Evaluation Copy 2

ISOLATION, IDENTIFICATION AND MOLECULAR CHARACTERIZATION OF
Escherichia coli FROM HANDMADE AND PACKETS FRUIT JUICE AVAILABLE

IN DINAJPUR CITY
A THESIS
BY
REGISTRATION NO: 1905185
SEMESTER: JULY-DECEMBER, 2020
SESSION: 2019
MASTER OF SCIENCE (M.S.)
IN
MICROBIOLOGY
DEPARTMENT OF MICROBIOLOGY
HAJEE MOHAMMAD DANESH SCIENCE AND TECHNOLOGY
UNIVERSITY, DINAJPUR-5200
DECEMBER, 2020
1
IN DINAJPUR CITY
A THESIS
BY
SESSION: 2019
Submitted to the
Department of Microbiology
Hajee Mohammad Danesh Science and Technology University, Dinajpur
In partial fulfillment of the requirements for the degree of
MASTER OF SCIENCE (M.S.)
IN
MICROBIOLOGY
DEPARTMENT OF MICROBIOLOGY
DECEMBER, 2020
2
IN DINAJPUR CITY
A THESIS
BY
SESSION: 2019
Approved as to style and content by
(Prof. Dr. Md. Mostafizer Rahman) (Dr. Nazmi Ara Rumi, Assistant Professor)
Research Supervisor Research Co- Supervisor
(Professor Dr. Md. Mostafizer Rahman)
Chairman
Department of Microbiology and
Examination Committee
3
Dedicated
To My
Beloved Parents
&
Respected Teachers
4
ACKNOWLEDGEMENTS
The author is ever grateful and indebted to the Almighty Allah without whose grace she
would have ever been able to pursue his studies in this field of science and to complete his
research work successfully for the degree of Master of Science (MS) in Microbiology.
The author sincerely desires to express his heart felt respect, deepest sense of gratitude,
sincere appreciation and profound indebtedness to his respected teacher and Research
Supervisor, Professor Dr. Md. Mostafizer Rahman, Chairman, Department of Microbiology,
Faculty of Veterinary and Animal Science (FVAS), Hajee Mohammad Danesh Science and
Technology University (HSTU), Dinajpur for his constant supervision, scholastic guidance,
uncompromising principles, helpful advice, constant inspiration, affectionate feeling, radical
investigation and constructive criticism in all phases of this study and preparing the
manuscript.
I would like to express great pleasure to my co-supervisor, Dr. Nazmi Ara Rumi, Assistant
Professor for his scholastic and dynamic guidance, unflinching cooperation and constant
inspiration in every stage of my study. Affectionate feeling, constructive criticism and
encouragement throughout the period of the research and preparation of the manuscript.
The author wishes to express his cordial respect and profound gratitude to his teachers
Professor Dr. Md. Khaled Hossain, Professor Dr. Mir Rowshan Akter, Dr. Nazmi Ara Rumi,
Dr. Farzana Afroz and Dr. Most. Deloara Begum, Assistant Professor, Department of
Microbiology, FVAS, HSTU, Dinajpur, for their valuable advice and constant inspiration
throughout the entire period of study.
The author expresses his deepest sense of gratitude to Md Sajib Hossain and Md.
Moniruzzaman, Invent Company Bonani, Dhaka for their cordial cooperation in molecular
part of this study. The author expresses his cordial appreciation to Md. Ayub, Md. Joinal
Islam, Md. Ansarand Md. Saiful, Department of Microbiology FVAS, and for their
cooperation throughout the MS course, HSTU, Dinajpur.
The author expresses heartfelt gratitude and gratefulness to his beloved parents, for their
blessing, inspiration, sacrifice and moral support which opened the gate and paved the way
to her higher studies and also provided with the best of everything in her life.
5
Finally, the author is extending his cordial thanks to all her friends, relatives and well-
wishers. The Author December, 2020.
ABSTRACT
Millions of people around the world are widely consuming fruit juices in every season as it
provides an easy and affordable source of nutrients to them. Fruit juices are popular drinks as
they contain antioxidants, vitamins, and minerals that are essential for human being and play
important role in the prevention of heart diseases, cancer, and diabetes. They contain
essential nutrients which support the growth of acid tolerant bacteria, yeasts, and moulds. The
study was conducted to estimate the microbial quality of various fruit juices made and sold
for immediate consumption in home and in the market of Dinajpur city. Altogether, 40 fruit
juice samples (10 different packed fruit juices and 30 homemade fruit juice) were collected
from different areas Dinajpur city and tested for their microbiological quality. Microbial
quality was determined by quantifying the total viable count, isolation of Escherichia coli are
examined with different bacteriological, biochemical, and molecular technique. A total of 40
juice sample were collected. Among the samples (30 handmade and 10 packets) 17 of
handmade samples and 3 packets juice samples were positive and contained for E.coli. PCR
primers targeting gene of Escherichia coli amplified 1492 bp fragment of DNA confirmed
the identity of Escherichia coli. Total viable count of handmade juice samples were ranges
from 1.5×105to 5.5×10 4 and total Escherichia coli count ranged from 1.1×102 to2.1×103
Total viable count of packets juice were ranged from 1.75 ×10 5 to 2.75×10 6 and total
Escherichia coli count were ranged from1×101 to 1.2×104 . The identified bacteria were
tested for sensitivity to use common antibiotics. E.coli isolates were sensitive to gentamycin,
chloramphenicol and azithromycin and resistant to amoxicillin, ciprofloxacin and
tetracycline. This study specially highlights the level of Escherichia coli found in various
6
fruit juice samples. Some of the microorganisms detected in these juice samples can cause
disease in human beings, so there is need for some guidelines that can improve the quality of
fruit juices.
CONTENT
CHAPTER NO LIST OF CONTENT PAGE

ACKNOWLEDGEMENTS v
ABSTRACT vi
CONTENT vii
LIST OF TABLES x
LIST OF ABBREVIATIONS AND SYMBOLS xi
LIST OF FIGURES xii
CHAPTER I INTRODUCTION 12-18
CHAPTER-II REVIEW OF LITERATURE 19-23
CHAPTER-III MATERIALS AND MATHODES 24-43
3.1 Location of the study 24

3.1.2 Collection sites 24
3.1.3 Collection of samples 24
3.1.4 Study areas of the sample 25
3.1.5 Handmade fruit juice sample 25
3.1.6 Packets fruit juice 25
7
3.1.7 Sample processing 26
3.1.8 Serial dilution 26
3.2 Laboratory preparation 26
3.3 Glassware’s and appliances 26
3.4 Media for culture 27

3.4.1 liquid Media (broth) 27
3.4.2 Solid media 27
3.4.3 Chemical, Reagent and Solution 27
3.4.4 Materials used for bacterial genomic DNA 28
isolation
3.4.5 Antibiotic discs 28
3.4.6 Materials used for Polymerase chain reaction 29
3.5 Methods 29
3.5.1 Experimental design 29
3.5.2 Experimental Layout 30
3.5.3 PCR amplification and sequencing PCR 31
condition.
3.5.4 Preparation of culture media 33
3.5.5 Nutrient Agar medium 33
3.5.6 Eosin methylene blue agar 33
3.5.7 MacConkey Agar (MAC) 33
3.5.8 Muller-Hinton Agar (MHA) 34

3.5.9 Triple Sugar Iron (TSI) agar slant 34
3.5.10 MIU Medium 34

3.5.11 Nutrient Broth 34
3.6 Preparation of Reagent 34
3.6.1 Methyl-Red Solution 34

3.6.2 Alpha-Nephthol Solution 35
3.6.3 Kovac’s Reagent 35
3.6.4 Crystal Violet Solution (0.5%) 35
3.6.5 Gram’s Iodine 35
3.7 Isolation and Identification of bacterial pathogen 35
3.7.1 Primary culture on nutrient agar 35
8
3.7.2 Enumeration and Identification of 36
Microorganism
3.7.3 Morphological study by Gram’s staining 35

3.8 Biochemical Test 36
3.8.1 Oxidase Test 36
3.8.2 Catalase Test 37
3.8.3 Coagulase test 38
3.8.4 Indole Production Test 38
3.8.5 Triple Sugar Iron (TSI) Test 38
3.8.6 Methyl Red Test 39
3.8.7 Voges-Proskauer (VP) Test 40
3.8.8 Citrate Utilization Test 41
3.8. 9 Antibiotic sensitivity tests 41
3.9.10 Antimicrobial susceptibility testing of 42
isolated microorganisms
3.9.11 Maintenance of stock culture 43
CHAPTER IV RESULTS 44-56

4.1 Results of isolation and identification of pathogen 44
(Bacteria)
4.2 Characterization of bacteria by using different 46
biochemical tests
4.3 Results of Gram’s staining technique 48
4.4 Result of antibiotic sensitivity test of isolated bacteria 48
4.5Antibiotic sensitivity pattern of Escherichia coli 48
4.5.6 Confirmation of Escherichia coli by PCR 56
CHAPTER V DISCUSSION 57-58

Discussion:
CHAPTER VI CONCLUSION 59
9
Appendix 60
Reference 64
LIST OF TABLES
Table 1: Antibiotics with their disc concentration
Table 2: PCR reaction mixture for E.coli
Table 3: Condition of PCR
Table 4: Result
Table 5: Antimicrobial agents with their disc concentration and diameter of zone of
inhibition
Table 6: Total Bacterial Count of handmade fruit juice sample
Table 7: Total bacterial count of packets juice sample
Table-8: Isolation and identification of bacteria by using morphological and cultural

characteristic
Table-9: Characterization of bacteria using different biochemical tests
Table-10: Zone diameter interpretative standards Escherichia coli
Table-11: Characterization of Bacteria by PCR.
10
LIST OF ABBREVIATIONS AND SYMBOLS
TVC Total Viable Count

TSC Total Staphylococci Count
TFC Total Fecal Count
MSA Mannitol Salt Agar
NA Nutrient Agar
EMB Eosin Methylene Blue Agar
CA Cetrimide Agar
XLD Xlylose Lysine Deoxycholate Agar
Mac MacConkey Agar
MIU Motility Indole Urea
TSI Triple Sugar Iron Agar
ml Milliliter
μl Microliter
mg Milligram
gm Gram
Kg Kilogram
e.g. For example
et al.And others
pH Negative logarithm of hydrogen ion
concentration
CFU Colony Forming Unit
spp. Species
% Percentage
°C Degree Celsius
BCSIR Bangladesh Council of Scientific and Industrial
research
BSTI Bangladesh Standards and Testing Institution
Sec Second
mm Millimeter
µm Micrometer
MHA Mueller Hinton Agar
11
LIST OF PLATE AND FIGURES
Plate 1: White mucoid colonies on Nutrient agar.
Plate 2: Green metallic sheen colony of E.coli on EMB agar with reflected light.
Plate 3: Rose pink colony of E.coli on MAC agar.
Plate 4: Gram negative large pink color, road shaped E. coli, arranged in single, pair or
short chain under microscope (100X).
Plate 5: Methyl red test, showing red color ring on the surface of media.
Plate 6: Motility test, E.coli show color change.

