Molecular Genetics Test Questions 2023

DNA Replication

You are a molecular biologist developing new cancer treatments. Your current project is trying to find
ways to disrupt the DNA replication process within cancer cells, to prevent the cancer cells from
successfully going through mitosis and dividing. DNA replication is a complicated process with a lot of
moving parts, so you think that you can prevent cell division by destroying or modifying some of the
components.

You first create a drug that attacks DNA polymerase within cancer cells. What effect might this have on
the process of DNA replication? How might this prevent the cancer cells from successfully dividing?

Your next target is ligase, so you create a drug that stops cancer cells from producing ligase. What effect
might this have on the process of DNA replication? How might this prevent the cancer cells from
successfully dividing?

Your next target is helicase. Helicase normally does NOT have an effect on the newly synthesized strands
of DNA, but you create a drug that causes helicase in cancer cells to be over-active. This over-active
helicase continuously binds to and acts on any DNA available, both old DNA and newly created DNA.
What effect might this have on the process of DNA replication? How might this prevent the cancer cells
from successfully dividing?

Central Dog-ma

You are a veterinary scientist studying genetic deafness in purebred Dalmatian puppies (a very real
problem within the breed!). About 30% of Dalmatians are born deaf in at least one ear and the cause of
this is not well understood. It is known that, sometimes, something about the Dalmatian breed’s
genetics causes parts of their inner ear to rapidly degenerate and stop working. Armed with your
knowledge of the Central Dogma of Biology, you begin researching what could be causing this
degeneration.

-You begin with a female adult Dalmatian named Jot. Jot is deaf in both ears. You ask Jot’s breeder about
her family history to begin building a pedigree. He describes it to you like this:

Jot’s mother and father were both deaf in one ear.

Jot was part of a 7 puppy litter, 5 of which have some kind of deafness.

Jot herself had a litter of 6 puppies with a male dog that was not deaf, and 2 of the puppies had
some form of deafness.

What information can you gather from this family history? Is there a pattern to Dalmatian deafness?
How might this inform how you carry out your research?

-By running some molecular tests, you discover that all Dalmatians that exhibit deafness are lacking a
specific protein required for inner ear formation. Excited by this discovery, you gather DNA samples from
some deaf Dalmatians as well as Dalmatians that have perfect hearing. When you compare the two
types of DNA for differences, you are initially dismayed to discover that deaf Dalmatians exhibit no
difference in the DNA that codes for the inner ear protein. It’s the same as the dogs that can hear!

What could be causing the deaf Dalmatians to lack the necessary protein when the DNA that codes for
the protein is exactly the same as in hearing Dalmatians? Where else should you look for a problem?

EXTRA CREDIT: What specific enzyme and/or process (that we briefly discussed) could be causing this
problem?

Protein Synthesis 1

You are a geneticist with poor ethics working on creating designer babies for the ultra-rich. Part of your
job is making precise edits to human DNA in order to create perfect little super humans to one day rule
the world. Here are some of your daily tasks:

-To create a baby with super strength, you know you need an mRNA strand that reads

UUGCAUGUAAGCCCCCUGUCAU

What DNA sequence would you need to build to get this mRNA? What chemical components would you
need to build the DNA strand?

-You know that the following amino acid sequence makes a protein that will provide enhanced eyesight:

Methionine – Alanine – Valine – Proline – Arginine – Glycine – Leucine – Histidine—STOP

What is one possible strand of mRNA that you could build to produce this protein? What chemical
components would be different about the mRNA you build when compared to DNA?

Protein Synthesis 2

You are still a geneticist with poor ethics. You find out one of your competitors (another super-baby-
making-poor-ethics-geneticist) has created a new gene to insert into rich peoples’ babies that causes the
babies to have enhanced night-time vision like a cat. In fact, it’s rumored that the gene is literally an
isolated feline gene. The gene has this DNA sequence:

TACACGCCCGGTGAGTTGTGCCCGCCCCCCATT

In order to better understand the competition, you write out the mRNA that would result from the
transcription of this gene and the amino acid sequence that would result from the translation of the
mRNA.

During your investigation you realize that if you change the last amino acid in the protein into a Glutamic
Acid molecule, the babies’ eyes would also gain protection from UV damage in addition to the enhanced
night vision. How would you make this change? (where, from what to what, etc)
If you changed every third (3rd, 6th, 9th, etc) nucleotide in the DNA sequence to cytosine, what would the
resulting amino acid sequence be? What is surprising about this change?

How is it, biologically, that a human could use and benefit from a feline gene inserted into their genome?
Why is this hypothetical situation possible?