Spirometra Phylo 2021 SM

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/343181748
Sparganosis (Spirometra) in Europe in the molecular era
Article in Clinical Infectious Diseases · March 2021

DOI: 10.1093/cid/ciaa1036
CITATIONS READS
46 4,032
6 authors, including:
Roman Kuchta Marta Kołodziej-Sobocińska

The Czech Academy of Sciences Polish Academy of Sciences
159 PUBLICATIONS 2,839 CITATIONS 63 PUBLICATIONS 910 CITATIONS
SEE PROFILE SEE PROFILE
Jan Brabec Daniel Mlocicki

Biology Centre of the Czech Academy of Sciences Medical University of Warsaw
53 PUBLICATIONS 1,359 CITATIONS 74 PUBLICATIONS 768 CITATIONS
SEE PROFILE SEE PROFILE
All content following this page was uploaded by Roman Kuchta on 02 March 2021.
The user has requested enhancement of the downloaded file.

Clinical Infectious Diseases
REVIEW ARTICLE
Sparganosis (Spirometra) in Europe in the Molecular Era

Roman Kuchta,1, Marta Kołodziej-Sobocińska,2, Jan Brabec,1,3, Daniel Młocicki,4,5, Rusłan Sałamatin,4, and Tomáš Scholz1,
1
Institute of Parasitology, Biology Centre, Czech Academy of Sciences, České Budějovice, Czech Republic, 2Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland, 3Natural
History Museum of Geneva, Geneva, Switzerland, 4Department of General Biology and Parasitology, Medical University of Warsaw, Warsaw, Poland, and 5W. Stefański Institute of Parasitology,
Polish Academy of Sciences, Warsaw, Poland
Sparganosis is a relatively neglected foodborne and waterborne disease caused by species of the tapeworm genus Spirometra, the
global distribution of which has not been sufficiently recognized. Known mainly as a zoonosis of East Asia, its species are native to all
inhabited continents including Europe. Spirometra has been reported from numerous wildlife species from 17 European countries,
Downloaded from https://academic.oup.com/cid/article/72/5/882/5875650 by ESIEE Paris user on 02 March 2021

and a critical review confirmed 17 autochthonous and 8 imported human clinical cases. We present the first molecular evidence of
the coincident presence of 2 species in Europe and review the current distribution to raise awareness of the parasite in this region.
Spirometra erinaceieuropaei is restricted to Europe and Spirometra mansoni represents a lineage distributed mainly across Asia and
Oceania that reaches Europe. The parasite is common in Eastern Europe and its distribution has potential to expand along with its
invasive or migrating mammal hosts, spreading the risks of human infection.
Keywords. Cestoda; emerging infectious disease; epidemiology; zoonosis.
Sparganosis is a zoonosis caused by broad tapeworms of the [3]. Nowadays Spirometra has 64 nominal species, but only 4
genus Spirometra (Cestoda: Diphyllobothriidea); its impor- are considered valid [4]. However, the global species diversity
tance tends to be ignored outside Eastern Asia. More than of Spirometra is undoubtedly much higher than assumed by
2000 human cases have been reported so far, with the majority Kamo [5] and other authors (see, eg, [4]). The incorrect use of
originating from China and Korea [1, 2], but the disease is invalid or superseded species names in recent publications in-
known from other continents too [3], despite the limits of cur- cludes (1) Spirometra decipiens, described from South America
rent knowledge of its distribution. and recently reported in Korea; (2) Spirometra ranarum, orig-
The parasite life cycle involves 3 hosts (Figure 1) and hu- inally described from Europe and recently reported in Korea,
mans become infected by (1) eating or (2) using raw flesh of Myanmar, and Tanzania; and (3) Spirometra theileri, reported in
frogs, snakes, or other tetrapods in traditional poultices; or (3) Tanzania. This has only added to the confusion and prompted a
drinking water containing infected copepods [3]. Accurate spe- major taxonomic revision of the group (Supplementary Data 2)
cies identification allows us to understand the origins and routes [4]. Despite notable attempts to clarify the taxonomy, host spec-
of spread of parasites to new regions [4]. DNA sequencing is ificity, and geographical distribution of Spirometra, it remains
therefore essential for reliable species identification of otherwise one of the most obscure groups of tapeworms (Supplementary
morphologically indistinguishable larval forms of Spirometra. Data 2) [4].
BRIEF HISTORY AND SPECIES COMPOSITION

CLINICAL FEATURES, DIAGNOSIS, AND TREATMENT
The first species of the genus, Spirometra erinaceieuropaei, was OF SPARGANOSIS
described 200 years ago based on plerocercoid larvae collected Sparganosis typically manifests as migrating larvae (spargana),
from European hedgehog at an unknown locality, most prob- and the symptoms depend on their localization in the body.
ably in Brandenburg or former Prussia (Figure 2D). A further The most common is subcutaneous sparganosis, caused by
7 species have been described from European wildlife [4]. The migrating larvae in connective tissues and superficial muscles
first case of human sparganosis was reported in 1882 by Patrick [1, 2]. Subcutaneous sparganosis manifests as local erythema or
Manson from China (Xiamen); larvae were found during au- slowly growing nodules (about 1–2 cm in diameter). They are
topsy of a man and described 1 year later as Ligula mansoni mostly observed under the skin of the limbs or trunk, but also
in the scrotum [1, 3].
Cerebral sparganosis is reported much less frequently [1, 2].
Received 6 April 2020; editorial decision 22 June 2020; published online 23 July 2020.
Correspondence: R. Kuchta, Institute of Parasitology, Biology Centre, Czech Academy of
Larvae migrate to the central nervous system, often to the ce-
Sciences, Branišovská 31, 370 05 České Budějovice, Czech Republic (krtek@paru.cas.cz). rebral hemispheres, but they have been also observed in the
Clinical Infectious Diseases® 2021;72(5):882–90 cerebellum and spinal cord [6, 7]. This form may cause se-
© The Author(s) 2020. Published by Oxford University Press for the Infectious Diseases Society
of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
rious health problems including various neurological symp-
DOI: 10.1093/cid/ciaa1036 toms [3].
882 • cid 2021:72 (1 March) • Kuchta et al

Figure 1. Life cycle of Spirometra erinaceieuropaei.
Ocular sparganosis is rather rare [1, 2]. The larvae may mi- recognized in 18 confirmed reported cases [8] (Figure 3). The
grate to the (sub)conjunctiva or the orbit and cause irritation, causative agent of this form and the factors that contribute to
palpebral edema, pruritus, and lacrimation, with at least 1 case this type of sparganosis remain the greatest enigma.
of blindness and deafness being reported as a consequence [3]. Exceptionally, elephantiasis-like disease and lymph nodes in-
Rarely, intraocular sparganosis may occur. volvement have been described in several cases of proliferative
Exceptionally the larvae may enter internal organs such as sparganosis as well as in experimentally infected monkeys [8].
the breast, abdominal cavity, pleura, or the pericardium, re- In some cases, the larvae may reach maturity in the human
sulting in visceral sparganosis [1, 2]. intestine and induce mild disease recognized as spirometrosis,
The most serious form is proliferative sparganosis caused by which can be easily misidentified as diphyllobothriosis. So far,
the so-called Sparganum proliferum, which nearly always re- only 14 cases have been reported from Asia [3].
sults in generalized, lethal infection. This type is characterized The diagnosis of sparganosis is complicated and requires
by highly invasive continuous proliferation resulting in me- specimens obtained through biopsy. They are uniformly flat,
tastasis and systemic dissemination of the disease. Cutaneous ribbon-like thin white worms varying from a few millimeters
and internal types of proliferative sparganosis were recently to 50 cm in length (Figure 2). The anterior end is flattened
Sparganosis (Spirometra) in Europe • cid 2021:72 (1 March) • 883

Figure 2. Plerocercoids (Sparganum) and adults of Spirometra erinaceieuropaei from Europe. A, B. Plerocercoids obtained from Pelophylax esculentus, Romania, black
arrow indicating position of plerocercoids in host. C, E, F. Plerocercoids obtained from Sus scrofa, Poland. D. Probably type material of S. erinaceieuropaei from Erinaceus
europaeus deposited at Museum für Naturkunde, Berlin (No. ZMB 2246). G–M. Adults obtained from Canis lupus, Poland. G. Scolex. H, K. Gravid proglottids. I, J. Sagittal
section of gravid proglottids. L, M. Eggs.
and possesses a cleft-like invagination without suckers. tumor, glioma, metastatic tumors, or cauda equina syndrome
The gross morphology of spargana differ from other tape- of the spinal cord [10, 11].
worm larvae, except Mesocestoides larva, by the absence of Although imaging is an important diagnostic tool for
a bladder, hooked scolex, suckers (present in tetrathyridia of sparganosis, it is not specific and therefore cannot provide an
Mesocestoides), and the presence of a solid body without a unequivocal diagnosis. Neuroimaging, in combination with bi-
primary lacuna. The larva is mostly enclosed within a gliotic opsy or serological testing (see below), can provide a presump-
wall and surrounded by inflammatory exudates [9]; however, tive diagnosis. Magnetic resonance imaging (MRI) is more
the form causing proliferative sparganosis is characterized specific than computed tomography for sparganosis but cannot
by branches and buds. The cerebral form commonly resem- show pathognomonic symptoms because lesions are typically
bles tumor-like structures, dysembryoplastic neuroepithelial hypointense or hyperintense, with variable enhancement.

Figure 3. Maximum likelihood estimate of the interrelationships of the genus Spirometra based on cytochrome c oxidase subunit I (COI) gene data. The branch length
scale bar indicates number of substitutions per site; also note that the length of 2 nodes of the Spirometra decipiens complex 2 was reduced by a factor of 2. Colors high-
light specimens from different continents; samples in bold indicate new sequences. Types of sparganosis are specified for human cases (SUBCUTAN indicates subcutaneous
sparganosis). Data are summarized from references in Supplementary Data.
Interestingly, migration has also been reported within the brain sparganosis but is also crucial from the epidemiological point
or to the spinal cord via the cerebrospinal fluid, and a sign of of view.
tunnel highlighting the migrating path of the moving worm Although praziquantel has limited success in treating of pe-
has been observed in several cases. Brain MRI scans indicate a ripheral sparganosis [14], it does not affect larvae in the cerebral
signal change in the right frontotemporal lobe, suggesting that or visceral infections, which respond better to surgical excision
a parasite had migrated through the ventricular systems [12]. [7]. However, while most sparganum infections respond well to
Serological tests are a valuable complement to diagnosis of medical or surgical therapy, such approaches are ineffective in
sparganosis but can cross-react with other cestodes common treating proliferative sparganosis due to the wide dissemination
in sparganosis-endemic regions [9]. Of the available serological of larvae throughout the body. In such cases, praziquantel may
tests, enzyme-linked immunosorbent assay has 100% sensitivity be effective at high doses [8]. The prevention of recurrence de-
and 97% specificity in subjects with potentially cross-reacting pends on total surgical removal of the parasite, but incomplete
parasitic coinfections [13]. removal cannot prevent its regeneration [7].
Accurate species identification can be achieved only with
the use of molecular approaches currently based on the DNA MOLECULAR DATA AND PHYLOGENY: NEW
sequencing of the complete mitochondrial cytochrome c ox- CONCEPT OF SPECIES IN THE GENUS
idase subunit I (COI) gene. As with other tapeworms (eg, Waeschenbach et al [15] presented a molecular phylogenetic
Echinococcus, Mesocestoides, Taenia), correct species identifi- hypothesis of the interrelationships of diphyllobothriidean
cation is expected to contribute to more effective treatment of tapeworms, supporting Spirometra as a valid genus that forms

