VIETNAM NATIONAL UNIVERSITY – HO CHI MINH CITY

INTERNATIONAL UNIVERSITY

Sequencing mitochondrial genome and

phylogenetic analysis of gaur individuals
collected from Vietnam

A thesis submitted to

The School of Biotechnology, International University

In partial fulfillment of the requirements for the degree of

B.S. in Biotechnology

Student’s name: Đặng Gia Hoàng - BTBTIU17071

Supervisor: Dr. Le Minh Thong

September 2022
ACKNOWLEDGEMENT
First of all, I would want to express my heartfelt thanks to my thesis advisor Le
Minh Thong, Ph.D., who encouraged me to engage in many experiences,
overcome numerous hurdles, and nurture new skills during the growth of my thesis
performance. I am grateful for his helpfulness, patience, loyalty, and generosity
anytime I needed assistance. Without his supervision and devoted participation
during the development of my thesis, this research paper would have never been
produced; I am indebted to him for his assistance.

In addition, I would like to express my gratitude to Assoc. Prof. Nguyen Van

Thuan - Dean, Head of the Department of Biotechnology at the International
University, provided me with the opportunity to work in a professional environment,
particularly in the Biomedicine and Molecular Biotechnology Laboratory (LA1.702).
He inspires me to the greatest level and gives me access to research resources that
play a key role in the development of my thesis. Associate Professor Nguyen Van
Thuan has provided me with wholehearted aid, uplifting inspiration, and
encouraging counsel during my thesis course.

Second, I'd like to thank The Office of Biotechnology Department, specifically all my
professors in the Department of Biotechnology at International University, for
creating the best conditions for me to perform lab work with practical experience
and gain profound knowledge outside of book-learning, as well as a professional
atmosphere for learning both soft and hard skills over the past four years.

In addition, I'd like to express my appreciation to Tran Thi Hai Yen, Ph.D., and Do
Ngoc Phuc Chau, MSc, for their aid in imparting helpful tips on laboratory
procedures and for their kind welcome. It was convenient for me to work with
everyone else.

My dissertation required more than assistance, so I have a diverse group of

colleagues to thank for listening to me and putting up with me over the last four
years. I admire these caring pals. Quang Trong Thoai, BSc., Nguyen Thi
Phuong Hang, Dao Quoc Tan, Hoang Ngoc Thien, Nguyen Thanh Liem, Tran
Phuc Toan, and Ho Hai Long provided personal and professional support
throughout my time at the Biomedicine and Molecular Biotechnology Laboratory
(LA1.702).
SEQUENCING MITOCHONDRIAL GENOME AND PHYLOGENETIC
ANALYSIS OF GAUR INDIVIDUALS COLLECTED FROM VIETNAM

Gia Hoang Danga, Minh Thong Lea,b

a School of Biotechnology, International University – Vietnam National University in

HCMC

b Corresponding author’s email address: lmthong@hcmiu.edu.vn

1
ABSTRACT
The gaur (Bos gaurus) is the biggest living species of Bovine and is native to South
Asia and Southeast Asia. A minority of gaurs inhabits Vietnam's Cát Tiên National
Park. Moreover, the gaur population has declined significantly over the past two
decades due to a variety of human activities. In addition, there is insufficient
genetic evidence to distinguish the Vietnamese gaur from other gaurs. Meanwhile,
the mitochondrial genome is acknowledged as a crucial conservation tool for
identifying the genetic relationship between individual gaurs and another
population, as well as for detecting distinct mutations throughout the whole
genome. Therefore, sequencing the mitochondrial genome of the Bos gaurus
population in Vietnam is an urgent measure for conservation issues. Consequently,
this study successfully extracted mitochondrial DNA from Bos gaurus samples and
was conducted to optimize conditions for long-range PCR with the purpose of whole
mitochondrial sequencing. The mitochondrial genome of Bos gaurus in Vietnam was
partially sequenced at a cytochrome b gene (cob), 12S rRNA, and 16S rRNA
regions. Furthermore, while comparing these regions to the whole mitochondrial
genome of other gaur populations, initially indicating the genetic distinctions and
coining the premises for further study of sequencing the whole mitochondrial
genome in highlighting the genetic value and detecting distinctive mutations in the
genome of the Bos gaurus in Vietnam served for conservation strategies.

KEYWORDS: Bos gaurus, long-range PCR, mitochondrial genome, Sanger

sequencing.

2
TABLE OF CONTENTS
ACKNOWLEDGEMENT ____________________________________________________________ II
ABSTRACT ________________________________________________________________________ 2
TABLE OF CONTENTS _____________________________________________________________ 3
1. INTRODUCTION _______________________________________________________________ 7
2. MATERIALS AND METHODS ___________________________________________________ 9
2.1. GENERAL SCHEME OF THIS STUDY ________________________________________________________ 9
2.2. SAMPLE COLLECTION_________________________________________________________________ 9
2.3. DNA EXTRACTION _________________________________________________________________ 10
2.3.1. Lysis buffer preparation ______________________________________________________ 10
2.3.2. Sample incubation __________________________________________________________ 10
2.3.3. Organic extraction __________________________________________________________ 10
2.4. LONG-RANGE PCR _________________________________________________________________ 11
2.4.1. Bos gaurus DNA sample and primers ___________________________________________ 11
2.4.2. Conventional long-range PCR _________________________________________________ 12
2.4.3. PCR amplicons purification ___________________________________________________ 14
2.5. MITOCHONDRIAL GENOME SEQUENCING __________________________________________________ 15
2.5.1. Prepare the sequencing reactions ______________________________________________ 16
2.5.2. Set up cycle sequencing conditions _____________________________________________ 18
2.5.3. Sanger sequencing of the mitochondrial genome of Bos gaurus _____________________ 18
2.6. DATA ANALYSIS ___________________________________________________________________ 18
3. RESULTS AND DISCUSSION: ________________________________________________ 19
3.1. DNA EXTRACTION OF BOS GAURUS SAMPLES _______________________________________________ 19
3.2. CONVENTIONAL LONG-RANGE PCR ______________________________________________________ 20
3.2.1. Optimization of DNA concentration ____________________________________________ 21
3.2.2. Optimization of 2 sets of primer: annealing temperature___________________________ 22
3.2.3. Modification of DNA Polymerase concentration __________________________________ 23
3.2.4. Modification of Other Reaction Components _____________________________________ 24
3.2.5. Optimal PCR Reaction Results _________________________________________________ 27
3.3. MITOCHONDRIAL SEQUENCING RESULTS___________________________________________________ 28
3.3.1. Binding sites of used primers for the sequencing reaction __________________________ 28
3.3.2. Partially sequenced the mitochondrial genome of Bos gaurus in Vietnam _____________ 29
3.3.2. Assembly and comparison of the partially sequenced mitochondrial genome of Bos gaurus
in Vietnam to reference genome ____________________________________________________ 32
3.3.3. Designed primers for further sequencing reactions performance ____________________ 35
4. CONCLUSION _________________________________________________________________ 36
REFERENCES _______________________________________________________________________ I
APPENDIX ________________________________________________________________________ IV
APPENDIX 1 – PRIMER BLAST FOR THE USED PRIMERS IN THIS STUDY ___________________________________ IV
APPENDIX 2 – PRIMER BLAST FOR FOURTEEN PRIMERS DESIGNED FOR THIS STUDY __________________________ V

