Developmental and Comparative Immunology 55 (2016) 159e168

Contents lists available at ScienceDirect

Developmental and Comparative Immunology

journal homepage: www.elsevier.com/locate/dci

Zebrafish as a useful model for zoonotic Vibrio parahaemolyticus

pathogenicity in fish and human
Qinghua Zhang a, 1, *, Xuehong Dong a, 1, Biao Chen a, Yonghua Zhang a, Yao Zu a,
Weiming Li a, b
a
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, College of Fisheries and Life Science,
Shanghai Ocean University, Shanghai 201306, China
b
Department of Fisheries and Wildlife, Michigan State University, East Lansing, MI 48824, USA

a r t i c l e i n f o a b s t r a c t

Article history: Vibrio parahaemolyticus is an important aquatic zoonotic pathogen worldwide that causes vibriosis in
Received 7 August 2015 many marine fish, and sepsis, gastroenteritis and wound infection in humans. However, the pathogenesis
Received in revised form of different sources of V. parahaemolyticus is not fully understood. Here, we examined the pathogenicity
24 October 2015
and histopathology of fish (V. parahaemolyticus 1.2164) and human (V. parahaemolyticus 17) strains in a
Accepted 25 October 2015
Available online 28 October 2015
zebrafish (Danio rerio). We found that different infection routes resulted in different mortality in
zebrafish. Moreover, death due to V. parahaemolyticus 1.2164 infection occurred quicker than that caused
by V. parahaemolyticus 17 infection. Hematoxylin-eosin staining of liver, kidney and intestine sections
Keywords:
Zebrafish
showed histological lesions in all three organs after infection with either strain. V. parahaemolyticus
Vibrio parahaemolyticus 1.2164 caused more severe damage than V. parahaemolyticus 17. In particular, V. parahaemolyticus 1.2164
Infectious model treatment induced more serious hydropic degeneration and venous sinus necrosis in the liver than
Pathogenicity V. parahaemolyticus 17 treatment. The expression levels of three proinflammatory cytokines, interleukin
Histopathology 1b (il1b), interferon phi 1 (ifnf1) and tumor necrosis factor a (tnfa), as determined by quantitative real-
Inflammatory cytokines time PCR, were upregulated in all examined tissues of infected fish. Notably, the peak levels of tnfa were
significantly higher than those of il1b and ifnf1, suggesting, together with pathological results, that tnfa
and il1b play an important role in acute sepsis. High amounts of tnfa may be related to acute liver ne-
crosis, while ifnf1 may respond to V. parahaemolyticus and play an antibacterial role for chronically
infected adult zebrafish. Taken together, our results suggest that the zebrafish model of
V. parahaemolyticus infection is useful for studying strain differences in V. parahaemolyticus pathogenesis.
© 2015 Elsevier Ltd. All rights reserved.

1. Introduction
The zebrafish (Danio rerio), with a complete (innate and adap-
tive) immune system, could be an efficient animal model for im-
munity and infectious disease because it is convenient to obtain
specific mutant zebrafish for elucidation of pathogenicity (Lieschke
and Currie, 2007; H Meijer and Spaink, 2011; Haenen et al., 2013;
Yang et al., 2014). In comparison to other established vertebrate
Abbreviations: TCBS, thiosulfate citrate bile salts sucrose; CFU, colony-forming
unit; i.m. injection, intramuscular injection; i.p. injection, intraperitoneal injection;
hpi, hour post infection; tlh, thermostable hemolysin gene; il1b, interleukin 1b;
ifnf1, interferon phi 1; tnfa, tumor necrosis factor a.
* Corresponding author.
E-mail address: qhzhang@shou.edu.cn (Q. Zhang).
1
Qinghua Zhang and Xuehong Dong contributed equally to this work.
infection models such as mice and rats, the advantages of the
zebrafish model include small size, rapid growth, relatively short
life cycle, ease of breeding, and a transparent body in early life
stages, allowing efficient genetic screens and real-time visualiza-
tion (Kanther and Rawls, 2010; Goldsmith and Jobin, 2012; Kanwal
et al., 2014; Rowe et al., 2014; Runft et al., 2014). Recently, zebrafish
have been used for investigating in vivo hostepathogen in-
teractions (van der Sar et al., 2004; Allen and Neely, 2010; Kanther
and Rawls, 2010; Kanwal et al., 2014). This animal hosts Gram-
positive and Gram-negative bacteria, fungi, mycobacteria, pro-
tozoa and viruses (Sullivan and Kim, 2008; Goody et al., 2014;
Gratacap and Wheeler, 2014). Indeed, the zebrafish infectious dis-
ease model has emerged as an effective system for examining
aquatic pathogens, both in the aquatic environment and in infec-
tion of humans (Rowe et al., 2014).