one of the earliest diverging and thus, in evolutionary terms, the encompassing the vast majority of specimens from Asia.
oldest lineage of human parasites of Diphyllobothriidea [15]. Despite the obvious necessity to gather a larger sample of spe-
In February 2020, the GenBank sequence repository con- cimens from around Europe to understand the distribution
tained 490 837 sequence entries corresponding to Spirometra, of better, the current phylogenetic evidence based on COI data
which 785 represented COI gene sequences. The majority of the already strongly contradicts the previous assumption of the
rest were reads gathered under a high-throughput sequencing cosmopolitan distribution of S. erinaceieuropaei [4].
project on S. erinaceieuropaei by Bennett et al [16]. Nearly all From our point of view, the accuracy of assigning species iden-
sequences deposited in GenBank are named S. erinaceieuropaei tity to the sources of most of the sequence data in repositories
(or misnamed as Spirometra erinacei) (490 768 records; 751 of is problematic and requires further attention and, likely, correc-
COI), and 32 cases are designated only as Spirometra species. tion (Supplementary Data 2). The current phylogenetic analysis
In addition, most available sequence data correspond to spe- indicates there are at least 6 distinct, molecularly well-defined
cimens from China (around 85% of COI sequences [n = 642]), lineages corresponding to separate species (Supplementary Data

contrasting with the very few sequences of specimens collected 2) with a clear geographical pattern behind them (Figure 3).
outside Asia. Recently, Kołodziej-Sobocińska et al [17] pub- Most of the available data from Asia (excluding a few specimens
lished the first sequences of European origin. from Korea and Japan that form a separate lineage, which might
We characterized novel sequence data of specimens col- represent a new species of Spirometra), Australia, Romania,
lected from wildlife in several European countries and and a single sequence from Tanzania form a monophyletic lin-
analyzed those phylogenetically in the context of all avail- eage that corresponds to S. mansoni (Figure 3; Supplementary
able sequence data from around the globe (see Table 1 and Data 2). The majority of the European specimens form an in-
Supplementary Data 1). The topology of the best-scoring dependent lineage conspecific with S. erinaceieuropaei de-
phylogenetic tree (Figure 3) depicts the results based on a scribed from Europe. The remaining specimens from Africa
full-length dataset of the COI gene. Contrary to expecta- (Sudan, Ethiopia, and Tanzania) form a lineage likely to corre-
tions, European specimens do not share a common origin spond to Spirometra folium (Supplementary Data 2). Two addi-
but form two independent lineages. Specimens from Finland, tional lineages are formed by specimens from North and South
Poland, and Ukraine (Table 1) formed a well-defined, distinct America, and both lineages display relatively high levels of in-
European lineage of S. erinaceieuropaei, whereas specimens ternal genetic divergence. One lineage includes the enigmatic
from Romania clustered within a clade of S. mansoni, the S. proliferum and one of these lineages is likely conspecific with
latter being the most densely sequenced lineage of Spirometra S. decipiens. However, since it is impossible to decide which of
these two lineages is the genuine S. decipiens based on the cur-
rent, mostly fragmentary, sequence data, we opted to use the
Table 1. Newly Obtained Material Sequenced in This Study (Cytochrome c
Oxidase Subunit I Gene) temporary terms Spirometra decipiens complex 1 and 2.
The following patterns for the systematics of the genus
GenBank Spirometra can be inferred from the phylogenetic analysis pre-
Accession
Host/Stagea State (Locality; Year; Code) No.
sented in Figure 3:
Austrelaps superbus/P Australia (Cottles Bridge, Victoria; MT131821
2003; AU15) 1. The species-level lineages follow a strong geographical pat-
Canis lupus/A Poland (Białowieża Forest; 2013; MT131828 tern, that is, species from different continents/geographical
POL11)
regions form molecularly well-defined lineages.
Canis lupus/A Ukraine (Chernobyl; 2013; POL25) MT131830
2. Spirometra erinaceieuropaei does not show a cosmopolitan
Coluber constrictor/P United States (Mississippi; 2012; MT131831
USR1) distribution, implying that all Asian and Australian sam-
Lynx lynx/A Finland (Kallasti; 2008; FIN134) MT131825 ples were misidentified and in fact belong to at least 2 dif-
Lynx rufus/A United States (Illinois; 2012; US401) MT131820 ferent species (mostly to S. mansoni resurrected here) and
Lutra lutra/P Poland (Białowieża Forest; 4. ix. MT131827
2013; POL9)
not to S. erinaceieuropaei, which seems to be restricted to
Meles meles/P Poland (Białowieża Forest; 19. iv. MT131829 Europe.
2013; POL6) 3. The existence of a second, relatively rarely sequenced (in
Nyctereutes procyonoides/P Poland (Białowieża Forest; 2013; MT131826 comparison to S. mansoni in Asia) species-level lineage, re-
POL8)
Pelophylax esculentus/P Romania (Danube delta; ix. 2019; MT131822
ported as “S. erinaceieuropaei” by Jeon et al [18].
ROF2) 4. The existence of at least two distinct lineages in the Americas;
Pelophylax esculentus/P Romania (Danube delta; ix. 2019; MT131823 one of them probably corresponds to S. decipiens described
ROF7)
from Brazil and the other probably to Spirometra mansonoides
Pelophylax ridibundus/P Romania (Danube delta; ix. 2019; MT131824
ROF80) described from the United States; one of the lineages includes
a
A, adult; P, plerocercoid. the enigmatic S. proliferum.

5. Erroneous identification of Korean specimens as subcutaneous case was reported from Poland (Białowieża Forest
“S. decipiens,” originally described in Brazil; and erro- region) in 2019 [19]. Another two cases of subcutaneous and ce-
neous identification of specimens from Korea, Myanmar, rebral sparganosis imported from Europe (Greece) were reported
and Tanzania as “S. ranarum,” originally described in Italy in Canada [20] and in the United States [21].
(Supplementary Data 2); both are in fact conspecific with the In total, 8 cases imported to Europe were reported between 1995
main Asian lineage of S. mansoni. and 2018 (Table 2), comprising 3 cases of cerebral sparganosis
diagnosed in Switzerland, Spain, and the United Kingdom, plus 4
subcutaneous and one ocular case. However, only 4 reports also
HUMAN CASES REPORTED FROM EUROPE
confirmed pathogen identity by molecular methods (Figure 3). The
Sparganosis is an uncommon and neglected zoonosis in Europe, identity of one case imported from South America (Bolivia, Brazil,
but its presence in wildlife implies a potential risk for human or Paraguay) was confirmed molecularly and showed greater se-
health. The most recent review on sparganosis cited 18 European quence similarity to S. proliferum than to one of the Asian lineages

human cases, of which 11 were autochthonous [19]. A detailed of Spirometra (Figure 3). In this case, a single worm was removed
literature search revealed at least 17 autochthonous cases from from the right side of the chest and no additional relapse was later
the Czech Republic, France, Italy, Poland, and the former Soviet reported (Table 2). A case of presumptive cerebral sparganosis im-
Union (Belarus, Russia, or Ukraine) (Table 2; Figure 4). The first ported from Malawi and diagnosed in Germany was in fact an in-
reported case briefly described proliferative sparganosis in brain fection with a cyclophyllidean cestode larva [27].
tissue, obtained by autopsy of a Polish refugee in Prague (Czech
Republic) studied by Professor H. Šikl probably around World DISTRIBUTION AND HOST SPECTRUM OF
War II (Table 2). Unfortunately, nothing more is known about SPIROMETRA IN EUROPE
this unique case. Most autochthonous cases of sparganosis in Spirometra has been reported from 17 European countries,
Europe have been subcutaneous (n = 12); two were ocular and with most observations from Belarus, Bulgaria, and Poland
3 represented serious cerebral forms (Table 2). The most recent
Table 2. List of Cases of Sparganosis in Europe
Year Country Sex/Age Sparganosis Reference
Autochthonous cases
1950a Poland to Czech Republic M/? Proliferative cerebral [22]
1953 Italy F/40 Subcutaneous [19]
1953a Czech Republic M/? Subcutaneous [23]
1958 Russia (or Belarus) F/33 Subcutaneous [24]
1964 Italy M/30 Subcutaneous [19]
1967 Ukraine (or Belarus) M/64 Subcutaneous [25]
1969 Greece (in Canada) F/23 Subcutaneous [20]
1976 Italy M/28 Cerebral [19]
1982 Greece (in United States) F/27 Cerebral [21]
1997 France M/21 Subcutaneous [19]
1999 France M/14 Ocular [19]
2006 Czech Republic M/14 Ocular [19]
2018 Poland F/60 Subcutaneous [19]
Imported cases
1995 Vietnam to Czech Republic M/29 Subcutaneous [19]
2003 Sri Lanka to France M/17 Ocular [19]
2008 Bangladesh to Switzerland M/39 Cerebral [19]
2013 Japan to Germany F/68 Subcutaneous [19]
2014 South America to Germany M/61 Subcutaneous [19]
2014 China to United Kingdom M/50 Cerebral [19]
2015 Bolivia to Spain M/29 Cerebral [19]
2018 Thailand to Switzerland F/55 Subcutaneous [26]
Abbreviations: F, female; M, male.
a
Year of the case is unknown.