3
List of Abbreviations

AS Ammonium sulfate
BLAST The Basic Local Alignment Search Tool
Cob Cytochrome b
CRL Cell Reprogramming Lab
ddATP dideoxyadenosine 5′-triphosphate
ddCTP dideoxycytidine 5′-triphosphate
ddGTP dideoxyguanosine 5′-triphosphate
ddNTPs dideoxynucleotides triphosphates
ddTTP dideoxythymidine 5′-triphosphate
DNA Deoxyribonucleic acid
dNTPs Deoxynucleotide triphosphates
dsDNA Double-stranded DNA
EDTA Ethylenediaminetetraacetic acid
EtOH Ethanol
F Forward
IUCN International Union for Conservation of Nature
Kbp Kilobasepair
Lao PDR Lao People's Democratic Republic
NCBI National Center for Biotechnology Information
PCR Polymerase Chain Reaction
R Reverse
RNA Ribonucleic acid
rpm revolutions per minute
rRNA ribosomal RNA
SDS Sodium dodecyl-sulfate
ssDNA Single-stranded DNA
TAE Tris-acetate-EDTA
Tm melting temperature

4
List of Figures

Figure 1. Binding sites of 2 sets of primer on Bos gaurus whole mitochondrial

genome ___________________________________________________________________________ 12
Figure 2. The PCR conditions for primer pair UniBos W-Mito 1 ____________________ 13
Figure 4. Schematic of the ExoSAP-IT method ___________________________________ 14
Figure 5. The gel electrophoresis result of DNA extraction ________________________ 20
Figure 6. The long-range PCR results for primer pair UniBos W-Mito 1 ___________ 20
Figure 7. Optimization of DNA concentration in PCR reaction _____________________ 21
Figure 8. Annealing temperature optimization for UniBos W-Mito 1 primer _______ 22
Figure 9. Annealing temperature optimization for UniBos W-Mito 3 primer _______ 23
Figure 10. DNA Polymerase concentrations modification with UniBos W-Mito 1
primer pair ________________________________________________________________________ 24
Figure 11. Effects of additional MgCl2 concentration to PCR reaction mixtures with
UniBos W-Mito 1 primer pair ______________________________________________________ 25
Figure 12. Effects of additional ammonium sulfate (AS) concentrations on PCR
reaction mixtures with 2 sets of primer ____________________________________________ 26
Figure 13. Optimal PCR reaction for both sets of primer result ___________________ 27
Figure 14. Binding sites of Cytb (F + R) primers on target regions for partially
sequencing mitochondrial genome ________________________________________________ 28
Figure 15. Binding sites of 12S (F + R) primers and 16S (F+R) on specific regions
for partially sequencing mitochondrial genome ____________________________________ 28
Figure 16. Partial 12S rRNA sequence of Bos gaurus in Vietnam _________________ 29
Figure 17. Partial 16S rRNA sequence of Bos gaurus in Vietnam _________________ 29
Figure 18. Partial cytochrome b gene sequence of Bos gaurus in Vietnam (Forward
primer) ____________________________________________________________________________ 30
Figure 19. Partial cytochrome b gene sequence of Bos gaurus in Vietnam (Reverse
primer) ____________________________________________________________________________ 31
Figure 20. The BLASTn result of 12S-F regions ___________________________________ 32
Figure 21. The BLASTn result of 16S-F regions ___________________________________ 32
Figure 22.The BLASTn result of CytB-F regions ___________________________________ 33
Figure 23.The BLASTn result of CytB-R regions __________________________________ 33
Figure 24. Assembly of the four sequenced regions on the reference genome ____ 33
Figure 25. Alignment of sequenced DNA (Cytb-F) with the whole mitochondrial
genome of Indian Bos gaurus _____________________________________________________ 34
Figure 26. Alignment of sequenced DNA (Cytb-R) with the whole mitochondrial
genome of Indian Bos gaurus _____________________________________________________ 34
Figure 27. Binding sites of fourteen primers designed for performing sequencing
reaction ___________________________________________________________________________ 35

5
List of tables

Table 1. Primers used in the long-range PCR reaction ____________________________ 11

Table 2. The components of sequencing reactions ________________________________ 16
Table 3. Primers designed for sequencing reactions for PCR products of primer pair
UniBos W-Mito 1 __________________________________________________________________ 17
Table 4. Primers designed for sequencing reactions of purified PCR products _____ 17
Table 5. The PCR condition for sequencing reactions _____________________________ 18
Table 6. The NanoDrop spectrophotometer result of DNA extraction ______________ 19

6
1. INTRODUCTION

The gaur (Bos gaurus) is one of the biggest members of the Bovidae family. They
allocate broadly from South Asia's landmass to Southeast Asia (Ha, 2009). The gaur
has been seen in India, Bhutan, Nepal, Myanmar, Thailand, Southern China,
Vietnam, Cambodia, and Peninsular Malaysia (Dang et al., 1986; Corbet & Hill,
1992; Choudhury, 2002). However, the gaur (Bos gaurus) is one of the most
endangered animals in Vietnam. Fortunately, between 2004 and 2007, Dr. Ha
performed studies of the gaur's condition or range. (Ha, 2009).

Particularly, in Vietnam, gaur is extensively distributed from north to south,

particularly near the Lao People's Democratic Republic and Kingdom of Cambodia
borders (Dang et al., 1986; Pham et al., 1997; Nguyen and Nguyen, 2005; Thach
and Nguyen, 2005). Gaur populations have plummeted in Vietnam due mostly to
poaching and habitat destruction. Consequently, a few gaurs persisted in border
provinces and certain rural parts of the Central Highlands, Vietnam (Dang et al.,
1986; Pham et al., 1997; Duckworth & Hedges, 1998; Nguyen & Nguyen, 2005;
Thach & Nguyen 2005). The Vietnam Red Data Book classifies the Vietnamese gaur
as an Endangered species (Ministry of Science and Technology, 2007; Government
of Vietnam, 2006). Also, the International Union for Conservation of Nature (IUCN)
Red List classifies gaur as Vulnerable and Endangered worldwide (IUCN, 2007).

Initially, experts have subdivided the Bos gaurus into numerous subspecies,
clarifying its classification based on classical morphology methods. Particularly,
Lydekker identified three subspecies of gaur: (1) Bos gaurus gaurus, which inhabits
India, Nepal, and Bhutan; (2) Bos gaurus readei, which inhabits Cambodia,
southern China, Lao PDR, Viet Nam, Myanmar, and Thailand; and (3) Bos gaurus
hubbacki, which inhabits Malaysia (Lydekker, 1903; Lydekker, 1907). Based on skull
and horn size, Groves and Grubb suggested two subspecies: Bos gaurus gaurus,
which inhabits Nepal and India, and Bos gaurus laosiensis, which inhabits Vietnam,
Myanmar, Thailand, Cambodia, Lao PDR, and West Malaysia (Groves, 2003; Groves
& Grubb, 2011). In Sri Lanka, an extinct subspecies known as Bos gaurus
sinhaleyus has been documented (Wilson & Reeder, 2005). Nevertheless, all the
studies have classified the subspecies based on morphological/cranial characteristics
from a small number of specimens, which is inconsistent with the taxonomic
classification of the gaur. The International Union for the Conservation of Nature

7
(IUCN) has recognized just two subspecies of gaur based on phenotypic differences:
Bos gaurus and Bos gaurus laosiensis. This indicates the validity of subspecies was
explored based only on morphological evidence, without genetic confirmation.

In 2020, Ranganathan and his collaborators sequenced the whole mitochondrial

genome of the Indian gaur and conducted a phylogenetic analysis to find distinctive
mutations in the Indian gaur and investigate their genetic links to other populations
of Bos gaurus. Specifically, they have identified a substantial genetic difference
between the Indian, Cambodian, and Malayan gaur (Ranganathan et al., 2020). It
synonymized that sequencing the whole mitochondrial genome for phylogenetic
analysis provided crucial genetic information for species classification.

