See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/373107544

Genotypic identification of hypervirulent Klebsiella pneumoniae in Anbar,

Iraq

Article in Malaysian Journal of Microbiology · August 2023

DOI: 10.21161/mjm.230269

CITATIONS READS

0 40

3 authors, including:

Abdulbaset Mohammed Thamer Yousif Mutter

University of Anbar University of Anbar
1 PUBLICATION 0 CITATIONS 19 PUBLICATIONS 14 CITATIONS

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Sphingomonas -- Molecular genetics View project

Proteins in Lactococcus lactis View project

All content following this page was uploaded by Thamer Yousif Mutter on 30 September 2023.

The user has requested enhancement of the downloaded file.

Malaysian Journal of Microbiology, Vol 19(5) 2023, pp. 527-534
DOI: http://dx.doi.org/10.21161/mjm.230269

Malaysian Journal of Microbiology

Published by Malaysian Society for Microbiology
(In since 2011)

Genotypic identification of hypervirulent Klebsiella pneumoniae in Anbar, Iraq

Abdulbaset Mohammed Al-Fahdawi1, Thamer Yousif Mutter1* and Gerben John Zylstra2
1Department of Biology, College of Science, University of Anbar, Ramadi, Anbar, Iraq.
2Department of Biochemistry and Microbiology, School of Environmental and Biological Sciences, Rutgers University,
New Brunswick, New Jersey, USA.
Email: mthamir78@uoanbar.edu.iq

Received 1 May 2023; Received in revised form 25 July 2023; Accepted 7 August 2023

ABSTRACT

Aims: The aim of this study was to identify hypervirulent clinical Klebsiella pneumoniae isolates from Anbar (Iraq) and
differentiate them from classical isolates using molecular markers and capsule serotyping.
Methodology and results: Between June and December 2022, we gathered a total of 100 K. pneumoniae isolates from
patients with hospital-acquired infections in four prominent hospitals located in Anbar province. We performed the
identification of all isolates using biochemical tests and the VITEK2 compact system. Hypervirulent genes were detected
using PCR and multiplex PCR. Five virulent genes, namely, iucA, iroB, rmpA, rmpA2 and peg344, were considered in
the study. Each isolate was serotyped using six capsular serotypes, K1, K2, K5, K20, K54 and K57. Three genes, iucA,
iroB and rmpA were detected by PCR. The most prevalent gene identified was iucA (23%). Serotyping results identified
four capsular types among the 100 isolates, with K2 (71.2%) being the most predominant type. Of the 100 isolates, 18
(18%) K. pneumonia isolates were identified as hypervirulent. According to the presence of the virulent genes, four
virulent types (VP) were determined, namely, VP1, VP2, VP3 and VP4, with VP3 being the most common among the
four types.
Conclusion, significance and impact of study: Eighteen hypervirulent K. pneumoniae strains were identified using
molecular markers. The results indicate that hypervirulent K. pneumoniae infections are emerging in Anbar province and
need active monitoring to minimize spreading through the region.

Keywords: Hypervirulent, K. pneumoniae, molecular markers, serotyping

INTRODUCTION and Mecsas, 2016). However, infections caused by hvKp

Klebsiella pneumoniae has been known to cause many
infections in humans for over a century. However, the
bacterial factors that enables causing these illnesses
were unclear (Walker and Miller, 2020). For decades, K.
pneumoniae was classified into two distinct groups of
clinical isolates (two pathotypes). Classical strains (cKp)
are known as carbapenem-resistant (CR) that are usually
isolated from patients with some degree of
immunocompromise and hypervirulent strains (hvKp) are
known as carbapenem-sensitive (CS), which are
associated with community-acquired invasive infections
(Paczosa and Mecsas, 2016; Sellick and Russo, 2018;
Russo and Marr, 2019).
While both pathotypes are widespread pathogens, the
Asian Pacific Rim has recorded an increase in the
prevalence of infections caused by hvKp over the past
three decades. In contrast, cKp has been the main
causative agent of pneumonia, urinary tract infections and
bloodstream infections in Western nations (Paczosa
are now increasingly being recognized (Russo and Marr,
2019).
There is a strong correlation between the
hyperproduction of an extracellular polysaccharide
(capsule), a hypermucoviscous (HMV) colony phenotype
and the hypervirulence factors of hvKp strains. Recent
research has begun to elucidate the relationship between
those factors (Walker and Miller, 2020).
A positive string test, a routine microbiological test to
define hypermucoviscosity, is widely used to identify the
hypermucoviscous phenotype and differentiate the
hypervirulent from the classical K. pneumoniae when a
loop touched to a colony and stretched away at least five
millimeters from the colony (Fang et al., 2004).
Nevertheless, several factors, such as culture condition,
colony age and user techniques, can affect the string test
results, making the test not quantitative. Moreover, not all
hvKp strains show or have hypermucoviscous, which is,
in turn, this characteristic found in some cKp (Catalán-
Nájera et al., 2017; Russo et al., 2018). Several studies

