See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/49804504

Haplotypes of mtDNA-HV1/HV2 in Non-Related Individuals of Caucasian

Population Living in the Slovak Republic

Article in Молекулярная биология · December 2010

DOI: 10.1134/S0026893310060038 · Source: PubMed

CITATIONS READS

4 472

4 authors, including:

Vanda Repiská
Comenius University Bratislava
100 PUBLICATIONS 870 CITATIONS

SEE PROFILE

All content following this page was uploaded by Vanda Repiská on 24 August 2015.

The user has requested enhancement of the downloaded file.

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ, 2010, том 44, № 6, с. 980–984

ГЕНОМИКА. ТРАНСКРИПТОМИКА
UDC 577.2

HAPLOTYPES OF mtDNA HV1/HV2 IN NONRELATED INDIVIDUALS

OF CAUCASIAN POPULATION LIVING IN THE SLOVAK REPUBLIC
© 2010 V. Repiska1*, I. Lehocky2, J. Galatova3, D. Böhmer1
1
Institute of Medical Biology, Genetics and Clinical Genetics, Faculty of Medicine, Comenius University in Bratislava,
811 08 Bratislava, Slovak Republic
2
Department of Biology, Institute of Forensic Science of Police Corps, 812 72 Bratislava, Slovak Republic
3
Institute of Foreign Languages, Faculty of Medicine, Comenius University in Bratislava, 811 08 Bratislava, Slovak Republic
Received February 09, 2010
Accepted for publication April 29, 2010

Evaluation of the frequency index for mtDNA particular sequences in the Caucasian population is crucial for forensic
practice. There are two hypervariable regions in the mtDNA Dloop, HV1 and HV2. Both of them, 610 bp altogether,
were sequenced, 342 bp from the hypervariable region HV1 (16024–16365) and 268 bp from the hypervariable region
HV2 (73–340). We have analyzed 374 randomly selected nonrelated individuals of the Caucasian population and 192
individuals of the Roma subpopulation living in Slovakia. The main goals of the work were to introduce and standardize
methods of analysis of variability of the HV1 and HV2 regions of mtDNA for forensic use; to characterize the variability
of mtDNA in the Slovakian population taking into account the subpopulations; classification of mtDNA profiles into
haplotype groups, and comparison with other haplotype groups in Europe in the frame of phylogenetic studies.

Keywords: haplotype groups, mitochondrial DNA analysis, PCR.

* A database of mitochondrial DNA (mtDNA) haplo casian population and from 192 individuals of the Roma
types, which is an equivalent of a database of DNA pro subpopulation living in Slovakia.
files, plays unique role in the identification of cadavers or
parts of human bodies of unrecognized identity. A data For PCR amplification of the HV1 region of mtDNA
base of this type is very important in case of absence of rel the following primers were used: H15806 (5'GCATC
atives and during ethnicity identification. mtDNA typing CGTACTATACTTCACAACAATCC3') and L16545
is performed in samples wherein successful typing of nu (5'AACGTGTGGGCTATTTAGGC3'). The algo
clear DNA (ncDNA) is unlikely – bones, teeth, hair, ma rithm of the PCR reaction was as follows:
terial fixed in paraffin blocks, excrements and other sam
ples which were resolved or exposed to unfavorable condi 94°C 1 min
tions of the environment [1, 2].
94°C 20 s
The largest variability among mtDNA haplotypes in 52°C 15 s 38 cycles 72°C 1 min
the human population was detected in the region of the
Dloop [3]. There are two hypervariable regions in that ar 72°C 5 min
ea labelled as HV1 and HV2. mtDNA haplogroup distri
bution correlates with the polymorphism of HV1/HV2, as 4°C
well as with polymorphism of the whole mitochondrial
genome. Haplogroups A, B, C, D, E, F, G and M are typ For PCR amplification of the HV2 of mtDNA the
ical for Asian populations, while the majority of native next primers: H8 (5'GGTCTATCACCCTATTAAC
American populations have haplogroups A, B, C and D. CAC3') and L429 (5'CTGTTAAAA GTGCATAC
Haplogroups L1, L2 and L3 are African, whereas haplo CGCC3') – were used. The PCR reaction algorithm of
groups H, I, J, K, T, U, V, W and X are linked with the Eu was as follows:
ropean populations [4, 5].
95°C 2 min