Regarding the above information, the genetic characteristics of gaur play a

significant role. Because of its exceptionally high mutation rate and absence of
recombination, the mitochondrial genome has been widely used to explore the
evolutionary and phylogenetic connections of numerous species (Ren et al., 2018,
Prabhu et al., 2019; Rosli et al., 2019; Ranganathan et al., 2020). In addition, the
mitochondrial genome is supposed to be a powerful instrument for species
identification and monitoring the populations of conservation concern. Meanwhile,
there is insufficient genetic evidence to demonstrate the distinct characteristics of
Bos gaurus in Vietnam compared to other species. Hence, it is vital to sequence the
mitochondrial genome of the gaur in Vietnam.

The study conducted by Ranganathan and his colleagues has provided me with a
foundational premise for my dissertation, as well as two reasons that encourage me
to complete my thesis Ranganathan et al., 2020. First, genetic research on the gaur
population in Vietnam is limited, but it has been stated that the Vietnamese gaur is
at a high risk of becoming an endangered species, since illegal hunting, habitat
degradation, and disturbance seem to be the greatest dangers to gaurs (Pham et
al., 1997; Thach & Nguyen, 2005., Ha, 2009). Second, the distinctive mutations in
the genomes of the Vietnamese gaur have remained a mystery that poses
challenging conservation challenges. Therefore, the application of Vietnamese gaur
mitochondrial genome sequencing and its phylogenetic analysis are crucial tools for
identifying specific mutations in the Vietnamese gaur genome and distinguishing the
Vietnamese gaur from other gaur populations. In addition, this project highlights the
genetic conservation importance of Vietnamese gaur.

8
In the current investigation, the purpose is to sequence the whole mitochondrial
genome of gaur samples collected from the Cell Reprogramming Lab (CRL) of
International University - Vietnam National University in Ho Chi Minh City, Vietnam.
The goal of analyzing these sequences was to discover the genetic relationship
between the gaur in Vietnam and other populations and to undertake phylogenetic
and genetic analysis.

2. MATERIALS AND METHODS

2.1. General scheme of this study

2.2. Sample collection

In the current investigation, two gaur samples were gathered in Vietnam. The
sample included meat and lung sample from a deceased gaur that was obtained in
Vietnam's National Conservative Park. With the aid of Associate Professor Nguyen
Van Thuan, samples were gathered. These specimens were sent to the Biomedicine
9
and Molecular Biotechnology Laboratory (LA1.702) by Associate Professor Nguyen
Van Thuan, who obtained the appropriate approvals from the provincial forest
departments, therefore facilitating my research. Before DNA extraction, the
acquired lung and tissue samples were kept at 20°C in 50 mL falcon under suitable
conditions.

2.3. DNA extraction

2.3.1. Lysis buffer preparation

In our laboratory, we self-prepared the 250 μL of lysis buffer required in this
stage including containing 50mM Tris HCl at pH 8, 50mM NaCl, 25mM EDTA at
pH 8, 0.5% SDS and filling distilled water (dH2O) up to 250 μL.

2.3.2. Sample incubation

• Cut tissue into approximately 50 mg pieces and put them in a 1.5 mL
Eppendorf tube with 70 µL of Lysis Buffer.
• Add 5 µL Proteinase K (0.1 mg/ml) to the tube. Mix vigorously by vortexing
and incubate at 56°C for 14 to 18 hours or overnight, or until the tissue is
totally lysed.
• Following incubation, spin down the tube for 1 minute and transfer the
supernatant to a fresh 1.5 mL Eppendorf tube

2.3.3. Organic extraction

• Genomic DNA was isolated from the meat and lung samples according to
Le Minh Thong, Ph.D.'s directions using the laboratory's technique:
• Add chloroform to the collected supernatant in an Eppendorf tube in a 1:1
ratio and immediately invert the tube for one minute.
• Centrifuge the tube at 10,000 rpm for 15 minutes at 4 oC, and then transfer
the aqueous layer to a new Eppendorf tube.
• Fill the tube with 3M Sodium Acetate (pH =6) following the ratio VCH3COONa=

0.2 Vsupernatant and VIsopropanol = 2 Vsupernatant.

• Incubate the tube for 30 minutes at 5oC, followed by 15 minutes of

centrifugation at 10.000 rpm at 4oC. Maximum supernatant removal is
desired.
• Add 300 µL of ice-cold ethanol and invert the mixture 3 times. The DNA
pellet was then centrifuged at 10,000 rpm for 10 minutes at 4oC. Again,
twice more.

10
 • Incubate any remaining Ethanol (EtOH) at 50oC for 15 minutes to
evaporate it.
• Dissolve the DNA pellet in 50 µL of Milli-Q water by tapping or slow
vortexing.
• Perform DNA quality assessment using electrophoresis method and DNA
measurement method NanoDrop™ One/OneC Microvolume UV-Vis
Spectrophotometer.

2.4. Long-range PCR

2.4.1. Bos gaurus DNA sample and primers

Following the procedure outlined in the DNA extraction section, DNA samples were
successfully retrieved from the tissue and lung of the gaurs gathered in Vietnam.
Except for the Vietnamese gaur sequences, two sets of primers, UniBos W-Mito 1
(Set 1) and UniBos W-Mito 3 (Set 2), were created based on the mitochondrial
genome sequences obtained from GenBank. Each set of primers would amplify the
mitochondrial genome partly. The desired product size was 9.2 Kbp. Primers were
ordered at PhuSa Biochem firm (Can Tho). Samples and primers were kept at -20°C
until further tests were conducted.

In addition, the annealing temperature of two sets of primers was optimized to

determine the ideal PCR conditions, and a series of PCR tests were undertaken at
the prescribed annealing temperatures (52°C, 54°C, 56°C, 58°C, 60°C, and 62°C)
prior to the long-range PCR reaction. The optimal annealing temperatures for primer
sets 1 and 2 were 62°C and 57°C, respectively (shown by the result section).

Table 1. Primers used in the long-range PCR reaction

Primer Primer Sequence (5’ → 3’) Tm (oC) Product size

UniBos Forward CTAATCGGAGCCCTACGAGCA
62oC 9.2 Kbp
W-Mito 1 Reverse CAATGTCGCCGATGCGGT
UniBos Forward ATRMTCATCCTTGTAACCGCA
57oC 9.2 Kbp
W-Mito 3 Reverse TATGAAGAAGAGGGCAAATGGTC

11
Figure 1. Binding sites of 2 sets of primer on Bos gaurus whole mitochondrial genome

2.4.2. Conventional long-range PCR

The whole mitochondrial genome was amplified by long-range PCR with two
overlapping sets of primers UniBos W-Mito 1 and UniBos W-Mito 3 (Table 2). The
PCR was conducted in a final volume of 20 µinL using FU14 DNA polymerase
(3:4000), 5X FU14 Buffer (6.25 mM MgCl 2/µL), dNTP mix 2.5 mM, MgCl2 0.1 mM,
(NH4)2SO4 1 mM, 10X PCR dye, UniBos W-Mito 1 forward or UniBos W-Mito 3
forward 10 pmol/µL, UniBos W-Mito 1 reverse or UniBos W-Mito 3 reverse 10
pmol/µL (1 µL), Mili Q water and Bos gaurus DNA template 100 ng/µL (1 µL). Mili Q
water will be used instead of the Bos gaurus DNA template in the negative control.

PCR was performed using Vapo.protect Mastercycler machine (Eppendorf, Germany)

with the following program: initial denaturation for 10 minutes at 95°C - 1 cycle;
followed by 35 cycles of 15 s at 94°C, 20 s at 62°C (UniBos W-Mito 1) or 57°C
(UniBos W-Mito 3), and 10 minutes at 72°C; then final extension for 5 minutes at
72°C - 1 cycle; and hold at 4 °C as shown in figure 2 and figure 3. Finally, gel

12
electrophoresis was done to visualize the result: 5 µL of PCR product stained with
GelRed Nucleic Acid Stain was loaded into 0.8 % agarose gel, run the gel in 0.5X

Figure 2. The PCR conditions for primer pair UniBos W-Mito 1

Figure 3. The PCR conditions for primer pair UniBos W-Mito 3

Tris acetate-EDTA (TAE) buffer at 50 volts for first 10 minutes and 100 volts for last
30 minutes. 1 Kbp DNA marker was used as a reference. The gel was then put
under ultraviolet (UV) light to observe the result.