http://dx.doi.org/10.1016/j.dci.2015.10.021
0145-305X/© 2015 Elsevier Ltd. All rights reserved.
160 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168
The Vibrio parahaemolyticus, a Gram-negative bacterium and an
important zoonotic pathogen, was first isolated by Fujino et al. in
Japan in 1950 from explosive food poisoning (Broberg et al., 2011).
It is widely distributed in marineeestuarine environments, and
causes vibriosis of fish, shellfish and other aquatic animals. In
humans, waterborne V. parahaemolyticus can cause mild to severe
infections, including wound infections, gastroenteritis, and septi-
cemia (Hlavsa et al., 2011). Since its discovery, pathogenesis of
V. parahaemolyticus has been examined in several cell lines as well
as mammalian animal challenge models (Calia and Johnson, 1975;
Brown et al., 1977; Boutin et al., 1979; Hoashi et al., 1990;
Takahashi et al., 2000; Park et al., 2004; Kodama et al., 2008;
Vongxay et al., 2008; Hiyoshi et al., 2010; Pineyro et al., 2010).
However, these systems have not been used to compare the path-
ogenesis of distinct V. parahaemolyticus strains from different
sources. In recent years, zebrafish have been used to study the
pathogenesis of several Vibrio species, such as Vibrio vulnificus (Pan
et al., 2011) and Vibrio cholerae (Runft et al., 2014), but there has
been no direct comparison of infectious effects caused by the same
pathogen from different hosts. V. parahaemolyticus is a very diverse
and complex species, and shows signs of significant strain-specific
differences (Izutsu et al., 2008; Okada et al., 2009; Li et al., 2014). In
order to determine its role in epidemiology, we tested for virulence
of, and other innate immune response characteristics to,
V. parahaemolyticus strains isolated from different clinical and
diseased fish sources using the zebrafish model.
On the basis that the sources of the two strains are different, we
hypothesized that a V. parahaemolyticus fish pathogenic strain
(V. parahaemolyticus 1.2164) and a human pathogenic strain
(V. parahaemolyticus 17) would have different pathogenicity to
zebrafish, including gross symptoms, histopathology and inflam-
matory cytokine levels. TNFa, known to kill cancer cells but which
causes acute liver and nerve cell necrosis at high doses, is the first
cytokine released in the inflammatory immune response and leads to
the downstream expression of IL-1b and chemokines and mainly
produced by macrophages, whereas TNFb is mainly produced by T
lymphocytes. Cytokine IL-1b is the key proinflammatory cytokine,
one of the first cytokine genes discovered in fish, known to stimulate
inflammation. So, we selected il1b and tnfa for our cytokine analyses.
Zebrafish IFNs are classified into two subfamilies, type I and II, on the
basis of the cognate receptors they interact with and the subsequent
immune responses they initiate (Zou and Secombes, 2011). Zebrafish
type I IFNs, named interferon-phi (IFNf) are classified into two
groups: group I (comprising IFNf1 and IFNf4) and group II (IFNf2
and IFNf3) (Stein et al., 2007; Zou et al., 2007; Hamming et al., 2011),
and only group I zfIFN was able to protect the fish against bacterial
infection (Lopez-Munoz et al., 2009). Recently, more and more re-
searchers have selected the isoform IFNf1 (alternative names IFN,
IFN1, IFN-a1) to evaluate the inflammatory level induced by various
pathogens (Xiong et al., 2012; Varela et al., 2014; Feng et al., 2015).
Thus, we also chose to analyze ifnf1 levels.
Here, we describe the first direct comparison in an adult
zebrafish model of pathogenic features of fish and human
V. parahaemolyticus strains at the individual, tissue and molecular
levels. We demonstrate that zebrafish are susceptible to
V. parahaemolyticus infection and can distinguish the virulence of
different strains. We use the typical proinflammatory cytokines
il1b, tnfa and ifnf1 to investigate the immune response in zebrafish
challenged by V. parahaemolyticus. We show that tnfa and il1b play
a pivotal role in V. parahaemolyticus infection and are relevant to
the process of acute sepsis. High doses of tnfa may be related to
acute liver necrosis. We also find that ifnf1 plays a key antibacterial
role in chronic adult zebrafish infection. These results provide a
proof of principle for understanding zoonotic V. parahaemolyticus
pathogens in the zebrafish model.
2. Materials and methods
2.1. Bacterial strains and growth conditions
The fish pathogenic bacterial strain V. parahaemolyticus 1.2164,
purchased from the China General Microbiological Culture Collec-
tion Center (CGMCC), and the human pathogenic strain