*Corresponding author
527 ISSN (print): 1823-8262, ISSN (online): 2231-7538
Malays. J. Microbiol. Vol 19(5) 2023, pp. 527-534
DOI: http://dx.doi.org/10.21161/mjm.230269
indicated that the rate of cKp strains positivity to string
test ranged between 17% and 23% (Fang et al., 2004;
Lee et al., 2010).
Infections with K. pneumonia are increasing worldwide
and the low accuracy of string tests to differentiate
between the two pathotypes raised the need for new
identification tests (Lan et al., 2021). So, a more accurate
diagnostic test is required to differentiate between the two
pathotypes. Recently, gene biomarkers were used to
distinguish between the two pathotypes, proving that
genetic markers better predict hvKp than the string test
(Russo and Marr, 2019). Recent research used
bioinformatic analyses to locate and predict genes
associated with hypervirulence Klebsiella, including iucA,
iroB, rmpA, rmpA2 and peg344 (Hsu et al., 2011; Follador
et al., 2016; Wyres et al., 2016).
Most of these genes are found to be encoded on a
highly conserved virulence plasmid and some of them can
be integrated into the chromosome as part of an ICE
element (Chen et al., 2004; Lam et al., 2018). The
hypervirulence-associated genes iroB (salmochelin) and
iucA (aerobactin) encode siderophore systems associated
with hvKp (Lam et al., 2018; Walker and Miller, 2020).
Additionally, rmpA (a regulatory of protein A) and rmpA2
(a transcriptional regulator), required for capsule
formation, were also associated with the virulence of
hvKp strains (Hsu et al., 2011; Paczosa and Mecsas,
2016).
Although hvKP has been identified in various
countries, data from Iraq is lacking. This study aimed to
identify hvKp isolates using virulence markers (iucA, iroB,
rmpA, rmpA2 and peg-344) and to determine capsule
types among K. pneumoniae isolates clinically collected
from Anbar, Iraq.
MATERIALS AND METHODS
Sample collection
A total of 623 participants suffering from different
infections attending Ramadi Teaching Hospital, Ramadi
Hospital for Women and Children, Fallujah Teaching
Hospital, and Fallujah Hospital for Women and Children
were subjects of this study. Clinical isolates of K.
pneumoniae were collected from four major hospitals
(mentioned above) throughout the Al-Anbar governorate
of western Iraq between June and December 2022.
Patients with suspected infection due to K. pneumoniae
(pneumonia, urinary tract infection and wound infection)
were included in this study. Whereas patients that are not
suspected of having K. pneumoniae infections (gastritis
and enteritis) were excluded from this study. Also,
patients undergoing antibiotic treatment were excluded.
Ethical approval
This study was performed in accordance with the
principles of the Declaration of Helsinki. Ethical approval
was obtained from the research committee of Al-Anbar
Directorate of Health (authority of Al-Anbar hospitals)
528
under decision No. 2022054 on 24/7/2022. Ethical
approval was granted by the Ethics Committee of the
University of Anbar (No.88-2023). All participants were
informed about the study before getting their written
consent.
Isolates identification
Klebsiella pneumoniae isolates were first identified with
traditional and biochemical tests such as cultural,
microscopic and biochemical tests. All isolates were
tested by growing on MacConkey agar, Gram stain and
biochemical tests such as indole, methyl red, Voges-
Proskauer, citrate utilization, catalase, oxidase and
urease (Mahon and Lehman, 2022). Then, the diagnosis
of all isolates was confirmed by using VITEK2 compact
system using a G-ve bacterial card (ID-GNB) following the
manufacturer’s instructions.
String test
Blood agar was used to grow K. pneumoniae isolates and
incubated overnight at 37 °C. A loop was used to conduct
the string test by touching the colony and lifting it away
from the colony surface. A positive string test (HMV) is
defined as a mucoid >5 mm in length (Lee et al., 2006).
Molecular markers to identify hypervirulent K.
pneumoniae
Total genomic DNA was extracted using Wizard®
Genomic DNA Purification Kit (Promega, USA) following
the manufacturers’ instructions. PCR analysis was carried
out using GoTaq® Hot Start Green Master Mix (Promega,
USA).
Five genes, including iucA, rmpA, rmpA2, peg344 and
iroB were tested using PCR to differentiate between hvKp
and cKp (Russo et al., 2018). All primers used in this
study are listed in Table 1. PCR conditions to amplify the
above-mentioned genes were (per reaction) 10 µL of 2×
GoTaq® Hot Start Green Master Mix, 1 µL of forward
primer, 1 µL of reverse primer (final concentration 0.2
µg/µL), 1 µL of genomic DNA (60 ng/µL) and 7 µL of
nuclease-free water. PCR was performed using a Bio-
Rad T100 Thermal Cycler (UK) under the following
cycling conditions: denaturation at 94.0 °C for 30 sec,
annealing (Tm is variable as listed in Table 1) for 30 sec
and extension at 72 °C for 1 min for 25 cycles.
Capsule typing
PCR reaction was used to detect capsule types, including
K1, K2, K5, K20, K54 and K57, as described previously
(Turton et al., 2010). All primers used in serotyping are
listed in Table 2. All positive bands were confirmed by
uniplex PCR as follows: each PCR reaction was carried
out in 20 µL volumes: 10 µL of 2× GoTaq® Hot Start
Green Master Mix, 1 µL of forward primer, 1 µL of reverse
primer (final concentration 0.2 µg/µL), 1 µL of genomic
DNA (60 ng/µL) and 7 µL of nuclease-free water. PCR
ISSN (print): 1823-8262, ISSN (online): 2231-7538
Malays. J. Microbiol. Vol 19(5) 2023, pp. 527-534
DOI: http://dx.doi.org/10.21161/mjm.230269