13
 2.4.3. PCR amplicons purification
ExoSAP-IT prepares PCR products for a wide range of applications, including
fluorescence sequencing detection methods (Bell, J. R., 2008). Unconsumed dNTPs
and primers remaining in the PCR product mixture after amplification are
incompatible with these techniques. ExoSAP-IT utilizes two hydrolytic enzymes,
Exonuclease I and Shrimp Alkaline Phosphatase, to eliminate these undesirable
dNTPs and primers. Exonuclease I destroy any leftover single-stranded primers and
single-stranded DNA generated by the PCR. The Shrimp Alkaline Phosphatase
hydrolyzes any leftover dNTPs from the PCR mixture that might otherwise interfere
with the sequencing reaction. ExoSAP-IT is directly added to the PCR product. Since
the enzymes are active in the PCR solution, no buffer exchange is necessary.

Figure 3. Schematic of the ExoSAP-IT method

(Figure created by Biorender.com)
ExoSAP-IT may be used to purify PCR products ranging in size from under 100 bp to
over 20 Kbp. When employing the ExoSAP-IT purification procedure, no PCR product
will be wasted:

PCR Product: 5 µL
ExoSAP-IT: 5 µL

Total: 10 µL
14
• Mix and incubate for 1 hour at 37 oC. (This phase is facilitated by the Vapo.protect
Mastercycler machine (Eppendorf, Germany).

• Heat ExoSAP-IT at 80 oC for 30 minutes to deactivate it. (This is also facilitated by

the Vapo.protect Mastercycler machine (Eppendorf, Germany).

• The DNA is now ready to be sequenced directly using manual or automated

techniques.

2.5. Mitochondrial genome sequencing

In Sanger sequencing, the starting point for DNA synthesis is a DNA primer that is
complementary to the template DNA (the DNA to be sequenced). The polymerase
extends the primer by adding the complementary dNTP to the template DNA strand
in the presence of the four deoxynucleotide triphosphates (dNTPs: A, G, C, and T).
To detect which nucleotide is integrated into the chain of nucleotides, the synthesis
process is terminated using fluorescent dye-labeled dideoxynucleotide triphosphates
(ddNTPs: ddATP, ddGTP, ddCTP, and ddTTP). Unlike dNTPs, ddNTPs lack an oxygen
atom on the ribonucleotide and hence cannot establish a connection with the
subsequent nucleotide. After synthesis, the reaction products are placed onto four
lanes of a single gel, based on the various chain-terminating nucleotides, and
subjected to gel electrophoresis (Sikkema‐Raddatz, Birgit, et al). Thus, the DNA
sequence is estimated based on the sizes of the bases. Sanger sequencing involves
six steps, which are as follows:

• Denaturation of the double-stranded DNA (dsDNA) results in the formation of

two single-stranded DNA (ssDNA).
• Attached to the sequence is a primer that matches one end.
• Only one type of ddNTP and four different types of dNTPs are added to each
of the four polymerase solutions.
• The DNA synthesis reaction starts, and the chain grows until an unpredicted
termination nucleotide is added.
• Denatured ssDNA is created from the resultant DNA fragments.

15
• Capillary electrophoresis is used to separate the denatured fragments, and
the sequence is established.

Figure 5. The structure of Figure 6. The Sanger sequencing method

ddNTP and dNTP in 6 steps
(OpenStax College, Biology) (Gauthier 2008)

2.5.1. Prepare the sequencing reactions

• The components of the BigDye TM Terminator v3.1 Cycle Sequencing Kit and
diluted primers (3.5 pmol/µL) must be completely thawed and stored on ice.
• Vortex the tubes for 2 to 3 seconds, and then centrifuge them for 2 to 3
seconds using a benchtop microcentrifuge in order to collect the contents at
the bottom of the tubes.
• Add components as shown

Table 2. The components of sequencing reactions

Quantity per Forward Reverse

Component
reaction (µL) sample (µL) sample (µL)
BigDye™ Terminator 3.1
1 1 1
Ready Reaction Mix
Forward primer (3.5 µM) 1 -
3.5 pmol
Reverse primer (3.5 µM) - 1
Buffer sequencing 5X 2 2 2
Purified PCR products 1 1 1
Mili Q water 5 5 5
Total volume 10 µL 10 µL 10 µL

16
Fourteen overlapping segments of the mitochondrial genome designated for
sequencing PCR products of primer pair UniBos W-Mito 1 were amplified by
polymerase chain reaction (PCR) using the following primer sets:

Table 3. Primers designed for sequencing reactions for PCR products of

primer pair UniBos W-Mito 1

Amplicon
Tm (oC)
Primer Primer Sequence (5’ – 3’) sizes
(NCBI)
(NCBI)
Reverse 1 TGGTGTAATTGGGAGCAC 53.8
115
Forward 1 AAAGAGTTACTTTGATAGAGT 51.6
Reverse 2 AGTTGTGTTTGGTTTAGTC 50.9
109
Forward 2 TATCTGTACTTTACCAAATCT 51.6
Reverse 3 TCTTGCAATCCTTATCAGGA 54.3
89
Forward 3 TTAGAATAGGAATTTAGGTTAA 50.9
UniBos-Seq-P1 Reverse 4 GGAGRAGTCAGAAGCTTAT 54.1
144
Forward 4 TAACCGCACACGCATTTG 53.8
Reverse 5 TATATGGTGAGCTCATACGA 54.3
90
Forward 5 GGAAAAAAAGAACCATTCGGA 55.5
Reverse 6 GGGTTCTTCAAATGTGTG 51.6 119
Forward 6 TTTTCATCATCTGAGAAGCAT 53.5
Reverse 7 CGATTATCGACTTCTAATAGTC 56.5 91
Forward 7 CAGATTATGAGGACTTAAGCT 55.5

Table 4. Primers designed for sequencing reactions of purified PCR

products

Tm (oC) Amplicon
Primer Primer Sequence (5’ – 3’)
(NCBI) sizes
Forward CGAAGCTTGATATGAAAAACCATCGTTG 61.98
Bos-Cyt-b 1246
Reverse GGAATTCATCTCTCCCGGTTTACAAGAC 63.51
Forward CAAACTGGGATTAGATACCC 52.73
Bos-12S 440
Reverse GAGGGTGACGGGCGGTGTGT 66.97
Forward ACCGTGCAAAGGTAGCATAAT 58.00
Bos-16S 499
Reverse TCCGGTCTGAACTCAGATCAC 59.18

17
 2.5.2. Set up cycle sequencing conditions
The PCR-purified amplicons in section 2.4.3 were used for direct sequencing. The
ABI PRISM BigDyeTM Terminator v.3.1 Cycle Sequencing Kit (Thermo Fisher
Scientific) was used to perform sequencing reactions with designated primers
(Tables 3 and 4) according to the manufacturer's instructions.

Stage/step
Parameter 25 cycles
Incubate Hold
Denature Anneal Extend
Temperature 96oC 96oC 50oC 60oC 4oC
Hold until
Time (mm:ss) 01:00 00:10 00:10 04:00 ready to
purify
Table 5. The PCR condition for sequencing reactions

2.5.3. Sanger sequencing of the mitochondrial genome of Bos gaurus

All sequencing reactions were carried out on an Applied Biosystems ProFlexTM PCR
System with a ramp rate of 60oC per second. The sequencing products were further
purified with an ABI BigDye XTerminatorTM Purification Kit (Thermo Fisher
Scientific) in accordance with the manufacturer's instructions. Capillary
electrophoresis was performed on an ABI 3500xl DNA Analyzer (Applied
Biosystems) with POP-7 polymer and a 50 cm array length, using the instrument
protocol StandardSeq50 POP7.