V. parahaemolyticus 17, kindly provided by Dr. Jian Wang, Shanghai
Animal Disease Prevention and Control Center, were routinely
grown overnight in thiosulfate citrate bile salts sucrose (TCBS) agar
culture medium at 28
C for V. parahaemolyticus 1.2164 and 37
C
for V. parahaemolyticus 17. Sucrose non-fermenting colonies were
selected by streak plating on TCBS agar and inoculated into sterile
nutrient broth supplemented with NaCl (3% w/v), then were grown
overnight at 28
C for V. parahaemolyticus 1.2164 and 37
C for
V. parahaemolyticus 17 with shaking at 150 rpm. Logarithmic phase
cultures were obtained by dilution of the overnight culture with
sterile nutrient broth supplemented with NaCl (3% w/v) at 1:10 and
allowed growth for another 3 h at the appropriate temperature,
with shaking. Cultures were harvested by centrifugation
(2000 rpm), washed twice and resuspended in saline solution
(0.85% NaCl). In the following procedures, bacterial suspensions
were prepared with saline, and control groups were treated with
saline in the same way as test groups. The concentrations of the two
strains were determined by McFarland nephelometry and plate
count methods (Aldridge and Schiro, 1994). Each treatment (as
described below) was carried out in triplicate, with ten animals for
each replicate. Saline was used as a vehicle treatment.
2.2. Zebrafish care and maintenance
Wild-type AB adult zebrafish (7e8 months old) used
throughout this study were obtained from Shanghai Institute of
Biochemistry and Cell Biology (SIBCB). Fish husbandry followed the
methods of Westerfield (Westerfield, 2000) (also see http://zfin.
org/zf_info/zfbook/zfbk.html). Zebrafish were transferred to a
stand-alone unit with a separate flow-through system, and accli-
mated for 2 weeks before infection treatment. Zebrafish were
handled according to the procedures of the Institutional Animal
Care and Use Committee (IACUC) of Shanghai Ocean University,
Shanghai, China. The proposed research methodology received
clearance from the Shanghai Ocean University Experimentation
Ethics Review Committee.
2.3. Adult zebrafish infections and bacterial quantification
2.3.1. Exposure by immersion only
The first method used to infect zebrafish was immersion only, in
which zebrafish were exposed to 6.0  106, 6.0  107 or
6.0  108 CFU/mL (CFU, colony-forming unit) V. parahaemolyticus
1.2164 or V. parahaemolyticus 17, respectively, by static immersion
for 5 h in a total volume of 600 mL of bacterial solution. Zebrafish
were then moved to 3 L tanks and maintained for 96 h. Zebrafish
were observed daily for mortality and signs of disease (Pressley
et al., 2005).
2.3.2. Exposure by immersion following dermal abrasion
In the second method of immersion exposure, zebrafish were
subjected to abrasion prior to immersion in V. parahaemolyticus
1.2164 or V. parahaemolyticus 17. Zebrafish were lightly anes-
thetized with 0.1% 3-aminobenzoic acid ethyl ester (tricaine). After
the zebrafish had been sufficiently anesthetized (~4 min), they
were lightly scraped along the lateral surface behind the pectoral
fins with a sterile scalpel to remove several scales and scratch the
underlying dermis before immersion, as described by Neely et al.
 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168
(Neely et al., 2002). When the scraped zebrafish recovered from
anesthesia they were exposed to 1.0  106, 1.0  107 or
1.0  108 CFU/mL V. parahaemolyticus for 5 h and then transferred to
fresh water. These concentrations were chosen because this
method of infection causes higher mortality than simple immer-
sion; if we used the concentrations effective in the immersion
treatment, the zebrafish would die before conclusion of the treat-
ment. Control groups were also scraped and treated with the
vehicle (saline). Mortalities were recorded for 96 h to obtain sur-
vival rates. Survival fractions were determined using the
KaplaneMeier method and the logrank test to compare the survival
curves (Paranjpye et al., 2013). The following two methods of
infection, intramuscular injection and intraperitoneal injection,
were also evaluated in terms of survival time by this statistical
analysis.
2.3.3. Exposure by intramuscular injection (i.m. injection)
Zebrafish were anesthetized as described in Section 2.3.2 and
infected by intramuscular injection (i.m. injection) with 20 mL of
1.0  106, 1.0  107 or 1.0  108 CFU/mL V. parahaemolyticus 1.2164
or V. parahaemolyticus 17. For i.m. injection, an anesthetized
zebrafish was positioned prostrate, supported by the open jaws of a
gauze-covered hemostat. The needle was inserted cephalad at a 45

