This article appeared in a journal published by Elsevier.

The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/authorsrights
 Author's personal copy

Virus Research 180 (2014) 76–83

Contents lists available at ScienceDirect

Virus Research
journal homepage: www.elsevier.com/locate/virusres

Genotyping of canine distemper virus strains circulating

in Brazil from 2008 to 2012
Renata da Fontoura Budaszewski a , Luciane Dubina Pinto a , Matheus Nunes Weber a ,
Eloiza Teles Caldart b , Christian Diniz Beduschi Travassos Alves a , Vito Martella c ,
Nilo Ikuta d , Vagner Ricardo Lunge d , Cláudio Wageck Canal a,∗
a
Laboratório de Virologia, Faculdade de Veterinária, Universidade Federal do Rio Grande do Sul, Av. Bento Gonçalves 9090, Agronomia, 91540-000 Porto
Alegre, Rio Grande do Sul, Brazil
b
Laboratório de Zoonoses e Saúde Pública, Universidade Estadual de Londrina, Londrina, Rodovia Celso Garcia Cid, PR 445 Km 380, Jardim Alto da Colina,
86051-980 Londrina, Paraná, Brazil
c
Dipartimento di Medicina Veterinaria, Università di Bari, Strada provinciale per Casamassima Km 3, 70010 Valenzano, Bari, Italy
d
Laboratório de Diagnóstico Molecular, Universidade Luterana do Brasil, Av. Farroupilha, 8.001, Prédio 22, Sala 312, São José, 92425-900 Canoas, Rio
Grande do Sul, Brazil

a r t i c l e i n f o a b s t r a c t

Article history: Canine distemper virus (CDV) is a major pathogen of dogs and represents a serious threat to both unvac-
Received 30 August 2013 cinated and vaccinated animals. This study surveyed dogs with or without clinical signs related to canine
Received in revised form distemper from different regions of Brazil from 2008 to 2012. A total of 155 out of 386 animals were
29 November 2013
found to be CDV positive by RT-PCR; 37 (23.8%) dogs were asymptomatic at the time of sampling, and 90
Accepted 9 December 2013
(58%) displayed clinical signs suggestive of distemper. Nineteen (12.2%) dogs had a record of complete
Available online 24 December 2013
vaccination, 15 (9.6%) had an incomplete vaccination protocol, and 76 (49%) had no vaccination record.
Based on the sequence analysis of the complete hemagglutinin gene of 13 samples, 12 of the strains
Keywords:
Canine distemper virus
were characterized as Genotype South America-I/Europe. Considering criteria of at least 95% nucleotide
Detection identity to define a genotype and 98% to define a subgenotype, South America-I/Europe sequences segre-
Genotype gated into eight different phylogenetically well-defined clusters that circulated or co-circulated in distinct
Phylogeny geographical areas. Together, these findings highlight the relevance of CDV infection in Brazilian dogs,
South America demonstrate the predominance of one genotype in Brazil and support the need to intensify the current
control measures.
© 2014 Elsevier B.V. All rights reserved.

1. Introduction the incidence of canine distemper in dogs. However, CDV infec-

Canine distemper virus (CDV) is a major pathogen of domes-
tic dogs and wild carnivores. CDV infection is relevant worldwide
and is associated with high morbidity and mortality. CDV-infected
dogs may develop respiratory, gastrointestinal, dermatologic, oph-
thalmic or neurological disorders (Greene and Appel, 2006).
Taxonomically, CDV is a member of the genus Morbillivirus within
the family Paramyxoviridae (King et al., 2011). The genomic RNA
encodes six structural proteins: fusion (F), hemagglutinin (H),
envelope-associated matrix (M), phosphoprotein (P), large poly-
merase (L) and nucleocapsid (N) protein (Appel, 1987; Rima, 1983).
Like measles virus, CDV is a monotypic virus, as defined by poly-
clonal antisera. In general, the introduction and extensive use of
live attenuated CDV vaccines in the 1950s has drastically reduced
∗ Corresponding author. Tel.: +55 51 33086926; fax: +55 51 33087305.
E-mail address: claudio.canal@ufrgs.br (C.W. Canal).
tion and disease in immunized dogs have been observed on several
occasions (Ek-Kommonen et al., 1997; Józwik and Frymus, 2002; Si
et al., 2010; Simon-Martínez et al., 2008). This raises the question of
whether the current vaccines effectively protect against wild-type
CDV strains that are genetically divergent from the vaccinal viruses.
Furthermore, a number of studies have shown antigenic differences
between vaccine strains and wild-type isolates (Hashimoto et al.,
2001; Si et al., 2010).
Of the six structural proteins, the H gene (Blixenkrone-Møller
et al., 1993) has the greatest genetic variation and is therefore
a suitable target for investigating the polymorphism of the CDV
isolates and for molecular epidemiological studies (Haas et al.,
1997; Hashimoto et al., 2001; Von Messling et al., 2001). Based
on the variability in the H gene, CDV strains segregate into at
least nine major geographically related genetic lineages: America-
I, America-II, Asia-I, Asia-II, Europe Wildlife, Arctic, South Africa,
South America-I/Europe and South America-II (Calderón et al.,
2007; Haas et al., 1997; Martella et al., 2006; Mochizuki et al.,

0168-1702/$ – see front matter © 2014 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.virusres.2013.12.024
 Author's personal copy

R.d.F. Budaszewski et al. / Virus Research 180 (2014) 76–83 77

Fig. 1. Map of South America. The map indicates the origin of the strains and the distribution of genotypes and subgenotypes within the Brazilian states. Letters indicate
the genetic lineages circulating in these regions, including strains from Uruguay and Argentina. Numbers within parentheses indicate the number of positive animals per
number of samples analyzed. The states are MT: Mato Grosso; PR: Paraná; RJ: Rio de Janeiro; RO: Rondônia; RS: Rio Grande do Sul; SC: Santa Catarina; SP: São Paulo. SA-I:
South America-I/Europe; SA-II: South America-II; RL: Rockborn-like. Letters A-G indicate the subgenotypes.