EXPERIMENTAL 94°C 45 s
66°C 1 min 30 cycles
DNA was obtained by standard phenolchloroform
extraction from 374 peripheral blood samples from ran 72°C 1 min
domly selected nonrelated individuals of the Slovak Cau
72°C 7 min
* Email: vanda.repiska@fmed.uniba.sk
4°C

980
 HAPLOTYPES OF MTDNA HV1/HV2 IN NONRELATED INDIVIDUALS
Amplification was performed on thermal cycler
GeneAmp® PCR System 2700 (“Applied Biosystems”,
USA). The PCR products were revised in the coloured by
ethidium bromide agar gel with using an UV transilumi
nator. All PCR products were purified, and the DNA was
sequenced. The algorithm for the DYEPCR reaction of
the HV1 region of mtDNA was the following:
94°C 20 s
50°C 15 s 34 cycles
60°C 1 min
The algorithm for the DYEPCR reaction of the HV2
region of mtDNA was the following:
96°C 1 min
96°C 10 s
50°C 5s 25 cycles
60°C 4 min
In the DYEPCR reaction we used three primers (two
forward primers and one reverse primer): H15909 (5'
ACACCAGTCTTGTAAACCGG3'), H15975 (5'
CTCCACCATTAGCACCCAAAG3'), and L16420 (5'
TGATTTCACGGAGGATGGTGG3').
Amplification products of the mtDNA HV1 region
were sequenced on a MegaBACE™ 1000 Sequencer
(“Amersham Biosciences”).
Sequences of hypervariable region HV1 were analyzed
using SeqLab (GCG Wisconsin Package 10, Genetics
Computer Group). Sequence analysis of the hypervari
able region HV2 was performed using DNA Sequencing
Analysis Software version 5.2 (“Applied Biosystems”).
The reference sequence of the complete human mito
chondrial genome is available in the Genbank index ac
cess code NC_001807. In order to compare the obtained
sequences with the reference one we used the ABI
PRISM® SeqScape® Software version 2.5 (“Applied Bio
systems”).
Genetic diversity was calculated according to Tajima
[6], random match probability was detected according to
Stoneking et al. [7], and the average number of nucleotide
differences was calculated using the DnaSP version 3 pro
gramm [8]. Particular haplotypes were classified into the
corresponding haplogroups and respectively labelled.
RESULTS AND DISCUSSION
For better differentiation of haplotypes some new
terms were used. The region between positions 16024 and
16465, overlapping HV1, was called the “HV1 overpass
ing region” (HV1ex); the region between positions 72 and
340, overlapping HV2, was called the “HV2 overpassing
region” (HV2ex). All calculations were performed for the
regions HV1, HV1ex, HV2 and HV2ex, and also for
HV1HV2 and HV1exHV2ex.
The most polymorphic region was HV1, which in
volved 342 bp with 97 variable positions. The extended
МОЛЕКУЛЯРНАЯ БИОЛОГИЯ том 44 №6 2010
981
HV1 region (HV1ex), being significantly longer the HV1,
had only 10 polymorphic places more (107 over 442 bp).
Mutation at the 16399 position was observed in 22 indi
viduals (5.9%). The HV2 region was 268 bp in length and
had only 56 mutating positions. The extended HV2ex re
gion being 269 bp in length carried an additional, 57th,
polymorphic place. The HV2 region was extended by the
72 position (HV2ex), mutation at which was observed in
10 individuals (2.7%).
Comparison of the detected sequences with the Cam
bridge reference [9] allowed us to identify 284 mtDNA
lines according to the 164 variable positions, 43 of which
characterized only one of the examined mtDNA (26%),
while the other 121 positions were not unique (the each
nucleotide difference appeared in at least 2 individuals).
These results obtained do not agree with Lutz`s data [10]
according to which the unique changes were at 92 variable
positions (46% of all detected ones)Most of the polymor
phic places are related to only one type of mutation, and
only in 8 out of 164 variable positions (4.9%) two different
types of mutation were reported.
By comparing sequences of the whole HV1exHV2ex
segment 284 haplotypes were detected. At that, 240 se
quences (64.2%) were unique, 27 haplotypes (14.4%) oc
curred twice, 9 (7.2%) were observed 3 times, 4 (4.3 %)
were found 4 times, and also more 4 different haplotypes
every of which occurred 5 (1.3%), 9 (2.4%), 10 (2.7%)
and 13 (3.5%) times were identified.
The most prevailing haplotype in the population in
vestigated is the 263G, 315.1C one (Table 1) that was
found in 3.5% of individuals. It is a characteristic haplo
type observed in the Caucasian population of other Euro
pean countries, namely: 3% of all individuals in Austria
[11], 2% in Germany [12], 2.6% in Switzerland [13],
4.3% in the Czech [14], in 4.5% the United Kingdom [15]
and 4% in France [16] of all individuals have this haplo
type. It would be very interesting to expand a scale of our
investigation to the Russian population which, unfortu
nately, such data are available only for the HV1 region for
[17, 18].
Basing on the monitored haplotype frequency occur
rence in our population, calculation of the genetic diver
sity [6], random match probability [7] and average num
ber of nucleotide differences [8] were performed for hy
pervariable regions HV1, HV1ex, HV2, HV2ex, HV1 and
HV2 together, and HV1ex and HV2ex together (Table 2).
Genetic diversity of 374 individuals of Caucasian popula
tion of Slovakia in the whole region sequenced is 0.997;
probability that two randomly selected individuals
from the population will have an identical haplotype of
mtDNA is 0.62%. The average number of nucleotide dif
ferences was fixed to 8.03 for the two hypervariable regions
together.
Most substitutions were distributed randomly. In hy
pervariable region HV1 position 16126C had a mutation
in 17.4%, position 16311C was mutated in 16.6%, the
16270T position was different in 11.5% of samples. In
HV2 region position 263G was mutated in 99.5%, posi
982 REPISKA et al.