Figure 4. Distribution of Spirometra species and sparganosis in Europe. Indicating the host group and human cases
(Figure 4; Supplementary Data 3). Sparganosis has been also re- Adult Tapeworms in Definitive Hosts
corded in neighboring Asian regions. Six species of carnivores have been confirmed as natural defin-
We confirmed the presence of S. erinaceieuropaei and itive hosts in Europe (Supplementary Data 4). The most com-
S. mansoni in Europe (Figure 3; Supplementary Data 2). monly reported host in Europe is the Eurasian lynx followed
Although S. erinaceieuropaei has been confirmed in Eastern by domestic cat, red fox, wolf, and golden jackal, as well as an
Europe (Poland, Ukraine) and Scandinavia (Finland), speci- invasive raccoon dog that could, in theory, introduce Asian
mens from the Balkan Peninsula region (Romania) show con- S. mansoni (Supplementary Data 4).
specificity with S. mansoni. Unfortunately, there are no data from
other parts of Europe. The distribution of S. erinaceieuropaei Plerocercoids in Secondary Intermediate Hosts
and S. mansoni may overlap (sympatric distribution) in the So far, 38 species of amphibians (frogs), reptiles (snakes), one
Middle East and South-East Europe. bird, and several mammals serve as secondary intermediate
The current occurrence of Spirometra in Germany hosts in Europe (Supplementary Data 4). The most commonly
awaits confirmation. Except for the original descriptions of reported intermediate host is the grass snake, followed by wild
S. erinaceieuropaei and Spirometra felis, only a single case of boar, raccoon dog, and mustelids (Supplementary Data 4).
proliferative sparganosis has been reported in Germany, in a The parasite may, in theory, spread throughout Europe with
dog (Figure 4) [28]. its invasive mammalian hosts including raccoons, American

mink, or raccoon dog, which can serve as final, intermediate, or Supplementary Data
paratenic hosts [17, 29]. Supplementary materials are available at Clinical Infectious Diseases online.
Consisting of data provided by the authors to benefit the reader, the posted
materials are not copyedited and are the sole responsibility of the authors, so
questions or comments should be addressed to the corresponding author.
RISK OF SPARGANOSIS IN EUROPE
Although the traditional eating habits of Europeans in general Notes

seem incompatible with a high risk of infection, recently re- Acknowledgments. The valuable comments of anonymous reviewers
ported cases (Table 2) indicate that it is possible. Most cases of are appreciated. Thanks are also due to A. Jones and P. Wightman (United
Kingdom) for language corrections of the manuscript; to I. Beveridge
human foodborne sparganosis in Asia have been associated with (Australia), F. A. Jimenez-Ruiz (United States), A. Lavikainen (Finland),
the consumption of undercooked meat of snakes or frogs [1]. and Y. Yakovlev (Ukraine) for the collection of valuable material; to M. Luo
A higher risk of infection is associated with traditional food for preparation of Figure 1 and to B. Neuhaus (Germany) for providing
Figure 2D.
in exotic countries, where prevalence can be much higher [1].
Financial support. This work was supported by the Czech Science

The prevalence of spargana in snakes of Southeast Asia is usu- Foundation (project number 19-28399X); the Institute of Parasitology,
ally much higher than in frogs and their consumption without Biology Centre of the Czech Academy of Sciences (RVO: 60077344); and the
adequate cooking carries a high risk [30]. The greatest risk National Science Center, Poland (project number 2016/21/B/NZ8/02429).
Potential conflicts of interest. The authors: No reported conflicts of
for Europeans may be the consumption of infected wild boar interest. All authors have submitted the ICMJE Form for Disclosure of
meat [31]. Spargana have been found in wild boars in Hungary, Potential Conflicts of Interest.
Poland, Serbia, and Ukraine (Supplementary Data 3). To elimi-
nate pathogen transmission, meat should be frozen at −12°C for References
1. Liu Q, Li MW, Wang ZD, Zhao GH, Zhu XQ. Human sparganosis, a neglected
at least 5 days or thoroughly cooked [3]. food borne zoonosis. Lancet Infect Dis 2015; 15:1226–35.
2. Kim JG, Ahn CS, Sohn WM, Nawa Y, Kong Y. Human sparganosis in Korea. J
CONCLUSIONS Korean Med Sci 2018; 33:e273.
3. Kuchta R, Scholz T, Brabec J, Narduzzi-Wicht B. Chapter 17. Diphyllobothrium,
The assignment of species identity to the causative agents of Diplogonoporus and Spirometra. In: Xiao L, Ryan U, Feng F eds. Biology of
foodborne parasites. Section III: important foodborne helminths. Boca Raton,
sparganosis has been problematic or completely ignored by FL: CRC Press, 2015: 299–326.
previous surveys. Here, we describe 6 molecularly well-defined 4. Scholz T, Kuchta R, Brabec J. Broad tapeworms (Diphyllobothriidae), parasites
of wildlife and humans: recent progress and future challenges. Int J Parasitol
lineages/species of Spirometra, 3 of them capable of causing Parasites Wildl 2019; 9:359–69.
human sparganosis. The following two sympatric species 5. Kamo H. Guide to identification of diphyllobothriid cestodes. Tokyo, Japan:
Gendaikikaku, 1999 (in Japanese).
have been found in Europe for the first time: a more common 6. Zhu Y, Ye L, Ding X, Wu J, Chen Y. Cerebral sparganosis presenting with atypical
S. erinaceieuropaei, probably restricted to Europe, but con- postcontrast magnetic resonance imaging findings: a case report and literature
review. BMC Infect Dis 2019; 19:748.
firmed only in wildlife so far; and S. mansoni, a common caus- 7. Kim DG, Paek SH, Chang KH, et al. Cerebral sparganosis: clinical manifestations,
ative agent of sparganosis in Asia and Oceania. Molecular data treatment, and outcome. J Neurosurg 1996; 85:1066–71.
are currently essential for precise determination of a pathogen’s 8. Kikuchi T, Maruyama H. Human proliferative sparganosis update. Parasitol Int
2020; 75:102036.
identity, allowing an understanding of the spectrum of its nat- 9. Rengarajan S, Nanjegowda N, Bhat D, Mahadevan A, Sampath S, Krishna S.
ural hosts and, consequently, the epidemiology. While it is Cerebral sparganosis: a diagnostic challenge. Br J Neurosurg 2008; 22:784–6.
10. Lo Presti A, Aguirre DT, De Andrés P, Daoud L, Fortes J, Muñiz J. Cerebral
known that several species of Spirometra can infect humans, sparganosis: case report and review of the European cases. Acta Neurochir
the importance of different species in the etiology and variable (Wien) 2015; 157:1339–43.
11. Nkwerem S, Goto T, Ogiwara T, Yamamoto Y, Hongo K, Ohaegbulam S.
pathology of sparganosis remains completely unknown thanks Ultrasound-assisted neuronavigation-guided removal of a live worm in cerebral
to the lack of initiative and limited opportunities to carry out sparganosis. World Neurosurg 2017; 102:696.e13–16.
12. Jang SY, Kim CH. Migration of sparganosis from the brain to the cervical spinal
accurate pathogen identification using molecular data and
cord. J Korean Neurosurg Soc 2012; 51:170–2.
phylogenetic tools. The etiology of tissue helminthoses in ge- 13. Nishiyama T, Ide T, Himes SR Jr, Ishizaka S, Araki T. Immunodiagnosis of human
neral would benefit if parasite tissues from clinical cases were sparganosis mansoni by micro-chemiluminescence enzyme-linked immuno-
sorbent assay. Trans R Soc Trop Med Hyg 1994; 88:663–5.
to be routinely preserved in absolute ethanol and if collabora- 14. Deng L, Xiong P, Qian S. Diagnosis and stereotactic aspiration treatment of cere-
tion between clinicians and taxonomists/parasitologists were to bral sparganosis: summary of 11 cases. J Neurosurg 2011; 114:1421–5.
15. Waeschenbach A, Brabec J, Scholz T, Littlewood DTJ, Kuchta R. The catholic taste
be increased. An improved general awareness of this zoonosis of broad tapeworms—multiple routes to human infection. Int J Parasitol 2017;
among clinicians, its presence in the natural environments in 47:831‒43.
16. Bennett HM, Mok HP, Gkrania-Klotsas E, et al. The genome of the sparganosis
Europe, and recognition of the potential for transmission to hu- tapeworm Spirometra erinaceieuropaei isolated from the biopsy of a migrating
mans will, in our opinion, help avoid future misdiagnoses, may brain lesion. Genome Biol 2014; 15:510.
17. Kołodziej-Sobocińska M, Stojak J, Kondzior E, Ruczyńska I, Wójcik JM. Genetic
enhance treatment, and would improve estimation of the actual
diversity of two mitochondrial DNA genes in Spirometra erinaceieuropaei
number of human cases. (Cestoda: Diphyllobothridae) from Poland. J Zool Syst Evol Res 2019; 57:764–77.

18. Jeon HK, Park H, Lee D, et al. Human infections with Spirometra decipiens 26. Muigg V, Ruf MT, Schwarzkopf S, et al. Case report: human subcuta-
plerocercoids identified by morphologic and genetic analyses in Korea. Korean J neous sparganosis in a Thai migrant. Am J Trop Med Hyg 2019; 101:
Parasitol 2015; 53:299–305. 1170–3.
19. Czyżewska J, Namiot A, Koziołkiewicz K, Matowicka-Karna J, Dzięcioł J, 27. Walker P, Cooper NK, Brandis A. Cerebral sparganosis presenting as grand mal
Kemona H. The first case of human sparganosis in Poland and a review of the epilepsy. J R Army Med Corps 2007; 153:189–90.
cases in Europe. Parasitol Int 2019; 70:89–91. 28. Stief B, Enge A. Proliferative peritonitis with larval and cystic parasitic stages in a
20. Ali-Khan Z, Irving RT, Wignall N, Bowmer EJ. Imported sparganosis in Canada. dog. Vet Pathol 2011; 48:911–4.
Can Med Assoc J 1973; 108:590–1. 29. Sutor A, Schwarz S, Conraths FJ. The biological potential of the raccoon dog
21. Anders K, Foley K, Stern E, Brown WJ. Intracranial sparganosis: an uncommon (Nyctereutes procyonoides, Gray 1834) as an invasive species in Europe-new risks
infection. Case report. J Neurosurg 1984; 60:1282–6. for disease spread? Acta Theriol (Warsz) 2014; 59:49–59.
22. Craig CF, Faust EC. Clinical parasitology. 5th ed. Philadelphia: Lea & Febiger, 1951. 30. Wang FM, Li WY, Gong SP, et al. Spirometra erinaceieuropaei severely infect frogs
23. Jíra J. Medical helminthology. Prague: Galén, Czech Republic, 1998. and snakes from food markets in Guangdong, China: implications a highly risk
24. Sokolova LN, Yaroschuk IN. The case of human sparganosis in the USSR. Med for zoonotic sparganosis. Trop Biomed 2018; 35:408–12.
Parazitol Parazit Bolezni 1961; 1961:106–7 (in Russian). 31. Kołodziej-Sobocińska M, Miniuk M, Ruczyńska I, Tokarska M. Sparganosis in
25. Berdonosova TI, Miretskyia OY, Skryabin AS. A case of human sparganosis in the wild boar (Sus scrofa)—implications for veterinarians, hunters, and consumers.
USSR. Med Parazitol Parazit Bolezni 1968; 37:739–41 (in Russian). Vet Parasitol 2016; 227:115–7.

Supplementary Data
The information summarised in the Supplementary files is based on a critical review of the
literature since 1819 as well as examination of extensive material of Spirometra tapeworms
newly collected by numerous collaborators or deposited in helminthological collections
throughout the world, especially in Europe and Russia.
Supplementary Data 1. Molecular phylogenetic methods used.

Gravid segments from adult worms or small pieces of plerocercoids preserved in 96% ethanol
(Table 2) were used to extract DNA using the DNeasy Blood and Tissue Kit (Qiagen)
following the manufacturer’s protocol. The complete sequence of the cox1 gene (1,566 bp)
was amplified by PCR using the primers Cox1Forward
(TATCAAATTAAGTTAAGTAGACTA) and Cox1Reverse
(CCAAATAGCATGATGCAAAAG) designed by Wicht et al. (2010). Both primers align
outside the coding region of the cox1 and amplify a ~1,800 bp fragment of the mitochondrial
genome. Phusion High-Fidelity DNA Polymerase (New England Biolabs, Inc.) and the
following cycling conditions were used to amplify this fragment: 30 cycles of 10 s at 98 °C,
15 s at 53 °C, 50 s at 72 °C. PCR products were gel-checked, purified with Exonuclease I and
FastAP alkaline phosphatase enzymes (Thermo Fisher Scientific) and Sanger-sequenced at
SeqMe (Czech Republic). Contiguous gene sequences were assembled and inspected for
errors in Geneious 7.1.9 (http://www.geneious.com, Kearse et al. 2012) and deposited in
GenBank. cox1 alignment was built using the G-INS-i algorithm of the program MAFFT
(Katoh and Standley 2013) implemented in Geneious. Uncharacterised parts of the partial
sequences downloaded from GenBank were encoded as missing data. The maximum
likelihood phylogenetic tree was estimated under the best-scoring TPM2u+F+I+G4 model
selected by ModelFinder (Kalyaanamoorthy et al. 2017) according to the corrected Akaike
information criterion in the program IQ-TREE (Nguyen et al. 2015). Nodal supports were
estimated running standard nonparametric bootstrap resamples (1,000 repetitions).
Supplementary Data 2. Comments on the systematics of Spirometra.