1999; Panzera et al., 2012; Woma et al., 2010). Classical vaccine
CDV strains are derived from America-I genotype viruses, with the
exception of the Rockborn vaccine strain (Martella et al., 2011).
Rockborn-like strains have been identified from dogs and wild ani-
mals as well as in some vaccines currently available on the market
(Martella et al., 2011).
While canine distemper is endemic in Brazil (Silva et al., 2007),
information on the molecular epidemiology of this viral infection is
scarce (Castilho et al., 2007; Negrão et al., 2013; Rosa et al., 2012). To
fill this gap, we surveyed the CDV infection burden in seven Brazil-
ian states during a 4-year period and molecularly characterized a
representative selection of CDV strains.
2. Materials and methods
clinical signs at the time of sampling were considered asymp-
tomatic, although there was no monitoring of the dogs after
sampling date. Samples were diluted to 20% (w/v) in phosphate-
buffered saline (PBS, pH 7.4) and stored at −80 ◦ C for further
analysis.
2.2. RNA extraction
RNA was extracted from rectal swab suspensions using TRIzol
LS Reagent® (Life Technologies, Carlsbad, CA, USA) according to the
manufacturer’s instructions. The attenuated live vaccine Vanguard
Plus® (Pfizer, New York, NY, USA) was used as a positive control,
and ultrapure water and rectal swabs from five healthy adult dogs
were used as negative controls.

2.1. Samples 2.3. Primers

The study was comprised of a total of 386 rectal swab samples
collected from dogs between April 2008 and June 2012, selected
by convenience sampling. The samples were collected from ani-
mals with or without clinical signs suggestive of CDV infection in
seven Brazilian states: Rio Grande do Sul, Santa Catarina, Paraná,
São Paulo, Rio de Janeiro, Rondônia and Mato Grosso (Fig. 1). Infor-
mation about the animals, such as age, gender, breed, clinical
signs and vaccination status was collected. Animals not presenting
The primers used to amplify fragments of the N and H genes
were synthesized as described in previous reports (An et al.,
2008; Castilho et al., 2007; Frisk et al., 1999; Harder et al., 1996;
Hashimoto et al., 2001), with minor modifications, allowing the
detection of a larger number of local isolates. The N primers were
used for the detection of CDV by nested RT-PCR. CDV-1F and
CDV-2R were used for the first round of amplification, and CDV-
3F and CDV-4R were used for the second round of amplification.
 Author's personal copy
78 R.d.F. Budaszewski et al. / Virus Research 180 (2014) 76–83
Table 1
Oligonucleotide primers used in the PCR assays.
Primer Sequence
(5 –3 )
CDV-1F ACTGCTCCTGATACTGC
CDV-2R TTCAACACCRACYCCC
CDV-3F (p1b ) ACAGRATTGCYGAGGACYTRT
CDV-4R (p2b ) CARRATAACCATGTAYGGTGC
RH3-F AGGGCTCAGGTACTCCAGC
RH4-R AATGCTAGAGATGGTTTAATT
H1F ATGCTCTCCTACCAAGACAA
H1R CATGTCATTCAGCCACCGTT
H2F AATATGCTAACCGCTATCTC
H2RB TTTGGTTGCACATAGGGTAG
H3FB CATATGATATATCCCGGGGC
H3R TCARGGWTTTKAACGRYYAC
CDVF10B TAYCATGAYAGYARTGGTTC
CDVR10 ARTYYTCRACACTGRTKGTG
Bold characters indicate modifications introduced to the original sequences published in the references.
a
Numerical position on the genome of CDV Onderstepoort strain (GenBank: NC001921).
b
Original denomination in the respective reference.
Modifications were made in agreement with a previous report
(Fischer et al., 2013). For the phylogenetic analysis, the complete H
gene was amplified. The first round of amplification used the primer
pair RH3-F and RH4-R, and the nested PCR used inner primer pairs
H1F/H1R, H2F/H2RB, CDVF10B/CDVR10 and H3FB/H3R generating
overlapping fragments of 789, 700, 870 and 542 bp, respectively.
Primers H2RB and H3FB were designed based on Brazilian strains
previously sequenced with primer pair CDVF10B/CDVR10. The
primers sequences are shown in Table 1.
2.4. Detection of CDV by RT-PCR
For CDV detection, one-step RT-PCR for the amplification of
480 bp of the N gene was performed, followed by nested PCR to
amplify an internal 287 bp fragment (corresponding to positions
769–1055 of the Onderstepoort strain genome). The cDNA was
synthesized with a SuperScript III Reverse Transcriptase Kit (Life
Technologies, Carlsbad, CA, USA) and Platinum® Taq DNA poly-
merase (Life Technologies, Carlsbad, CA, USA) in a total volume of
25 ␮L. The nested PCR was performed in a final volume of 50 ␮L that
contained 2 ␮L of the first reaction product. The one-step RT-PCRs
were performed under the following conditions: 1 cycle at 55 ◦ C
for 30 min followed by 35 cycles of denaturation at 94 ◦ C for 20 s,
annealing at 55 ◦ C for 40 s and polymerization at 72 ◦ C for 1 min.
The nested PCR was performed in 1 cycle at 94 ◦ C for 3 min; 35
cycles of denaturation at 94 ◦ C for 20 s, annealing at 59 ◦ C for 40 s
and polymerization at 72 ◦ C for 1 min; and a final extension cycle
at 72 ◦ C for 5 min.
2.5. Amplification of the H gene by RT-PCR
The amplification of the complete H gene was performed using
the inner primers described by Harder et al. (1996) and four sets of
outer primers described by Hashimoto et al. (2001), An et al. (2008)
and the present study. The cDNA was synthesized with a Super-
Script III Reverse Transcriptase Kit (Life Technologies, Carlsbad, CA,
USA) according to the manufacturer’s instructions. Amplification
was conducted with an initial denaturation at 94 ◦ C for 3 min; 30
cycles of 30 s for denaturation at 94 ◦ C, 30 s of primer annealing at
50 ◦ C, and 1 min of extension at 72 ◦ C; and a 10 min final exten-
sion at 72 ◦ C. The inner primer pairs were used in nested PCR with
Platinum® Taq DNA polymerase (Life Technologies, Carlsbad, CA,
Target Positiona Reference
NC 654–670 Castilho et al.
(2007)
NC 1118–1133 Castilho et al.
(2007)
NC 769–789 Frisk et al. (1999)
NC 1055–1035 Frisk et al. (1999)
H 7059–7077 Harder et al. (1996)
H 8975–8995 Harder et al. (1996)
H 7079–7098 An et al. (2008)
H 7848–7867 An et al. (2008)
H 7730–7749 An et al. (2008)
H 8236–8255 Present study
H 8649–8668 Present study
H 8883–8902 An et al. (2008)
H 7991–8010 Hashimoto et al.
(2001)
H 8842–8861 Hashimoto et al.
(2001)
USA). The temperature cycling consisted of an initial denaturation
at 94 ◦ C for 3 min; 30 cycles of 30 s of denaturation at 94 ◦ C, 30 s of
primer annealing at 50 ◦ C, and 1 min of extension at 72 ◦ C; and a
10 min final extension at 72 ◦ C.
2.6. Sequence and phylogenetic analysis of the H gene
The PCR products generated with sets of inner primers were
purified using the NucleoSpin Extract II kit (Macherey–Nagel,
Düren, Germany). Both DNA strands were sequenced with an ABI
PRISM 3100 Genetic Analyzer using a BigDye Terminator v.3.1
cycle sequencing kit (Applied Biosystems, Foster City, CA, USA).
Overlapping fragments were aligned and contigs were assem-
bled using SeqMan (DNASTAR package). Sequence alignment and
edition was performed with MEGA5 (Tamura et al., 2011) soft-
ware using CLUSTAL W. For phylogenetic analysis, a selection of
13 Brazilian CDV strains collected in this study and 53 refer-
ence CDV strains were used. The strains from the present work
were selected from among the PCR-positive samples from differ-
ent geographical regions. MEGA5 (Tamura et al., 2011) was used
for phylogeny inference using the neighbor-joining model and the
Tamura 3-parameter distance correction and are in the units of the
number of base substitutions per site. The rate variation among
sites was modeled with a gamma distribution (shape parame-
ter = 5). Statistical support was provided by 1000 non-parametric
bootstrap analyses. A nucleotide distance matrix was calculated
using an alignment of 66 H gene sequences. Ambiguous positions
were removed for each sequence pair. There were a total of 1802
positions in the final dataset. The CDV genotypes were distin-
guished based on a criterion of a difference of at least 5% at the
nucleotide level (Mochizuki et al., 1999). Within each genotype,
strains in the same clade with high bootstrap values showing at
least 98% nucleotide identity were considered to belong to the same
subgenotype.
3. Results
3.1. Detection of CDV and description of CDV-associated clinical
signs
CDV was detected by N nested RT-PCR in 155 (40.2%) of the 386
samples analyzed. The majority of the CDV-positive samples (123)
 Author's personal copy