Plate 7: TSI test, E. coli produces gas
Plate 8: Citrate test show no color change
Plate 9: Antibiotic sensitivity test of E.coli
LIST OF FIGURES
Figure 1: Schematic illustration of the experimental layout.
Figure 2: Schematic illustration of the bacterial genomic DNA isolation.
Figure 3: Schematic illustration of the process of Electrophoresis.
Figure 4: Catalase test show negative

Figure 5: Oxidase test show negative
Figure 6: Coagulase tests, E. coli are negative absence of clumping.
Figure7: Profiles of 27F and 1492R primers generated from Bacteria, M: denotes 1 kb
DNA ladder (Marker).
12
CHAPTER I
INTRODUCTION
Fruits are a part of our daily consumptions. All over the world, in everyone’s diet chart it is
always included as a whole fruit, juice, beverage or still drink etc. The world consumed 117.7
billion gallons of industrialized still drinks. Of the total volume, 77% were consumed in 40
countries, with 23.5 million liters in the juice category, 42 million in the category of still
drinks, and 35 million in the category of powdered and concentrated juices (Neves, 2012).
Fruit juices contain antioxidants, vitamins, and minerals that are essential for human being
and they play important role in the prevention of heart diseases, cancer, and diabetes. Fruit
juices contain essential nutrients which support the growth of acid tolerant bacteria, yeasts,
and molds. In recent years, the increasing consumer awareness has emphasized the need for
chemically and microbiologically safe food (Aneja, 2014).
A structural part of a plant is fruit which contains seeds, normally fleshy, sweet and edible in
the raw states that include: mangoes, oranges, grapes, litchis, and pomegranates etc. They are
ripe ovaries or carpals that contain seed (McGee, 2004). Similar in composition to vegetables,
fruits contain various phytochemical compounds and a high percentage of water averaging
85%, also in small amount fat; protein and carbohydrate (cellulose and starch) are present
(Ihekoronye & Ngoddy, 1985). Most fruits are eaten as desserts and they can be processed
into liquid product which includes fruit juices, wines and other preserves like; marmalade,
jams, jellies etc. Fruit products are marketed canned, bottled or packaged in tetra-packets.
The aqueous liquid, puree of the edible portions is juice, or any concentrates of such liquid or
puree from one or more fruits or vegetables can be juice either. Fruit juices are mainly used
for their nutritional value, refreshing nature also for their medicinal importance. In
detoxification of human body and in improvement of blood lipid profile in patients of
hypercholesterolemia fruit and vegetable juices play great roles. Fruit juices are nutritious
drinks with great taste and health benefits (Suaads & Hamed, 2008). Fruit juices are
important sources of nutrients and contain several important therapeutic.
13
Properties that may reduce the risk of various diseases. They contain large amounts of
antioxidants, vitamins C and E, and possess pleasant taste and aroma (Abbo et. al, 2006)
Juice Amount Per1 cup (249g)
Calories 136
Vitamin A 2% Vitamin C 62% % Daily Value*

Total Fat 0 g 0%
Calcium 0% Iron 1%
Saturated fat 0 g 0%
Vitamin D 0% Vitamin B-6 60% Polyunsaturated fat 0 g

Monounsaturated fat 0 g
Vitamin B-12 0% Magnesium 1%
Cholesterol 0 mg 0%
Sodium 5 mg 0%
Potassium 105 mg 3%
Total Carbohydrate 33 g 11%
Dietary fiber 0.5 g 2%
Sugar 23 g
Protein 0.5 g 1%
Juices are mostly consumed for their perceived health benefits. For example, orange juice is
rich in vitamin C, folic acid, potassium, which are an excellent source of bioavailable
antioxidant phytochemicals (Franke, 2005) and in people affected with hypercholesterolemia
it significantly improves blood lipid profiles (Kurowska, 2000). Prune juice is associated with
a digestive health benefit. Cranberry juice has long been known to help prevent or even treat
bladder infections, and it is now known that a substance in cranberries prevents bacteria from
binding to the bladder. Pomegranate juice reduce dangerous LDL-cholesterol in blood,
improve blood flow to the heart in patients with coronary artery disease, reduce thickening of
the arteries that supply blood to the brain, lower the level of systolic blood pressure also an
antioxidant-rich fruit. This fruit may also be able to help fight cancer which researchers have
been looking for. Mango juices are perfect to replenish salts, vitamins and energy after
14
physical exercise. In gall bladder cancer a protective effect of mangoes consumes has been
proven. Mango juice also contains a lot of tryptophan, the precursors of serotonin. Litchi
juice contains high amount of antioxidants which is effective to prevent early ageing also
effective to protect from asthma and a rich source of nutrient that is required for the
production of blood. It provides manganese, magnesium, copper, iron and folate that are
required for the formation of RBC. The most predominant nutrient in grape juice is
manganese. Drinking grape juice helps fight conditions associated with cardiovascular
disease, including high blood pressure and plaque buildup. Jujube fruit contains high levels of
Vitamin C (higher than in most citrus fruits like the orange), Vitamins B1 (thiamine), B2
(riboflavin), B3 (niacin) and B6 (which are the complex B vitamins), Vitamin A (in 2 forms),
and minerals that include calcium, potassium, phosphorus and manganese. It also contains
significant levels of copper, zinc, iron and sodium. Perhaps the most significant of all of the
jujube benefits is the fact that the fruit contains 18 amino acids.
Juice is mainly prepared by squeezing fresh fruits by hand or juicers (in home) and by
machines (in factories). For example, orange juice is the liquid extract which results from
pressing the fruits of the orange tree. Most of the commercial fruit juices are filtered to
remove fiber or pulp, but high-pulp fresh orange juice is a popular beverage all over the
world. General methods for preservation and processing of fruit juices include canning,
pasteurization, concentrating,
Freezing, evaporation and spray drying. Many juice preservation strategies include washing
and sorting, juice extraction, straining, filtration and clarification, blending, pasteurization,
filling, sealing and sterilization, cooling, labeling and packing (Davidson 2001).
The squeezing, macerating or crushing of fruits is done in the process of extracting juice from
fruits. A major amount of pulp is obtained by this process or it may be extracted using water.
These juices are used either in their natural concentrations or may be concentrated by
evaporation or freezing and they are preserved by canning, freezing or drying.
Deterioration of fruits results from so many factors such as physical factors, fruits’ own
enzyme action, microbial action or combination of all these. When the fruit is soft and juicy,
the fruit rot is appropriate to be soft and squashy and some leakage may result. Fruits carry a
natural flora of micro-organisms acquired from their environment and certain organisms
cause a drying effect, which results in dry, leathery rots with the discolored surface area.
Fruits can be infected by pathogenic microbes which cause wilts, blotching and browning.
Once harvested care has to be taken in handling as bruising can allow the entry of harmful
15
organisms, particularly fungi, which soon rot the product. The green mold sometimes seen on
oranges is a type of Penicillium; Botrytis causes the fuzzy grey growth on strawberries.
Juices extracted from fruits are acidic in nature. For the lemon juice, the pH is 2.4 and for
tomato juice is 4.2. They also contain high sugar content of about 2% in lemon juice and
about 17% in some grape juices. Mold growth is favored on the surface of these juices.
Bacteria and yeast grow faster when juices are exposed to high moisture. Removal of solids
by extraction and sieving of juices makes the oxidation-reduction potential to become higher
which in turn favors the growth of yeast. Lack of vitamin B discourages some bacteria. The
character of spoilage depends on the product attacked and the microbe that causes the
spoilage. The identification of the type of spoilage will help in finding out the appropriate
method for preventing its decay.
Four types of factors determine the colonization of fresh-cut fruits and derivatives by
microorganisms such as intrinsic factors, which are dependent on food composition, such as
water activity, pH, redox potential, nutrients, structures, and antimicrobial agents;
technological treatments, which can modify the initial micro biota; extrinsic factors or
environmental conditions of the medium such as temperature, relative humidity, and
atmosphere; implicit factors, which. Depend on the developing micro biota and the handling
of both the raw material and the product during processing and storage (Montville and
Matthews, 2001)
Fruits may become contaminated with pathogenic and spoilage microorganisms either during
their growing in fields, orchards, vineyards, or greenhouses, or during harvesting, postharvest
handling, and distribution (Beuchat 2002). Fresh fruits have a natural protective barrier (skin)
that acts effectively against most plant spoilage and pathogenic microorganisms; however,
Fresh fruits can contain large and diverse populations of bacteria. However, most of the work
on produce-associated bacteria has focused on a relatively small number of pathogenic
bacteria and, as a result, we know far less about the overall diversity and composition of
those bacterial communities found on produce and how the structure of these communities
varies across produce types. Moreover, a comprehensive view of the potential effects of
differing farming practices is lacked on the bacterial communities to which consumers are
exposed. (Jonathan, 2013). The causative agents of microbiological spoilage in fruits and
fruit juices can be bacteria, as well as yeasts and molds. The main spoilage agents can be
considered as due to the low pH of most fruits. Some bacteria such as Campylobacter spp., E.
coli O157:H7, Salmonella spp., Listeria monocytogenes, Staphylococcus aureus, Shigella
16
spp, Erwinia spp., Enterobacter spp., Alicyclobacillus spp., Propionibacterium
cyclohexanicum, Pseudomonas spp., and lactic acid bacteria can cause spoilage in fruit and
fruit juices (Walker and Phillips, 2008). Certain common molds such as Penicillium spp.,
Aspergillus spp., Eurotium spp., Alternaria spp., Cladosporium spp., Paecilomyces spp., and
Botrytis spp. have been shown to be involved in the spoilage of fresh fruits (Lund and
Snowdon, 2000).
E. coli (Escherichia coli) is a gram negative bacterium, which lives in the digestive tracts of
humans and animals. There are many types of E. coli, and most of them are harmless. E. coli
infection occurs by coming into contact with the feces, or stool, of humans or animals. By
drinking water or eating food that has been contaminated by feces anyone can get infected by
E. coli.
Salmonella spp. is infectious bacteria associated with food borne and gastrointestinal
illnesses. Salmonella bacteria can be found in food products such as raw poultry, eggs, and
beef, and sometimes on unwashed fruit. There are two main diseases caused by Salmonella
spp. and they are Salmonellosis and typhoid fever. Salmonella enteritidis or Salmonella
typhimurium causes Salmonellosis and Typhoid fever is caused by Salmonella typhi. People
who eat food contaminated by Salmonella can become ill with salmonellosis.
Staphylococcus aureus stains are gram positive and non-moving small round shaped or non-
motile cocci. Staphylococcus spp. are found in grape-like (staphylo-) clusters.
Staphylococcus is one of the five most common causes of infections after injury or surgery.
S. aureus may occur commonly in the environment. S. aureus is transmitted through air
droplets or aerosol also by direct contact with objects that are contaminated by the bacteria or
by bites from infected persons or animals.
Pseudomonas spp. are gram negative bacteria, morphologically enteric bacilli and vibrios.
They have peritrichous flagella which defines them as motile bacteria. Pseudomonas spp. are
strict aerobes. They are mostly free-living bacteria widely distributed in soil and water. For
the most part they are found wherever organic matter is decomposing. Pseudomonas
aeruginosa can cause sputum of patients with cystic fibrosis, burns, urinary tract infections
also prevalent nosocomial infections, external ear infections etc.Serratia spp. are gram
negative, bacilli shaped, facultative anaerobe, motile bacteria that belongs to the family
Enterobacteriaceae. These bacteria grow well on standard media and produce a red to dark
pink pigment that aids in identification. (Kayla, 2004). Although S. marcescens was
considered to be an innocuous, non-pathogenic organism, over the last two decades they have
17
become an opportunist pathogen causing nosocomial infections. A broad range of hospital-
acquired infections caused by S. marcescens include respiratory tract infections, urinary tract
infections (UTI), septicaemia, meningitis, pneumonia, conjunctivitis wound and eye
infections, osteomyelitis, keratoconjunctivitis, keratitis, endophthalmitis and endocarditis
(Hejazi, 1997).
Above mentioned pathogens can be treated with different medicines and antibiotics. There
are other different bacteria in the world those are pathogenic or opportunistic pathogens and
causes deadly disease to humans and animals. Some recent studies have shown that so many
bacteria have become antibiotic resistant and for that reason the disease they cause become
untreated, which is very dangerous for all human being. These are about bacteria but there are
huge number of other microorganisms like virus, mold, fungus; they also cause so many
diseases to human being which are curable as well as deadly diseases like HIV/ AIDS, cancer
etc. Some are treated with medicines and antibiotics or vaccines but most of these
microorganisms either themselves yet not been discovered or the disease they cause yet no
treatment have been discovered.
Bacterial genes when mutate because of chemical or radiation exposure; or sometimes