angle relative to the spine into a position immediately anterior and
lateral to the dorsal fin, and the needle was held in place for 5 s
before it was withdrawn. Infected zebrafish were transferred to
fresh water, and their recovery was verified before moving them
into the water unit (Moyer and Hunnicutt, 2007; Phelps et al.,
2009). Any zebrafish observed to be bleeding or otherwise
suffering was immediately euthanized. Signs of disease and mor-
talities were recorded for 96 h.
2.3.4. Exposure by intraperitoneal injection (i.p. injection)
For intraperitoneal injection (i.p. injection) of anesthetized
zebrafish to be infected with 1.0  106, 1.0  107 or 1.0  108 CFU/
mL V. parahaemolyticus 1.2164 or V. parahaemolyticus 17, the needle
was inserted cephalad into the midline of the abdomen immedi-
ately posterior to the pectoral fins. If any leakage of the injection
solution was observed at the injection site, the zebrafish was
euthanized. As described in Section 2.3.3, infected zebrafish were
transferred to a fresh water tank (Neely et al., 2002). Doses followed
the i.m. injection protocol. Mortalities were recorded for 96 h and
zebrafish were sampled for reisolation of the pathogen and for
histology.
2.4. Reisolation and identification of bacteria
Adult zebrafish infected with V. parahaemolyticus 1.2164 or
V. parahaemolyticus 17 were euthanized and analyzed separately for
the presence of bacteria. The ascites, liver, pancreas and kidneys
were, respectively, homogenized in 10 mL of saline solution using a
stomacher lab blender, streaked on selective TCBS agar, and incu-
bated overnight at 28
C for V. parahaemolyticus 1.2164 and 37
C for
V. parahaemolyticus 17. After pure cultures were obtained, all iso-
lates were grown in nutrient broth supplemented with NaCl (3% w/
v) overnight at the appropriate temperature for the respective
bacteria. All reisolates that were positive for V. parahaemolyticus
were confirmed by PCR using primers specific for the thermolabile
hemolysin (tlh) gene as a specific marker for V. parahaemolyticus. All
primers were synthesized by Shanghai Sheng Gong Synthetic Bio-
logical Co., Ltd. (Table 1). In addition, we sequenced the two
different strains reisolated from the diseased zebrafish using the
16S rRNA methods, and confirmed the results of sequence sub-
mitted to NCBI (http://www.ncbi.nlm.nih.gov).
161
2.5. Histopathology
To examine the pathogenicity of fish and human zoonotic
V. parahaemolyticus in the zebrafish model, zebrafish were infected
for 96 h with V. parahaemolyticus 1.2164 or V. parahaemolyticus 17 at
1.0  108 CFU/mL by i.p. injection. The infected zebrafish to be
sampled for histology were euthanized, cut along the ventral line,
and placed in 10 mL of buffered 10% formalin. After 24 h, the
fixative was aspirated and replaced with 10 mL of fresh buffered
10% formalin and the samples were stored at 4
C. The whole
zebrafish were embedded in paraffin wax and sections were
stained with hematoxylineeosin (Neely et al., 2002). Histological
sections were analyzed under a microscope (BX41, Olympus,
Japan).
2.6. Real-time quantitative PCR
In order to compare the changes in proinflammatory cytokines
induced by different infection routes, the mRNA levels of il1b, tnfa
and ifnf1 were measured using real-time PCR. Samples from
zebrafish that were subjected to abrasion prior to immersion in
1.0  107 CFU/mL V. parahaemolyticus were collected 2, 4, 8 and 12 h
post infection (hpi). Zebrafish that were subjected to i.p. injection
with 1.0  107 CFU/mL V. parahaemolyticus were sampled at 1, 2, 4
and 8 hpi. Total RNAs of liver and kidney of zebrafish were extracted
using Trizol reagent (Invitrogen, 15596-026) and reverse tran-
scribed with the Prime Script RT reagent kit (Takara, RR036A),
following the manufacturer's instructions. Quantitative PCR assays
were performed using a real-time PCR System (CFX-96, BIO-RAD;
primers listed in Table 1). Each primer (0.5 mL, 10 mM) was mixed
with 12.5 mL of SYBR Green PCR master mix (Takara) in a final
volume of 25 mL. The standard cycling conditions were 95
C for
30 s, followed by 40 cycles of 95
C for 5 s and 60
C for 30 s. The
2DDCT method was used to determine the expression levels of
analyzed genes. Expression of the selected genes was normalized
against that of b-actin mRNA levels in the same sample. Fold units
were calculated by dividing the normalized expression values in
infected zebrafish by the normalized expression values in the
controls (Pressley et al., 2005).
2.7. Statistics
Statistical tests and significances were analyzed with IBM SPSS
Statistics Software 19.0 by one-way ANOVA, followed by Duncan's
test. P values < 0.05 and < 0.01 were considered statistically sig-
nificant and extremely significant, respectively.
3. Results
3.1. Clinical symptoms of zebrafish infected with
V. parahaemolyticus
The most notable symptom from zebrafish treated by i.p. in-
jection of 1.0  108 CFU/mL V. parahaemolyticus 1.2164 or
V. parahaemolyticus 17 was widespread septicemia at 24 h. The
treated zebrafish had inflammation at the injection site and in the
entire abdomen (Fig. 1). The symptoms of zebrafish infected with
V. parahaemolyticus 1.2164 were more serious than in
V. parahaemolyticus 17 infected zebrafish. In the abdomen,
V. parahaemolyticus 1.2164 infected zebrafish showed more severe
hemorrhage than V. parahaemolyticus 17 infected zebrafish, and
had spinal curvature.
162 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168