2.6. Data Analysis

The ABI SEQUENCE ANALYSIS V5.3 software was used to read base-calling from the
raw sequence output (Applied Biosystem, Foster City, CA). The raw sequence reads
from both ends were aligned, visually inspected by comparing the chromatogram
images, and manually edited as necessary. Utilizing the CLC Genomics Workbench
22.0.2 software (Qiagen, Germany) to utilize molecular biology tools, assemble
sequences in comparison to the reference genome, and demonstrate primer binding
sites.

18
3. RESULTS AND DISCUSSION:
3.1. DNA extraction of Bos gaurus samples
The DNA concentration of the meat and lung samples, according to the NanoDrop
spectrophotometer's results, was 759.0, 441.2, 655.0, and 754.0 ng/µL,
respectively (Table 5). The A260/A280 ratio should be maintained between 1.7 and
2.0 to be considered good-quality DNA, and the A260/A230 ratio should be higher
than 1.5, per Promega Corporation's recommendations (Promega Corporation, n.d.).

In particularly, DNA isolated from the flesh of deceased Bos gaur consistently
exhibited 260/280 absorbance ratios of 1.8 or above (Table 6), indicating good
purity with respect to protein contamination (Desjardins and Conklin 2010) and was
undamaged, as measured by agarose gel electrophoresis. The 260/230 absorbance
ratios, which generally ranged between 2.06 and 2.34, showed extremely low levels
of polysaccharide contamination (Desjardins and Conklin 2010). The average
260/230 ratio for DNA of meat 1 sample was 1.83 and was just beyond the optimal
reference range, indicating some residual impurity still exists. In brief, the DNA
purity was suitable for use in subsequent processes.

# Sample name ng/ µL A260/A280 A260/A230

1 Lung 1 759.0 1.86 2.31
2 Lung 2 441.2 1.85 2.34
3 Meat 1 655.0 1.81 1.83
4 Meat 2 754.0 1.82 2.06
Table 6. The NanoDrop spectrophotometer result of DNA extraction

The flesh and lung of the deceased Bos gaurus were used to extract four DNA
samples and check gel electrophoresis. The target band size of over 16 Kbp was the
only one seen in the double-stranded DNA yields. On the one hand, compared to
DNA from lung samples, DNA from meat samples showed brighter and denser
bands. The findings of agarose gel electrophoresis result, on the other hand, also
showed that the DNA from the lung sample was faint bands, low intension, and
smearing, indicating that the nucleic acids isolated from the lung sample were
degraded and fragmented. However, the integrity and the intact quantity of
mitochondrial DNA are required to be applied for long-range PCR in the next stage.
DNA degradation is influenced by tissue preservation methods, exposure to UV
radiation, temperature, pH, and salt concentration in the surrounding environment
(Dean, M., and Ballard, J.W.O., 2001). The reasons explained for DNA degradation
19
also resulted from freezing and thawing DNA samples repeatedly and leaving DNA
samples at room temperature.

Figure 4. The gel electrophoresis result of DNA extraction

3.2. Conventional long-range PCR

Figure 5. The long-range PCR results for primer pair UniBos W-Mito 1
without conditions optimization

20
The gel electrophoresis results indicated that the mitochondrial DNA amplification
process using long-range PCR was unstable. Concerning the results of long-range
PCR on lung samples, the gel electrophoresis showed smearing and band-less. The
gel electrophoresis of meat samples, on the other hand, revealed faint bands and
smearing (Figure 7). Consequently, modification of PCR reaction mixtures is
necessary for downstream applications, including adjusting DNA concentration, DNA
Polymerase concentration, and reagents concentration.

3.2.1. Optimization of DNA concentration

The initial step in optimizing a PCR reaction is to add an equal amount of DNA
template to each reaction tube containing the master mix. The optimal
concentration of genomic DNA for a reaction is approximately 10-30 ng/µL (Asif,
Saaim et al. 2021). However, the gel electrophoresis results revealed faint and
weak bands of 9-Kbp products, indicating that more template DNA should be added
to the reaction mixture.

Figure 6. Optimization of DNA concentration in

PCR reaction

In a PCR reaction, the DNA concentration was increased from 25 ng/ul to 100 ng/ul
over a range of 25 ng/ul to 100 ng/ul. The gel electrophoresis results revealed that
adding 100 ng/ul to the PCR reaction produced 9-Kbp products (Figure 8). However,
a series of modifications should be made to the reagents in PCR reaction mixtures to
maintain optimal polymerase activity, thereby increasing the likelihood that the
polymerase can extend over long distances.

21
 3.2.2. Optimization of 2 sets of primer: annealing temperature
Identifying the Tm of the primers is the first step in optimizing cycling conditions.
This goal can be accomplished by conducting a gradient PCR experiment. In this
procedure, the thermal cycler's annealing step is set to varying temperatures. The
thermal cycler is set to a range of temperatures specific to each row; this can assist
in determining the optimal Tm for primers by examining the primers' annealing
ability at various temperatures (Asif, Saaim et al., 2021). UniBos W-Mito 1 and
UniBos W-Mito 3 primer sets' ideal annealing temperatures for long-range PCR were
empirically determined using the criteria of maximizing yield and minimizing extra
bands. The primer pairs UniBos W-Mito 1 and UniBos W-Mito 3 were amplified by
PCR at the indicated annealing temperatures of 56°C to 62°C for the set 1 and 54°C
to 62°C for the remainder, and resolution on 0.8% agarose gel in 0.5X TAE was
carried out afterward.

A series of PCR experiments were carried out at the specified annealing

temperatures (56°C, 58°C, 60°C, and 62°C), followed by resolution on a 0.8%
agarose gel with a size marker (1-Kbp DNA ladder from Salagene), in order to
determine the ideal PCR conditions for the UniBos W-Mito 1 primer pair.

Figure 7. Annealing temperature optimization for UniBos W-Mito 1 primer

Similarly, to ascertain the ideal PCR conditions for the UniBos W-Mito 3 primer pair,
a series of PCR experiments were performed at the designated annealing
temperatures (54°C, 56°C, 58°C, 60°C, and 62°C), followed by resolution on a
0.8% agarose gel with a size marker (1-Kbp DNA ladder from Salagene).

22
 Figure 8. Annealing temperature optimization for UniBos W-Mito 3 primer

The optimal annealing temperatures for two sets of primer were 62°C and 57°C,
respectively. Regarding the gel electrophoresis results of the UniBos W-Mito 1
primer pair, the band at the optimal annealing temperature of 62°C at the desired
position of over 9 Kbp is a clear and bright pattern devoid of additional bands and
smearing. Concerning the result of the UniBos W-Mito 3 primer pair produced a
series of bands that were clearer, brighter, and denser than the PCR products
generated by the UniBos W-Mito 1 primer pair. Specifically, two bands at the
annealing temperature range of 56°C to 58°C are the densest and brightest
compared to others, leading to the conclusion that 57°C is the optimal annealing
temperature for the UniBos W-Mito 3 primer pair (Figure 9).

3.2.3. Modification of DNA Polymerase concentration

In order to determine the appropriate concentration for the ideal amplification of
long PCR products, a range of FU14 DNA polymerase (1:100) concentrations
including 2:4000 and 3:4000 was examined in this experiment, followed by
resolution on a 0.8% agarose gel with a size marker (100-bp DNA ladder from
Salagene)

According to the results of gel electrophoresis, the suitable concentration of FU14

DNA Polymerase (1:100) for each PCR reaction is 2:4000. Evidently, the PCR
products produced with a FU14 DNA Polymerase (1:100) concentration of 2:4000
had bands that were brighter, clearer, and denser than those of other products, and
there is no presence of additional bands (Figure 10).