R.d.F. Budaszewski et al. / Virus Research 180 (2014) 76–83 79

Fig. 2. Phylogenetic neighbor-joining tree based on the complete H gene sequence. Bootstrap (1000 replicates) values >60 are indicated at the internal nodes. The samples
obtained in the present study are highlighted with a symbol (䊉). RS: Rio Grande do Sul state; PR: Paraná state, both in Brazil.

were from municipalities in the state of Rio Grande do Sul. The
remaining 32 CDV-positive samples were from the states of Santa
Catarina (SC), Paraná (PR), São Paulo (SP), Rio de Janeiro (RJ) and
Mato Grosso (MT).
Thirty-seven (23.8%) of the 155 CDV-positive dogs were asymp-
tomatic at the time of sampling, whereas 90 (58%) displayed clinical
signs suggestive of canine distemper (CD). Information regarding
clinical signs was unavailable for 28 animals. Fifty-nine (65.5%)
out of the 90 CDV-positive/symptomatic animals displayed gas-
troenteritis, and 20 of these exhibited hemorrhagic feces. Of the
90 CDV-positive/symptomatic animals, 21 (23.3%) had respiratory
signs such as nasal discharge, coughing and sneezing; 23 (25.5%)
displayed ocular discharge; and 12 (13.3%) displayed dermato-
logical alterations such as nose and/or foot hyperkeratosis and
abdominal pustules. Twenty-six dogs (28.8%) displayed neurolog-
ical signs, such as myoclonus and seizure. In a significant number
of animals, the practitioner reported only a single clinical sign: 41
animals (45.5%) had only gastrointestinal signs; 11 animals (12.2%)
had only neurological signs; three dogs (3.3%) displayed only respi-
ratory signs; one animal displayed only ocular lesions; and one
animal displayed only dermatological lesions.
3.2. Detection of CDV in vaccinated animals
Information about the immunization schedule/status was not
available for 45 (29%) of the 155 CDV RT-PCR-positive dogs. Seven
out of the 19 (12.2%) dogs with a history of complete vaccination
were asymptomatic, 11 had CD-related signs, and one had no avail-
able information about clinical signs. Fifteen (9.6%) animals had
not completed the vaccination program, as they had not received
all the three doses recommended for primary vaccination during
the first year of life; of these, only 12 animals were symptomatic.
 Author's personal copy
80 R.d.F. Budaszewski et al. / Virus Research 180 (2014) 76–83
Seventy-six (49%) animals were not vaccinated; of these, 21 were
asymptomatic and 29 showed one or more clinical signs.
3.3. Association between CDV RT-PCR positive dogs and age or
breed
In our attempt to investigate the patterns of CDV infection, the
influence of age and breed were also examined. Seventy-one out of
155 animals (45.8%) were aged less than 6 months, 29 (18.7%) were
aged between 7 and 12 months, and 33 (21.3%) were aged more
than 12 months. With respect to breed, 87 were mixed-breed dogs,
and 51 were of specific breeds.
3.4. Sequence analysis of the H gene
A selection (23 samples) of the N PCR-positive samples was
further screened by H gene fragment amplification; 13 of them
had the complete H gene amplified. The nucleotide sequences of
the amplicons were determined and deposited into the GenBank
under the accession numbers JX912956–JX912978. Upon sequence
and phylogenetic analysis, all but one of the wild-type CDVs from
Brazil clustered with strains from Uruguay, Argentina and European
countries, within the South America-I/Europe genotype (Fig. 2). A
high degree of identity was detected among the Brazilian wild-type
strains, ranging from 95.7% to 100% nucleotide identity. Inter-
estingly, a single CDV strain, Bra-188/08 (GenBank: JX912968),
resembled the Rockborn vaccine strain (GenBank: GU810819.1)
and Rockborn-like CDVs, including the strain N-CDV (GenBank:
FJ461702), the Lesser Panda (Ailurus fulgens) strain from China
(GenBank: AF178039) and the canine CDV strain isolated from the
USA, 25259 (GenBank: AY964114).
4. Discussion
Canine distemper is one of the most important viral diseases in
dogs in Brazil (Amude et al., 2006; Amude and Alfieri, 2010; Del
Puerto et al., 2010; Figuera et al., 2008; Headley et al., 2012; Rosa
et al., 2012). Several recent reports suggest both the re-emergence
and the increased activity of CDV worldwide, including in South
America (Calderón et al., 2007; Norris et al., 2006; Panzera et al.,
2012). In several of these reports, the clinical and pathological
observations were not followed up by molecular epidemiology
using H gene analysis (Amude et al., 2011; Del Puerto et al., 2010;
Headley et al., 2009).
In Brazil, epidemiological studies are scarce, but previous stud-
ies have suggested that CD is endemic in urban canine populations,
with frequencies of RT-PCR-positive strains ranging from 47.1% to
66.5% in dogs with signs of distemper (Gebara et al., 2004; Negrão
et al., 2007). In this study, 40.2% of the animals were positive. In
Brazil, most dogs are unvaccinated, mainly due to the large num-
ber of stray dogs and the poor economic situations of dog owners,