Table 1: Primers used for virulence gene detection.

Primer Estimated Annealing

Primer sequence 5′→3′ Source
target product size (bp) temperature (°C)
F-GAGTAGTTAATAAATCAATAGCAAT
rmpA 332 53* Russo et al. (2018)
R-CAGTAGGCATTGCAGCA
F-GTGCAATAAGGATGTTACATTA
rmpA2 451 50* Russo et al. (2018)
R-GGATGCCCTCCCTCCTG
F-GCTTATTTCTCCCCAACCC
iucA 583 56* Russo et al. (2018)
R-TCAGCCCTTTAGCGACAAG
F-ATCTCATCATCTACCCTCCGCTC
iroB 235 54* Russo et al. (2018)
R-GGTTCGCCGTCGTTTTCAA
F-AAAGGACAGAAAGCCAGTG
peg-344 411 53* Russo et al. (2018)
R-CAATGACGAGGGGGATAATC
*Tm annealing for each set of primers was determined by PCR troubleshooting to achieve a better result; F, forward; R, reverse.

Table 2: Primers used for detection of capsule type.

Annealing Estimated
Capsule Primer
Primer sequence 5′→3′ temperature product size Source
type name
(°C) (bp)
MagAF1 GGTGCTCTTTACATCATTGC Fang et al.
K1 58* 1283
MagAR1 GCAATGGCCATTTGCGTTAG (2004)
K2wzy-F1 GACCCGATATTCATACTTGACAGAG Turton et al.
K2 58* 641
K2wzy-R1 CCTGAAGTAAAATCGTAAATAGATGGC (2008)
K5wzxF360 TGGTAGTGATGCTCGCGA Turton et al.
K5 58* 280
K5wzxR639 CCTGAACCCACCCCAATC (2008)
wzxK54F CATTAGCTCAGTGGTTGGCT Fang et al.
K54 58* 881
wzxK54R GCTTGACAAACACCATAGCAG (2007)
wzyK57F CTCAGGGCTAGAAGTGTCAT Fang et al.
K57 58* 1037
wzyK57R CACTAACCCAGAAAGTCGAG (2007)
wzyK20F CGGTGCTACAGTGCATCATT Fang et al.
K20 58* 741
wzyK20R GTTATACGATGCTCAGTCGC (2007)
*Tm annealing for each set of primers was determined by PCR troubleshooting to achieve a better result; F, forward; R, reverse.

sec, annealing at 58 °C for 30 sec and extension at 72 °C

for 1 min.

Statistical analysis

Chi-square or Fisher’s exact test (two-tailed) was used for

analyzing and comparing all variables. All statistical
analyses were performed using GraphPad Prism version
8, GraphPad Software, San Diego, California, USA.
P<0.05 was considered statistically significant.

RESULTS

Isolate identification

One hundred K. pneumonia isolates were isolated from

Figure 1: String test shows the mucoid filament of K.
pneumoniae isolates.
reactions were performed under the following cycling
conditions: 25 cycles of denaturation at 94.0 °C for 30
623 patients with hospital-acquired infections attending
the four hospitals mentioned in the methods. All isolates
were identified by Gram stain and biochemical tests
mentioned in the methods and confirmed by VITEK2. The
main infection site was urinary tract infection (n=44),
burns (n=23), pneumonia (n=19), bacteremia (n=9) and
wounds (n=5) (see Table 3).

529 ISSN (print): 1823-8262, ISSN (online): 2231-7538

Malays. J. Microbiol. Vol 19(5) 2023, pp. 527-534
DOI: http://dx.doi.org/10.21161/mjm.230269

Figure 2: PCR results of virulence genes. L: Ladder 100-1200 bp; A: iucA bands with 583 bp; B: iroB bands with 235
bp; C: rmpA bands with 332 bp.