Table 1. Most frequent occurrence of haplotypes in the Caucasian population of the Slovak Republic
Frequency,
Times Haplotypes in the database
%
13 263G 315.1C 3.48
10 263G 309.1C 315.1C 2.67
9 263G 309.1C 309.2C 315.1C 2.41
5 16298C 72C 263G 309.1C 315.1C 1.34
4 16311C 263G 315.1C 1.07
4 16129A 16223T 16291T 16298C 73G 263G 309.1C 315.1C 1.07
4 16069T 16126C 16145A 16172C 16222T 16261T 73G 242T 263G 295T 315.1C 1.07
4 16126C 16294T 16296T 73G 263G 309.1C 315.1C 1.07

Table 2. Genetic diversity (GD), random match probability (RMP) and average number of nucleotide differences (ANND) in
HV1, HV1ex, HV2, HV2ex, HV1HV2 and HV1exHV2ex regions of mtDNA from 374 individuals of the Caucasian population of
Slovakia
Parametr HV1 16024–16365 HV1ex 16024–16465 HV2 73–340 HV2ex 72–340 HV1HV2 HV1exHV2ex
GD 0.9750 0.9768 0.9651 0.9685 0.9962 0.9964
RMP, % 2.76 2.58 3.74 3.40 0.65 0.62
ANND 4.27 4.49 3.47 3.52 7.76 8.03

tion 73G in 54.8%, position 152C in 19.0% and position
195C in 16.3% of samples.
Only one deletion was detected: adenine residue at the
249 position in HV2. The deletion was related to 4 haplo
types of the haplogroup C being one of the main charac
teristics of this haplogroup.
We also analyzed 192 members of the Roma subpopu
lation, for which the HV1 region was more polymorphic
than HV2. For this subpopulation the HV1 region is
342 bp in length and carries only 59 variable positions that
is 38 variable positions less than in the Caucasian popula
tion of Slovakia. We detected 8 mutations in positions that
were not observed in Slovakian Caucasian population.
The extended HV1 region (HV1ex) is 377 bp long and in
volves 64 polymorphic places, i.e. 5 polymorphic places
more than the HV1. One of these 5 mutations, at the
16391 position, was observed in 32 individuals (16.7%); its
being characteristic for haplogroup I1, common for the
Roma subpopulation. The HV2 region carries 27 poly
morphic positions over 268 bp of length, while the extend
ed HV2ex region involves 28 polymorphic places over
269 bp HV2 region was expanded only by position 72
(HV2ex), mutation of which was observed in 2 individuals
(1.6%).
Comparison of obtained sequences with the Cam
bridge reference sequence [9] in the control region of
mtDNA allowed us to identify 83 mitochondrial lines,
which were defined by 92 variable positions. Twentyfive
of these variable positions characterized only one sample
of mtDNA, whereasremaining 67 positions were unique,
nucleotide differences in them to occur in at least two in
dividuals. Most polymorphic places are again linked with
single type of mutation, and only in 2 of the 92 variable
positions (2.1%) 2 different types of mutations were
recorded.
In the HV1exHV2ex segment 83 haplotypes were de
tected: 59 (30.7%) sequences occurred once, 10 (10.4%)
twice, 3 (4.7%) 3 times, 5 (10.4%) 4 times, 2 (6.3%)
6 times, 1 haplotype (3.6%) was found 7 times, 1 (4.7%)
9 times, 1 (14.1%) 27 times and 1 haplotype (15.1%)
29 times.
Statistical analysis of the results was the same as for the
Caucasian population (Table 3). Genetic diversity of 192
individuals of the Roma population in Slovakia of the
whole sequenced region is 0.951; the probability that 2 in
dividuals randomly selected from the population will have
an identical haplotype of mtDNA is 5.37%. This value in
the Roma subpopulation is almost one order higher