explaining the endemicity of the virus in this region. There is a lack
of information about CDV in other South American countries.
In the present study, 23.8% of CDV-positive dogs were
asymptomatic. This finding agrees with previous estimates that
approximately 25% to 75% of dogs susceptible to CD are sub-
clinically infected and may be transmitting the virus without any
clinical sign of disease, thus acting as CDV reservoirs (Greene and
Appel, 2006).
In our study, 12.2% of the CDV-positive dogs were considered
vaccinated based on clinical records. CDV outbreaks in vaccinated
dogs have been documented repeatedly (Blixenkrone-Møller et al.,
1993; Ek-Kommonen et al., 1997; Iwatsuki et al., 2000; Józwik and
Frymus, 2002; Simon-Martínez et al., 2008; Uema et al., 2005).
Several hypotheses have been proposed to explain these vaccine
failures, such as immunization of immune-compromised dogs,
incorrect protocols or improper storage, a poor immune response
and the emergence of new strains that are antigenically divergent
and are able to escape the immune protection elicited by the vac-
cines (Appel, 1978; Lan et al., 2006). In the cases studied here,
vaccination with the modified live vaccine was performed in 19
out of 155 dogs. One of these was sequenced (Bra-110/12, Gen-
Bank: JX912976), and the resulting sequence was clearly distinct
from those of known vaccine strains.
The CDV H glycoprotein determines the cytopathology and
tropism of the virus and can vary by up to 10% among the CDV
isolates. While previous work has used the P and N gene sequences
to assess the phylogenetic relationship among CDV strains, H gene
inference results in a more robust comparison (Tan et al., 2011). At
least nine separate genotypes of CDV that differ by more than 5% at
the nucleotide level can be distinguished (Mochizuki et al., 1999).
In Brazil, most of the previous phylogenetic analyses of CDV strains
were based on partial N gene sequences, which varies less among
CDV isolates than H gene sequences because this gene is part of the
most conserved region of the CDV genome (Castilho et al., 2007;
Headley et al., 2012).
The phylogenetic analysis of H gene sequences revealed the
circulation of two genotypes of CDV in Brazil, which was already
suggested by a previous study that used a smaller fragment of the H
gene (Rosa et al., 2012), thus these sequences were not included in
this study. The first group contains isolates from South America and
European countries, designated genotype South America-I/Europe,
and the second contains mainly isolates from Argentina, designated
genotype South America-II. Although most of the sequences could
be grouped in a phylogenetic cluster clearly separate from the vac-
cine strains (America-I) and from other wild-type CDV strains, the
Bra-188/08 strain (GenBank: JX912968) was located in a clearly
separate branch within the Rockborn-like genotype. In Argentina,
genotype South America-II seems to be more prevalent and is more
closely related to the Europe Wildlife genotype. None of our strains
belonged to this group.
The Bra-188/08 isolate was highly similar (99.4% nt) within
a 1802-nt long fragment to a Rockborn strain (GenBank:
GU810819.1) and was found to match (99.3% nt) the vaccine N-CDV
strain (GenBank: FJ461702). Rockborn-like strains have already
been described in wild animals, but vaccine-like strains have been
reported only occasionally in dogs (Harder and Osterhaus, 1997;
Pardo et al., 2005). A cluster of sequences including the 25259
and Lesser Panda strains usually occupies an intermediate posi-
tion between the Asia-I and the European Wildlife group. Their
classification into one of these two groups varies between the
different genomic regions investigated and the authors who con-
ducted the research (Benetka et al., 2011; Martella et al., 2006;
McCarthy et al., 2007). In this study, these sequences grouped in
a well defined cluster with high bootstrap value. We have classi-
fied them as Rockborn-like strains, according to a recent review
(Martella et al., 2011).
The Rockborn strain is claimed to be part of a commercial vac-
cine available in the Brazilian market, despite being withdrawn
from several markets after the mid-1990s due to reports of sus-
pected cases of postvaccinal encephalitis and the resulting belief
that it could be less attenuated and less safe than other CDV strains
(Gloyd, 1995). The dog in this study that was infected with the Bra-
188/08 strain was not vaccinated, which confirms the circulation
of this Rockborn-like strain in this region. Laboratory contamina-
tion could be ruled out because we do not have this strain in our
laboratory.
Reviewing the South America-I/Europe genotype separately,
we suggest that there are eight subgenotypes circulating in this
region and that these subgenotypes are consistent with the geo-
graphical origins of the strains (Fig. 3). Subgenotype A includes
isolates from the State of Rio Grande do Sul/Brazil and State of
 Author's personal copy