23
 Figure 9. DNA Polymerase concentrations
modification with UniBos W-Mito 1 primer
pair

3.2.4. Modification of Other Reaction Components

In addition to examining a range of FU14 DNA polymerase concentrations, the
effects of a range of concentrations of reaction components that may "stabilize"
DNA polymerase will be systematically evaluated. Included in these reagents were
magnesium chloride (MgCl2) (0.1 mM - 0.4 mM) and ammonium sulfate (NH4)2SO4
(1 mM - 4 mM). The potential effects of substances that can "stabilize" DNA
polymerase (Innis, 2012). At 95oC, the half-life of DNA polymerase is approximately
10 minutes (Innis, 2012). Given the lengthy incubation times required at elevated
temperatures for DNA polymerase to sufficiently extend a primer to yield PCR
products longer than 9 Kbp. During a 35-cycle PCR, a critical level of enzyme
activity may be compromised, causing concern. The addition of MgCl2 or (NH4)2SO4,
two known polymerase stabilizers (Innis, 2012), would help to maintain optimal
polymerase activity, thereby increasing the likelihood that the polymerase would be
able to extend over longer distances.

Beginning at 0.1 mM and ending at 0.4 mM, a series of MgCl 2 concentrations were
added to the designated reaction mixtures, followed by resolution on a 0.8%
agarose gel with a size marker (100-bp DNA ladder from Salagene). The addition of
0.1 mM MgCl2 had a significant effect on the 9-Kbp target PCR products. Although
the PCR products containing 0.2 mM of MgCl 2 displayed a bright band on gel
electrophoresis, its surroundings were smeared. The range of MgCl 2 utilized yielded

24
no desired results (0.3 mM and 0.4 mM). Therefore, optimal long-range PCR results
were obtained with 0.1 mM MgCl2 in the reaction mixtures.

Figure 10. Effects of additional MgCl2

concentration to PCR reaction mixtures with
UniBos W-Mito 1 primer pair

Similarly, (NH4)2SO4, also known as a polymerase stabilizer, was added to preserve

polymerase activity (Naruporn et al.,2021). The PCR reaction mixtures were
adjusted with the final concentration of ammonium sulfate between 1 mM and 4
mM. Concerning UniBos W-Mito 1 (above lanes of gel electrophoresis result), the gel
electrophoresis result demonstrated that the addition of (NH4)2SO4 at 1 mM had a
profound effect on 9-Kbp PCR products. Specifically, the band resulting from the
addition of 1 mM to the PCR reaction mixtures was brighter and denser than the
positive control band. Meanwhile, the range of (NH4)2SO4 used (2 mM and 4 mM)
yielded no results. Regarding UniBos W-Mito 3 (below lanes of gel electrophoresis
result), the addition of (NH4)2SO4 at 1 mM to PCR reaction mixtures resulted in a
band that was brighter and denser than the positive control band and the PCR
products band which 4 mM of (NH4)2SO4 was added to PCR reaction mixtures
previously. The concentration of 2 mM (NH4)2SO4 utilized in PCR reaction mixtures,
indicating the absence of bands on gel electrophoresis. Consequently, using 1 mM
(NH4)2SO4 in PCR reaction mixtures was an appropriate concentration for optimal
long-range PCR with both primer sets.

25
 Figure 11. Effects of additional ammonium sulfate (AS)
concentrations on PCR reaction mixtures with 2 sets of primer

Concerning magnesium chloride (MgCl2) is a crucial component of the PCR master

mix. It enhances the enzymatic activity of DNA polymerase by acting as a cofactor
during the reaction, thereby boosting DNA amplification. For optimal PCR reaction
mixtures, the addition of MgCl 2 or an increase in the reaction's concentration is
essential (Chauhan, 2018). The first essential function of MgCl2 is to aid DNA
polymerase, it functions at higher temperatures. However, like other enzymes, DNA
polymerase is rendered inactive or incapable of catalyzing in the absence of a co-
factor. DNA polymerase synthesizes the template DNA effectively and precisely in
the presence of Mg2+. The second essential function of MgCl 2 in PCR is to raise the
melting temperature (Tm) of the reaction, thereby facilitating the binding of primers
to specific sites. The magnesium ion of MgCl2 binds to the negatively charged
phosphate ion of DNA, thereby reducing electrostatic repulsion between two DNA
strands. This results in the correct annealing of primers with their complementary
DNA strands (Chauhan, 2018). Due to the aforementioned advantages of MgCl2 in
optimizing PCR reactions, the decision was made to modify the MgCl 2 concentration
about 1 mM in PCR reaction mixtures. In fact, the results demonstrated that as the
concentration of MgCl 2 increases, the annealing capacity of the primer and the
temperature are compromised, resulting in the formation of target bands that are
brighter and denser.

26
Regarding ammonium ion (NH4+) of ammonium sulfate which stabilizes DNA
polymerase and dNTPs, eliminates PCR inhibitors, solves secondary structure of
nucleic acid making it more accessible to reaction, and enhances specificity between
primer-template base-pairing (Park and Kim 1996; Korfhage et al. 2002; Pelt-
Verkuil et al. 2008). In this experiment, consequently, it was discovered that the
presence of ammonium sulfate (1 mM) in PCR reactions increased amplification
sensitivity compared to the absence of this component in the reaction buffer.

3.2.5. Optimal PCR Reaction Results

Completing the modification process of DNA concentration, DNA Polymerase
concentration and reagents concentration, specific PCR products up to 9 kbp in size
were obtained when reaction mixtures were formulated and used as described in
2.4.2. part. Following optimization of reaction conditions, amplification of specific
PCR products as large as 9 Kbp in size was obtained faithfully for both primer sets
(Figure 13). The 9-Kbp PCR product, although generally obtained, was not always
able to be detected. It synonymized that unequally mitochondrial DNA amounts
pipetting them into PCR reaction mixtures. In addition, each PCR reaction required
adequate quantities of intact mitochondrial DNA genome to perform the
amplification, resulting in unequal 9-Kbp products.

Figure 12. Optimal PCR reaction for both sets of

primer result

27
Notably, 9-Kbp products were only produced by the successful amplification of DNA
from the meat sample. The problem may have been caused by the degradation of
DNA extracted from lung samples as explained in 3.1. part, resulting in a lack of
mitochondrial DNA quantities and breaking the integrity of mitochondrial DNA
extracted from the lung sample.

3.3. Mitochondrial sequencing results

3.3.1. Binding sites of used primers for the sequencing reaction

Figure 14. Binding sites of 12S (F + R) primers and 16S (F+R) on specific
regions for partially sequencing mitochondrial genome

Figure 13. Binding sites of Cytb (F + R) primers on target regions for partially
sequencing mitochondrial genome

The designed primers including 12S (F + R), 16S (F + R) and Cytb (F + R) can bind
to the target regions on the mitochondrial genome of Bos gaurus as shown in Figure
14 and 15, used to partially sequencing the mitochondrial genome of Bos gaurus.

28
 3.3.2. Partially sequenced the mitochondrial genome of Bos gaurus in
Vietnam
The mitochondrial genome of gaur in Vietnam was partially sequenced from using
meat sample, which included 2 sequences of a cytochrome b gene (cob) - a protein
coding gene, were observed to be 962 bp and 921 respectively in length and 2
subunits 12S rRNA (356 bp) and 16S rRNA (446 bp) of the ribosomal RNA (rRNA).