High intraspecific or even individual morphological variability of Spirometra tapeworms
on one hand, and general uniformity of adults of most taxa of diphyllobothriidean tapeworms
on the other hand, have led to considerable confusion in the delineation of individual species
and the erection of new taxa often synonymous with previously described ones (see Kuchta
and Scholz 2017, Waeschenbach et al. 2017). Similar problems have affected classification
and nomenclature of Spirometra tapeworms, which has resulted in the existence of a large
number of synonyms for etiologic agents of sparganosis in different parts of the world. In
many cases, new species have been insufficiently described based on limited and/or badly
fixed specimens, making it almost impossible to distinguish intraspecific morphological and
morphometric variation from interspecific differences (Iwata 1934, 1972, Kuchta and Scholz
2017). Taxonomic problems have also arisen because most authors have failed to consider the
possibility of host-induced intraspecific morphological variation that may be associated with
host size, age, geographic origin, etc.
Numerous authors have tried to resolve the systematics of the genus using morphological
characters, but mostly without considering the high degree of morphological variation and
1
phenotypic plasticity of most taxa. For example, Faust et al. (1929) and Wardle et al. (1974)
based their descriptions of taxa on variable morphological characters studied on only a few
selected proglottids, without considering intraspecific variation. Distinguishing
characteristics, such as the length and width of the strobila, shape of the proglottids, number
and form of the uterine coils, shape of the ovary, shape and distribution of the testes and
vitelline follicles, and the size of the testes, but also the host spectrum, are highly variable
between different individuals of Spirometra obtained from the same host species or even the
same host individual. They may even vary within the strobila of a single specimen as
evidenced by detailed experiments by Iwata (1934, 1972). As a result, morphologically
different proglottids of the same individual may correspond to several ‘species’ as described
by Faust et al. (1929). Unfortunately, even some recent researchers ignore this intraspecific
variation and do not consider the geographical origin of individual samples as a key
discriminatory character and assume erroneously that most species of the genus are
distributed globally. The present molecular phylogenetic study rejects this assumption (Figure
4).
Previous authors also gave too much emphasis to the species of the definitive host,
whereas previous experimental studies (e.g., Iwata 1934, 1972) as well as current molecular
data (present study) provide convincing evidence that host specificity of species of
Spirometra at the level of the definitive host is not as strict as assumed. In fact, taxonomy of
the genus was in “blind alley” before the advent of molecular taxonomy and phylogenetics.
Therefore, previous researchers could not know that isolates from different continents most
likely belong to different species, even though they are morphologically indistinguishable. For
example, Faust et al. (1929) used the names of taxa, originally described from different
continents outside Asia, for samples obtained in China, which caused confusion in the
literature. This erroneous species concept, which is not supported by the present molecular
data, is still followed by some researchers, especially in East Asia.
Another important factor that may significantly affect morphology of samples is their
fixation. Iwata (1934, 1972) fixed pieces of the same worm by different methods and
demonstrated that fixation causes substantial changes in the shape and position of structures
that were used by previous authors to differentiate individual species. To get comparable
samples suitable for light microscopical, histological and SEM observations, heat-fixation is
strongly recommended (hot 4% formalin or hot water followed by transfer to alcohol or
formalin) for morphological work, provided a tissue sample is in parallel fixed in 96–99%
molecular-grade ethanol for DNA sequencing (see Kuchta and Scholz 2017). Fixation by
AFA (alcohol-formalin-acetic acid) is not recommended. The traditional practice of relaxing
diphyllobothriidean tapeworms in saline or even in water, or fixing them under strong
pressure, must be avoided because these methods cause artificial changes in morphology (see
Kuchta and Scholz 2017). Unfortunately, helminths of mammals are usually recovered from
dead or frozen hosts, which make specimens useless for reliable morphological study;
however, molecular data can be generated from these samples.
Iwata (1934, 1972), who carried out the most comprehensive experimental infections and
morphological observations of properly-processed samples, synonymised all species of
Spirometra with S. erinaceieuropaei. Some subsequent authors accepted this taxonomic
proposal which, however, represents the other extreme in classification (64 nominal species
versus one valid). Later revisions recognised four species as valid, considering the type-
species S. erinaceieuropaei to have a worldwide distribution (Daly 1981; Stephanson 1985;
Kamo 1999; Scholz et al. 2019).
However, molecular data indicate that the number of valid species of Spirometra is higher
than assumed previously and at least six separate lineages characterised by distinct
geographical distribution can be recognised (Figure 4). This result provides a robust baseline
2
for future taxonomic studies, which should always combine molecular data with
morphological evaluation of properly processed samples from definitive hosts when existing
species are redescribed or new taxa are proposed.
Morphological characters and their limitations in species identification of Spirometra

and other diphyllobothriideans
Length of worms and ratio of proglottids. The length of worms depends on their degree of
contraction or/ relaxation. Consequently, the proportion of the length and breadth of
proglottids varies considerably according to fixation.
Extent of genital organs. In longer proglottids, the testes and vitelline follicles may extend
across the anterior margin of one proglottid into the anterior one to cover the posterior part of
the uterus. In contrast, the fields of the testes and vitelline follicles are not continuous between
proglottids and do not overlap the uterus of the anterior proglottid in shorter and wider
proglottids, especially contracted ones.
Number of uterine coils. Uterine coils are fewer in the more anterior, broad mature
proglottids, but their number increases in more posterior, usually longer proglottids.
Presumably, the increase in the number of coils reflects the accumulation of more and more
eggs in the uterus as the proglottids become fully gravid. Iwata (1972) reported that in fully-
grown S. erinacei (= S. mansoni) without the posterior-most proglottids, each gravid
proglottid has 3–5 uterine coils, whereas younger (more anterior) proglottids possess only 1 or
2 coils.
Shape of the ovary. The form of the ovary is highly variable, depending mainly on the
shape of the proglottids (more elongate in longer proglottids, shorter in wider proglottids), but
also on the position in the strobila (less developed proglottids have a shorter and broader
ovary, which becomes more elongate and narrower in proglottids towards the posterior end of
the strobila).
Testes and vitelline follicles. The shape of these structures is variable and depends on the
shape and state of contraction of proglottids. The number of the testes is of limited taxonomic
value mainly because is usually extremely high (usually hundreds per proglottid) and thus
accurate counts are almost impossible to obtain (see Maltsev and Gavrilova 1994; Hernández-
Orts et al. 2015; Kuchta and Scholz 2017).
Cirrus sac. The shape of the cirrus sac changes with the extension and contraction of
proglottids, being oval in extended proglottids to highly compressed in contracted proglottids.
In contrast, the length of the cirrus sac and external seminal vesicle measured in sagittal
sections or observed in whole mounts (i.e., in ventral frontal view), appear to be relatively
invariable within a species and thus may serve as useful diagnostic features (Hernández-Orts
et al. 2015, Kuchta and Scholz 2017).
Eggs. The size of the eggs is variable and may overlap between individual species.
Moreover, eggs from permanent preparations (whole mounts) should not be measured
because they are usually deformed (collapsed due to dehydration). Nevertheless, the
morphology and the size of the eggs can have some taxonomic value in diphyllobothriidean
taxa (Maltsev and Gavrilova, 1994; Leštinová et al., 2016).
Spirometra species reported in the recent literature and their validity as demonstrated
by the present study
• Spirometra erinaceieuropaei (Rudolphi, 1819) – valid (type species); European lineage

This is the oldest available species name in the genus, which has been accepted by most
authors. Its description was based on larvae from European hedgehog (Erinaceus europaeus)
from an unknown locality in Europe, most probably from former Prussia (northern part of
3
present Germany, Poland or Baltic countries). Therefore, the Poland-Ukraine-Finland lineage
is considered to be S. erinaceieuropaei. Molecular data show that this species occurs in
Europe only. However, its name has been recently used incorrectly for samples of Spirometra
from Korea and Japan, which are distinct from those of the most common Asian species S.
mansoni (see below) (e.g., Jeon et al. 2015). We consider these isolates from Korea and Japan
to represent a new undescribed species, which is referred to as Spirometra sp. 1 in Figure 4.
• Spirometra decipiens (Diesing, 1850) – valid; one of South and/or North American
lineages
This is the first species described from the New World (Brazil) from several hosts; the first
host listed by Diesing (1850) was jaguar (Panthera once), which is considered as the type-
host. The type material of S. decipiens was studied by the present authors, but sequences of
samples of two distinct lineages from South America cannot be linked with this species
unequivocally. Therefore, both American lineages, which represent two separate species, are
considered to belong to the S. decipiens species complex. The name S. decipiens has been
erroneously used for Asian samples of S. mansoni (see below and Figure 4). Molecular data
provide unequivocal evidence that these samples named as S. decipiens cannot be conspecific
with either of the two American lineages of the S. decipiens species complex (Figure 4).
• Spirometra folium (Diesing, 1850) – valid; African lineage

It is the first species described from Africa, based on adult tapeworms from white-tailed
mongoose (Ichneumia albicauda) in the Sudan (Diesing, 1850). Unfortunately, the type
material of S. folium, which was studied by the present authors, is in poor condition and does
not enable morphological differentiation of the species from other African taxa. However,
sequences of several isolates of Spirometra sp. larvae from human provided by Eberhardt et
al. (2015) have the same geographical origin (Sudan) and thus we consider them conspecific.
Spirometra folium has not been found since its original description, but several other species
have been described from Africa (see Scholz and Kuchta 2019). However, only S. theileri
(Baer, 1924) and S. pretoriensis (Baer, 1924), both described from South Africa by Baer
(1924), have been commonly reported in the literature. They have been accepted as valid by
Kamo (1999) and Kuchta and Scholz (2017). Unfortunately, the type material of both species,
also studied by the present authors, is in poor condition and useless for morphological study.
Recently, Eom et al. (2019) reported sequences of S. theileri from leopard (Panthera pardus)
and spotted hyena (Crocuta crocuta) in Tanzania, based on two incomplete worms. These
sequences form the closest known relative and a sister lineage to the sequences by Eberhardt
et al. (2015). Eom et al. (2018) reported S. ranarum, the European species of uncertain
taxonomic status (considered invalid by most authors), from lion (Panthera leo) in Tanzania.
Interestingly, this isolate is genetically indistinguishable from samples of S. mansoni, which
may therefore also occur in Africa (Figure 4).
• Spirometra ranarum (Gastaldi, 1854) – taxon of uncertain taxonomic status

This poorly known species of uncertain taxonomic status was described as larvae from
green frog (Pelophylax esculentus) in northern Italy (Torino). This species was later reported
without any discussion by Meggitt (1924) from Myanmar and later by Faust et al. (1929) from
China. It was synonymised with S. erinaceieuropaei by most subsequent authors. However,
Eom et al. (2018) and Jeon et al. (2018 a,b) used this name for isolates from Korea, Myanmar
and Tanzania, not providing any solid arguments for their species identification. The
molecular data (Figure 4) clearly indicate that these authors in fact misidentified S. mansoni.
4
• Spirometra mansoni (Cobbold, 1882) – valid; Eurasian and Oceanic species, possibly in
Africa
The species was described as larvae found during the autopsy of a man in Amony (now
Xiamen, China) and represents the first taxon described in Asia. Most samples from China
and neighbouring countries are considered conspecific with this species, because they have
the same geographical origin as S. mansoni. This is by far the most common and widely
distributed species of Spirometra and the most important causative agent of human
sparganosis (Figure 4).
• Spirometra sp. 1 – valid (to be formally described); second Asian lineage

Molecular phylogenetic analyses of sequences throughout the world revealed the existence
of two lineages in Asia. In addition to common S. mansoni occurring in most of Eurasia (see
above and Figure 4), the second lineage comprises samples from 35 human cases in Korea
including one adult specimen obtained from experimentally infected dog (Jeon et al. 2015);
however, only one sequence is available in GenBank. An additional case of this species was
reported from a Japanese patient by Kudo et al. (2017). This clade was mistakenly identified
as S. erinaceieuropaei by Jeon et al. (2015), even though it has no genetic similarity with any
European samples (Figure 4). We consider this lineage to be a new and as yet undescribed
species.
Supplementary Data 3. Reports of Spirometra in Europe and related countries.