randomly (without specific reason). If bacteria with a changed gene is less susceptible to an
antibiotic, and that antibiotic is around, the less susceptible (and more resistant) version of the
bacteria is more likely to survive the antibiotic and continue to multiply. This is particularly
happening if the amount of antibiotic around is not quite enough to kill all of the bacteria
quickly, it can happen if enough of the antibiotic was not taken to keep its level high in our
body, or the antibiotic taking was stopped too early. This is why when someone is prescribed
an antibiotic they MUST take it exactly as prescribed, and for as long as it was prescribed:
they may feel better after only a short time, but still have some bacteria left in body but not
enough to make them feel bad, but enough to come back and those bacteria left include the
ones that are partly resistant to the antibiotic already and likely to become more resistant.
Although there are many different species of bacteria, some bacteria can exchange genes with
other bacteria. They can then give the resistance genes they have developed to other, harmful
bacteria. There are viruses around that attack bacteria rather than plants, animals, or people.
Most of these viruses just kill the bacteria, but sometimes the viruses can copy genes like the
antibiotic resistance genes from one kind of bacteria to another and becomes resistant to drug.
Objectives
18
 Isolation, identification and molecular characterization of Escherichia coli from
handmade and packets fruit juice available in Dinajpur city.
 To detect the antibiotic resistance pattern of the isolated Escherichia coli.
 To Characterize identified isolates by PCR analysis.
19
CHAPTER-II
REVIEW OF LITERATURE
2.1 Isolation and identification of microbes
Bikila et al. (2019) studied that the fruit juice contains essential nutrient, mineral, antioxidant
and vitamins for overall health. However, food borne illness related to fruit and fruit product
is increasing and very serious problem in different part of Ethiopia is comprised Arba Minch.
So, the main objective of this study was to assess the bacteriological quality of both fresh and
commercially packed fruit juices available for the consumers in Arba Minch town, Southern
Ethiopia. This study analysis and evaluates the bacteriological quality of some fresh and
packed fruit juices available in Arba Minch town. A total of 120 samples was purchased
from cafeteria, restaurants and supermarkets which consisted of 96 fresh juice samples 16
each of Mango, Papaya, Avocado, Orange, Apple and Mixed juice whereas from the total
samples, another 24 commercially packed juices viz., Mango, pineapple, Orange and white
grape were collected from supermarkets. Also, detection of pathogens and antimicrobial
susceptibility testing was conducted. All fresh fruit juice samples were found to harbor TVC,
TCC, FCC and TSC within the range between 5.32 ± 0.49-6.65 ± 0.31, 2.59 ± 0.42-4.87 ±
0.45, 2.00 ± 0.36-3.95 ± 0.47 and 2.08 ± 0.29-2.86 ± 0.33 log10 cfu/ml, respectively. Also,
all commercially packed fruit juice samples exhibit the presence of TVC, TCC and TSC
within the range of 2.26 ± 0.51-3.08 ± 0.65, 0.00 ± 0.00-0.60 ± 0.35 and 1.00 ± 0.15-1.85 ±
0.59 log10 cfu/ml, respectively with the exception of FCC in which detection was not shown.
In this study the prevalence of E. coli, Salmonella and Staphylococcus aureus was detected
for all fresh fruit juices samples of this avocado was more dominated. Antibiotic
susceptibility test for Escherichia coli isolates. In general the study, especially exhibits the
level of bacterial load found in both fresh and packed juice samples was unsatisfactory
compared to gulf standards. This cause health problems and possible vehicle of foodborne
outbreaks to the community. Therefore, good quality of water used; hygienic conditions
related to washing of utensils, good personal and domestic hygiene during fresh fruit juice
preparation can improve the bacterial quality and safety of the finished product.
Ketema et al. (2018) this study was conducted by collecting samples of 63 fruit juices and 21
vegetable salads from 21 juice houses. The survey indicated poor kiosk sanitary situation and
20
personal hygiene, and bad storage conditions. Mean average of total viable counts of the
samples of juices and vegetable salads was found to be 5.96 log cfu/g. The highest and lowest
mean total coliform counts (TCCs) were that of avocado (1.17 log cfu/mL) and mango (0.51
log cfu/mL) juice samples. Mean fecal coliform counts were between 0.04 and 0.09 log
cfu/mL. Treatment with sodium benzoate (0.1%) was found effective in reducing the total
viable count. Escherichia coli were detected from 32.14% and 3.6% of samples, respectively.
All E. coli isolates were found resistant to vancomycin. Hygienic status of the kiosks, storage
situation of prepared juices and vegetable salads, and ingredients are the critical contributing
factors for high microbial load of juices and vegetable salads.
Balvindra et al. (2018) investigated to resolve Microbes are the sources of many food
poisoning cases, usually due to improperly processed food and fruit juice separation by hand
or juice mill. It is now commonly accepted that fruit juice consumption is a risk factor for
infection with enteric pathogens. The trouble begins when certain bacteria and other harmful
pathogens spores of multiply and spread in ubiquitous and environments. However, fruit juice
Sample was collected from the various places of Kanpur, India and observed the highest
microbial load in nutrient agar (4.3×107 ) viz., Shivrajpur, rose bengal chloramphenicol agar
(2.8×10 7 ) Viz. Chaubepur-A and MacConkey agar (6.8X105 ) viz. Chaubepur-B. Bacteria
were identified as, Escherichia coli, Salmonella. In different types of fruit juices from the
various fruit mill vendors; While, these pathogens confirmed by biochemical, Grams staining
and culture methods.
Mahamuda Akther Eva et al. (2017) studied that the Quality of juice is very important
because if the quality deteriorates by the contamination of faecally originated
microorganisms, it may cause serious diarrhea associated problems leading to death. In
overpopulated countries like Bangladesh, this is a common scenario to experience diarrheal
diseases due to drinking non-potable water as well as contaminated fresh juices. Present study
was conducted to determine the quality of drinking water and juice by detection of indicator
bacteria Escherichia coli by MPN (Most Probable Number) method which was performed by
three consecutive steps including presumptive test, confirmed test and completed test. Other
gram negative bacteria were also identified by biochemical methods. The indicator bacterium
Escherichia coli was detected in two water samples out of 15 samples and one juice sample
out of fifteen samples respectively during the MPN test method.
21
Christo J Padamadan et al. (2016) investigated to resolve the microbiological attributes of
the fruit juices collected from different areas around m different area of Thrissur city. Four
mentor fruit juices and four packed fruit juices were examined for the presence of coliforms.
Coliforms were detected in two samples Apple juice and pineapple juice with MPN index of
140+and 140+ which were further detected as Escherichia coli The highest pH was recorded
in apple juice (street vented: 4.86, packed fruit juice: 3.10) and the lowest pH in grape juice
(street vented: 2.55, packed fruit juice: 1.45). The highest titratable acidity was recorded in
grape juice (street vented: 13.5%, packed fruit juice: 16.5%) and the lowest pH in apple juice
(street vented: 4.02%, packed fruit juice: 10.85%). Drug resistance among the isolated was
found against Amikacin, Ampicillin, Cefixime, and Cefotaxime. Overall study demonstrates
that the quality of fresh juices was unsatisfactory compared to packed juices. Hence the
products need to be microbiologically controlled in order to ensure the overall health safety,
Poonam U.Sharma et al, (2013) studied that traditionally, fruit products have been regarded
as microbiologically safer than other unprocessed foods. However, many outbreaks of human
infections have been associated with the consumption of contaminated fruit juices. The
objective of this study was to evaluate the microbiological safety and quality of fruit juices
being served in various cities of Vidarbha. A study aimed at examining the quality and safety
of freshly squeezed fruit juices, in various cities of Vidarbha, based on standard techniques
(e.g. culturing on selective media), showed that in most localities the street vended fruit
juices remained hygienically poor since bacterial loads (Total viable counts and Total
coliforms) on the whole are abnormally high The samples were collected from various places
and processed within an hour in laboratory. The bacterial isolates were identified on the basis
of their cultural, morphological & biochemical reactions. Total 115 samples of fruit juices
sold by local vendors were analyzed and from which 98 organisms were isolated & identified
on the basis of morphological, cultural & biochemical characteristics. In different fruit juice
samples sold by local vendors four types of pathogenic bacteria were found. Based on the
presence of Microorganism, it is concluded that fruit juices in certain areas inside the various
city (e.g. Bus Stand, Railway Station, Vegetable market) are highly impacted and unfit for
human consumption. The occurrence of pathogenic E coli, alarming enough for an immediate
action by the suitable agency. It is suggested that regular monitoring of the quality of fruit
juices.
Rowshan et al, (2013) the present study was undertaken with the aim of investigating the
isolation and quantification of microorganisms from the fruit samples collected from different
22
areas of Dhaka city. Out of ten samples studied, the range of total viable bacterial
proliferation was approximately102to107 cfu/g. Among the specific bacterial pathogens the
presumptive identification of these isolates was done by the conventional cultural,
microscopic and biochemical tests. Fungal growth was also observed in four samples within
the range of 1.2×103 to 3.6×103cfu/g.Among other samples, Tanarindus bacilus (tamarind)
was found to exhibit activity against Escherichia coli, Pseudomonas spp., Salmonella spp.,
Vibrio spp., and Listeria spp. On the other hand, Monifera indica (mango) showed anti-
bacterial efficacy against E. coli.
Rashed et al, (2012) investigated to resolve the microbiological attributes of the fruit juices
collected from different areas around Dhaka city. To check the total bacterial load, coliforms
and staphylococci 26 vendor fruit juices and 15 packed juices were examined. Samples were
found to harbor viable bacteria within the range between 103 -107 cfu/ ml. thirty samples
exhibited the presence of staphylococci. Total coliforms were detected in 31 samples within
the range of 102 and 107 cfu/ ml which were further detected as Escherichia coli Fecal
coliforms were found in 4 vendor fruit juice samples ( 102cfu/ ml), while in the industrially
packed samples, they were completely absent. Drug resistance among the isolates was found
against ampicillin, ciprofloxacin, amoxicillin, erythromycin, chloramphenicol, ceftriaxone,
piperaciline, trimethoprime-sulfomethoxazole, nalidixic acid and vancomycin. Overall, the
study demonstrates that the quality of the both packed and fresh juices was unsatisfactory and
hence the products need to be microbiologically controlled in order to ensure the overall
health safety.
Tasmina et al. (2010) conducted their study to assess the microbial quality of fresh and
commercially packed available juices collected from different locations of Dhaka city. A total
of six fresh juice and nine commercially packed juice samples were collected. Standard
culture techniques were followed to assess total viable count (TVC), total Staphylococcal
count (TSC), total Bacillus count (TBC) and total fungal count (TFC) on different culture
media. The TVC varied from the range from 102 to 107 cfu/ ml with the highest of 2.4 x 105
cfu/ ml. A large number of Staphylococci and Bacillus was also found from several samples.
Total coliform and fecal coliform was found in six and five (out of fifteen) samples,
respectively. Among total coliforms, Klebsiella spp., Enterobacter spp. along with E. coli was
detected. From all the assessment it was determined that the microbial quality of
commercially packed juice was fairer than that of fresh juice collected from local market.
Md. Munjur et al. (2014) investigated to resolve the microbiological attributes of the fruit
juices collected from different areas around Jessore city. Ten fresh fruit juices and ten
23
commercially packed fruit juices were collected. Standard plate count techniques were
followed to assess total viable count (TVC), total coliform count (TCC) and total
Staphylococcal count (TSC) on different culture media. Samples were found to harbor viable
bacteria within the range between 103-108 cfu/ ml. 19 samples exhibited the presence of
Staphylococci. Total coliforms were detected in 17 samples within the range of 103-106 cfu/
ml which were further detected as Escherichia coli, Klebsiella spp. and Enterobacter spp.
From all the assessment, the study demonstrates that the quality of both packed and fresh
juices was unsatisfactory and hence the products need to be microbiologically controlled in
order to ensure the overall health safety.
Joy et al. (2006) aimed at examining the quality and safety of freshly squeezed fruit juices, in
a metropolitan city (Visakhapatnam) in south India, based on standard techniques (e.g.
culturing on selective media), showed that in most localities the street vended fruit juices
remained hygienically poor since bacterial loads (Total viable counts and Total coliforms) on
the whole are abnormally high (HVC 0.88-33.6× 102 cfu/ 100 ml; TC 0.8-22.2×102 CFUs/
100 ml). Based on the presence of fecal coliforms (0.4-11.0 cfu/ 100 ml) and fecal
Streptococci (0.0-6.6 cfu/ 100 ml), it is concluded that fruit juices in certain areas inside the
city (e.g. R.T.C. Complex, Fishermen’s colony, Vegetable market) are highly impacted and
unfit for human consumption. Overall, it is contended that contamination is mainly due to
poor quality of water used for dilution, prevailing unhygienic conditions related to washing of
utensils, maintenance of the premises, and location by the side of a busy road with heavy
vehicular traffic or by the side of the waste disposal system and overcrowding. The
occurrence of pathogenic E. coli, Streptococcus faecalis, Salmonella typhi and Salmonella
typhimurium is alarming enough for an immediate action by the suitable agency. It is
suggested that regular monitoring of the quality of fruit juices for human consumption must
be introduced to avoid any future pathogen outbreaks.
Another study was aimed and done to assess the microbial quality of fruit juices sold for
immediate consumption in the markets of Kashmir valley. Twelve fruit juice samples (3 from
each apple, orange, pineapple and mango juices) were procured from different markets and
tested for their microbiological quality. Microbial quality was determined by enumerating the
total viable count. About 25% of the samples (orange juice) did not comply with the
standards of microbial quality as per the guidelines for microbiological quality of ready to eat
foods while as apple, orange and pineapple juices complied with the standards. The microbial
load in orange juice was comparatively higher than that in the apple, pineapple and mango
juice which had the microbial load within acceptable limits (Gulzar et al. 2013).
24
CHAPTER-III
MATERIALS AND MATHODES
The research work was conducted during the period from January–July 2020 at the
Bacteriological laboratory of the Department of Microbiology, Hajee Mohammad Danesh
Science and Technology University (HSTU), Dinajpur and also in the Laboratory on Invand
Company, Bonani, and Dhaka. The detailed outline of the materials and methods are given
below.
3.1 Location of the study
The study was conducted at Microbiological Laboratory, HSTU, and Dinajpur-5200.
3.1.2 Collection sites
The handmade and packets fruit juice samples were collected from Dinajpur during January –
July 2020. A total of 40 samples were collected from different sites during this period.
3.1.3 Collection of samples
The samples were collected in pre-sterilized, labeled and screw caped bottles. The collected
samples were then transported to the laboratory within very short periods for microbiological
analysis. Finally, the samples were stored at appropriate conditions until analysis of samples
were performed.
25
3.1.4 Study areas of the sample collection
3.1.5 Handmade fruit juice sample
Sampling site Number of the Name of the Total sample