Table 3: Gene biomarkers distribution according to the source of isolation.

Source
Total
Biomarker Urine Burns Sputum Blood Wounds
positives
(n=44) (n=23) (n=19) (n=9) (n=5)
Phenotype
String test 51 16 (36.3%) 8 (34.7%) 15 (78.9%) 9 (100%) 3 (60%)
Molecular marker
iucA 23 7 (15.9%) 4 (17.4%) 4 (21.1%) 8 (88.9%) 0
iroB 17 7 (16%) 2 (8.7%) 1 (5.3%) 6 (67%) 1 (20%)
rmpA 17 7 (15.9%) 0 6 (31.6%) 3 (33.3%) 1 (20%)
rmpA2 0 0 0 0 0 0
peg344 0 0 0 0 0 0
Serotyping
K1 0 0 0 0 0 0
K2 19 8 (18.2%) 2 (8.7%) 3 (15.8%) 6 (66.7%) 0
K5 0 0 0 0 0 0
K20 13 5 (11%) 4 (17%) 2 (11%) 2 (22%) 0
K54 10 3 (6.8%) 1 (4.3%) 5 (26%) 0 1 (20%)
K57 6 3 (6.8%) 1 (4.3%) 1 (5.3%) 1 (11%) 0

Identification of the hypermucoviscous phenotype by
string test
Fifty-one of the isolates were determined as
hypermucoviscous (HMV) using the string test (Figure 1).
All isolates that were isolated from blood (100%) were
positive for the string test, followed by sputum (78.9%),
wounds (60%), urine (36.3%) and burns (34.7%), as
shown in Table 3.
Identification of the hypervirulent pathotypes by
molecular markers
The 100 K. pneumoniae isolates were evaluated using
five virulence genes associated with hypervirulent K.
pneumoniae mentioned in the methods. The results
showed that iucA was the most abundant gene (23%),
followed by iroB (17%) and rmpA (17%). No isolates were
detected carrying the genes rmpA2 or peg344. The genes
iucA (88.9%), iroB (67%) and rmpA (33.3%) were highly
abundant among the blood isolates compared to other
sources (Figure 2; Table 3).
Serotyping
The capsule types of K2, K20, K54 and K57 were
detected using PCR in 48 isolates among the 100 isolates
(Figure 3). The most prevalent capsular type detected
was K2 (19%), followed by K20 (13%), K54 (10%) and
K57 (6%). No isolates were detected by PCR carrying K1
or K5. K2 was the most prevalent type (66.7%) among the
blood isolates, whereas K54 was the most prevalent type
(26%) among sputum isolates, Table 3. Among hvKp
isolates, K2 was the most prevalent serotype, with 71.2%,
followed by K20 (11.1%), K54 (11.1%) and K57 (5.5%)
(Table 4).

530 ISSN (print): 1823-8262, ISSN (online): 2231-7538

Malays. J. Microbiol. Vol 19(5) 2023, pp. 527-534
DOI: http://dx.doi.org/10.21161/mjm.230269

Figure 3: PCR results of serotyping. L: ladder 100-1200 bp; A-left: K2 capsule type bands with 641 bp; A-right: K20
capsule type bands with 741 bp; B-left: K54 capsule type bands with 881 bp; B-right: K57 capsule type bands with 1037
bp.

Table 4: Prevalence of capsular type among hvKP.

Serotypes
K2 K20 K54 K57
hvKp (n=18) 13 (71.2%) 2 (11.1%) 2 (11.1%) 1 (5.5%)

Table 5: Characteristics of hypervirulent and classical K. pneumonia.

Strain group (n) Capsule VP profile No. of Virulence marker HMV

type isolates iucA iroB rmpA rmpA2 peg344 (n)
hvKp (18) K2 VP1 3 + + + - - 3
K2 VP2 4 - + + - - 4
K2 VP3 5 + + - - - 5
K2 VP4 1 + - + - - 1
K20 VP3 1 + + - - - 1
K20 VP4 1 + - + - - 1
K54 VP2 2 - + + - - 1
K57 VP3 1 + + - - - 1
cKp (82) K2 NV 1 - - + - - 1
K2 NV 4 + - - - - 2
K2 NV 1 - - - - - 0
K20 NV 2 + - - - - 1
K20 NV 1 - - + - - 1
K20 NV 8 - - - - - 6
K54 NV 2 + - - - - 2
K54 NV 2 - - + - - 2
K54 NV 4 - - - - - 3
K57 NV 2 + - - - - 2
K57 NV 1 - + - - - 0
K57 NV 2 - - + - - 2
NC NV 1 + - - - - 0
NC NV 51 - - - - - 12
hvKp: hypervirulent K. pneumonia; cKP: classical K. pneumonia; HMV: hypermucoviscous phenotype; NC: no capsular type detected.