1. Belarus: Belyaeva 1959, Mekuscheva 1963, 1974, Shimalov 1965, Siarzhanin1965
(Mustela martes), Arzamasov et al. 1969, Karasev 1975, Sharpilo 1976 (snakes),
Shimalov and Shimalov 2001a (Neovison vison), Sidorovich and Anisimova 1993,
Shimalov et al. 2000 (Lutra lutra), Shimalov and Shimalov 2000a,b (Cansi lupus, Natrix
natrix, Vipera berus), Shimalov and Shimalov 2002b (Nyctereutes procyonoides),
Shimalov and Shimalov 2001c (Mustela erminea, M. nivalis), Shimalov and Shimalov
2001b (Talpa europaea), Shimalov and Shimalov 2002a (Mustela putorius), Anisimova
2004 (Mustela lutreola), Shimalov 2009 (Pelophylax lessonae, P. ridibundus)
2. Bulgaria: Genov 1969, 1984, Odening 1980, Odening and Bockhardt 1982 (Natrix natrix,
N. tessellata), Prokopič and Genov 1074, Genov and Georgiev 1998 (Apodemus agrarius,
A. flavicollis, Crocidura leucodon, C. suaveolens, Erinaceus concolor, Felis catus, F.s
silvestris, Mustela putorius, Neomys anomalus, Pelophylax esculentus, P. ridibundus,
Rattus norvegicus, Sorex araneus)
3. Croatia: Hermosilla et al. 2017 (Canis lupus; as D. latus but re-identified as Spirometra
in present study based on morphological characters of eggs)
4. Czech Republic: Jíra 1998 (subcutaneous), Rehák 2006 (ocular)
5. Estonia: Konyaev et al. 2011 (Felis catus)
6. Finland: Schneider 1906 (Lynx lynx; Russia; Spirometra sp. [Bothriocephalus felis, B.
decipiens]), Lavikainen et al. 2013 (L. lynx), present study (L. lynx)
7. France: Garin et al. 1997 (subcutaneous), Mougeot et al. 1999 (ocular), Joyeux and Baer
1936 (Natrix natrix; close to the Mediterranean Sea and border with Italy)
8. Germany: Creplin 1825 (?) (Felis catus), Stief and Enge 2011 (proliferative sparganosis
in Canis familiaris from Dresden, born in Spain)
9. Greek: Ali-Kham et al. 1973 (subcutaneous case from Canada; emigrated from Greece in
1969), Papadopoulos et al. 1997 (Vulpes vulpes)
10. Hungary: Rátz 1913 and Kotlán 1923 (Sus scrofa)
5
11. Italy: Gastaldi 1854 (Pelophylax esculentus), Molin 1858 (Martes foina, Mustela
putorius), 1860 (Erinaceus europaeus), Polonio 1860 (Natrix natrix), Generali 1878
(Canis familiaris), Perroncito 1882 (C. familiaris), Parona 1887 (Natrix sp.), Ariola 1896
(C. lupus), Joyeux and Baer 1927 (Natrixi sp.), Vitalli 1929 (E. europaeus), Panzera 1931
(Rattus norvegicus), Pujatti 1953 (man), Pampiglione et al. 2003 (man)
12. Moldavia: Andreiko 1973 (Felis catus, F. silvestris, Erinaceus europaeus)
13. Poland: Sołtys 1949 (Sorex araneus), Furmaga 1953 (Canis lupus, Lynx lynx, Vulpes
vulpes, S. araneus), Odening and Bockhardt 1982 (Natrix natrix, N. tessellata), Szczęsna
et al. 2008 (L. lynx), Kołodziej-Sobocińska and Miniuk 2018 (L. lutra), Kołodziej-
Sobocińska et al. 2014 (Meles meles), 2016 (Sus scrofa), 2018 (L. lynx), 2019 (M. meles,
Mustela putorius, N. natrix, Neovison voson, Nyctereutes procyonoides), Kondzior et al.
2018 (N. natrix), present study (C. lupus, L. lutra, M. meles, N. procyonoides)
14. Romania: Chiriac and Barbu 1970 (Nyctereutes procyonoides), Mihalca 2007 (Natrix
natrix), present study (Pelophylax esculentus, P. ridibundus)
15. Russia: Schneider 1906 (Lynx lynx; Russia; Spirometra sp. [Bothriocephalus felis, B.
decipiens]), Zmeev 1936, Dubinina 1951, Dibinin 1953, Chizhova and Gofman-
Kadoshnikov 1968, Ryzhenko 1969a,b, Sharpilo 1976 (snakes), Kozlov 1977, Ryzhikov
1978, Sergiev et al. 2003 (Mustela lutreola), Malysheva et al. 2012, Bugmyrin et al. 2015
(Myodes glareolus)
16. Serbia: Rátz 1913, Rukavina et al. 1957 (Sus scrofa), Rozman 1976 (Pelophylax
esculentus)
17. Ukraine: Sharpilo 1976 (snakes), Kornyushin 2011 (Canis lupus, Felis silvestris, Martes
martes, Neovison vison, Nyctereutes procyonoides), Nevolko and Litvinenko 2014 (Sus
scrofa), present study (C. lupus)
Asian countries related to Europe with Spirometra reported

Armenia: Nelli et al. 2014 (Macrovipera lebetina, Natrix tessellata)
Azerbaijan: Sadykhov 1954 (see Ryzhenko 1969), Sharpilo 1976 (snakes), Mustafaev and
Farzaliev 1977 (Pelophylax ridibundus), Fataliev 2011, Fataliev and Ibragimova 2016 (Canis
aureus, C. familiaris, Felis silvestris, F. catus, F. chaus, Vulpes vulpes)
Georgia: see Ryzhikov 1978 for references
Iran: Badri et al. 2017 (Felis silvestris), Amouei et al. 2018 (Felis catus, Canis aureus),
Beiromvand et al. 2018 (C. familiaris)
Tajikistan: Zmeev 1936 (Canis aureus, Hemiechinus auritus), Petrov and Potekhina 1953
(Meles canescens), Sharpilo 1976 (snakes)
Turkey: Yildirimhan et al. 2007 (Natrix natrix)
Turkmenistan: Gnezdilov and Chebotarevich 1934 (Canis familiaris), Babajev 1968 (thesis)
Uzbekistan: Sharpilo 1976 (snakes), Ikromov et al. 2004 (Pelophylax ridibundus)
Supplementary Data 4. Host-Parasite list Europe.

Adults
1. Canis lupus Ariola 1896, Furmaga 1953, Shimalov and Shimalov 2000a, Kornyushin
2011, Malysheva et al. 2012, Hermosilla et al. 2017 (as D. latus), present study
2. Felis catus Andreiko 1973, Genov and Georgiev 1998, Konyaev et al. 2011, Fataliev and
Ibragimova 2016
3. Felis silvestris Andreiko 1973, Genov and Georgiev 1998, Fataliev and Ibragimova 2016
4. Lynx lynx Schneider 1906, Furmaga 1953, Belyaeva 1959, Shimalov 1965, Szczęsna et al.
2008, Kornyushin 2011, Lavikainen et al. 2013, Kołodziej-Sobocińska et al. 2018, present
study
6
5. Vulpes vulpes Belyaeva 1959, Shimalov 1965, Papadopoulos et al. 1997, Malysheva et al.
2012
6. Nyctereutes procyonoides Shimalov and Shimalov 2002b, Kornyushin 2011
Plerocercoids
1. Apodemus agrarius Genov 1969, Genov 1984
2. Apodemus flavicollis Genov 1969, Prokopič and Genov 1974
3. Arvicola amphibius (see Ryzhikov 1978 for references)
4. Canis familiaris Stief and Enge 2011
5. Corvus frugilegus Dubinina 1951
6. Crocidura leucodon Genov 1969, Prokopič and Genov 1974
7. Crocidura suaveolens Genov 1969, Prokopič and Genov 1974
8. Eliomys quercinus (see Ryzhikov 1978 for references)
9. Elaphe dione Dubinina 1951
10. Erinaceus concolor Genov and Georgiev 1998
11. Erinaceus europaeus Rudolphi 1819, Molin 1860, Vitalli 1929, Andreiko 1973
12. Erinaceus roumanicus Genov 1969
13. Lutra lutra Kozlov 1977, Shimalov et al. 2000, Kołodziej-Sobocińska and Miniuk 2018,
present study
14. Martes foina Molin 1958
15. Martes martes Siarzhanin 1965, Kornyushin 2011
16. Meles meles Kołodziej-Sobocińska et al. 2014, 2019, present study
17. Mustela erminea Shimalov and Shimalov 2001c
18. Mustela lutreola Sidorovich and Anisimova 1993, Sergiev et al. 2003, Anisimova 2004
19. Mustela nivalis Shimalov and Shimalov 2001c
20. Mustela putorius Polonio 1860, Molin 1958, Genov 1984, Shimalov Shimalov 2002a,
Kołodziej‐Sobocińska et al. 2019
21. Myodes glareolus Bugmyrin et al. 2015
22. Natrix maura Parona, 1887
23. Natrix natrix Polonio 1860, Joyeux and Baer 1927, Dubinina 1951, Chizhova and
Gofman-Kadoshnikov 1968, Ryzhenko 1969a, Sharpilo 1976, Odening and Bockhardt
1982, Shimalov and Shimalov 2000b, Mihalca et al. 2007, Malysheva et al. 2012,
Kondzior et al. 2018, Kołodziej‐Sobocińska et al. 2019
24. Natrix tessellata Dubinina 1951, Sharpilo 1963, Ryzhenko 1969a,b, Odening and
Bockhardt 1982
25. Neomys anomalus Genov 1969, Prokopič and Genov 1974
26. Neovison vison Shimalov and Shimalov 2001a, Kornyushin 2011, Kołodziej‐Sobocińska
et al. 2019
27. Nyctereutes procyonoides Chiriac and Barbu 1970, Shimalov and Shimalov 2002b,
Kornyushin 2011, Kołodziej‐Sobocińska et al. 2019, present study
28. Pelophylax esculentus (as Rana esculenta) Gastaldi 1854, Genov 1969, Rozman 1976,
Genov and Georgiev 1998, present study
29. Pelophylax lessonae (as Rana lessonae) Shimalov 2009
30. Pelophylax ridibundus (as Rana ridibunda) Dubinina 1951, Chizhova and Gofman-
Kadoshnikov 1968, Genov 1969, Genov and Georgiev 1998, Shimalov 2009, present
study
31. Rattus norvegicus Panzera 1931, Genov 1969, Prokopič and Genov 1974
32. Sciurus vulgaris (see Ryzhikov 1978 for references)
33. Sorex araneus Sołtys 1949, Furmaga 1953, Genov 1969, Prokopič and Genov 1974
7
34. Sus scrofa Rátz 1913, Kotlán 1923, Rukavina et al. 1957, Malysheva et al. 2012, Nevolko
and Litvinenko 2014, Kołodziej-Sobocińska et al. 2016
35. Talpa europaea Shimalov and Shimalov 2001b
36. Vipera berus Shimalov and Shimalov 2000b
37. Vulpes vulpes Furmaga 1953, Shimalov et al. 2003
38. Homo sapiens (man) see Table 2
Animals infected with Spirometra in European zoos