Table 1
Primers used in this study.

Gene NCBI GenBank accession no. Annealing temperature (
C) Primer sequence (50 e30 ) Product size (bp)

Tlh JQ929914 55 Forward: AAAGCGGATTATGCAGAAGCACTG 450

Reverse: GCTACTTTCTAGCATTTTCTCTGC
Il1b AY340959 60 Forward: ATCCAAACGGATACGACCAG 148
Reverse: TCGGTGTCTTTCCTGTCCAT
Ifnf1 NM_207640 60 Forward: AGTCCTGACATTGGATCACATC 156
Reverse: TGCTGGCTTTGCGTATCTTG
Tnfa NM_212859 60 Forward: TTGGATGTTGAAGAAGGAGAGT 152
Reverse: TTATGGAGCGTGAAGCAGAC
bactin AF025305 60 Forward: ATGGATGATGAAATTGCCG 130
Reverse: TGACACCCTGATGTCTGGGG

(1428 bp) (Fig. S1) and the sequence of putative V. parahaemolyticus

17 16S rRNA (1420 bp) (Fig. S2) showed similarity 99% to those of
V. parahaemolyticus strains in the NCBI database.

3.3. Infection kinetics

Infection kinetics results showed that strain V. parahaemolyticus

Fig. 1. Gross pathology of zebrafish infected by i.p. injection of V. parahaemolyticus at
24 h. (A) Control zebrafish injected with saline solution (0.85% NaCl). (B) Zebrafish
injected with V. parahaemolyticus 1.2164 (1.0  108 CFU/mL). The zebrafish showed
serious abdominal hemorrhages and swelling. (C) Zebrafish injected with
V. parahaemolyticus 17 (1.0  108 CFU/mL). The zebrafish showed mild abdominal
hemorrhages and swelling.
3.2. Reisolation and identification of bacterial strains
Bacteriological analyses were carried out on ascites, liver,
pancreas and kidneys from diseased zebrafish using TCBS plates.
After overnight incubation at 28
C (for V. parahaemolyticus 1.2164)
and 37
C (for V. parahaemolyticus 17), almost pure cultures of green
colonies were recovered (Fig. 2A). Gram staining was negative, and
PCR identified the specific gene marker tlh for V. parahaemolyticus
(Fig. 2B). We sequenced the two different strains reisolated from
diseased zebrafish using 16S rRNA methods, the BLAST results of
the sequence of putative V. parahaemolyticus 1.2164 16S rRNA
1.2164 caused a higher mortality rate than strain
V. parahaemolyticus 17, and i.p. injection had more significant ef-
fects than the other infection routes. Control static immersion fish
showed no mortalities or signs of disease over a period of 96 h. We
analyzed the experiments by logistic regression, the virulence of V.
parahaemolyticus 1.2164 was not significantly different from that of
V. parahaemolyticus 17 at the three bacterial concentrations in the
three different infection routes. Zebrafish that were subjected to
abrasion prior to immersion in V. parahaemolyticus 1.2164 at 1.0 
106, 1.0  107 or 1.0  108 CFU/mL displayed 100%, 80% and 70%
survival, respectively, and for V. parahaemolyticus 17 the corre-
sponding values were 100%, 90% and 80%, respectively, in com-
parison to the 100% survival rate for the control group (Fig. 3A).