Virulence marker profile association
hypermucoviscous phenotype
A K. pneumoniae isolate was defined as hvKp if two or
more of the five virulence markers (iucA, iroB, rmpA,
rmpA2 and peg344) were detected by PCR in the same
isolate. Out of the 100 K. pneumoniae isolates, 18
with isolates carried two or three of the five virulence genes
chosen in the study. Four virulence gene profiles were
determined in this study, as shown in Table 5. The most
common gene profile was VP3 (iucA+, iroB+, rmpA-,
rmpA2- and peg344-) (n=7), followed by VP2 (n=6), VP1
(n=3) and VP4 (n=2). There was a high association
between the gene profile and the hypermucoviscousity

531 ISSN (print): 1823-8262, ISSN (online): 2231-7538

Malays. J. Microbiol. Vol 19(5) 2023, pp. 527-534
DOI: http://dx.doi.org/10.21161/mjm.230269
Table 6: Association of carrying a molecular marker with hypermucoviscousity.
Molecular marker
String test
iucA (n=23) iroB (n=17)
Positive 19 (82.6%) 15 (88%)
Negative 4 (17.4%) 2 (12%)
P-value <0.001 <0.001
among VP1 (positive string test=3), VP3 (positive string
test=7) and VP4 (positive string test=2). However, one
isolate among VP2 was negative for the string test
(positive string test=5).
Phenotypic evidence of hypermucoviscousity (string
test) and the PCR analysis of molecular markers
indicated that the highest association was between
carrying rmpA and the hypermucoviscousity with 94.1%
(P value<0.001) followed by iroB (88%) and iucA (82.6%),
Table 6.
DISCUSSION
This study used molecular markers to determine and
differentiate between hvKp and cKp among patients
attending major hospitals in Anbar province (Iraq).
Even though hypervirulent K. pneumoniae (hvKp)
isolates are less resistant to antibiotics than classical
isolates (cKp) (Li et al., 2014), hvKp isolates are rising
variants that cause serious community-acquired infection
and exhibit the hypermucoviscous (HMV) phenotype
(Shon et al., 2013). The string test is a widely used
marker to detect HMV. The hypermucoviscosity
phenotype was detected in 51% of the isolates. Our
results agree with previous studies that showed the
percentage of HMV among isolates was 35.7% in central
Iraq (Ali and Sana’a, 2019) and 40% in a study conducted
in Egypt (Abd-Elmonsef et al., 2016). Previous studies
used string tests widely to identify hvKp strains (Li et al.,
2014; Yao et al., 2015; Li et al., 2018). However, several
in vitro and in vivo experiments demonstrated that K.
pneumoniae with high mucoviscosity is not directly
associated with high virulence, making the string test for
separating hvKp and non-hvKp controversial (Zhang et
al., 2015; Russo et al., 2018). They pointed out that the
string test should not be utilized as a final diagnostic test
for hvKp, especially in low-prevalence areas where its
performance characteristics may result in significantly
more inaccurate classifications than the other more
precise markers. Genetic biomarkers were recently
shown to give more accurate results in differentiating
between hvKp and cKp. Five genes, including iroB, iucA,
rmpA, rmpA2 and peg344 served as excellent and
precise markers to distinguish hypervirulent K.
pneumoniae than the string test (Russo et al., 2018).
Our investigation used a combination of genetic
biomarkers to differentiate between the two pathotypes.
Our results indicated that of the 100 isolates, 18 (18%)
carried two or three virulence genes. iucA, iroB and rmpA
were the most prevalent among the five genes tested.
These genes are highly associated with hvKp isolates
with an accuracy of >95% (Russo et al., 2018). However,
532
rmpA (n=17) rmpA2 (n=0) peg344 (n=0)
16 (94.1%) 0 0
1 (5.9%) 0 0
<0.001 NA NA
PCR did not detect any isolates of the 100 carryings
rmpA2 or peg344 gene.
Our results indicated that hvKp accounted for 18%
(18/100). This is the only and the highest rate reported in
Iraq using gene combinations to identify hvKp isolates.
The result is consistent with a study conducted in Iran by
Rastegar et al. (2019), who found that hvKp accounted for
15.1% in their research. Additionally, the percentage of
hvKp ranged between 4.5-33% in China (Li et al., 2014;
Zhang et al., 2015) and 15.2% in Taiwan (Lee et al.,
2006).