Leuckart 1848 (as Bothriocephalus maculatus from “Leoparden”, most probably Panthera
pardus in Göttingen, Germany)
Raffaele 1932 (Leopardus pardalis in Rome, Italy)
Prokopič and Jaroš 1961 (Felis chaus in Prague, Czech Republic)
Brglez et al. 1970 in Daly 1981 (jaguar Leopardus onca in Ljubljana)
Odening 1976 (Thailandese snakes in Berlin, Germany)
Odening et al. 1980 (Canis aureus and Lynx lynx in Germany from Lake Baikal)
References
Ali-Khan Z, Irving RT, Wignall N, et al. Imported sparganosis in Canada. Can Med Assoc J
1973; 108: 590–1.
Almeida GG, Coscarelli D, Melo MN, et al. Molecular identification of Spirometra spp.
(Cestoda: Diphyllobothriidae) in some wild animals from Brazil. Parasitol Int 2016; 65:
428–31.
Amouei A, Jahandar H, Daryani A, et al. Carnivores as important reservoirs of intestinal
helminthic infections in Mazandaran Province, northern Iran. Iran J Parasitol 2018; 13:
251–7.
Andreiko OF. Parasites of mammals in Moldavia; Shtiintsa; 1973 (in Russian).
Anisimova EI. Study on the European mink Mustela lutreola helminthocenoses in connection
with the American mink M. vison expansion in Belarus: story of the study and review of the
results. Helminthologia 2004; 41: 193–6.
Ariola V. Note intorno agli elminti del Museo Zoologico di Torino. Di alcuni botriocefali. Bol
Mus Zool Anat Compar R Uni Torino 1896; 11: 1–7.
Arzamasov IT, Merkusheva IV, Mikholap ON, et al. Insectivores and their parasites on the
territory of Belarus. Minsk, Science and Technology; 1969 (in Russian).
Babajev J. Helminth fauna of hare-like and rodents of various landscape zones of
Turkmenistan. Autoref. kand. diss. Moscow; 1968 (in Russian).
Badri M, Eslahi AV, Majidiani H, et al. Spirometra erinaceieuropaei in a wildcat (Felis
silvestris) in Iran. Vet Parasitol: Region Stud Rep 2017; 10: 58–61.
Baer JG. Contribution a la faune helminthologique Sud-Africaine. Ann Parasitol Hum Comp
1924; 2: 239–47.
Bauchet AL, Joubert C, Helies JM, et al. Disseminated sparganosis in a cynomolgus macaque
(Macaca fascicularis). J Comp Pathol 2013; 148: 294–7.
Beiromvand M, Rafiei A, Razmjou E, et al. Multiple zoonotic helminth infections in domestic
dogs in a rural area of Khuzestan Province in Iran. BMC Vet Res 2018; 14: 224.
Belyaeva MYa. Toward the study of helminth fauna of mammals in the Bialowieza Forest. Tr
Vses Ist Gelmintol KI Skryabina; 1959; 6: 100–14 (in Russian).
Bennett H, Mok H, Gkrania-Klotsas E, Tsai I, Stanley E, Antoun N, et al. The genome of the
sparganosis tapeworm Spirometra erinaceieuropaei isolated from the biopsy of a migrating
brain lesion. Genome Biol 2014; 15: 510.
Berger L, Skerratt LF, Zhu XQ, et al. Severe sparganosis in Australian tree frogs. J Wildl Dis
2009; 45: 921–9.
8
Boonyasiri A, Cheunsuchon P, Srirabheebhat P, et al. Sparganosis presenting as cauda equina
syndrome with molecular identification of the parasite in tissue sections. Kor J Parasitol
2013; 51: 739–42.
Boonyasiri A, Cheunsuchon P, Suputtamongkol Y, et al. Nine human sparganosis cases in
Thailand with molecular identification of causative parasite species. Am J Trop Med Hyg
2014; 91: 389–93.
Bugmyrin SV, Korosov AV, Bespyatova LA, Ieshko EP. Helminth fauna of the bank vole
Myodes glareolus (Schreber, 1780) in the Kizhi Archipelago. Parazitologiya 2015; 49: 61–
71.
Chiriac E, Barbu P. Contribution à la connaissance de l’helminthofaune du nyctéreute
(Nyctereutes procyonoides ussuriensis Mat.) du delta du Danube. Rev Roumaine Biol, ser
Zool 1970; 15: 277–290.
Chizhova TP, Gofman-Kadoshnikov PB. Origin of patogenic diphyllobothriosis in SSSR. In:
Prokopenko DI, editor. Diphyllobothriosis. Moscow; 1968. p. 43–7 (in Russian).
Creplin CH. Observationes de Entozois: Gryphiswaldiae: Sumtibus Mauritii Librarii; 1825.
Czyżewska J, Namiot A, Koziołkiewicz K, et al. The first case of human sparganosis in
Poland and a review of the cases in Europe. Parasitol Int 2019; 70: 89–91.
Daly JJ. Sparganosis. In: Steele JH, Beran GW, eds. CRC Handbook Series in Zoonoses
Section C: Parasitic Zoonoses. Boca Raton: CRC Press; 1981; p. 293–312.
Diesing KM. Systema helminthum. Vindobonae: W. Braumüller; 1850.
Dubinin VB. Parasitofauna of mouse rodents and its changes in the Volga delta. Parazit
Sbornik Zool Inst AN SSR 1953; 15: 252–76 (in Russian).
Dubinina MN. On the biology and distribution of Diphyllobothrium erinacei-europaei (Rud.,
1819) Iwata, 1933. Zool Zh 1951; 30: 421–9 (in Russian).
Eberhard ML, Thiele EA, Yembo GE, et al. Thirty-seven human cases of sparganosis from
Ethiopia and South Sudan caused by Spirometra spp. Am J Trop Med Hyg 2015; 93: 350–5.
Eom KS, Park H, Lee D, et al. Molecular and morphologic identification of Spirometra
ranarum found in the stool of African lion, Panthera leo in the Serengeti Plain of Tanzania.
Kor J Parasitol 2018; 56: 379–83.
Eom KS, Park H, Lee D, et al. Identity of Spirometra theileri from a leopard (Panthera
pardus) and spotted hyena (Crocuta crocuta) in Tanzania. Korean J Parasitol 2019; 57:
639–45.
Fataliev GG. Helminthofauna of wild dogs in Azerbaijan and the ways of its formation.
Parazitologiya 2011; 45: 129–39 (in Russian).
Fataliev GG, Ibragimova RS. Comparative analysis of the helminth fauna in cats of the family
Felidae in Azerbaijan. Rus J Parasitol 2016; 36: 1–7 (in Russian).
Faust EC, Campbell HE, Kellogg CR. Morphological and biological studies on the species of
Diphyllobothrium in China. Am J Hyg 1929; 9: 560–83.
Fischer D, Heuser W, Pantchev N, et al. Subkutane Sparganose beim Korallenfingerfrosch
(Litoria caerulea). Tierärztliche Praxis Kleintiere 2010; 38: 249–53.
Furmaga S. Spirometra janickii sp. n. (Diphyllobothriidae). Acta Parasitol Polon 1953; 1: 29–
59.
Generali G. Note elmintologiche. Arch Med Vet Milano 1878, 3.
Garin YJF, Frottier J, Lavergne-Slove A, et al. Cutaneous sparganosis in France: the second
case described from Europe. Acta Pathol, Microbiol Immunol Scandinavica 1997; 105: 14–
6.
Gastaldi B. Cenni sopra alcuni nuovi elminti della Rana esculenta con nuove osservazioni sul
Codonocephalus mutabilis (Diesing). Torino: Tip. G. Favale; 1854.
9
Genov T. Natural infestation of the vertebrates from the reservation “Srebarna” with
plerocercoids of Spirometra erinacei-europaei (Rudolphi, 1819) – Diphyllobothriidae
(Cestoidea). Izv Tsentralnata Khelmintol Labor 1969; 13: 197–209 (in Bulgarian).
Genov T. Helminths of insectivores and rodents in Bulgaria, Srebarna; 1984 (in Bulgarian).
Genov T, Georgiev BB. Phylum Platyhelminthes, Class Cestoda. In: Michev T, Georgiev BB,
Petrova AV and Stoyneva MP (eds) Biodiversity of the Srebarna Biosphere Reserve:
Checklist and Bibliography. Ministry of Environment and Waters, Sofia, 1998; pp. 51–3.
Gnezdilov GV, Chebotarevich ND. On parasitic worms of domestic carnivores of the
Karakalinsky district of Turkmenistan. Tr. Karak Kzyl-Atrek Parasit Expedicin 1934; 177.
Hermosilla C, Kleinertz S, Silva LMR, et al. Protozoan and helminth parasite fauna of free-
living Croatian wild wolves (Canis lupus) analyzed by scat collection. Vet Parasitol 2017;
233: 14–9.
Hernández-Orts JS, Scholz T, Brabec J, Kuzmina T, Kuchta R. High morphological plasticity
and global geographical distribution of the Pacific broad tapeworm Adenocephalus pacificus
(syn. Diphyllobothrium pacificum): molecular and morphological survey. Acta Trop 2015;
149: 168–78.
Ikromov EF, Azimov JA, Cho MR. The helminth fauna of lake frog (Rana ridibunda Pallas,
1771) in Ferghana Valley, Uzbekistan. J Asia-Pacific Entomol 2004; 7: 137–41.
Iwata S. Some experimental studies on the regeneration of the plerocercoid of Mansonʼs
tapeworm, Diphyllobothrium erinacei (Rudolphi), Sparganum proliferum Ijima. Jpn J Zool
1934; 6: 209–47.
Iwata S. Experimental and morphological studies of Mansonʼs tapeworm Diphyllobothrium
erinacei (Rudolphi) – special reference with its scientific name and relationship with
Sparganum proliferum Ijima. Progr Med Parasitol Jpn 1972; 4: 535–90.
Jeon H-K, Park H, Lee D, et al. Genetic and morphologic identification of Spirometra
ranarum in Myanmar. Kor J Parasitol 2018a; 56: 275–80.
Jeon H-K, Huh S, Sohn W-M, Chai J-Y, Eom KS. Molecular genetic findings of Spirometra
decipiens and S. ranarum in Korea. Kor J Parasitol 2018b; 56: 359–64.
Jeon H-K, Park H, Lee D, et al. Human infections with Spirometra decipiens plerocercoids
identified by morphologic and genetic analyses in Korea. Kor J Parasitol 2015; 53: 299–
305.
Jíra J. Human helminthology. Prague: Galén; 1998 (in Czech).
Jongthawin J, Intapan PM, Sanpool O, et al. Molecular evidence of Spirometra
erinaceieuropaei infection in snakes Ptyas korros from Lao PDR and Thailand and frogs
Hoplobatrachus rugulosus from Myanmar. Southeast Asian J Trop Med Public Hlth 2014;
45: 1271–8.
Joyeux C, Baer JG. Sur quelques larves de Bothriocéphales. Bul Soc Pathol Exot 1927; 20:
921–36.
Joyeux C, Baer JG. Faune de France: Cestodes. Paris: Paul Lechevalier; 1936.
Kalyaanamoorthy S, Minh BQ, Wong TKF, Haeseler A, Jermiin LS. ModelFinder: fast model
selection for accurate phylogenetic estimates. Nature Methods 2017; 14: 587–89.
Kamo H. Guide to identification of diphyllobothriid cestodes. Tokyo, Japan; 1999.
Karasev NF. Cestodes of predatory mammals. Berezinskii Zapoved 1975; 4: 221–3 (in
Russian).
Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Mol Biol Evol 2013; 30: 772–80.
Kearse M, Moir R, Wilson A, et al. Geneious Basic: an integrated and extendable desktop
software platform for the organization and analysis of sequence data. Bioinformatics 2012;
28: 1647–49.
10
Kołodziej-Sobocińska M, Miniuk M. Sparganosis – neglected zoonosis and its reservoir in
wildlife. Medycyna Weterynaryjna-Veterinary Medicine-Science and Practice 2018; 74:
224–7.
Kołodziej-Sobocińska M, Miniuk M, Ruczyńska I, et al. Sparganosis in wild boar (Sus scrofa)
– implications for veterinarians, hunters, and consumers. Vet Parasitol 2016; 227: 115–7.
Kołodziej-Sobocińska M, Stojak J, Kondzior E, et al. Genetic diversity of two mitochondrial
DNA genes in Spirometra erinaceieuropaei (Cestoda: Diphyllobothridae) from Poland. J
Zool Syst Evol Res 2019; 57: 764–77.
Kołodziej-Sobocińska M, Tokarska M, Kowalczyk R. The first report of sparganosis
(Spirometra sp.) in Eurasian badger (Meles meles). Parasitol Int 2014; 63: 397–99.
Kołodziej-Sobocińska M, Yakovlev Y, Schmidt K, et al. Update of the helminth fauna in
Eurasian lynx (Lynx lynx) in Poland. Parasitol Res 2018; 117: 2613–21.
Kondzior E, Tokarska M, Kowalczyk R, et al. The first case of genetically confirmed
sparganosis (Spirometra erinaceieuropaei) in European reptiles. Parasitol Res 2018; 117:
3659–62.
Konyaev SV, Sуatkovskaya OS, Filimonova AY. The finding of adult form Spirometra
erinacei from the cat in Estonia. Russ Vet J 2011: 40–41.
Kornyushin V, Malyshko EI, Malega AM. The helminths of wild predatory mammals of
Ukraine. Cestodes. Vest Zool 2011; 45: e-1–e-8.
Kotlán A. Über Sparganum raillieti Ratz und den zugehörigen geschlechtsreifen Bandwurm
Dibothriocephalus rallieti, Ratz. Zbl Bakteriol Parasitenkd 1923; 90: 277–85.
Kozlov DP. Guide for the determination of the helminths of carnivores of USSR. Leningrad:
Nauka; 1977 (in Russian).
Kuchta R, Scholz T. Diphyllobothriidea. In: Caira JN, Jensen K, eds. Planetary Biodiversity
Inventory (2008–2017): Tapeworms from Vertebrate Bowels of the Earth. Lawrence, KS,
USA: University of Kansas, Natural History Museum, Special Publication No. 25; 2017:
167–89.
Kudo T, Fujioka A, Korenaga M, et al. Molecular identification of intramuscular and
subcutaneous Spirometra erinaceiuropaei sparganosis in a Japanese patient. J Dermatol
2017; 44: e138–e9.
Lavikainen A, Haukisalmi V, Deksne G, et al. Molecular identification of Taenia spp. in the