sample taken. Juice sample
Baser hat 3 Mango ,Lemon 30
Sweehari 2 Apple, orange
Gopal gonj 2 Jujube
Dashmail 3 Grape, Lemon
Kalitola 3 Lemon
Bahadur bazar 3 Mango
Modern more 2 Lemon
Lilirmore 2 Orange
Boromath 4 Mango
Shaheedminar more 2 Apple, orange
Chirirbandar 2 Mango, Orange
Birgonj 1 Orange juice
Station Bazar 1 Grape juice
3.1.6 Packets fruit juice

Sampling site Number of the Name of the Juice Total
sample taken. sample sample
Baser hat 3 Mango juice 10
Station Bazar 2 Orange juice
Lilirmore 2 Mango
Dashmail 2 Litchi flavored
Chirirbandar 1 Mango
3.1.7 Sample processing
26
After collecting the samples, pH was measured; serial dilutions were done from the samples
and spread plate, method was done to see the growth of different microorganisms.
3.1.8 Serial dilution
Test tubes containing 9 ml of physiological saline (0.9% NaCl) were autoclaved before use.
Tenfold serial dilutions of the soil sample were prepared in autoclaved saline water. Initially,
-1
1 ml of juice was mixed with 9 ml of saline water in a test tube in order to dilution 10 and
mixed with 9 ml of saline in it by repeated pipetting in order to make tenfold dilution. Again,
-1 -2
1 ml from the 10 test tube was transferred to 10 labeled test tube and mixed with 9 ml
saline solution in it by repeated pipetting. This action was repeated for the test tubes labeled
-3 -4
as 10 , and 10 .
3.2 Laboratory preparation
All items of glassware including test tubes, micropipettes, cylinder, conical flasks, flasks,
glass plates, slides, vials and test tubes soaked in a household dishwashing detergent solution
for overnight. The glassware were then cleaned by brushing, washed thoroughly and finally
sterilized either by dry heat at 160C for 2 hours or by autoclaving for 15 minutes at 121C
under 15 Ibs pressure per square inch. Autoclaved items were dried in a hot air oven at
500C.Disposable plastic ware (micropipette tips) was sterilized by autoclaving.
3.3 Glassware’s and appliances
The different types of important equipment used for this work are listed in following ;
distilled water ; forceps, scissors, tray, Petri-dishes, experimental test tube, stopper, conical
flask, vortex mixture, labeling tape, micropipette(5-50𝜇l; 10-100𝜇l; 50-500𝜇l; 100-1000𝜇l),
slides, test tube racks, water bath, bacteriological incubator, freeze (-20°C), refrigerator
(4°C), sterilizing instruments, hot air oven, centrifuge tubes and machine, ice boxes,
electronic balance, syringe and needle, immersion oil, cotton, slide, compound microscope,
spirit lamps, match lighter, bacteriological loop, inoculums loop, autoclave machine laminar
air flow, Gel-electrophoresis, PCR machine, spinner, Genetic analyzer etc.
3.4 Media for culture
27
Different types of media were used for selective growth, enrichment culture, and indication
of specific properties. Media preparation and sterilization were done according to the
protocol and standard recipe.
3.4.1 Liquid media (broth)
 Nutrient broth (Hi-media, India)

 Methy Red-Voges Proskauer (MR-VP) broth (HiMedia, India)
 Buffered Peptone Water (.HiMedia, India)
3.4.2 Solid media
 Nutrient agar base (HiMedia, India)

 Eosin Methylene Blue (EMB) Agar (HiMedia, India)
 MacConkey Ager medium (HiMedia, India)
 Triple Sugar Iron (TSI) Agar slant (HiMedia, India)
 Motility, Indole, Urease (MIU) medium (HiMedia, India)
 Semon citrate agar (HiMedia, India)
3.4.3 Chemical, Reagent and Solution
 Gram' s staining reagent(Crystal violet, Gram' s iodine, Acetone alcohol, Safranin)

 Catalase test reagent Hydrogen peroxide (3% solution)
 Kovac's reagent
 Ethyl alcohol (70% and 95%) 20
 Methyl red solution
 Iodine solution
 Ethidium bromide
 TAE buffer, Wash buffer, elusion buffer
 Gel-loading dye
 PCR master mix
 Normal Saline
 Distilled water and other common laboratory media, reagents and chemicals.
3.4.4 Materials used for bacterial genomic DNA isolation
 1.5 ml micro centrifuge tubes
28
 Water bath, 80°C & 37°C
 Isopropanol, room temperature
 70% ethanol, room temperature
 Nuclei Lysis solution
 RNase solution
 Protein precipitation solution
 DNA Rehydration solution
 Centrifuge machine
3.4.5 Antibiotic discs
To determine the antibiotic sensitivity pattern of different bacterial isolates with different
types of antibiotics. Commercially available antibiotics discs were used. The method allowed
for the determination of the sensitivity pattern of different antibiotics by measuring the
diameter of the zone of inhibition that results from different diffusion of the agent into the
medium surrounding the disc. The followings are the antibiotics that were tested against the
selected organism with their disc concentration.
Table 1: Antibiotics with their disc concentration
SI. Name of the antibiotics Disc concentration

No. (µg/disc)
01 Gentamycin (GEN) 10
02 Chloramphenicol (C) 30
03 Azithromycin (AZM) 30
04 Levofloxacin (LE) 05
05 Amikacin (AK) 30
06 Ampicillin (AMP) 25
07 Colistin (CL) 10
08 Tetracycline (TE) 30
09 Erythromycin (E) 15
10 Bacitracin (B) 10
11 Novobiocin (NV) 30
Legends: µg = Microgram; SI = Serial; No = Number
3.4.6 Materials used for Polymerase chain reaction
29
Table 2: PCR reaction mixture for E.coli
SI Items Volume Reaction

No. Number
1 Master Mix 10 µl X1
2 T DNA ( Concentration 25-65 ng/ul) 1 µl X1
3 Primer F ( Concentration 10-20 pMol) 1 µl X1
4 Primer R ( Concentration 10-20 pMol) 1 µl X1
5 Water 7 µl X1
Total 20 µl
3.5 Methods
3.5.1 Experimental design
Juice samples were collected from different locations of Dinajpur city. Total 40 juice samples
were collected, where10 from different local street shops and the other 30 from different
handmade juice samples from different locations. Bacterial pathogens by morphology,
staining and cultural characteristics. Characterization of bacteria were done by cultural and
biochemical reaction. The isolated bacteria were tested for the sensitivity patterns of different
antibiotics and finally perform the molecular test PCR.
3.5.2 Experimental Layout
30
Sample collection
Serial dilution
Culture on ordinary media nutrient agar and nutrient broth and

incubation at 37°C
Sample showing growth of bacterial were Samples showing no growth of bacteria

selected for isolation were discarded
Sub culturing onto the EMB, NA, MAC agar and incubation at 37°C for 24 hr.
Morphological characterization by Gram staining
Selected colonies were sub cultured into selective media EMB, MAC agar and incubated at 37°C
for 24-48 hr
Colony morphology were observed
Staining characteristics of Antibacterial sensitivity Biochemical test

suspected colony were performed study by Agar disc diffusion
by Gram staining
Coagulase test, Catalase test, Oxidase test, MIU test, MR test, VP test, Indole test, TSI test,
Simmons’s citrate test, Nitrate reduction test, Lactose fermentation test.
Molecular characterization by PCR test
Figure 1: Schematic illustration of the experimental layout.
31
3.5.3. PCR amplification and sequencing PCR condition
Table 3: Condition of PCR
Step name Temperature Duration time Number of cycle

Pre Heat 95°C 2 minute 1
Denaturation 95°C 30 second
Annealing 52°C 30 second 35
Extension 72°C 50 second
Final Extension 72°C 5 minute 1
Hold 4°C Over night 1
Inoculate 25 ml of liquid culture with E.coli. Grow in conditions appropriate for