R.d.F. Budaszewski et al. / Virus Research 180 (2014) 76–83 81

Fig. 3. South America-I/Europe subgenotypes. Subtree based on the CDV complete hemagglutinin gene with details of the subgenotypes (A–H) of the South America-I/Europe
genotype. The phylogenetic tree was inferred using the Neighbor-Joining method. The evolutionary distances were computed using the Tamura 3-parameter method and
are in units of the number of base substitutions per site. RS: Rio Grande do Sul; PR: Paraná.

Paraná/Brazil, collected between 2008 and 2012 (present study).
Subgenotype B includes isolates from different cities in the State
of Rio Grande do Sul/Brazil. Subgenotype C includes only isolates
from Uruguay, collected between 2007 and 2009. Subgenotype D
includes isolates from Rio Grande do Sul/Brazil and Argentina col-
lected from 2003 to 2012. Subgenotypes E and F includes only
one isolate each, both from Paraná. The isolate CDVBR1 (GenBank:
EU098102) of subgenotype F, collected in the state of Paraná in
2007, was distant from the others, with a high bootstrap value and
highest nucleotide identity of 97.8% to isolate CDVBR4 (GenBank:
EU098105), grouped in subgenotype G which includes Brazilian
strains collected in the State of Paraná in 2007. In addition, most of
the isolates from Rio Grande do Sul are more similar to isolates from
Uruguay and Argentina than to those from other regions of Brazil,
which is explained by the geographical proximity of these regions.
The uncontrolled movement of dogs between continents has been
blamed for the recirculation of CDV variants around the globe. This
could be an explanation to the high similarity between isolates
from South America and European countries. Isolates from Italy,
Germany, Denmark and Turkey were clustered in the subgenotype
H. There is better vaccine compliance and wider use of the CDV
vaccine in dogs in the United States and in Western Europe than in
parts of Central and Eastern Europe, where several different CDV
variants have been reported (Demeter et al., 2007). The same sce-
nario occurs in South America, which may explain the presence of
different subgenotypes in this region.
The proposal to use the term “genotype” to distinguish among
the various genetic lineages of CDV was made based on the classi-
fication used for measles virus (MV) (Bolt et al., 1997), and its use
is now widely accepted for defining novel CDV strains (Mochizuki
et al., 1999). However, CDV strains appear to be more heteroge-
neous and to differ more from the currently used vaccine than
comparable MV field and vaccine strains (Martella et al., 2007). In
the case of MV, several genotypes and subgenotypes co-circulate at
a given time (Jin et al., 1997; Zhang et al., 2012). In the present study,
subgenotypes were defined based on the phylogenetic properties
of the H gene nucleotide sequence (data not shown); strains in the
same clade with a high bootstrap value and at least 98% nucleotide
identity were considered to belong to the same subgenotype. In
addition, subgenotypes are clearly separated in the phylogenetic
tree. The classification of clades into subgenotypes for CDV has not
been suggested previously.
5. Conclusion
Rectal swab samples were collected from 386 dogs from dif-
ferent regions of Brazil in 2008–2012, and 40.2% of these animals
tested CDV positive by RT-PCR. Of the CDV-positive animals, 23.8%
were asymptomatic and 58% displayed clinical signs suggestive
of distemper. Approximately 12% of the CDV-positive dogs had
a record of complete vaccination, and 49% animals had no vac-
cination record. The present data indicates the presence of two
 Author's personal copy
82 R.d.F. Budaszewski et al. / Virus Research 180 (2014) 76–83
co-circulating lineages with different prevalences in South Amer-
ica: (1) Genotype South America-I/Europe, which includes isolates
from southern Brazil, Uruguay, Argentina and European countries,
that are grouped in subgenotypes A–H and (2) Subgenotype South
America-II, formed exclusively by isolates from Argentina, closely
related to Europe Wildlife genotype.
Conflict of interest
None.
Acknowledgements
Financial support was provided by Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Fundação
de Amparo a Pesquisa do Estado do Rio Grande do Sul (FAPERGS),
Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq) and Propesq/UFRGS. The authors would like to express
their gratitude to the clinical practitioners who generously pro-
vided samples for analysis and to the graduate and post-graduate