Figure 15. Partial 12S rRNA sequence of Bos gaurus in Vietnam

Figure 16. Partial 16S rRNA sequence of Bos gaurus in Vietnam

29
Figure 17. Partial cytochrome b gene sequence of Bos gaurus in Vietnam
(Forward primer)

30
Figure 18. Partial cytochrome b gene sequence of Bos gaurus in Vietnam
(Reverse primer)

31
 3.3.2. Assembly and comparison of the partially sequenced
mitochondrial genome of Bos gaurus in Vietnam to reference genome
Comparing the partially sequenced mitochondrial genome of Bos gaurus in Vietnam
to other populations using BLASTn to determine their evolutionary relationships.
Concern was raised regarding the genetic relationship between Bos gaurus in
Vietnam and cows (Bos taurus) with high percent identity from 80% to over 90% as
shown in Figure 20;21;22 and 23. Concurrently, this indicates the need for further
sequencing of the whole mitochondrial genome to identify genetic differences
between the Bos gaurus in Vietnam and other populations, highlighting the genetic
value and detecting a distinctive mutation in the genome of the Bos gaurus in
Vietnam.

Figure 19. The BLASTn result of 12S-F regions

Figure 20. The BLASTn result of 16S-F regions

32
 Figure 21.The BLASTn result of CytB-F regions

Figure 22.The BLASTn result of CytB-R regions

Figure 23. Assembly of the four sequenced regions on the

reference genome

33
Comparing the sequenced DNA fragments to the reference genome (Mitochondrial
genome of Bos gaurus from Prabhu et al., 2019), indicating gene regions
correspond to the 12s RNA, 16s RNA, and cob genes of the Indian gaur (Figure 24).
Particularly, it witnessed similarly genetic characteristics when comparing Cytb-F
and Cytb-R sequences, which were partially sequenced from gaur in Vietnam to the
mitochondrial genome of the Indian Bos gaurus (Prabhu et al., 2019).

Figure 24. Alignment of sequenced DNA (Cytb-F) with the whole

mitochondrial genome of Indian Bos gaurus

Specially, the CytB-F regions have coverage (green line) between coordinates
14,123 and 15,084, but the association begins between coordinates 14167 and
14968. (802 bp). This difference could be the result of signal noise during
sequencing and constraints on sequencing conditions. The sequencing noise
proposed that primer or template concentrations are low or that impurities are
present, thus establishing a premise for optimizing sequencing conditions in future
experiments. The comparison of over 800 bp to the complete mitochondrial genome
of the Indian Bos gaurus revealed (Figure 22). This difference in sequence has
initially revealed the genetic distinguishes between Bos gaurus in Vietnam and
Indian gaur in regions that have only been partially sequenced (Prabhu et al.,
2019).

Figure 25. Alignment of sequenced DNA (Cytb-R) with the whole

mitochondrial genome of Indian Bos gaurus
34
Similarly, Cytb-R fragment showed 35 distinct points in 396 bp compared to the
complete mitochondrial genome of the Indian Bos gaurus.

3.3.3. Designed primers for further sequencing reactions performance

Figure 26. Binding sites of fourteen primers designed for performing

sequencing reaction

The time required for optimizing long-range PCR reactions to generate 9-Kbp
products consumed the majority of this project's duration, resulting in insufficient
time for sequencing the whole mitochondrial genome of Bos gaurus in Vietnam; only
some regions were sequenced. As shown in Figure 25, the required primers for
sequencing reactions consisted of approximately 14 primers as described in 2.5.1
part. This result has established a fundamental premise for future sequencing
research.

35
4. CONCLUSION
This is the first study aimed to sequence the mitochondrial genome of Bos gaurus in
Vietnam. In this study, the mitochondrial genome of Bos gaurus in Vietnam was
partially sequenced in some regions including 12S rRNA, 16s rRNA and cob gene,
thereby initially indicating the partially similarity in genetic relationship between Bos
gaurus in Vietnam and cow (Bos taurus) in those regions. Furthermore, this study
initially confirms the genetic distinction between Bos gaurus in Vietnam and other
population, especially Indian Bos gaur. Consequently, coining the fundamental
premises for further study on sequencing the complete mitochondrial genome of
gaur, thereby providing a useful genetic resource for phylogenetic, evolutionary
biology, and conservation related studies. In addition, this study described the
essential conditions to optimize the long-range PCR reaction for 9-Kbp PCR
products, thereby providing the crucial reference to produce the larger target
products.

36
REFERENCES

Applegate, R. D. (2013). Ungulate Taxonomy by C. Groves and P. Grubb Groves, C.

and P. Grubb 2011. Ungulate Taxonomy. Johns Hopkins University Press, Baltimore,
Maryland, 317 pp. ISBN-13 978-1-4214-0093-8 and ISBN-10 1-4214-0093-6 , price
(hardbound), $100.00. Journal of Mammalogy, 94(1), 245–246.
https://doi.org/10.1644/12-MAMM-R-103

Choudhury, A. (2002). Distribution and conservation of the Gaur Bos gaurus in the
Indian Subcontinent. Mammal Review, 32(3), 199–226.
https://doi.org/10.1046/j.1365-2907.2002.00107.x

Groves, C. P. (2003). Taxonomy of ungulates of the Indian Subcontinent. The

Journal of the Bombay Natural History Society, 100, 341–362.

Hassanin, A., Ropiquet, A., Couloux, A., & Cruaud, C. (2009). Evolution of the
Mitochondrial Genome in Mammals Living at High Altitude: New Insights from a
Study of the Tribe Caprini (Bovidae, Antilopinae). Journal of Molecular Evolution,
68(4), 293–310. https://doi.org/10.1007/s00239-009-9208-7

Hutson, A. M. (1993). Mammals of the Indomalayan Region: A Systematic Review

by G. B. Corbet and J. E. Hill (Oxford University Press, Oxford, and Natural History
Museum, London, 1992, ISBN 019 854693 9, 488 pp. HB £60.00). Oryx, 27(2),
124–125. https://doi.org/10.1017/S0030605300020718

Kamalakkannan, R., Bhavana, K., Prabhu, V. R., Sureshgopi, D., Singha, H. S., &
Nagarajan, M. (2020). The complete mitochondrial genome of Indian gaur, Bos
gaurus and its phylogenetic implications. Scientific Reports, 10(1), 11936.
https://doi.org/10.1038/s41598-020-68724-6

Lydekker, R. (1907). The game animals of India, Burma, Malaya, and Tibet; being a
new and revised edition of “The great and small game of India, Burma, and Tibet,”
by R. Lydekker. With nine plates and fifty-nine other illustrations. R. Ward, limited,.
https://doi.org/10.5962/bhl.title.16137

Nguyen, M. H. (2009). The status of Vulnerable gaur Bos gaurus and Endangered
banteng Bos javanicus in Ea So Nature Reserve and Yok Don and Cat Tien National
Parks, Vietnam. Oryx, 43(01), 129. https://doi.org/10.1017/S0030605307000440

Prabhu, V. R., Arjun, M. S., Bhavana, K., Kamalakkannan, R., & Nagarajan, M.
(2019). Complete mitochondrial genome of Indian mithun, Bos frontalis and its
phylogenetic implications. Molecular Biology Reports, 46(2), 2561–2566.
https://doi.org/10.1007/s11033-019-04675-0

Prabhu, V. R., Singha, H. S., Kumar, R. G., Gopalakrishnan, A., & Nagarajan, M.
(2020). Characterization of the complete mitochondrial genome of Barilius
malabaricus and its phylogenetic implications. Genomics, 112(3), 2154–2163.
https://doi.org/10.1016/j.ygeno.2019.12.009
I
 Ren, Q., Liu, Y., Xie, X., Yan, B., Zhang, K., Yang, Y., & Qiu, Q. (2018). The
complete mitochondrial genome of bovine species Gayal (Bos frontalis).
Conservation Genetics Resources, 10(4), 889–891.
https://doi.org/10.1007/s12686-017-0889-8

