, et al., Obesity-induced infertility and hyperandrogenism
are corrected by deletion of the insulin receptor in the ovarian theca cell, Diabetes 63
(4) (2014) 1270–1282.
[20] J.P. Camporez, F.R. Jornayvaz, H.Y. Lee, et al., Cellular mechanism by which estradiol
protects female ovariectomized mice from high-fat diet-induced hepatic and muscle
insulin resistance, Endocrinology 154 (3) (2013) 1021–1028.
[21] T.S. Faria, A.L. Correia Jr., T.L. dos Anjos, M.B. Aguila, C.A. Mandarim-de-Lacerda, Ad-
verse association between obesity and menopause in mice treated with bezafibrate,
a pan peroxisome proliferator-activated receptor agonist, Menopause 20 (12)
(2013) 1264–1274.
[22] R. Lopez-Grueso, J. Gambini, K.M. Abdelaziz, et al., Early, but not late onset estrogen
replacement therapy prevents oxidative stress and metabolic alterations caused by
ovariectomy, Antioxid. Redox Signal. 20 (2) (2014) 236–246.
[23] L. Malone, C. Schuler, R.E. Leggett, R.M. Levin, Effect of estrogen and ovariectomy on
response of the female rabbit urinary bladder to two forms of in vitro oxidative
stress, Int. Urogynecol. J. 25 (6) (2014) 791–798.
[24] M.C. Irigoyen, J. Paulini, L.J. Flores, et al., Exercise training improves baroreflex sen-
sitivity associated with oxidative stress reduction in ovariectomized rats, Hyperten-
sion 46 (4) (2005) 998–1003.
[25] A.E. Tjonna, S.J. Lee, O. Rognmo, et al., Aerobic interval training versus continuous
moderate exercise as a treatment for the metabolic syndrome: a pilot study, Circu-
lation 118 (4) (2008) 346–354.
[26] K. Green, M.D. Brand, M.P. Murphy, Prevention of mitochondrial oxidative damage
as a therapeutic strategy in diabetes, Diabetes 53 (Suppl 1) (2004) S110–S118.
[27] V. Bittner, Menopause, age, and cardiovascular risk: a complex relationship, J. Am.
Coll. Cardiol. 54 (25) (2009) 2374–2375.
[28] D. Jimenez-Pavon, M.A. Sese, I. Huybrechts, et al., Dietary and lifestyle quality indices
with/without physical activity and markers of insulin resistance in European adoles-
cents: the HELENA study, Br. J. Nutr 110 (10) (2013) 1919–1925.
[29] P. Jayakumar, K.V. Pugalendi, M. Sankaran, Attenuation of hyperglycemia-mediated
oxidative stress by indole-3-carbinol and its metabolite 3, 3′-diindolylmethane in
C57BL/6J mice, J. Physiol. Biochem. 70 (2) (2014) 525–534.
[30] L.L. Ji, Exercise and oxidative stress: role of the cellular antioxidant systems, Exerc.
Sport Sci. Rev. 23 (1995) 135–166.
[31] S.K. Powers, M.J. Jackson, Exercise-induced oxidative stress: cellular mechanisms
and impact on muscle force production, Physiol. Rev. 88 (4) (2008) 1243–1276.
[32] Y. Hellsten, F.S. Apple, B. Sjodin, Effect of sprint cycle training on activities of antiox-
idant enzymes in human skeletal muscle, J. Appl. Physiol. 81 (4) (1996) 1484–1487.
[33] S.A. Noeman, H.E. Hamooda, A.A. Baalash, Biochemical study of oxidative stress
markers in the liver, kidney and heart of high fat diet induced obesity in rats,
Diabetol. Metab. Syndr. 3 (1) (2011) 17.
[34] M.S. Evsen, A. Ozler, C. Gocmez, et al., Effects of estrogen, estrogen/progesteron com-
bination and genistein treatments on oxidant/antioxidant status in the brain of
ovariectomized rats, Eur. Rev. Med. Pharm. Sci 17 (14) (2013) 1869–1873.
[35] G. Kaur, S. Mishra, A. Kaur, A. Sehgal, K.S. Nageswari, R. Prasad, Retention of ovaries
and oxidative stress of surgery, Int. J. Gynaecol. Obstet. 97 (1) (2007) 40–43.
[36] Z. Wang, E.R. Chandrasena, Y. Yuan, et al., Redox cycling of catechol estrogens gen-
erating apurinic/apyrimidinic sites and 8-oxo-deoxyguanosine via reactive oxygen
species differentiates equine and human estrogens, Chem. Res. Toxicol. 23 (8)
(2010) 1365–1373.
[37] R.R. McLean, Proinflammatory cytokines and osteoporosis, Curr. Osteoporos. Rep 7
(4) (2009) 134–139.
[38] S.S. Signorelli, S. Neri, S. Sciacchitano, et al., Behaviour of some indicators of oxida-
tive stress in postmenopausal and fertile women, Maturitas 53 (1) (2006) 77–82.
[39] T. Finkel, N.J. Holbrook, Oxidants, oxidative stress and the biology of ageing, Nature
408 (6809) (2000) 239–247.
[40] G.C. Bogdanis, P. Stavrinou, I.G. Fatouros, et al., Short-term high-intensity interval
exercise training attenuates oxidative stress responses and improves antioxidant
status in healthy humans, Food Chem. Toxicol. 61 (2013) 171–177.
[41] L. Al-Nakkash, T. Janjulia, K. Peterson, et al., Genistein and exercise do not improve
cardiovascular risk factors in the ovariectomized rat, Climacteric 17 (2) (2014)
136–147.
[42] U.B. Macedo, R.R. Martins, F.P. Freire Neto, et al., Oophorectomy hinders antioxidant
adaptation promoted by swimming in Wistar rats, Appl. Physiol. Nutr. Metab. 38 (2)
(2013) 148–153.
[43] M.M. Domingos, M.F. Rodrigues, U.S. Stotzer, et al., Resistance training restores the
gene expression of molecules related to fat oxidation and lipogenesis in the liver
of ovariectomized rats, Eur. J. Appl. Physiol. 112 (4) (2012) 1437–1444.
[44] D.J. Mahoney, G. Parise, S. Melov, A. Safdar, M.A. Tarnopolsky, Analysis of global
mRNA expression in human skeletal muscle during recovery from endurance exer-
cise, FASEB J. 19 (11) (2005) 1498–1500.