iucA (encoding aerobactin) was the most prevalent
gene among the 100 isolates with (23%) of the isolates,
followed by iroB (17%), which is in agreement with a
study done in Sudan (Mohammed et al., 2022). Most
hvKp isolates carry an aerobactin encoding gene
compared to only 7-18% of cKP strains are aerobactin
(Yu et al., 2007; Hsieh et al., 2008; Jung et al., 2013).
This gene could be an important and major indicator of
differentiating hvKP isolates.
Another virulence gene prevalent in our isolates was
rmpA which regulates the synthesis of the extracellular
polysaccharide capsule and is located on a large
virulence plasmid that is only carried by strains with
hypermucoviscous phenotype (Shon et al., 2013).
Seventeen of the isolates (17%) had rmpA and were
highly correlated with the HMV phenotype, which is in
agreement with a previous study conducted in Taiwan
(Hsu et al., 2011). This gene is also highly associated
with hvKp, as indicated by previous studies (Li et al.,
2014; Yan et al., 2016). Moreover, a study conducted by
Lin et al. (2020) indicated that a low level of rmpA
expression resulted in losing the HMV phenotype and
strongly reducing strain virulence.
Other important virulence factors among hvKp are
capsular types. The PCR results showed that the K2
serotype (19%) was the most prevalent type among the
100 isolates and the hvKp isolates with 72.2%. Other
studies indicated that the prevalence of K2 among hvKp
ranged between 10 and 46% (Lee et al., 2008; Liu et al.,
2014). Our study partially agrees with other studies
regarding the prevalence of the K2 capsule type among
hvKp isolates. However, it disagrees regarding the K1
type as no isolate was detected carrying this capsule
type. In other studies, the K1 type showed the highest
abundance among hvKp, with 42.9% (Yan et al., 2016),
53.8% (Lee et al., 2008) and 98% (Fang et al., 2004).
This difference could be due to geographic differences or
the difference in isolated sources. All hvKp isolates from
these studies were collected from liver abscesses.
Confirming our explanation, a study by Liu et al. (2014)
reported that only 3.1% of having K1 type in Klebsiella
ISSN (print): 1823-8262, ISSN (online): 2231-7538
Malays. J. Microbiol. Vol 19(5) 2023, pp. 527-534
DOI: http://dx.doi.org/10.21161/mjm.230269
isolates from hospital-acquired bacteremia. Similarly, a
study in Iran (very close to Iraq) showed that most hvKp
isolates were associated with non-K1/K2 capsular type
(Rastegar et al., 2019). Other studies indicated that many
hvKP strains may be non-K1 serotypes (Zhang et al.,
2015; Ma et al., 2018).
Effective markers for distinguishing cKP and hvKP
pathotypes are undergoing more research and
researchers are still arguing over which factors give hvKP
strains their particular virulence capabilities. The
hypermucoviscous phenotype (string test) is thought to be
the most accurate marker for hvKP strains (Shon et al.,
2013). However, studies pointed out that this marker
should not be used to determine hvKP since its sensitivity
and specificity have not been determined accurately
(Shon et al., 2013; Russo et al., 2018). So, combining
virulence gene markers with the string test could be a
better solution to differentiate between cKP and hvKP.
The five selected genes in this study are more accurate
predictors of hypervirulence in K. pneumoniae than the
string test and the specific capsular type (Russo et al.,
2018).
CONCLUSION
The molecular biomarkers characterization of local K.
pneumoniae isolates revealed that iucA is the most
prevalent gene among isolates. Eighteen isolates were
identified as hvKP using a combination of molecular
biomarkers. Research findings highlight the necessity for
active monitoring of Klebsiella infections to identify and
monitor the spread of emerging hvKP strains that could
spread in the Iraq region through community or hospital-
acquired infections. Further research is required to
determine the severity of the public health risks posed by
hvKP strains in Iraq.
REFERENCES
Abd-Elmonsef, M. M., Khalil, H. S., Selim, A., Abd-
Elsalam, S., Elkhalawany, W., Samir, S. et al.
(2016). Detection of hypervirulent Klebsiella
pneumoniae in Tanta University Hospital, Egypt.
British Microbiology Research Journal 17(2), 1-10.