Ropiquet, A., & Hassanin, A. (2005). Molecular phylogeny of caprines (Bovidae,

Antilopinae): The question of their origin and diversification during the Miocene.
Journal of Zoological Systematics and Evolutionary Research, 43(1), 49–60.
https://doi.org/10.1111/j.1439-0469.2004.00290.x

Rosli, N., Sitam, F. T., Rovie-Ryan, J. J., Gan, H. M., Lee, Y. P., Hartini Ithnin,
Millawati Gani, Mohd Firdaus Ariff Abdul Razak, Md-Zain, B. M., & Abdullah, M. T.
(2019). The complete mitochondrial genome of Malayan Gaur (Bos gaurus hubbacki
) from Peninsular Malaysia. Mitochondrial DNA Part B, 4(2), 2535–2536.
https://doi.org/10.1080/23802359.2019.1640085

Solari, S., & Baker, R. J. (2007). Mammal species of the world: A taxonomic and
geographic reference. Journal of Mammalogy, 88(3), 824–830.
https://doi.org/10.1644/06-MAMM-R-422.1

Thornback, J., Jenkins, M., & International Union for Conservation of Nature and
Natural Resources (Eds.). (1982). The IUCN mammal red data book. IUCN.

Duckworth, Will & Hedges, Simon. (1998). Tracking Tigers: A review of the Status
of Tiger, Asian Elephant, Gaur, and Banteng in Vietnam, Lao, Cambodia, and
Yunnan (China), with Recommendations for Future Conservation Action. WWF
Indochina Programme, Hanoi, Vietnam.

Nguyen, Manh. (2005). Result of wild cattle (Bos spp.) survey in Binh Phuoc
Province. Journal of Biology. 27. 60-62.

Thach, M.H. & Nguyen, M.H. (2005). Survey on wild bovines (Bovidae spp.) in Bu
Gia Map National Park (Binh Phuoc province) and Nam Nung Nature Reserve (Dak
Nong province). Journal of Science, 29, 103–107.

Corbet, G.B. & Hill, J.E. (1992) The Mammals of the Indomalayan Region: A
systematic review. Oxford, UK.

Dang, H. H. (1986). Biology and ecology of ungulates in Vietnam. Science and

Technique, Hanoi, Vietnam.

Government of Vietnam (2006). Decree No. 32/2006/NÐ-CP on Management of

Endangered Species of Wild Fauna and Flora. Vietnamese Government, Hanoi,
Vietnam

Ahrestani, F. S. (2018). Bos frontalis and Bos gaurus (Artiodactyla: Bovidae).

Mammalian Species, 50(959), 1–17. https://www.jstor.org/stable/48572347

II
Jane Gurr, S., 1991. PCR Protocols-A Guide to Methods and Applications.
Biochemical Education, 19(1), p.45.

Le, X.C., Pham, T.A., Duckworth, W., Vu, N.T., Lic, V. (1997). A survey of large
mammals in Dak Lak Province, Vietnam. IUCN

Sikkema‐Raddatz, Birgit, et al. Targeted next‐generation sequencing can replace

Sanger sequencing in clinical diagnostics. Human mutation 34.7 (2013): 1035-1042

Gauthier, Michel. (2007). Simulation of polymer translocation through small

channels: A molecular dynamics study and a new Monte Carlo approach.

Department of Biological Sciences, Faculty of Basic and Applied Sciences,

International Islamic University, Islamabad, Pakistan., Asif, S., Khan, M.,
Department of Biological Sciences, Faculty of Basic and Applied Sciences,
International Islamic University, Islamabad, Pakistan., Waqar Arshad, M.,
Department of Molecular Biology, Faculty of Basic Medical Sciences, Shaheed
Zulfiqar Ali Bhutto Medical University, Islamabad, Pakistan., Shabbir, M. I., &
Department of Biological Sciences, Faculty of Basic and Applied Sciences,
International Islamic University, Islamabad, Pakistan. (2021). PCR Optimization for
Beginners: A Step-by-Step Guide. Research in Molecular Medicine, 9(2), 81–102.
https://doi.org/10.32598/rmm.9.2.1189.1

Miller, B. R., 3rd, Beese, L. S., Parish, C. A., & Wu, E. Y. (2015). The Closing
Mechanism of DNA Polymerase I at Atomic Resolution. Structure (London, England:
olete 1993), 23(9), 1609–1620. https://doi.org/10.1016/j.str.2015.06.016

Innis, Michael A., Gelfand, David H., Sninsky, John J., White, Thomas J., (2002).
PCR protocols: a guide to methods and applications

Park HO, Kim JJ (1996) Lyophilized reagent for polymerase chain reaction.
US5861251A (US patent)

Korfhage C, Oelmüller U, Wyrich R (2002) Ammonium sulfate for neutralization of

inhibitory effects. EP1356122A2 (European Patent)

Pelt-Verkuil EV, Belkum AV, Hays JP (2008) Principles and technical aspects of PCR
amplification. Springer, Dordrecht

Dean, M.D., & Ballard, J.W. (2001). Factors affecting mitochondrial DNA quality
from museum preserved Drosophila simulans. Entomologia Experimentalis et
Applicata, 98.

Bell, J. R. (2008). A simple way to treat PCR products prior to sequencing using
ExoSAP-IT®. Biotechniques, 44(6), 834.

III
APPENDIX
Appendix 1 – Primer BLAST for the used primers in this study
Primer Sequence Amplicon size
Bos-Cyt-b-F CGAAGCTTGATATGAAAAACCATCGTTG
1246
Bos-Cyt-b-R GGAATTCATCTCTCCCGGTTTACAAGAC

12S-F CAAACTGGGATTAGATACCC
440
12S-R GAGGGTGACGGGCGGTGTGT

16S-F ACCGTGCAAAGGTAGCATAAT
499
16S-R TCCGGTCTGAACTCAGATCAC

IV
Appendix 2 – Primer BLAST for fourteen primers designed for this study
Primer Sequence Amplicon size
UniBos-Seq-P1-R1 TGG-TGT-AAT-TGG-GAG-CAC
115
UniBos-Seq-P1-F1 AAA-GAG-TTA-CTT-TGA-TAG-AGT

UniBos-Seq-P1-R2 AGT-TGT-GTT-TGG-TTT-AGT-C
109
UniBos-Seq-P1-F2 TAT-CTG-TAC-TTT-ACC-AAA-TCT

UniBos-Seq-P1-R3 TCT-TGC-AAT-CCT-TAT-CAG-GA
89
UniBos-Seq-P1-F3 TTA-GAA-TAG-GAA-TTT-AGG-TTA-A

UniBos-Seq-P1-R4 GGA-GRA-GTC-AGA-AGC-TTA-T
144
UniBos-Seq-P1-F4 TAA-CCG-CAC-ACG-CAT-TTG

V
UniBos-Seq-P1-R5 TAT-ATG-GTG-AGC-TCA-TAC-GA
90
UniBos-Seq-P1-F5 GGA-AAA-AAA-GAA-CCA-TTC-GGA

UniBos-Seq-P1-R6 GGG-TTC-TTC-AAA-TGT-GTG
119
UniBos-Seq-P1-F6 TTT-TCA-TCA-TCT-GAG-AAG-CAT

UniBos-Seq-P1-R7 CGA-TTA-TCG-ACT-TCT-AAT-AGT-C
91
UniBos-Seq-P1-F7 CAG-ATT-ATG-AGG-ACT-TAA-GCT

VI
SUPERVISOR’S APPROVAL

.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................

Signature: ....................................................................................................

Date: ............................................................................................................