Eurasian lynx (Lynx lynx) from Finland. Parasitology 2013; 140: 653–62.
Le AT, Do L-QT, Nguyen H-BT, et al. Case report: the first case of human infection by adult
of Spirometra erinaceieuropaei in Vietnam. BMC Inf Dis 2017; 17: 669.
Leštinová K, Soldánová M, Scholz T, Kuchta R. Eggs as a suitable tool for species diagnosis
of causative agents of human diphyllobothriosis (Cestoda). PLoS Negl Trop Dis 2016; 10:
e0004721.
Leuckart R. Beschreibung zweier neuen Helminthen. Arch Naturgesch 1848; 14: 26–9.
Maltsev VN, Gavrilova NA. Variation of morphological characters within different parts of
the strobila in cestodan genus Diphyllobothrium (Cestoda, Diphyllobothriidae). Zool Zh
1994; 1994: 59–62 .
Malysheva NS, A SN, Vagin NA, Elizarov AS, Ubozhenko L. Features of the circulation of
zoonotic pathogens in the Kursk region and the risk of human infection with them. 2012;
Uchenye Zapiski Elektronnyj Nauch Zh Kurskogo Gosudarstvennogo Univ 23: 10–15.
Meggitt FJ. On the life history of a reptilian tapeworm (Spargum reptans). Ann Trop Med
Parasitol 1924; 18: 195–204.
Mekuscheva IV. Helminths of rodents. In: Fauna and ecology of rodent parasites. Minsk,
Science and Technology, 1963; pp. 53–137 (in Russian).
Merkusheva IV. About the helminths of carotid (Myoxidae) and mouse (Zapodidae) on the
territory of Belarus. Doc. BSSR Academy of Sciences, 1974; 18; 278–81 (in Russian).
11
Mihalca AD, Gherman C, Ghira I, et al. Helminth parasites of reptiles (Reptilia) in Romania.
Parasitol Res 2007; 101: 491–2.
Miyadera H, Kokaze A, Kuramochi T, Kita K, Machinami R, Noya O, et al. Phylogenetic
identification of Sparganum proliferum as a pseudophyllidean cestode by the sequence
analyses on mitochondrial COI and nuclear sdhB genes. Parasitol Int 2001; 50: 93–104.
Mougeot G, Cambon M, Menerath JM, et al. Human eye anterior chamber sparganosis.
Parasite 1999; 6: 365–6.
Molin R. Prospectus Helminthum quae in prodromo faunae Helminthologicae Venetiae
continentur. Sitz-Ber K Akad Wiss, Math-Naturwiss Cl 1858; 30: 127–58.
Molin R. Cephalocotylea e Nematoidea. Sitzungsber Kaiserl Akad Wiss, Math-Naturwiss Cl
1860; 38: 7–38.
Muigg V, Ruf M-T, Schwarzkopf S, et al. Case report: human subcutaneous sparganosis in a
Thai migrant. Am J Trop Med Hyg 2019; 101: 1170–3.
Mustafaev JS, Farzaliev AM. Helminth fauna of marsh frog (Rana ridibunda Pall.) in
Azerbaijan. Izv Akad Nauk Azerbajdžana SSR ser Biol 1977; (1): 69–72 (in Russian).
Nelli S, Felix D, Marine A. Seven new species of helminths for reptiles from Armenia. Acta
Parasitol 2014; 59: 442–7.
Nevolko OM, Litvinenko OP. Sparganosis in wild pigs. Vet Med 2014; 99: 150–3 (in
Russian).
Nguyen L-T, Schmidt HA, Haeseler A, Minh BQ. IQ-TREE: A fast and effective stochastic
algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 2015; 32: 268–74.
Odening K. Plerozerkoid-Befall bei thailändischen Reptilien aus dem Tierpark Berlin. Angew
Parasitol 1976; 17: 9–14.
Odening K, Bockhardt I. Two European Spirometra forms (Cestoidea: Diphyllobothriidae)
with different sparganum growth factors. Angew Parasitol 1982; 23: 15–27.
Odening K, Tscherner W, Bockhardt I. Experimentelle Bestimmung von Cestodeneiern
(Spirometra) aus Goldschakal und Luchs. Milu, Berlin 1980; 5: 245–51.
Okamoto M, Iseto C, Shibahara T, et al. Intraspecific variation of Spirometra
erinaceieuropaei and phylogenetic relationship between Spirometra and Diphyllobothrium
inferred from mitochondrial CO1 gene sequences. Parasitol Int 2007; 56: 235–8.
Okino T, Ushirogawa H, Matoba K, et al. Establishment of the complete life cycle of
Spirometra (Cestoda: Diphyllobothriidae) in the laboratory using a newly isolated triploid
clone. Parasitol Int 2017; 66: 116–8.
Pampiglione S, Fioravanti ML, Rivasi F. Human sparganosis in Italy – case report and review
of the European cases. Acta Pathol, Microbiol Immunol Scand 2003; 111: 349–54.
Papadopoulos H, Himonas C, Papazahariadou M, et al. Helminths of foxes and other wild
carnivores from rural areas in Greece. J Helminthol 1997; 71: 227–32.
Panzera O. Due casi di Sparganosi net ratto. Riv Sci Nat Natura 1931; 22: 65–8.
Parona C. Elmintologia Sarda – contribuzione allo studio dei Vermi parassiti in animali di
Sardegna. Ann Mus Civ Stor Nat Genova 1887; 4: 275–384.
Perroncito E. I parassiti deii Uomo e degli animali utili, ecc. Milano, 1882.
Petrov AM, Potekhina LF. The helmintofauna of carnivore mammals of Tadzhikistan. Tr Vses
Ist Gelmintol KI Skryabina 1953; 5: 82–94.
Petrigh RS, Scioscia NP, Denegri GM, Fugassa MH. Cox-1 gene sequence of Spirometra in
Pampas foxes from Argentina. Helminthologia 2015; 52: 355–9.
Polonio AF. Catalogo dei Cefalocotilei Italiani. Atti Soc Ligust Sci Nat Geogr 1860; 2: 217–
29.
Prokopič J, Genov T. Distribution of helminths in micromammals (Insectivora and Rodentia)
under different ecological and geographical conditions. Academia, Prague 1974.
12
Prokopič J, Jaroš Z. Helminthological findings in exotic carnivores from Prague zoological
garden. Věst Českoslov Zool Spol 1961; 25: 22–4 (in Czech).
Pujatti D. Un caso di sparganosi umana. Riv Parassitol 1953; 14: 213–17.
Raffaele G. Su alcuni cestodi rinvenuti in una pantera. Bol Zool 1932; 3: 299–306.
Rátz S. Ein Plerocercoid von dem Schwein. Zbl Bakteriol Parasitenkd Infektionskrank 1913;
67: 523–27.
Rehák M, Kolářová L, Kohnová I, et al. Ocular sparganosis in the Czech Republic – a case
report. Klin Mikrobiol Infekc Lek 2006; 12: 161–64 (in Czech).
Rozman M. A contribution to the knowledge of endohelminths of Anura in some region of
Bosnia and Herzegovina and Yugoslavia. Vet Sarajevo 1976; 25: 449–76.
Rudolphi CA. Entozoorum synopsis cui accident mantissa duplex et indices locupletissimi.
Berolini (Berlin): S. A. Rücker; 1819.
Rukavina J, Džumurov N, Delič S. Larvae of Diphyllobothrium erinacei europaei in pigs.
Veterinaria Sarajevo 1957; 6: 46–55.
Ryzhenko GF. Experimental determination of the reservoir hosts of Spirometra erinacei-
europaei. Tr Vses Ist Gelmintol KI Skryabina 1969a; 15: 252–56 (in Russian).
Ryzhenko GF. Definitive hosts of Spirometra erinacei-europaei. Byul Vsesoyuz Ordena Tr
Krasnogo Znameni Inst Gelmintol KI Skryabina. 1969b; 2: 89–91 (in Russian).
Ryzhikov KM. Key to the helminths of rodents in the USSR. Cestodes and trematodes.
Moscow: Nauka; 1978 (in Russian).
Sado A, Yoshino T, Ikoma S, et al. A parasitological survey of the wild mammals living in
the Kushiro zoo. Jap J Zoo Wildl Med 2017; 22: 31–36.
Sato MO, Sato M, Yoonuan T, et al. The role of domestic dogs in the transmission of zoonotic
helminthes in a rural area of Mekong river basin. Acta Parasitol 2017; 62: 393–400.
Schauer F, Poppert S, Mockenhaupt M, et al. Travel-acquired subcutaneous Sparganum
proliferum infection diagnosed by molecular methods. Brit J Dermatol 2014; 170: 741–43.
Schneider G. Darmparasiten des Luchses. Meddel Soc Faun Flora Fenn 1906; 31: 105–07.
Sergiev VP, Gorokhov VV, Uspensky AV, et al. Animal and human spirometrosis
(sparganosis). Med Parazitol Parazit Bol 2003; (3): 56–60 (in Russian).
Siarzhanin IuI. Nutritive rivals, enemies and parasites of Mustela martes. In: Ekologia
Pozvonochich Zhivotnych Belorussii. Akademia Nauk Belorussii SSR, Minsk, 1965; pp.
85–89 (in Russian).
Scholz T, Kuchta R, Brabec J. Broad tapeworms (Diphyllobothriidae), parasites of wildlife
and humans: Recent progress and future challenges. Int J Parasitol: Parasit Wildl 2019; 9:
359–69.
Sharpilo VP. Parasitic worms of the reptile fauna of the USSR. Systematics, chorology,
biology. Naukova Dumka, Kiev; 1976 (in Russian).
Shimalov VT. New data on helminths of mammals of Byelorrusia (mainly carnivorous).
Mater Nauchn. Konf. Vsesojus. Obshch. Gelmint. 1965; 1, 265–68 (in Russian).
Shimalov VV. Helminth fauna of amphibians (Vertebrata: Amphibia) in the Republic of
Belarus. Parazitologiya 2009; 43: 118–29.
Shimalov VV, Shimalov VT. Helminth fauna of the wolf (Canis lupus Linnaeus, 1758) in
Belorussian Polesie. Parasitol Res 2000a; 86: 163–64.
Shimalov VV, Shimalov VT. Helminth fauna of snakes (Reptilia, Serpentes) in Belorussian
Polesye. Parasitol Res 2000b; 86: 340–41.
Shimalov VV, Shimalov VT. Helminth fauna of the American mink (Mustela vison Schreber,
1777) in Belorussian Polesie. Parasitol Res 2001a ; 87, 886–87.
Shimalov VV, Shimalov VT. Helminth fauna of the European mole (Talpa europaea
Linnaeus, 1758) in Belorussian Polesie. Parasitol Res 2001b; 87: 790–91.
13
Shimalov VV, Shimalov VT. Helminth fauna of the stoat (Mustela erminea Linnaeus, 1758)
and the weasel (M. nivalis Linnaeus, 1758) in Belorussian Polesie. Parasitol Res 2001c ; 87:
680–81.
Shimalov VV, Shimalov VT. Helminth fauna of the European polecat (Mustela putorius
Linnaeus, 1758) in Belorussian Polesie. Parasitol Res 2002a; 88: 259–60.
Shimalov VV, Shimalov VT. Helminth fauna of the racoon dog (Nyctereutes procyonoides
Gray, 1834) in Belorussian Polesie. Parasitol Res 2002b; 88: 944–45.
Shimalov VV, Shimalov VT. Helminth fauna of the red fox (Vulpes vulpes Linnaeus, 1758) in
southern Belarus. Parasitol Res 2003; 89: 77–78.
Shimalov VV, Shimalov VT , Shimalov AV. Helminth fauna of otter (Lutra lutra Linnaeus,
1758) in Belorussian Polesie. Parasitol Res 2000; 86: 528.
Sidorovich VE, Anisimova EI. Helminth infestation in a declining population of European
mink (Mustela lutreola) in Belarus. Small Carniv Conserv 1993; 9: 16–17 (in Russian).
Sołtys A. Endoparasites of the velvet shrew (Sorex araneus L) of the Białowieża National
Park. Annales UMCS Sectio C 6,5 Lublin; 1952 (in Polish).
Stephanson J. Biology and immunology of Spirometra in Western Australia: Murdoch
University; 1985.
Stief B, Enge A. Proliferative peritonitis with larval and cystic parasitic stages in a dog. Vet
Pathol 2011; 48: 911–14.
Szczęsna J, Popiotek M, Schmidt K, Kowalczyk R. Coprological study on helminth fauna in
Eurasian lynx (Lynx lynx) from the Białowieża Primeval Forest in eastern Poland. J
Parasitol 2008; 94: 981–84.
Ugarte CE, Thomas DG, Gasser RB, et al. Spirometra erinacei/S. erinaceieuropaei in a feral
cat in Manawatu with chronic intermittent diarrhoea. New Zealand Vet J 2005; 53: 347–51.
Vitalli M. Sparganum lanceolatum Molin forma larvale di Diphyllobothrium ranarum
Gastaldi. Monitore Zool Ital 1929; 40: 90–4.
Waeschenbach A, Brabec J, Scholz T, Littlewood DTJ, Kuchta R. The catholic taste of broad
tapeworms – multiple routes to human infection. Int J Parasitol 2017; 47: 831‒43.
Wardle RA, McLeod JA, Radinovsky S. Advances in the Zoology of Tapeworms, 1950–
1970: University of Minnesota Press; 1974.
Wicht, B., Yanagida, T., Scholz, T., Ito, A., Jiménez, J. A., & Brabec, J. Multiplex PCR for
differential identification of broad tapeworms (Cestoda: Diphyllobothrium) infecting
humans. J Clin Microbiol 2010 48: 3111–16.
Yamasaki H, Nakaya K, Nakao M, et al. Significance of molecular diagnosis using
histopathological specimens in cestode zoonoses. Trop Med Hlth 2007; 35: 307–21.
Yildirimhan HS, Bursey CR, Goldberg SR. Helminth parasites of the grass snake, Natrix
natrix, and the dice snake, Natrix tessellata (Serpentes: Colubridae), from Turkey. Comp
Parasitol 2007; 74: 343–54.
Zhang X, Duan JY, Shi YL, et al. Comparative mitochondrial genomics among Spirometra
(Cestoda: Diphyllobothriidae) and the molecular phylogeny of related tapeworms. Mol Phyl
Evol 2017;117:75–82.
Zhang X, Wang H, Cui J, et al. The phylogenetic diversity of Spirometra erinaceieuropaei
isolates from southwest China revealed by multi genes. Acta Trop 2016; 156: 108–14.
Zmeev GY. About the presence of a diphyllobothriosis in Tajikistan. Tr Tajikistanskoi Bazi
USSR Acad Sci 1936; 6: 267–74 (in Russian).
14
View publication stats