students of the Laboratório de Virologia for their collaboration in
this work.
Appendix A. Supplementary data
Supplementary material related to this article can be found,
in the online version, at http://dx.doi.org/10.1016/j.virusres.
2013.12.024.
References
Amude, A.M., Alfieri, A.A., Alfieri, A.F., 2006. Antemortem diagnosis of CDV
infection by RT-PCR in distemper dogs with neurological deficits with-
out the typical clinical presentation. Vet. Res. Commun. 30, 679–687,
http://dx.doi.org/10.1007/s11259-006-3308-2.
Amude, A.M., Alfieri, A.F., 2010. Use of immunohistochemistry and molecular
assays such as RT-PCR for precise post mortem diagnosis of distemper-related
encephalitis. In: Mendez-Vilas, A. (Ed.), Current Research Technology Education
Topics in Applied Microbiology Microbial Biotechnology, vol. 2. Formatex, Spain,
pp. 1539–1545.
Amude, A.M., Headley, S.A., Alfieri, A.A., Beloni, S.N.E., Alfieri, A.F.,
2011. Atypical necrotizing encephalitis associated with systemic
canine distemper virus infection in pups. J. Vet. Sci. 12, 409–411,
http://dx.doi.org/10.4142/jvs.2011.12.4.409.
An, D.-J., Yoon, S.-H., Park, J.-Y., No, I.-S., Park, B.-K., 2008. Phylogenetic
characterization of canine distemper virus isolates from naturally
infected dogs and a marten in Korea. Vet. Microbiol. 132, 389–395,
http://dx.doi.org/10.1016/j.vetmic.2008.05.025.
Appel, M.J.G., 1978. Reversion to virulence of attenuated canine distemper virus in
vivo and in vitro. J. Gen. Virol. 41, 385–393.
Appel, M.J.G., 1987. Canine distemper virus. In: Horzinek Virus Infections of Carni-
vores. Elsevier, Amsterdam, pp. 133–159.
Benetka, V., Leschnik, M., Affenzeller, N., Möstl, K., 2011. Phylogenetic analysis of
Austrian canine distemper virus strains from clinical samples from dogs and
wild carnivores. Vet. Rec. 168, 377–382, http://dx.doi.org/10.1136/vr.c6404.
Blixenkrone-Møller, M., Svansson, V., Have, P., Orvell, C., Appel, M.J.G., Pedersen, I.R.,
Dietz, H.H., Henriksen, P., 1993. Studies on manifestations of canine distemper
virus infection in an urban dog population. Vet. Microbiol. 37, 163–173.
Bolt, G., Jensen, T.D., Gottschalck, E., Arctander, P., Appel, M.J.G., Buckland, R.,
Blixenkrone-Møller, M., 1997. Genetic diversity of the attachment (H) protein
gene of current field isolates of canine distemper virus. J. Gen. Virol. 78, 367–372.
Calderón, M.G., Remorini, P., Periolo, O., Iglesias, M., Mattion, N., La Torre, J., 2007.
Detection by RT-PCR and genetic characterization of canine distemper virus from
vaccinated and non-vaccinated dogs in Argentina. Vet. Microbiol. 125, 341–349,
http://dx.doi.org/10.1016/j.vetmic.2007.05.020.
Castilho, J.G., Brandão, P.E., Carnieli Jr., P., Oliveira, R.N., Macedo, C.I., Peixoto,
Z.M.P., Carrieri, M.L., Kotait, I., 2007. Molecular analysis of the N gene of canine
distemper virus in dogs in Brazil. Arq. Bras. Med. Vet. Zootec. 59, 654–659,
http://dx.doi.org/10.1590/S0102-09352007000300016.
Del Puerto, H.L., Vasconcelos, A.C., Moro, L., Alves, F., Braz, G.F.,
Martins, A.S., 2010. Canine distemper virus detection in asymp-
tomatic and non vaccinated dogs. Pesq. Vet. Bras. 30, 132–138,
http://dx.doi.org/10.1590/S0100-736X2010000200007.
Demeter, Z., Lakatos, B., Palade, E.A., Kozma, T., Forgach, P., Rusvai, M., 2007. Genetic
diversity of Hungarian canine distemper virus strains. Vet. Microbiol. 122,
258–269, http://dx.doi.org/10.1016/j.vetmic.2007.02.001.
Ek-Kommonen, C., Sihvonen, L., Pekkanen, K., Rikula, U., Nuotio, L., 1997. Outbreak
of canine distemper in vaccinated dogs in Finland. Vet. Rec. 141, 380–383.
Figuera, R.A., Souza, T.M., Silva, M.C., Brum, J.S., Graça, D.L., Kommers, G.D., Irigoyen,
L.F., Barros, C.S.L., 2008. Causas de morte e razões para eutanásia de cães da
Mesorregião do Centro Ocidental Rio-Grandense (1965–2004). Pesq. Vet. Bras.
28, 223–230, http://dx.doi.org/10.1590/S0100-736X2008000400005.
Fischer, C.D.B., Ikuta, N., Canal, C.W., Makiejczuk, A., Allgayer, M.C., Car-
doso, C.H., Lehmann, F.K., Fonseca, A.S.K., Lunge, V.R., 2013. Detec-
tion and differentiation of field and vaccine strains. J. Virol. Methods,
http://dx.doi.org/10.1016/j.jviromet.2013.08.002.
Frisk, A.L., König, M., Moritz, A., Baumgärtner, W., 1999. Detection of canine distem-
per virus nucleoprotein RNA by reverse transcription-PCR using serum, whole
blood, and cerebrospinal fluid from dogs with distemper. J. Clin. Microbiol. 37,
3634–3643.
Gebara, C.M.S., Wosiacki, S.R., Negrão, F.J., Oliveira, D., Beloni, S.N.E.,
Alfieri, A.A., Alfieri, A.F., 2004. Detecção do gene da nucleoproteína