Ali, A. M. and Sana’a, N. (2019). Virulence factors
genotyping of Klebsiella pneumoniae clinical isolates
from Baghdad. Reviews in Medical Microbiology
30(1), 36-46.
Catalán-Nájera, J. C., Garza-Ramos, U. and Barrios-
Camacho, H. (2017). Hypervirulence and
hypermucoviscosity: Two different but complementary
Klebsiella spp. phenotypes? Virulence 8, 1111-1123.
Chen, Y. T., Chang, H. Y., Lai, Y. C., Pan, C. C., Tsai, S.
F. and Peng, H. L. (2004). Sequencing and analysis
of the large virulence plasmid pLVPK of Klebsiella
pneumoniae CG43. Gene 337, 189-198.
Fang, C. T., Chuang, Y. P., Shun, C. T., Chang, S. C.
and Wang, J. T. (2004). A novel virulence gene in
533
Klebsiella pneumoniae strains causing primary liver
abscess and septic metastatic complications. The
Journal of Experimental Medicine 199(5), 697-705.
Fang, C. T., Lai, S. Y., Yi, W. C., Hsueh, P. R., Liu, K. L.
and Chang, S. C. (2007). Klebsiella pneumoniae
genotype K1: An emerging pathogen that causes
septic ocular or central nervous system complications
from pyogenic liver abscess. Clinical Infectious
Diseases 45(3), 284-293.
Follador, R., Heinz, E., Wyres, K. L., Ellington, M. J.,
Kowarik, M., Holt, K. E. et al. (2016). The diversity of
Klebsiella pneumoniae surface polysaccharides.
Microbial Genomics 2(8), e000073.
Hsieh, P. F., Lin, T. L., Lee, C. Z., Tsai, S. F. and Wang,
J. T. (2008). Serum-induced iron-acquisition systems
and TonB contribute to virulence in Klebsiella
pneumoniae causing primary pyogenic liver abscess.
Journal of Infectious Diseases 197(12), 1717-1727.
Hsu, C. R., Lin, T. L., Chen, Y. C., Chou, H. C. and
Wang, J. T. (2011). The role of Klebsiella pneumoniae
rmpA in capsular polysaccharide synthesis and
virulence revisited. Microbiology 157(12), 3446-3457.
Jung, S. W., Chae, H. J., Park, Y. J., Yu, J. K., Kim, S.
Y., Lee, H. K. et al. (2013). Microbiological and
clinical characteristics of bacteraemia caused by the
hypermucoviscosity phenotype of Klebsiella
pneumoniae in Korea. Epidemiology and Infection
141(2), 334-340.
Lam, M. M., Wick, R. R., Wyres, K. L., Gorrie, C. L.,
Judd, L. M., Jenney, A. W. et al. (2018). Genetic
diversity, mobilisation and spread of the
yersiniabactin-encoding mobile element ICEKp in
Klebsiella pneumoniae populations. Microbial
Genomics 4(9), e000196.
Lan, P., Jiang, Y., Zhou, J. and Yu, Y. (2021). A global
perspective on the convergence of hypervirulence and
carbapenem resistance in Klebsiella pneumoniae.
Journal of Global Antimicrobial Resistance 25, 26-34.
Lee, C. H., Liu, J. W., Su, L. H., Chien, C. C., Li, C. C.
and Yang, K. D. (2010). Hypermucoviscosity
associated with Klebsiella pneumoniae-mediated
invasive syndrome: A prospective cross-sectional
study in Taiwan. International Journal of Infectious
Diseases 14(8), e688-e692.
Lee, H. C., Chuang, Y. C., Yu, W. L., Lee, N. Y., Chang,
C. M., Ko, N. Y. et al. (2006). Clinical implications of
hypermucoviscosity phenotype in Klebsiella
pneumoniae isolates: Association with invasive
syndrome in patients with community‐acquired
bacteraemia. Journal of Internal Medicine 259(6), 606-
614.
Lee, S. S. J., Chen, Y. S., Tsai, H. C., Wann, S. R., Lin,
H. H., Huang, C. K. et al. (2008). Predictors of septic
metastatic infection and mortality among patients with
Klebsiella pneumoniae liver abscess. Clinical
Infectious Diseases 47(5), 642-650.
Li, J., Ren, J., Wang, W., Wang, G., Gu, G., Wu, X. et
al. (2018). Risk factors and clinical outcomes of
hypervirulent Klebsiella pneumoniae induced
ISSN (print): 1823-8262, ISSN (online): 2231-7538
 Malays. J. Microbiol. Vol 19(5) 2023, pp. 527-534
DOI: http://dx.doi.org/10.21161/mjm.230269
bloodstream infections. European Journal of Clinical
Microbiology and Infectious Diseases 37(4), 679-689.
Li, W., Sun, G., Yu, Y., Li, N., Chen, M., Jin, R. et al.
(2014). Increasing occurrence of antimicrobial-
resistant hypervirulent (hypermucoviscous) Klebsiella
pneumoniae isolates in China. Clinical Infectious
Diseases 58(2), 225-232.
Lin, Z. W., Zheng, J. X., Bai, B., Xu, G. J., Lin, F. J.,
Chen, Z. et al. (2020). Characteristics of hypervirulent
Klebsiella pneumoniae: Does low expression of rmpA
contribute to the absence of hypervirulence? Frontiers