E.coli. Until the culture is saturated.
Centrifuge 1ml of overnight culture for 2 minutes at 13,000-16,000 rpm and Discard
the supernatant.
Add 600µl Nuclei Lyses solution. Mix thoroughly and Incubation for 5 minutes at
80°C. Then cool to room temperature.
Add 3µl of RNase solution and mix thoroughly and Incubation for 15-60 minutes at
37°C. Then cool to room temperature.
Then Add 200µl of Protein precipitation solution. Vortex the solution and incubate on
ice for 5 minutes
Then Centrifuge 2 minutes at 13,000-16,000 rpm
Transfer the supernatant to a clean tube containing 600µl of room temperature

isopropanol and mix well.
Centrifuge as in Pellet Cells above and decant the supernatant.
32
Add 600µl of room temperature 70% ethanol and mix thoroughly then centrifuge
for 2 minutes at 13,000-16,000 rpm
Aspirate the ethanol and air-dry the pellet for 10-15 minutes.
Rehydrate the DNA pellet in 100µl of Rehydration solution for 1 hour at 65° or
overnight at 4°C
Figure 2: Schematic illustration of the bacterial genomic DNA isolation.
Preparation of gel
Sample application in the gel
Adjustment of voltage or current (gel-electrophoresis about 70-100 volts)
Set up run time about 30-60 minute
When DNA migrated sufficiently, as judged from the migration of bromophenol

blue of loading buffer, the power supply was switched off
The gel stained in Ethidium bromide (0.5μg/ml) for 10 minutes, in a dark place
The gel was distained in distilled water for 10 minutes. The distained gel was
placed on the imaging system in the dark chamber of the image documentation
The UV light of the system was switched on; the image was viewed on the monitor,
focused, acquired and saved in an USB flash drive
Figure 3: Schematic illustration of the process of Electrophoresis.
33
3.5.4 Preparation of culture media
All the media, broth and reagents used in this experiment were prepared according to
instruction of the manufacturer.
3.5.5 Nutrient Agar medium
Nutrient agar (NA) medium was used to grow the organisms from the collected samples
(Cheesebrough 1984)
Twenty eight gram (28gm) of nutrient agar (HiMedia Laboratories Limited, Mumbai-india)
was suspended into 1000ml of cold distilled water in a flask and heated to boiling for
dissolving the medium completely. The medium was then sterilized by autoclaving. After
autoclaving, the medium was poured into each sterile petridish and allowed to solidify. After
solidification of the medium in the petridishes, these were incubated at 37°C for overnight to
check their sterility and used for cultural characterization. (Carter, 1979)
3.5.6 Eosin methylene blue agar
Eosin methylene blue (EMB) agar medium was used for the purpose of observing growth of
Escherichia coli (Cheesebrough, 1984)
Thirty six grams (36gm) of EMB agar base (HiMedia Laboratories Limited, Mumbai-india)
dissolving the medium completely. The medium was ten sterilized by autoclaving. After
autoclaving, the medium was poured into each sterile petridish and allowed to solidify.
(Carter, 1979)
3.5.7 MacConkey Agar (MAC)
MacConkey agar is both selective and differential .It contains bile salt and the dye crystal
violet, which inhibit the growth of Gram -positive (G+) bacteria and select for Gram negative
bacteria(G-).It also contains the carbohydrate lactose, which allows the differentiation of
Gram -negative (G-) bacteria based on their ability to ferment lactose.
51.5gm of MAC agar base (HiMedia Laboratories Limited, Mumbai-india) was suspended
into 1000ml of cold distilled water in a flask and heated to boiling for dissolving the medium
completely. The medium was ten sterilized by autoclaving. After autoclaving, the medium
was poured into each sterile petridish and allowed to solidify. (Carter, 1979)
34
3.5.8 Muller-Hinton Agar (MHA)
Muller-Hinton Agar is a microbiological growth medium that is commonly used for antibiotic
susceptibility testing. It is also used to isolate and maintain Neisseria and Moraxella species.
It is a non-selective and non-differential medium indicating that almost all organisms plated
on here will grow.
3.5.9 Triple Sugar Iron (TSI) agar slant
Sixty five grams (65gm) powder of TSI agar (HiMedia Laboratories Limited, Mumbai-india)
dissolving the medium completely. The medium was then sterilized by autoclaving. After
autoclaving, the medium was poured into each sterile test tube and to set in sloped from with
a butt about 1 inch long and allowed to solidify. After solidification of the test tube were used
for biochemical characterization after incubation at 37°C for 24 hours. (Carter, 1979).
3.5.10 MIU Medium
Eighteen (18) grams of powder of MIU agar base was added to 950 ml of distilled water in a
flask and hated boiling to dissolve the medium completely. The medium was then sterilized
by autoclaving at 121°C for 15 minutes. After autoclaving the medium was put in to water
bath of 45-50°C temperature. It was used for biochemical characterization after incubation at
37°C temperature for overnight. (Carter, 1979).
3.5.11 Nutrient Broth
13 gram of Nutrient broth (HiMedia Laboratory Limited, Mumbai-India) was dissolved in

1000 ml of cold distilled water and boil to dissolve completely. The solution was then
distributed in test tube, stoppered with cotton plugs and sterilized in the autoclaving at 121°C
for 15 minutes in 15 pound pressure per square in inch. The sterility of the medium was
incubation at 37°C temperature for overnight. (Carter, 1979).
3.6 Preparation of Reagent
35
3.6.1 Methyl-Red Solution
The indicator MR solution was prepared by dissolving 0.1 gram of Bactomethyl-red in 300
ml of 95% alcohol and diluted to 500 ml with the addition of distilled water (Merchant and
Packer, 1967).
3.6.2 Alpha-Nephthol Solution
Alpha-naphthol solution was prepared by dissolving 5 gram of alpha-naphthol in 100 ml of

95% ethyl alcohol (Merchant and Packer, 1967).
3.6.3 Kovac’s Reagent
The solution was prepared by mixing 25 ml of concentrated Hydrochloric acid in 5 ml of

Amyl alcohol and to this mixture 5 grams of paradimethyl-aminobenzyldehide crystals were
added. This was ten kept in a flask equipped with rubber cork for future use (Merchant and
Packer, 1967).
3.6.4 Crystal Violet Solution (0.5%)
Dissolve 500 mg Crystal Violet mixed 75 ml distilled water then add 35 ml Methanol and
store at room temperature which acts as a primary coloring agent, (Isenberg, H.D. 1995).
3.6.5 Gram’s Iodine
Dissolve 6.7 gram of potassium iodide in 100 ml of demonized water and add 3.3 gram of
iodine, stir to dissolve, then dilute to 1000 ml and then store in a dark bottle this acts as a
mordant. (Isenberg, H.D. 1995).
3.7 Isolation and Identification of bacterial pathogen
3.7.1 Primary culture on nutrient agar
The collected samples were directly inoculated into nutrient agar by spread plate technique
and incubated at 37ºC for 24 hours. The incubated media were then examined for growth of
bacteria.
Inspection: Growth of microorganisms and their colony characteristics were recorded

according to procedures described by Carter, 1979.
36
3.7.2 Enumeration and Identification of Microorganisms
When growths of the microorganisms on plates were occurred after incubation, different
colonies were enumerated and interpreted according to the sample. Colonies differing in
morphological characteristics were selected and used for further studies. Selected isolates
were grown on MacConkey agar, and Eosin Methylene Blue agar to identify bacteria these
colonies were then sub cultured in nutrient agar plates for pure colony isolation and
subsequently Gram stained. The shape, color and arrangement of the colonies were
examined under the microscope after Gram staining. Isolates were biochemically analyzed
for the activities of Oxidize, Catalase, MR-VP test, Urea’s test, TSI test, Nitrate reduction
test, Iodole production test and Citrate utilization test.
3.7.3 Morphological study by Gram’s staining
Gram staining also called Grams method is a method of staining used to distinguish and
classify bacterial species into two large groups (Gram-positive and Gram-negative). The
name comes from the Danish bacteriologist Hans Christian Gram who developed the
technique.
The procedure include the following steps -
1. A small colony were picked up with a bacteriological loop, smeared on glass slide and
fixed by gentle heating after air dry.
2. Crystal violate (primary stain) was applied over the smear for 1 min and then washed
with tap water.
3. Gram's iodine (mordent) was then applied over the smear for 1 min and then washed
with tap water.
4. Ethyl alcohol 95% (decolorizing agent) was applied over the smear for 15-20 seconds
and then washed with tap water.
5. Counter stains were done with Safranin for 1 minute followed by gentle wash with tap
water.
6. Slide was allowed to air dry and then examined under microscope with the help of oil
immersion.
3.8 Biochemical Test
3.8.1 Oxidase Test
Cytochrome containing organisms produce an intracellular Oxidase enzyme. This Oxidase

enzyme catalyzes the oxidation of Cytochrome c. Organisms which contain Cytochrome c as
37
part of their respiratory chain are Oxidase-positive and turn the reagent blue/purple.
Organisms lacking Cytochrome c as part of their respiratory chain do not oxidize the reagent,
leaving it colorless within the limits of the test, and are Oxidase-negative.
Oxidase positive bacteria possess Cytochrome Oxidase or indophenols Oxidase (an iron
containing haemoprotein). Both of these catalyse the transport of electrons from donor
compounds (NADH) to electron acceptors (usually oxygen). The test reagent, N, N, N’,
Tetra methyl-p-phenylene diamine dihydrochloride acts as an artificial electron acceptor for
the enzyme Oxidase. The oxidized reagent forms the colored compound indophenols blue.
Method
1. A strip of filter paper was soaked with a little freshly made 1% solution of the
reagent.
2. A speck of culture was rubbed on it with a toothpick.
Positive result: A positive reaction was indicated by an intense deep -purple color, appearing
within 5-10 seconds.
Negative Result: Negative results were observed by absence of coloration.
3.8.2 Catalase Test
Catalase is a common enzyme found in all living organisms exposed to oxygen. It is a very
important enzyme in protecting the cell from oxidative damage by reactive oxygen species
(ROS).
This test demonstrates the presence of Catalase, which catalyzes the release of oxygen from
hydrogen peroxide (H2O2). It is used to differentiate those bacteria that produce an enzyme
Catalase, such as staphylococci, from non-Catalase producing bacteria such as streptococci.
Normally 3% H2O2 is used for the routine culture while 15% H2O2 used for detection of
Catalyse in anaerobes.
Method
1. A drop of 3% H2O2was placed in the glass slide.

1. 2. A loopful of culture was added into 3% H2O2 solution.
2. Observed for the evolution of oxygen bubbles.
Positive result: Copious bubbles produced, active bubbling.
Negative Result: No or very few bubbles produced.
38
3.8.3 Coagulase Test
Small amount of bacterial colony dilute with water on slide and added one drop of human or
sheep plasma.
Inspection: Show the clamping the test is positive and on clamping the test are negative.
3.8.4 Indole Production Test
Indole test is used to determine the ability of an organism to split amino acid tryptophan to
form the compound indole. Tryptophan is hydrolysed by tryptophanase to produce three
possible end products – one of which is iodole. Iodole production is detected by Kovac’s or
Ehrlich’s reagent which contains 4 (p)-dimethyl amino Benz aldehyde, this reacts with iodole
to produce a red colored compound.
Indole production test is important in the identification of Enter bacteria. Most strains of E.
coli, P. vulgaris, P. rettgeri, and M. morganiand species break down the amino acid
tryptophan with the release of indole. This is performed by a chain of a number of different
intracellular enzymes, a system generally referred to as “tryptophanase.” It is used as part of
the IMViC procedures, tests designed to distinguish among members of the family
Enterobacteriace.
Method
1. Bacterium to be tested was inoculated into tryptophan broth.