do vírus da cinomose canina por RT-PCR em urina de cães com
sinais clínicos de cinomose. Arq. Bras. Med. Vet. Zootec. 56, 480–487,
http://dx.doi.org/10.1590/S0102-09352004000400009.
Gloyd, J., 1995. Vaccines recalled. J. Am. Vet. Med. Assoc. 207, 1397.
Greene, C.E., Appel, M.J.G., 2006. Canine distemper. In: Greene, C.E. (Ed.), Infectious
Diseases of the Dog and Cat. W. B. Saunders, Philadelphia, pp. 25–41.
Haas, L., Martens, W., Greiser-Wilke, I., Mamaev, L., Butina, T., Maack, D., Barrett, T.,
1997. Analysis of the haemagglutinin gene of current wild-type canine distem-
per virus isolates from Germany. Virus Res. 48, 165–171.
Harder, T.C., Kenter, M., Vos, H., Siebelink, K., Huisman, W., van Amerongen, G.,
Osterhaus, A.D.M.E., 1996. Canine distemper virus from diseased large felids:
biological properties and phylogenetic relationships. J. Gen. Virol. 77, 397–405.
Harder, T.C., Osterhaus, A.D.M.E., 1997. Canine distemper virus – a morbillivirus in
search of new hosts? Trends Microbiol. 5, 120–124.
Hashimoto, M., Une, Y., Mochizuki, M., 2001. Hemagglutinin genotype profiles of
canine distemper virus from domestic dogs in Japan. Arch. Virol. 146, 149–155.
Headley, S.A., Amude, A.M., Alfieri, A.F., Bracarense, A.P.F.R.L., Alfieri, A.A., Sum-
mers, B.A., 2009. Molecular detection of canine distemper virus and the
immunohistochemical characterization of the neurologic lesions in natu-
rally occurring old dog encephalitis. J. Vet. Diagn. Invest. 21, 588–597,
http://dx.doi.org/10.1177/104063870902100502.
Headley, S.A., Amude, A.M., Alfieri, A.F., Alfieri, A.A., Bracarense, A.P.F.R.L., 2012.
Epidemiological features and the neuropathological manifestations of canine
distemper virus-induced infections in Brazil: a review. Semina Ciênc. Agrar. 33,
1945–1978, http://dx.doi.org/10.5433/1679-0359.2012v33n5p1945.
Iwatsuki, K., Tokiyoshi, S., Hirayama, N., Nakamura, K., Ohashi, K., Wakasa, C.,
Mikami, T., Kai, C., 2000. Antigenic differences in the H proteins of canine dis-
temper viruses. Vet. Microbiol. 71, 281–286.
Jin, L., Brown, D.W.G., Ramsay, M.E.B., Rota, P.A., Bellini, W.J., 1997. The diversity of
measles virus in the United Kingdom, 1992–1995. J. Gen. Virol. 78, 1287–1294.
Józwik, A., Frymus, T., 2002. Natural distemper in vaccinated and unvaccinated
dogs in Warsaw. J. Vet. Med. B Infect. Dis. Vet. Public Health 49, 413–414,
http://dx.doi.org/10.1046/j.1439-0450.2002.00549.x.
King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J., 2011. II section – the nega-
tive sense single stranded RNA viruses. In: King, A.M.Q., Adams, M.J., Carstens,
E.B., Lefkowitz, E.J. (Eds.), Virus Taxonomy: Ninth Report of the International
Committee on Taxonomy of Viruses. Academic Press, San Diego, p. 1338.
Lan, N.T., Yamaguchi, R., Inomata, A., Furuya, Y., Uchida, K., Sugano, S., Tateyama,
S., 2006. Comparative analyses of canine distemper viral isolates from clini-
cal cases of canine distemper in vaccinated dogs. Vet. Microbiol. 115, 32–42,
http://dx.doi.org/10.1016/j.vetmic.2006.01.010.
Martella, V., Blixenkrone-Møller, M., Elia, G., Lucente, M.S., Cirone, F., Decaro, N.,
Nielsen, L., Bányai, K., Carmichael, L.E., Buonavoglia, C., 2011. Lights and shades
on an historical vaccine canine distemper virus, the Rockborn strain. Vaccine 29,
1222–1227, http://dx.doi.org/10.1016/j.vaccine.2010.12.001.
Martella, V., Cirone, F., Elia, G., Lorusso, E., Decaro, N., Campolo, M., Desario, C.,
Lucente, M.S., Bellacicco, A.L., Blixenkrone-Møller, M., Carmichael, L.E., Buon-
avoglia, C., 2006. Heterogeneity within the hemagglutinin genes of canine
distemper virus (CDV) strains detected in Italy. Vet. Microbiol. 116, 301–309,
http://dx.doi.org/10.1016/j.vetmic.2006.04.019.
Martella, V., Elia, G., Lucente, M.S., Decaro, N., Lorusso, E., Banyai, K., Blixenkrone-
Møller, M., Lan, N.T., Yamaguchi, R., Cirone, F., Carmichael, L.E., Buonavoglia, C.,
2007. Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR
provides a rapid approach for investigation of CDV outbreaks. Vet. Microbiol.
122, 32–42, http://dx.doi.org/10.1016/j.vetmic.2007.01.005.
McCarthy, A.J., Shaw, M., Goodman, S.J., 2007. Pathogen evolution and
disease emergence in carnivores. Proc. R. Soc. B 274, 3165–3174,
http://dx.doi.org/10.1098/rspb.2007.0884.
Mochizuki, M., Hashimoto, M., Hagiwara, S., Yoshida, Y., Ishiguro, S., 1999. Genotypes
of canine distemper virus determined by analysis of the hemagglutinin genes of
recent isolates from dogs in Japan. J. Clin. Microbiol. 37, 2936–2942.