Spirometra Phylo 2021 SM

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Spirometra Phylo 2021 SM

Uploaded by

Copyright:

Available Formats

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

Sparganosis (Spirometra) in Europe in the molecular era

Article in Clinical Infectious Diseases · March 2021

Roman Kuchta Marta Kołodziej-Sobocińska

SEE PROFILE SEE PROFILE

Jan Brabec Daniel Mlocicki

SEE PROFILE SEE PROFILE

The user has requested enhancement of the downloaded file.

Sparganosis (Spirometra) in Europe in the Molecular Era

Downloaded from https://academic.oup.com/cid/article/72/5/882/5875650 by ESIEE Paris user on 02 March 2021

BRIEF HISTORY AND SPECIES COMPOSITION

882 • cid 2021:72 (1 March) • Kuchta et al

Sparganosis (Spirometra) in Europe • cid 2021:72 (1 March) • 883

884 • cid 2021:72 (1 March) • Kuchta et al

Sparganosis (Spirometra) in Europe • cid 2021:72 (1 March) • 885

Downloaded from https://academic.oup.com/cid/article/72/5/882/5875650 by ESIEE Paris user on 02 March 2021

886 • cid 2021:72 (1 March) • Kuchta et al

Downloaded from https://academic.oup.com/cid/article/72/5/882/5875650 by ESIEE Paris user on 02 March 2021

Table 2. List of Cases of Sparganosis in Europe

Year Country Sex/Age Sparganosis Reference

Sparganosis (Spirometra) in Europe • cid 2021:72 (1 March) • 887

888 • cid 2021:72 (1 March) • Kuchta et al

Although the traditional eating habits of Europeans in general Notes

Downloaded from https://academic.oup.com/cid/article/72/5/882/5875650 by ESIEE Paris user on 02 March 2021

Sparganosis (Spirometra) in Europe • cid 2021:72 (1 March) • 889

Downloaded from https://academic.oup.com/cid/article/72/5/882/5875650 by ESIEE Paris user on 02 March 2021

890 • cid 2021:72 (1 March) • Kuchta et al

Supplementary Data 1. Molecular phylogenetic methods used.

Supplementary Data 2. Comments on the systematics of Spirometra.

Morphological characters and their limitations in species identification of Spirometra

• Spirometra erinaceieuropaei (Rudolphi, 1819) – valid (type species); European lineage

• Spirometra folium (Diesing, 1850) – valid; African lineage

• Spirometra ranarum (Gastaldi, 1854) – taxon of uncertain taxonomic status

• Spirometra sp. 1 – valid (to be formally described); second Asian lineage

Supplementary Data 3. Reports of Spirometra in Europe and related countries.

Asian countries related to Europe with Spirometra reported

Supplementary Data 4. Host-Parasite list Europe.

Animals infected with Spirometra in European zoos

View publication stats

You might also like