in Microbiology 11, 436.
Liu, Y. M., Li, B. B., Zhang, Y. Y., Zhang, W., Shen, H.,
Li, H. et al. (2014). Clinical and molecular
characteristics of emerging hypervirulent Klebsiella
pneumoniae bloodstream infections in mainland
China. Antimicrobial Agents and Chemotherapy 58(9),
5379-5385.
Ma, Y., Bao, C., Liu, J., Hao, X., Cao, J., Ye, L. et al.
(2018). Microbiological characterisation of Klebsiella
pneumoniae isolates causing bloodstream infections
from five tertiary hospitals in Beijing, China. Journal of
Global Antimicrobial Resistance 12, 162-166.
Mahon, C. R. and Lehman, D. C. (2022). Textbook of
Diagnostic Microbiology - E-Book. Elsevier Health
Sciences, USA.
Mohammed, K. A. M., Elhag, S. A. A., Ahmed, S. T. E.
S., Gorish, B. M. T., Mohammed, S. O. N.,
Abdelmula, W. I. Y. et al. (2022). Molecular detection
of virulence genes (rmpA2, iuc & iroB) of hypervirulent
Klebsiella pneumoniae in clinical isolates from patients
in Khartoum State, Sudan. Asian Journal of Research
in Infectious Diseases 9(4), 23-31.
Paczosa, M. K. and Mecsas, J. (2016). Klebsiella
pneumoniae: Going on the offense with a strong
defense. Microbiology and Molecular Biology Reviews
80(3), 629-661.
Rastegar, S., Moradi, M., Kalantar-Neyestanaki, D.,
Golabi, D. A. and Hosseini-Nave, H. (2019).
Virulence factors, capsular serotypes and
antimicrobial resistance of hypervirulent Klebsiella
pneumoniae and classical Klebsiella pneumoniae in
Southeast Iran. Infection and Chemotherapy 51, e39.
Russo, T. A. and Marr, C. M. (2019). Hypervirulent
Klebsiella pneumoniae. Clinical Microbiology Reviews
32(3), e00001-19.
Russo, T. A., Olson, R., Fang, C. T., Stoesser, N.,
Miller, M., MacDonald, U. et al. (2018). Identification
of biomarkers for differentiation of hypervirulent
Klebsiella pneumoniae from classical K. pneumoniae.
Journal of Clinical Microbiology 56(9), e00776-18.
534
View publication stats
Sellick, J. A. and Russo, T. A. (2018). Getting
hypervirulent Klebsiella pneumoniae on the radar
screen. Current Opinion in Infectious Diseases 31(4),
341-346.
Shon, A. S., Bajwa, R. P. and Russo, T. A. (2013).
Hypervirulent (hypermucoviscous) Klebsiella
pneumoniae: A new and dangerous breed. Virulence
4(2), 107-118.
Turton, J. F., Baklan, H., Siu, L. K., Kaufmann, M. E.
and Pitt, T. L. (2008). Evaluation of a multiplex PCR
for detection of serotypes K1, K2 and K5 in Klebsiella
sp. and comparison of isolates within these serotypes.
FEMS Microbiology Letters 284(2), 247-252.
Turton, J. F., Perry, C., Elgohari, S. and Hampton, C.
V. (2010). PCR characterization and typing of
Klebsiella pneumoniae using capsular type-specific,
variable number tandem repeat and virulence gene
targets. Journal of Medical Microbiology 59, 541-547.
Walker, K. A. and Miller, V. L. (2020). The intersection of
capsule gene expression, hypermucoviscosity and
hypervirulence in Klebsiella pneumoniae. Current
Opinion in Microbiology 54, 95-102.
Wyres, K. L., Wick, R. R., Gorrie, C., Jenney, A.,
Follador, R., Thomson, N. R. et al. (2016).
Identification of Klebsiella capsule synthesis loci from
whole genome data. Microbial Genomics 2, e000102.
Yan, Q., Zhou, M., Zou, M. and Liu, W. E. (2016).
Hypervirulent Klebsiella pneumoniae induced
ventilator-associated pneumonia in mechanically
ventilated patients in China. European Journal of
Clinical Microbiology and Infectious Diseases 35(3),
387-396.
Yao, B., Xiao, X., Wang, F., Zhou, L., Zhang, X. and
Zhang, J. (2015). Clinical and molecular
characteristics of multi-clone carbapenem-resistant
hypervirulent (hypermucoviscous) Klebsiella
pneumoniae isolates in a tertiary hospital in Beijing,
China. International Journal of Infectious Diseases 37,
107-112.
Yu, V. L., Hansen, D. S., Ko, W. C., Sagnimeni, A.,
Klugman, K. P., von Gottberg, A. et al. (2007).
Virulence characteristics of Klebsiella and clinical
manifestations of K. pneumoniae bloodstream
infections. Emerging Infectious Diseases 13, 986-993.
Zhang, Y., Zeng, J., Liu, W., Zhao, F., Hu, Z., Zhao, C.
et al. (2015). Emergence of a hypervirulent
carbapenem-resistant Klebsiella pneumoniae isolate
from clinical infections in China. Journal of Infection
71(5), 553-560.
ISSN (print): 1823-8262, ISSN (online): 2231-7538