Negrão, F.J., Gardinali, N.R., Headley, S.A., Alfieri, A.A., Fernandez, M.A., Alfieri,
A.F., 2013. Phylogenetic analyses of the hemagglutinin gene of wild-type
strains of canine distemper virus in southern Brazil. Genet. Mol. Res.,
http://dx.doi.org/10.4238/2013.March.11.2.
Negrão, F.J., Alfieri, A.A., Alfieri, A.F., 2007. Avaliação da urina e de leucócitos como
amostras biológicas para a detecção ante mortem do vírus da cinomose canina
por RT-PCR em cães naturalmente infectados. Arq. Bras. Med. Vet. Zootec. 59,
253–257, http://dx.doi.org/10.1590/S0102-09352007000100042.
Norris, J.M., Krockenberger, M.B., Baird, A.A., Knudsen, G., 2006. Canine dis-
temper: re-emergence of an old enemy. Aust. Vet. J. 84, 362–363,
http://dx.doi.org/10.1111/j.1751-0813.2006.00032.x.
 Author's personal copy
R.d.F. Budaszewski et al. / Virus Research 180 (2014) 76–83
Panzera, Y., Calderón, M.G., Sarute, N., Guasco, S., Cardeillac, A., Bonilla, B., Hernán-
dez, M., Francia, L., Bedó, G., La Torre, J., Pérez, R., 2012. Evidence of two
co-circulating genetic lineages of canine distemper virus in South America. Virus
Res. 163, 401–404, http://dx.doi.org/10.1016/j.virusres.2011.10.008.
Pardo, I.D.R., Johnson, G.C., Kleiboeker, S.B., 2005. Phylogenetic char-
acterization of canine distemper viruses detected in naturally
infected dogs in North America. J. Clin. Microbiol. 43, 5009–5017,
http://dx.doi.org/10.1128/JCM.43.10.5009-5017.2005.
Rima, B.K., 1983. The proteins of morbilliviruses. J. Gen. Virol. 64, 1205–
1219.
Rosa, G.N., Domingues, H.G., Santos, M.M.A.B., Felippe, P.A.N., Spilki, F.R., Arns, C.W.,
2012. Detecção molecular e análise filogenética do gene H de amostras do vírus
da cinomose canina em circulação no município de Campinas. São Paulo. Pesq.
Vet. Bras. 32, 72–77, http://dx.doi.org/10.1590/S0100-736X2012000100012.
Si, W., Zhou, S., Wang, Z., Cui, S., 2010. A multiplex reverse transcription-
nested polymerase chain reaction for detection and differentiation of
wild-type and vaccine strains of canine distemper virus. Virol. J. 7, 86–91,
http://dx.doi.org/10.1186/1743-422X-7-86.
Silva, M.C., Fighera, R.A., Brum, J.S., Graça, D.L., Kommers, D.,
Irigoyen, L.F., 2007. Aspectos clinicopatológicos de 620 casos neu-
rológicos de cinomose em cães. Pesq. Vet. Bras. 27, 215–220,
http://dx.doi.org/10.1590/S0100-736X2007000500006.
Simon-Martínez, J., Ulloa-Arvizu, R., Soriano, V.E., Fajardo, R., 2008. Iden-
tification of a genetic variant of canine distemper virus from clini-
cal cases in two vaccinated dogs in Mexico. Vet. J. 175, 423–426,
http://dx.doi.org/10.1016/j.tvjl.2007.01.015.
83
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:
molecular evolutionary genetics analysis using maximum likelihood, evolution-
ary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739,
http://dx.doi.org/10.1093/molbev/msr121.
Tan, B., Wen, Y.-J., Wang, F.-X., Zhang, S.-Q., Wang, X.-D., Hu, J.-X., Shi, X.-C., Yang, B.-
C., Chen, L.-Z., Cheng, S.-P., Wu, H., 2011. Pathogenesis and phylogenetic analyses
of canine distemper virus strain ZJ7 isolate from domestic dogs in China. Virol.
J. 8, 520, http://dx.doi.org/10.1186/1743-422X-8-520.
Uema, M., Ohashi, K., Wakasa, C., Kai, C., 2005. Phylogenetic and restriction frag-
ment length polymorphism analyses of hemagglutinin (H) protein of canine
distemper virus isolates from domestic dogs in Japan. Virus Res. 109, 59–63,
http://dx.doi.org/10.1016/j.virusres.2004.10.008.
Von Messling, V., Zimmer, G., Herrler, G., Haas, L., Cattaneo, R., 2001. The hemag-
glutinin of canine distemper virus determines tropism and cytopathogenicity. J.
Virol. 75, 6418–6427, http://dx.doi.org/10.1128/JVI.75.14.6418-6427.2001.
Woma, T.Y., van Vuuren, M., Bosman, A.-M., Quan, M., Oosthuizen, M., 2010. Phy-
logenetic analysis of the haemagglutinin gene of current wild-type canine
distemper viruses from South Africa: lineage Africa. Vet. Microbiol. 143,
126–132, http://dx.doi.org/10.1016/j.vetmic.2009.11.013.
Zhang, Y., Xu, S., Wang, H., Zhu, Z., Ji, Y., Liu, C., Zhang, X., Sun, L., Zhou, J., Lu, P.,
Hu, Y., Feng, D., Zhang, Z., Wang, C., Fang, X., Zheng, H., Liu, L., Sun, X., Tang, W.,
Wang, Y., Liu, Y., Gao, H., Tian, H., Ma, J., Gu, S., Wang, S., Feng, Y., Bo, F., Liu,
J., Si, Y., Zhou, S.S., Ma, Y., Wu, S., Li, F., Ding, Z., Yang, Z., Rota, P.A., Feather-
stone, D., Jee, Y., Bellini, W.J., Xu, W., 2012. Single endemic genotype of measles
virus continuously circulating in China for at least 16 years. PLoS ONE 7, e34401,
http://dx.doi.org/10.1371/journal.pone.0034401.