2. Incubated overnight at 37°C
3. Then added few drops of Kovac’s reagent 4. Without shaking the tube finally the
result was observed.
Positive Result: Formation of red or pink colored ring at the top was taken as positive.
Negative result: No color change after addition of reagent was taken as negative
3.8.5 Triple Sugar Iron (TSI) Test
The Triple sugar iron agar test is designed to differentiate among the different groups or
genera of the Enterobacteriace, which are all gram -negative bacilli capable of fermenting
glucose with the production of acid, and to distinguish the Enterobacteriace from other gram
negative intestinal bacilli. This differentiation is made on the basis of differences in
carbohydrate fermentation patterns and hydrogen sulphide production by the various groups
of intestinal organisms.
39
To facilitate observation of carbohydrate utilization pattern, the TSI agar slants contain
lactose and sucrose in 1% concentrations and glucose in a concentration of 0.1%, which
permits detection of the utilization of this substrate only. The acid-base indicator phenol red
is also incorporated to detect carbohydrate fermentation.
Method
1. With a sterilized straight inoculation needle touched the top of a well-isolated colony
2. Inoculated TSI Agar by first stabbing through the center of the medium to the bottom
of the tube and then streaking on the surface of the agar slant.
3. Leave the cap on loosely and incubated the tube at 35°C in ambient air for 18 to 24
hours.
Table 4: Result
SI.No. Result (slant/butt) Symbol Interpretation

01 Red/Yellow K/A Glucose fermentation only, peptone
catabolized
02 Yellow/Yellow A/A Glucose and lactose and/or sucrose
fermentation
03 Red/Red K/K No fermentation, Peptone catabolized.
04 Yellow/Yellow with A/A,G Glucose and lactose and/or sucrose

bubbles fermentation, Gas produced.
05 Red/Yellow K/A,G Glucose fermentation only, Gas produced.
06 Red/Yellow with K/ Glucose fermentation only, Gas produced,

bubbles and black A,G,H2 H2S produced.
precipitate S
07 Yellow/Yellow with A/ Glucose and lactose and/or sucrose
bubbles and black A,H2S fermentation, Gas produced, H2S produced.
precipitate
08 Red/Yellow with K/ Glucose fermentation only, H2S produced
black precipitate A,H2S
3.8.6 Methyl Red Test
40
Some bacteria have the ability to utilize glucose and convert it to a stable acid. The
VogesProskauer (VP) test is used to determine if an organism produces acetyl methyl
carbinol from glucose fermentation. If present, acetyl methyl carbinol is converted to diacetyl
in the presence of ∝-naphtha, strong alkali (40% KOH), and atmospheric oxygen. The ∝-
naphthol was not part of the original procedure but was found to act as a color intensifier by
Barritt’s reagents and must be added first. The diacetyl and guanidine-containing compounds
found in the peptones of the broth then condense to form a pinkish red polymer.
Method
1. Firstly the tube was Inoculated containing MR Broth with a pure culture of the
microorganism under investigation .
2. Then it was incubated at 37 °C for 24 hours.
3. Finally, about 5 drops of the methyl red indicator solution was added to the tube.
Positive result: A distinct red color
Negative result: A yellow color
3.8.7 Voges-Proskauer (VP) Test
The Voges-Proskauer (VP) test is used to determine if an organism produces acetyl methyl
carbinol from glucose fermentation. If present, acetyl methy l carbinol is converted to
diacetyl in the presence of ∝-naphthol, strong alkali (40% KOH), and atmospheric oxygen.
The ∝naphthol was not part of the original procedure but was found to act as a color
Glucose and lactose and/or sucrose fermentation, Gas produced, H2S produced.
Glucose and lactose and/or sucrose fermentation, H2S produced. Intensifier by Barritt’s
reagents and must be added first. The diacetyl and guanidine containing compounds found in
the peptones of the broth then condense to form a pinkish red polymer.
Method:
1. The tube was inoculated with a pure culture of microorganisms containing V-P broth.
2. Incubated at 37 °C for 24 hours.
3. After incubation 10 drops of Barritt’s reagent A was added to the V-P broth and shake
the cultures.
4. Then the tube was inoculated immediately with 10 drops of Barritt’s reagent B.
Positive Result: A pink-red color at the surface
Negative Result: A lack of a pink-red color
41
3.8.8 Citrate Utilization Test
Citrate utilization test is commonly employed as part of a group of tests, the IMViC (Iodole,
Methyl Red, VP and Citrate) tests that distinguish between members of the
Enterobacteriaceae family based on their metabolic by-products. Citrate utilization can be
used to distinguish between coliform such as Enterobacteriaceae aerogenes (+ve) which
occur naturally in the soil and in aquatic environments and faecal coliform such as
Escherichia coli (-ve) whose presence would be indicative of faecal contamination.
Citrate utilization test is used to determine the ability of bacteria to utilize sodium citrate as
its only carbon source and inorganic (NH4H2PO4) is the sole fixed nitrogen source. When an
organic acid such as citrate is used as a carbon and energy source, alkaline carbonates and
bicarbonates are produced ultimately. In addition, ammonium hydroxide is produced when
the ammonium salts in the medium are used as the sole nitrogen source.
Method:
1. Inoculate Simmons citrate agar lightly on the slant by touching the tip of a needle to a
colony that was 24 hours old.
2. Incubate at 37 °C for 24 hours. Some organisms may require up to 7 days of
incubation due to their limited rate of growth on citrate medium.
Positive Result: Development of bright blue color
Negative Result: No color change
3.8. 9 Antibiotic sensitivity tests
The standard Kirby-Bauer disk diffusion method was used to determine the antimicrobial
susceptibility profile of the isolates (Bauer, 1199) according to the recommendations of
National Committee for Clinical Laboratory Standard (CLSI-2015). Sensitivity to antibiotics
was studied on Muller-Hinton Agar plate used the different types of commercial antibiotic
discs. The antibacterial used are Gentamycin (GN10), Chloramphenicol (C30), Azithromycin
(AZM30), Levofloxacin (LE5), Amikacin (AK30), Ampicillin (AMP25), Colistin (CL10),
Tetracycline (TE30), Erythromycin (E15), Bacitracin (B10), Novobiocin (NV30). Antibiotic
disks were applied using some sterile forceps. Agar plates were incubated at 37°C for 24
hours. After overnight incubation at 37°C, the diameter in millimeters of the zones of
inhibition around each of the antimicrobial discs was recorded and categorized as resistant or
sensitive in accordance with company recommendations. All isolates were tested for
sensitivities to 11 of routine and practical antibiotics. Antibiotic disks are used shown in
(Table-5).
Table 5: Antimicrobial agents with their disc concentration and diameter of zone of
inhibition
Antimicrobial Agents Resistant or less Intermediate Sensitive or
42
more
Gentamycin-10µg ≤12 13-14 ≥15
Chloramphenicol-30µg ≤12 13-17 ≥18
Azithromycin-25µg ≤13 14-17 ≥18
Levofloxacin-5µg ≤13 14-16 ≥17
Amikacin-30µg ≤14 15-16 ≥17
Ampicillin-25µg ≤18 19 ≥20
Colistin-10µg ≤11 12-16 ≥17
Tetracycline-30µg ≤14 15-18 ≥19
Erythromycin-15µg ≤13 14-22 ≥23
Bacitracin-10µg ≤8 9-12 ≥13
Novobiocin-30µg ≤17 18-21 ≥22
3.8.10 Antimicrobial susceptibility testing of isolated microorganisms
Antibiotic susceptibility testing (AST) is usually carried out to determine which antibiotic
will be most successful in treating a bacterial infection in vivo.
The procedure involved the following steps -
 The bases of each of the agar plates were labeled with the name of the test organism
to be inoculated.
 A sterile cotton swab was dipped into a well-mixed saline test culture and by pressing
the saturated swab against the inner wall of the culture tube excess inoculums was
removed.
 Using the swab, the entire agar surface horizontally, vertically, and around the outer
edge of the plate to ensure a heavy growth over the entire surface was streaked.
 All the culture plates are allowed to dry for about 5 minutes.
 The individual discs were placed at equal distances with forceps dipped in alcohol and
flamed.
 Each disc down was pressed down with sterile forceps to ensure that the discs adhere
to the surface of the agar.
 All the culture plates were incubated in an inverted position for 24 hours at 37°C.
 All the culture plates are examined for the presence or absence of a zone of inhibition
surrounding each disc after completion of incubation.
43
3.8.11 Maintenance of stock culture
After completion of characterization of bacteria pathogens it was necessary to preserve the

isolated organisms for longer periods. For this purpose, pure culture of the isolated
Staphylococcus sp. E. coli and Salmonella were stored in sterilized 80% glycerol and used as
stock culture. Stock culture was prepared by adding 1ml of 80% sterilized glycerol in 1 ml of
pure culture in nutrient broth and it was stored at -20ºC for further use.
CHAPTER IV
RESULTS
44
Although fruit juices are very common and potential for human health, but over their
hygiene, safety and quality much concerns have been raised. Many fruit juice company have
already started producing different fruit juices and many of them going to market their
products in the market, but most of the companies have no concern about the quality of the
juice products. On the other hand, while making fruit juices in home people only think about
the nutritional benefits other than the quality of the juice.
The present research was carried out to isolation and molecular characterization study of
bacterial pathogens isolated from handmade and packets fruit juice. The collected samples
were subjected to various bacteriological examinations such as cultural, morphological,
biochemical techniques with antibiotic sensitivity pattern of identified isolates in the
laboratory of the department of Microbiology, HSTU, and Dinajpur. A total 40 sample were
collected from fruit juice for this study. Out of 40 samples, 1 organism was identified as
bacteria. The samples were subjected to bacteriological examination for isolation and
identification of bacteria. The identified bacteria were also subjected to molecular
characterization by PCR.
4.1 Results of isolation and identification of pathogen (Bacteria)
Isolation and identification of bacterial pathogen a total of 40 samples from fruit juice. The
samples were spread on Nutrient agar, MacConkey Agar, Eosin Methylene Blue Agar, (From
top to bottom right in order). After overnight incubation the number of colonies were
observed and recorded. Results of bacterial pathogens by using morphological and cultural
test the cultural characteristics of E. coli, on various selective media are presented in
following (table 7).
Table 6: Total Bacterial Count of handmade fruit juice sample
45
Sapling site Sample Total bacterial Total Escherichia coli
number count CFU/ml count CFU/ml
Baser hat 1 2.3×104 1.1×102
2 1.5×105 1.3×103
3 3×104 1.75×102
Sweehari 7 3.1×105 1.1×102
8 4.1×104 1.75×102
Gopal gonj 15 5.5×10 4 2.1×103
17 2.8×106 1.85×102
Dashmail 21 5.1×104 1.9×102
9 2.75×105 1.5×102
19 3.1××10 4 1.8×103
Kalitola 28 2.1×10 6 1.1×103
27 2.75×10 6 1.4×104
Bahadur 23 1.7×10 6 1.3×10 3

bazar
26 1.9×10 5 1.9×103
10 2×10 4 1.65×104
Boromath 14 4.10×10 4 1.1×104
6 5.1×10 5 1.3×10 4
Table 7: Total bacterial count of packets juice sample
46
Sapling site Sample Total bacterial Total Escherichia coli
number count CFU/ml count CFU/ml
Baser hat 5 1.75×10 5 1×101
Lilirmore 7 2×105 1.1×101
Chirirbandar 3 2.75×10 6 1.2×104
Table-8: Isolation and identification of bacteria by using morphological and cultural

characteristics
Name of media Cultural properties Morphological Remarks

properties
NA agar Large mucoid, white Pink colored, small E. coli

colony rod shaped
organism.
EMB agar Green metallic sheen Arranged in single,
with reflected light pair or short chain.
MAC agar Produce large mucoid
,rose pink colony
4.2 Characterization of bacteria by using different biochemical tests
Catalase test was performed by placing a drop of hydrogen peroxide on slide and mixing the
colony of the bacteria to be tested thoroughly. Catalase test was Negative (absence of bubble)
for E. coli (Figure-11).
The identified isolates were characterized by using different biochemical test (MR, VP, TSI,
MIU, Indole, Oxidase test etc). This observation also revealed that isolated organisms were
Escherichia coli.
Indole test were also positive (presence of a cherry red colored ring on the surface of the
media) for Escherichia coli (figure 15). In addition, MR reaction were positive (presence of a
47
red colored colony on the surface of the media) for Escherichia coli, VP test were negative
(absence of a red colored colony on the surface of the media) for Escherichia coli, Simon’s
citrate agar were negative (No colored changed of the medium) for E. coli.
MIU test were positive (Diffuse, hazy growth, slightly opaque media) for Escherichia coli.
Table 9: Characterization of bacteria using different biochemical tests