Table 3. Genetic diversity (GD) and random match probability (RMP) in HV1, HV1ex, HV2, HV2ex, HV1HV2 and
HV1exHV2ex regions of mtDNA from 192 individuals of the Roma population of Slovakia
HV1 16024–16365 HV1ex 16024–16400 HV2 73–340 HV2ex 72–340 HV1HV2 HV1exHV2ex
GD 0.9265 0.9268 0.9175 0.9180 0.9512 0.9512
RMP, % 7.82 7.80 8.72 8.67 5.37 5.37

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ том 44 №6 2010

 HAPLOTYPES OF MTDNA HV1/HV2 IN NONRELATED INDIVIDUALS 983

Table 4. The most frequent occurrence of haplotypes in the Roma subpopulation (gypsies) of the Slovak Republic

Frequen
Times Haplotypes in the database
cy, %

29 16129A 16172C 16223T 16311C 16391A 73G 199C 203A 204C 250C 263G 315.1C 15.1
27 16129A 16223T 16291T 16298C 73G 263G 309.1C 315.1C 14.1
9 16069T 16126C 16145A 16222T 16235G 16261T 16271C 73G 263G 295T 309.1C 315.1C 4.69
7 CRS 263G 309.1C 309.2C 315.1C 3.65
6 16129A 16223T 16291T 16298C 73G 263G 309.1C 309.2C 315.1C 3.13
6 16192T 16256T 16270T 16399G 73G 263G 309.1C 315.1C 3.13