Name of the test Observation Remarks
Catalase test Absence of bubbles Escherichia coli
Coagulase test Absence of bubble Escherichia coli
Oxidase test No color change Escherichia coli
Indole test Present of cherry red colored Escherichia coli

ring on surface of the media
MR test Presence of a red colored ring Escherichia coli
on the surface of the media
VP reaction Absence of red colored ring on Escherichia coli

the surface of media
Simon’s citrate test No color change of the Escherichia coli

medium
MIU test Diffuse hazy growth slightly Escherichia coli

opaque media.
TSI test Slant Butt Gas Production O2 Remarks
Yellow Yellow Presence Absence Escherichia coli
4.3 Results of Gram’s staining technique
48
The obtained results revealed that grams negative pink color, small road shaped organisms
arranged in single pair short chain indicated E.coli (Plate-4).
4.4 Result of antibiotic sensitivity test of isolated bacteria

The isolated Escherichia coli were subjected to antibiotic test to determine the sensitivity
and resistant pattern against common used antibiotic disc.
4.5 Antibiotic sensitivity pattern of Escherichia coli

The antibiotic sensitivity test revealed that all of the isolated Escherichia coli were resistant
to Levofloxacin, Ampicillin and Tetracycline. The isolate were sensitive to Gentamycin,
Chloramphenicol and Azithromycin. The isolates were intermediate to Amikacin, Colistin,
and Erythromycin (plate-9, 10).
Table-10: Zone diameter interpretative standards Escherichia coli
SI. Antimicrobial agents Disc code Diameter of zone of inhibition (ZOI)
No. (µg/disc) Susceptible Intermediate Resistant
01 Gentamycin (GEN) 10 25
02 Chloramphenicol (C) 30 28
03 Azithromycin (AZM) 30 15
04 Levofloxacin (LE) 05 17
05 Amoxicillin (AMX) 30 - - -
06 Ampicillin (AMP) 25 - - -
07 Ciprofloxacin (CIP) 05 - - -
08 Erythromycin (E) 15 - 14 -
09 Tetracycline (TE) 30 - - -
Table-11: Characterization of Bacteria by PCR.
49
Bacteria Amplified
Primer Sequence (5′-3′) Reference
Name Product
tetA Forward GGTTCACTCGAACGACGTCA
E. coli 576 bp El Seedy et al (2019)

tetA Reverse CTGTCCGACAAGTTGCATGA
50
Plate 1: White mucoid colonies on Nutrient agar.
Plate 2: Green metallic sheen colony of E.coli on EMB agar with reflected
light.
51
Plate 3: Rose pink colony of E.coli on MAC agar.
Plate 4: Gram negative large pink color, road shaped E. coli, arranged in single,
pair or short chain under microscope (100X).
52
Figure 4: Catalase test show negative
Figure 5: Oxidase test show negative
Figure 6: Coagulase tests, E. coli are negative absence of clumping.
53
Plate 5: Methyl red test, showing red color ring on the surface of media.
Plate 6: Motility test, E.coli show color change. Plate 7: TSI test, E. coli produces gas
54
Plate 8: Citrate test show no color change
55
Ciprofloxacin
Tetracycline
56
4.5.6 Confirmation of Escherichia coli by PCR
PCR primers targeting gene of Escherichia coli amplified1492 bp fragments of DNA
confirmed
The identity of Escherichia coli. Result of PCR for Escherichia coli.
M
PCR condition
bp 1. Initial heating 95°c-5 min
2.Denaturation 95°c- 30 sec
1500 3.Annealing 48°c-30 sec

1000 1492 bp
4 .Extension 72°c-90sec
700
500 5. Final extension 72° c- 5 min (35
250 cycle from step 2 to4)
Figure7: Profiles of 27F and 1492R primers generated from Bacteria, M: denotes 1 kb
DNA ladder (Marker).
Chapter V
Discussion
57
In many developing countries including Bangladesh, millions of people are widely
consuming fruit juices in every season as it provides an affordable source of nutrients to
them. Packed fruit juices being good in taste and available at low price and at the same time
they are liked by the consumers. (Ohiokpehai, 2003). Many fruit juice company are
producing and marketing different fruit juices, but most of the companies have no concern
about the quality of the juice products. Most of them think commercially and they are only
concerned about the marketing (with colorful advertisement) of their products. Though they
might maintain a lot of hygiene in their factory to avoid contamination (which is a good sign)
but in most of the factory they use preservatives or harmful chemicals to lower the microbial
growth in juice. In long time effect these harmful preservatives and chemicals can cause a
thousand times more powerful disease to human being than the microbes, or cause mutation
inside our body which eventually kills people ten times faster than normal diseases. Factors
which determine the colonization of juices by microorganisms include pH, redox potential,
water activity, nutrients, structures, antimicrobial agents, temperature, relative humidity, and
atmosphere (Raybaudi, 2009). In the present study the frequencies of occurrence of molds
and yeasts were more as compared to bacterial genera which are attributed to low pH values
and high sugar content (A. Rivas, 2006).
In this study the isolated organism were characterized by morphological examination by

using Grams staining technique, the result revealed that grams negative pink color, road
shaped organisms arranged is single pair short chain indicated E.coli.
In this study bacteria were isolated from handmade and packets fruit juice by using spread
plate method on NA, EMB and MacConky media .All the isolates produce opaque, smooth
colony on the different media. It was observed that Escherichia coli produce green metallic
sheen colony on EMB agar, and produced pink colony on MacConky agar.
In this study, morphologically and culturally identified isolates were then identified by using
different biochemical test. This observation also revealed that isolated organism is E.coli with
their biochemical reactions. Catalase test was performed by placing a drop of hydrogen
peroxide on slide and mixing the colony of the bacteria to be tested thoroughly. Catalase test
was negative (absence of bubbles) for E.coli. The identified isolated were characterized by
using different biochemical test (MP, VP, MIU, indole oxidase test etc.) .this observation also
revealed that organism were Escherichia coli. Indole test were also positive (presence of
cherry red colored ring on the surface of the media). In addition MR reaction was positive for
E.coli (presence of a red colored colony on the surface of the media).VP test were negative
for E.coli .MIU test for E.coli positive.
58
PCR primers targeting gene of Escherichia coli amplified 1492 bp fragment of DNA
confirmed the identity of Escherichia coli. Total viable count of handmade juice samples
were ranges from 1.5×105to 5.5×10 4 and total Escherichia coli count ranged from 1.1×102
to2.1×103.Total viable count of packets juice were ranged from1.75 ×10 5 to 2.75×10 6 and
total Escherichia coli count were ranged from1×101 to 1.2×104 . The identified bacteria were
tested for sensitivity to use common antibiotics. E.coli isolates were sensitive to gentamycin,
chloramphenicol and azithromycin and resistant to amoxicillin, ciprofloxacin and
tetracycline. This study specially highlights the level of Escherichia coli found in various
fruit juice samples. Some of the microorganisms detected in these juice samples can cause
disease in human beings, so there is need for some guidelines that can improve the quality of
fruit juices.
Chapter VI
59
Conclusion
Present study was performed to isolate and characterized bacterial agent Escherichia coli
predominant bacterial species isolated from the handmade and packets fruit juice. From the
data presented in the current study, it could be hard to claim that, consumption of packets
fruit juice safe than handmade fruit juice because almost all types of handmade fruit juice and
commercially packed juice samples collected from different areas of Dinajpur city were not
satisfactory as Escherichia coli, were found in large numbers from samples. There is a
generalized belief among the people that, automated machines and some preservatives are
used during processing of commercial fruit juices. Despite all these issues, a large number of
Escherichia coli count were detected from both commercially packed fruit juices and
handmade fruit juice in this current study, which clearly indicates poor plant management and
personnel hygiene. A combination of regular monitoring and proper training could be an
appropriate choice in fruit juice industries to minimize the health risks. In addition to this, not
only government authorized institution like BCSIR and BSTI but also some strongly active
administrative organization like mobile court should be given more authorization to
undertake precautionary investigations to check the microbial and chemical quality of fruit
juices. Besides, government and non-government institutions should create public awareness
about the contamination and adulteration of fruit juices more intensely with the help of social
media. So that people can take initiative for increasing awareness among them for checking
batch manufacturing date before consume juice products.
60
Appendix
Appendix- I
Media compositions
The composition of all media used in the study is given below.
Nutrient Agar
Component Amount (g/L)
Peptone 5. 0
Sodium chloride 5.0
Beef extract 3.0
Agar 15.0
Final pH 7.0
MacConkey Agar

Peptic digest of animal tissue 1.5
Casein enzymic hydrolysate 1.5
Pancreatic digest of gelatin 17.00
Lactose 10.00
Bile salts 1.50
Crystal violate 0.001
Neutral red 0.03
Agar 15.00
61
Physiological Saline

Sodium Chloride 9.0
Simmon’s Citrate Agar

Magnesium sulphate 0. 2
Ammoniun dihydrogen phosphate 1.0
Dipotassium phosphate 1.0
Sodium citrate 2.0
Sodium chloride 5.0
Bacto agar 15.0
Bacto bromo thymol blue 0.08
Methyl red Vogus Prekaure (MRVP) Media

Peptone 7. 0
Dextrose 5.0
Dipotassium hydrogen phosphate 5.0
Final pH 7.0
Triple Sugar Iron Agar

Bio-polytone 20.0
Sodium chloride 5.0
Lactose 10.0
Sucrose 10.0
Dextrose 1.0
Ferrous ammonium sulphate 0.2
Sodium thiosulphate 0.2
Phenol red 0.0125
Agar 13.0
Final pH 7.3
Motility Indole Urease (MIU) Agar

Tryptone 10
62
Phenol red 0.1
Agar 2.0
Sodium chloride 5.0
pH (at 25°C) 6.8 ± at 25°C
Mueller Hinton Agar