(8.67x) than that for the whole population of Slovakia,
likely, being a characteristic of the genetically isolated
subpopulations.
In HV1 region substitutions were detected at the
16223T position in 46.4% of samples, at position 16129A
in 41.7%, at 16298C that in 23.4%, at the 16311C in
23.4% and at the 16291T in 21.4% of all samples. In HV2
region the position 263G was mutated in 99.5%, position
73G in 77.6%, position 199C in 20.8%, position 204C in
18.8% and position 203A in 17.2% of all samples.
Deletion of adenine residues found at 16166 and
16183 positions in the HV1 and at the 249 position of the
HV2 concerned 5 haplotypes.
The haplotypes observed in Roma subpopulation in
Slovak Republic are shown in table 4 (Table 4).
CONCLUSION
We have generated a database of the haplotypes of
mtDNA of HV1 and HV2 hypervariable regions for non
related individuals of the Caucasian population and of
nonrelated individuals of the Roma subpopulation living
in the Slovak Republic. This database enables exact inter
pretation of the results of mtDNA sequence analyses in
forensic work executed in the laboratories of Slovakia.
REFERENCES
1. Paneto G.G., Longo L.V., Martins J.A., de Camargo M.A.,
Costa J.C., de Mello A.C., Chen B., Oliveira R.N.,
Hirata M.H., Cicarelli R.M. 2010. Heteroplasmy in hair:
study of mitochondrial DNA third hypervariable region in
hair and blood samples. J. Forensic. Sci. 55, 715–718.
2. Fedorova S.A., Stepanov A.D., Adoian M., Parik J., Ar
gunov V.A., Ozawa T., Khusnutdinova E.K., Villems R.
2008. Phylogenetic analysis of ancient mitochondrial
DNA lineages of human remains found in Yakutia. Mol.
Biol. (Mosk.). 42, 445–453.
3. Messina F., Scorrano G., Labarga C.M., Rolfo M.F.,
Rickards O. 2010. Mitochondrial DNA variation in an iso
lated area of Central Italy. Ann. Hum. Biol. 37, 385–402.
4. Wallace D.C., Brown M.D., Lott M. T. 1999. Mitochon
drial DNA variation in human evolution and disease. Gene.
238, 211–230.
5. Allard M.W., Wilson M.R., Monson K.L., Budowle B.
2004. Control region sequences for East Asian individuals
in the Scientific Working Group on DNA Analysis Meth
ods forensic mtDNA data set. Int. J. Legal. Med. 6, 11–24.
6. Tajima F. 1989. Statistical method for testing the neutral
mutation hypothesis by DNA polymorphism. Genetics.
123, 585–595.
7. Stoneking M., Hedgecock D., Higuchi R.G., Vigilant L.,
Erlich H.A. 1991. Population variation of human mtDNA
control region sequences detected by enzymatic amplifi
cation and sequencespecific oligonucleotide probes. Am.
J. Hum. Genet. 48, 370–382.
8. Rozas J., Rozas, R. 1999. DnaSP version 3: an integrated
program for molecular population genetics and molecular
evolution analysis. Bioinformatics. 15, 174–175.
9. Anderson S., Bankier A.T., Barrell B.G., de Bruijn M.H.,
Coulson A.R., Drouin J., Eperon I.C., Nierlich D.P.,
Roe B.A., Sanger F., Schreier P.H., Smith A.J., Staden R.,
Young I.G. 1981. Sequence and organization of the human
mitochondrial genome. Nature. 290, 457–465.
10. Lutz S., Wittig H., Weisser H.J., Heizmann J., Junge A.,
DimoSimonin N., Parson W., Edelmann J., Anslinger K.,
Jung S., Augustin C. 2000. Is it possible to differentiate
mtDNA by means of HVIII in samples that cannot be dis
tinguished by the sequencing the HVI and HVII regions?
Forensic. Sci. Int. 113, 97–101.
11. Parson W., Brandstätter A., Alonso A., Brandt N.,
Brinkmann B., Carracedo A., Corach D., Froment O.,
Furac I., Grzybowski T., Hedberg K., KeyserTracqui Ch.,
Kupiec T., LutzBonengel S., Mevag B., Ploski R.,
Schmitter H., Schneider P., SyndercombeCourt D.,
Sorensen E., Thew H., Tully G., Scheithauer R. 2004.
The EDNAP mitochondrial DNA population database
(EMPOP) collaborative exercises: organisation, results
and perspectives. Forensic. Sci. Int. 139, 215–226.
12. Pfeiffer H., Brinkmann B., Hühne J., Rolf B., Morris A.A.,
Steighner R., Holland M.M., Forster P. 1999. Expanding
the forensic German mitochondrial DNA control region
database: genetic diversity as a function of sample size and
microgeography. Int. J. Legal. Med. 112, 291–298.

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ том 44 №6 2010

984 REPISKA et al.

13. DimoSimonin N., Grange F., Taroni F., BrandtCas
adevall C., Mangin P. 2000. Forensic evaluation of
mtDNA in a population from southwest Switzerland.
Int. J. Legal. Med. 113, 89–97.
14. Vanecek T., Vorel F., Sip M. 2004. Mitochondrial DNA
Dloop hypervariable regions: Czech population data.
Int. J. Leg. Med. 118, 14–18.
15. Piercy R., Sullivan K.M., Benson N., Gill P. 1993. The ap
plication of mitochondrial DNA typing to the study of
white Caucasian genetic identification. Int. J. Legal. Med.
106, 85–90.
16. Rousselet F., Mangin P. 1998. Mitochondrial DNA
polymorphisms: a study of 50 French Caucasian indi
viduals and application to forensic casework. Int. J. Le
gal. Med. 111, 92–98.
17. Orekhov V., Poltoraus A., Zhivotovsky L.A., Spitsyn V.,
Ivanov P., Yankovsky N. 1999. Mitochondrial DNA se
quence diversity in Russians. FEBS Lett. 445, 197–201.
18. Maliarchuk B.A., Derenko M.V., Grzybowski T.,
Czarny J., MiscickaSlivka D., Denisova G.A., Kosti
unina E.A. 2002. Mitochondrial DNA variation in
Russian populations of Stavropol krai, Orel and Saratov
oblasts. Rus. J. Genet. 38, 1532–1538.

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ том 44 №6 2010

View publication stats