Beef, infusion from 300. 000
Casein acid hydrolysate 17.500
Starch 1.500
Agar 17.000
Final pH ( at 25°C) 7.3±0.1
Methylene blue 0.065
Agar 13.50
Appendix – II
Reagents
Crystal Violet (100 ml)
To 29 ml 95% ethyl alcohol, 2 g crystal violet was dissolved. To 80 ml distilled water, 0.8 g
ammonium oxalate was dissolved. The two solutions were mixed to make the stain and
stored in a reagent bottle at room temperature.
Safranin (100ml)
To 10 ml 95% ethanol, 2.5 g safranin was dissolved. Distilled water was added to the
solution to make a final volume of 100 ml. The final solution was stored in a reagent bottle
at room temperature.
Gram’s iodine (300 ml)
To 300 ml distilled water, 1 g iodine and 2 g potassium iodide was added. The solution
was mixed on a magnetic stirrer overnight and transferred to a reagent bottle and stored
at room temperature.
63
Kovac’s Reagent (150 ml)
To a reagent bottle, 150 ml of reagent grade isoamyl alcohol, 10 g of p-

dimethylaminobenzaldehyde (DMAB) and 50 ml of HCl (concentrated) were added and
mixed. The reagent bottle was then covered with an aluminum foil to prevent exposure of
reagent to light and stored at 4°C.
Methyl Red (200 ml)
In a reagent bottle, 1 g of methyl red powder was completely dissolved in 300 ml of ethanol
(95%). 200 ml of destilled water was added to make 500 ml of a 0.05% (wt/vol) solution in
60% (vol/vol) ethanol and stored at 4°C
Barrit’s Reagent A (100 ml)
5% (wt/vol) a-naphthol was added to 100 ml absolute ethanol and stored in a reagent
bottle at 4°C.
Barrit’s Reagent B (100 ml)
40% (wt/vol) KOH was added to 100 ml distilled water and stored in a reagent bottle at 4°C.
Oxidase Reagent (100 ml)
To 100 ml distilled water, 1% tetra-methyl-p-phenylenediamine dihydrochloride was added

and stored in a reagent bottle covered with aluminum foil at 4°C to prevent exposure to
light.
Catalase Reagent (20 ml 3% hydrogen peroxide)
From a stock solution of 35 % hydrogen peroxide, 583 µl solutions was added to

19.417 ml distilled water and stored at 4°C in a reagent bottle.
Urease Reagent (50 ml 40% urea solution)
To 50 ml distilled water, 20 g pure urea powder was added. The solution was filtered
through a HEPA filter and collected into a reagent bottle. The solution was stored at room
temperature.
Nitrate Reagent a (100 ml)
5Nacetic acid was prepared by adding 287 ml of glacial acetic acid (17.4N) to 713 ml of
deionized water. In a reagent bottle, 0.6 g of N, N-Dimethyl-α-naphthylamine was added
64
along with 100 ml of acetic acid (5N) and mixed until the color of the solution turned light
yellow. The reagent was stored at 4°C.
Nitrate Reagent B (100 ml)
In a reagent bottle, 0.8 g of sulfalinic acid was added along with 100 ml acetic acid (5N) a to
form a colorless solution and stored at 4°C.
65
References
A. Rivas, D. R.-C. (2006). LWT—Food Science and Technology. Effect of

PEF and heat pasteurization on the physical-chemical characteristics of blended
orange and carrot juice, vol. 39, no. 10, pp. 1163-1170.
Abbo, E., Olurin, T., & Odeyame, G. (2006). Afr. J. Biotechnology. Studies
on the storage stability of soursop (Annona Muricata L.), p- 108-112.
Acharya, T. (2015). Tests for Bacterial Motility: Procedure and Results.
Ahmed MSU, N. T. (2009). Bangladesh Journal of Scientific and Industrial

Research. . Microbiological quality of local market vended freshly squeezed
fruit juices in Dhaka city, Bangladesh. , 44(4), 421-424.
Andres, S. C. (2004). International Journal of Food Science and Technology.

The effect of temperature on microbial growth in apple cubes packed in film
and preserved by use of orange juice. , 39 (9): 927-933.
Aneja, K. R. (2014). Microbes Associated with Freshly Prepared Juices of

citrus and carrots.
Aryal , S. (2015). Blood Agar- Composition, Preparation, Uses and Pictures.
Bagde, N. I. (2011). Asiatic Journal of Biotechnology Resources. Studies on

microbial flora of fruit juices and cold drinks, 2 (4): 454-460.
Balla , C., & Farkas , J. (2006). Minimally processed fruits and fruit products
and their microbiological safety, p-115-28.
Barro, N., Bello, A.R., Aly, S., Ouattarac, & A.T, I. (2006.). African Journal.
Hygienic status anssessment of dishwashing waters,utensils, hands and pieces
of money from treetfood processing sites in Ouagadougou (BurkinaFaso).
66
Basar, M. A. (2007). Bangladesh Journal of Microbiology . Assessment of
microbiological quality of processed fruit juice. , 24 (2): 166-168.
Beuchat , L. (2002). Ecological factors influencing survival and growth of

human pathogens on raw fruits and vegetables, p- 413-23.
Cappuccino, J. G., & Sherman, N. (2005). Microbiology: A Laboratory

Manual, 8th Edition. SUNY, Rockland: Pearson.
Cruz, T. E., & Martin, J. O. (2012). Gelatin Hydrolysis Test.
Cappuccino, J. G., & Sherman , N. (2005). Microbiology A Laboratory

Manual. Seventh edition.
Davidson, P. (2001). Food microbiology: fundamentals and frontiers. Chemical

preservatives and natural antimicrobial compounds, 2nd edition, p- 593-627.
Franke, A. (2005). "Bioavailability and an J Agric Food Chem . Franke, AA;

Cooney, RV; Henning"Bioavailability and antioxidant effects of orange juice
components in humans", 53 (13), p-5170–8.
Gulf, S. (2000). Microbiological criteria for foodstuffs. Part 1. Riyadh, Saudi

Arabia: GCC.
Gulzar Ahmad Nayik, T. A. (2013). Asian Jr. of Microbiol. Biotech. Env. Sc.,
Global Science Publications . Microbial analysis of some fruit juices available
in the markets of kashmir valley, india, Vol. 15, p-733-737.
Hejazi, A. (1997). Medical Microbiology. Serratia marcescens, p- 903-912.
IDF. (1994). Belgium: International Dairy Federation. Recommendations for

the hygienic manufacture of milk and milk based products, appendix A. In
Spoilage and pathogenic bacteria in milk based products,, p. 28-30. .
67
Ihekoronye, A., & Ngoddy, P. (1985). Integrated food Science and Tecnology
for the Tropics. Macmilan Ltd, London, pp- 296-323.
Joy E. Lewis, P. T. (2006). Internet Journal of Food Safety. Human Bacteria in

Street Vended Fruit Juices: A Case Study of Visakhapatnam City, India, Vol. 8,
p. 35-38.
Kurowska, E. (2000). "HDL-cholesterol-raising effect of orange juice in

subjects with hypercholesterolemia"., 1095–100.
Kayla, B. (2004). “The Miracle Microbe: Serratia marcescens”. Serratia

marcescens.
Lund, B., & Snowdon, A. (2000). The microbiological safety and quality of
food. Fresh and processed food., p- 738-58.
MacWilliams, M. P. (2009). Indole Test Protocol.
McDevitt , S. (2009). Methyl Red and Voges-Proskauer Test Protocols.
McGee, H. (2004). On Foods and Cooking. The Science and Love of the
kitchen, p-714.
Md. Munjur Kader, A. A. (2014). International Journal of Biosciences | IJB | .

Bacteriological analysis of some commercially packed and fresh fruit juices
available in Jessore city: a comparative look, ISSN: 2220-6655.
Montville, T., & Matthews, K. (2001). Food microbiology: fundamentals and

frontiers, 2nd edition. Principles which influence microbial growth, survival,
and death in food, p- 1332.
Neves, M. F. (2012). The orange juice business. World consumption of fruit

juices, nectars, and still drinks, p 119.
68
Ohiokpehai , O. (2003). Pakistan Journal of Nutrition. Nutritional Aspects of
Street Foods in Botswana.
PM, D. (2001). Chemical preservatives and natural antimicrobial compounds,

p- 593-627.
Rashed, N. M. (2013). International food Research journal 20. Microbiological

study of vendor and packed juices locally available in Dhaka city, Bangladesh,
1011-1015.
Raybaudi-Massilia R. M., J. M.-M.-F.-B. (2009). ComprehensiveReviews in

Food Sciences and Food Safety. Control of pathogenic and spoilage
microorganisms in fresh-cut fruits and fruit juices by traditional and alternative
natural antimicrobials, vol. 8, no. 3, pp. 157-180.
Reiner, K. (2010). Catalase Test Protocol.
Reller, L. B., Weinstein, M., Jorgensen, J. H., & Ferraro, M. J. (2009). A

Review of General Principles and Contemporary Practices. Antimicrobial
Susceptibility Testing:, Volume 49, Issue 11, Pp. 1749-1755.
Shields, P., & Cathcart, L. (2010). Oxidase Test Protoco.
Sturm, T. (2013). Casein Hydrolysis.
69

Evaluation Copy 2

Uploaded by

Copyright:

Available Formats

You might also like

Evaluation Copy 2

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Evaluation Copy 2

Uploaded by

Copyright:

Available Formats

ISOLATION, IDENTIFICATION AND MOLECULAR CHARACTERIZATION OF

Escherichia coli FROM HANDMADE AND PACKETS FRUIT JUICE AVAILABLE

REGISTRATION NO: 1905185

SEMESTER: JULY-DECEMBER, 2020

MASTER OF SCIENCE (M.S.)

HAJEE MOHAMMAD DANESH SCIENCE AND TECHNOLOGY

REGISTRATION NO: 1905185

SEMESTER: JULY-DECEMBER, 2020

Hajee Mohammad Danesh Science and Technology University, Dinajpur

In partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE (M.S.)

HAJEE MOHAMMAD DANESH SCIENCE AND TECHNOLOGY

REGISTRATION NO: 1905185

SEMESTER: JULY-DECEMBER, 2020

Approved as to style and content by

(Professor Dr. Md. Mostafizer Rahman)

HAJEE MOHAMMAD DANESH SCIENCE AND TECHNOLOGY

wishers. The Author December, 2020.

CHAPTER NO LIST OF CONTENT PAGE

CHAPTER-II REVIEW OF LITERATURE 19-23

CHAPTER-III MATERIALS AND MATHODES 24-43

3.1 Location of the study 24

3.4 Media for culture 27

3.5.8 Muller-Hinton Agar (MHA) 34

3.5.10 MIU Medium 34

3.6.1 Methyl-Red Solution 34

3.7.3 Morphological study by Gram’s staining 35

CHAPTER IV RESULTS 44-56

CHAPTER V DISCUSSION 57-58

Table 7: Total bacterial count of packets juice sample

Table-8: Isolation and identification of bacteria by using morphological and cultural

TVC Total Viable Count

Plate 6: Motility test, E.coli show color change.

Plate 9: Antibiotic sensitivity test of E.coli

Plate 10: Antibiotic sensitivity test of E.coli

Figure 1: Schematic illustration of the experimental layout.

Figure 2: Schematic illustration of the bacterial genomic DNA isolation.

Figure 3: Schematic illustration of the process of Electrophoresis.

Figure 4: Catalase test show negative

Juice Amount Per1 cup (249g)

Vitamin A 2% Vitamin C 62% % Daily Value*

Vitamin D 0% Vitamin B-6 60% Polyunsaturated fat 0 g

Bacterial genes when mutate because of chemical or radiation exposure; or sometimes

2.1 Isolation and identification of microbes

MATERIALS AND MATHODES

3.1 Location of the study

The study was conducted at Microbiological Laboratory, HSTU, and Dinajpur-5200.

3.1.2 Collection sites

3.1.3 Collection of samples

3.1.5 Handmade fruit juice sample

Sampling site Number of the Name of the Total sample

Modern more 2 Lemon

3.1.6 Packets fruit juice

3.1.7 Sample processing

3.1.8 Serial dilution

3.2 Laboratory preparation

3.3 Glassware’s and appliances