When zebrafish were infected by i.m. injection, the survival rates
were 80%, 70% and 50% for 1.0  106, 1.0  107 and 1.0  108 CFU/mL
V. parahaemolyticus 1.2164, respectively, and 90%, 80% and 60% for
1.0  106, 1.0  107 and 1.0  108 CFU/mL V. parahaemolyticus 17,
respectively, in comparison to the 100% survival rate for the control
group (Fig. 3B). In the i.p. treatment groups, the survival rates were
70%, 50% and 20% for 1.0  106, 1.0  107 and 1.0  108 CFU/mL
V. parahaemolyticus 1.2164, respectively, and 70%, 60% and 30% for
1.0  106, 1.0  107 and 1.0  108 CFU/mL V. parahaemolyticus 17,
respectively. All zebrafish in the control group survived at 96 hpi.
The majority of the dead zebrafish were observed before 48 hpi
following immersion with dermal abrasion treatment, and before
24 hpi for i.m. injection or i.p. injection treatments (Fig. 3C).
3.4. Histopathology of V. parahaemolyticus infection
Examination of sections indicated that V. parahaemolyticus

Fig. 2. The reisolation and identification of V. parahaemolyticus. (A) V. parahaemolyticus colonies on TCBS agar. (B) PCR amplification of the 450 bp amplicons for the species specific
gene tlh using primers tlh-F/R. Vp1.2164, V. parahaemolyticus 1.2164; Vp17, V. parahaemolyticus 17.
 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168
Fig. 3. Survival curves (Kaplan-Meir) of zebrafish exposed to V. parahaemolyticus 1.2164 or V. parahaemolyticus 17. (A) Zebrafish exposed to V. parahaemolyticus 1.2164 or
V. parahaemolyticus 17 for 5 h by static immersion after being lightly scraped with a scalpel blade. Zebrafish infected by (B) i.m. injection and (C) i.p. injection.
1.2164 caused more severe lesions than V. parahaemolyticus 17 in
liver and kidney but not in the intestine. Especially in the liver,
zebrafish infected with V. parahaemolyticus 1.2164 showed more
serious hydropic degeneration than V. parahaemolyticus 17 infected
zebrafish. For instance, almost all the cytoplasm of liver cells in
V. parahaemolyticus 1.2164 infected zebrafish was dissolved, but
this was not the case in V. parahaemolyticus 17 infected zebrafish.
Moreover, the areas of hepatic venous sinus necrosis occurred in
V. parahaemolyticus 1.2164 infected zebrafish while the control was
normal (Fig. 4AeC), and showed signs of more severe hemoside-
rosis in V. parahaemolyticus 1.2164 than that in V. parahaemolyticus
17 infected zebrafish compared with the controls in kidney tissues
(Fig. 4DeF). Intestinal villus necrosis falling off and intestinal
bleeding were observed in infected zebrafish. Little difference was
observed between the intestines of zebrafish treated with
V. parahaemolyticus 1.2164 and V. parahaemolyticus 17, while the
control was normal (Fig. 4GeI).
3.5. Proinflammatory cytokines induced by V. parahaemolyticus
infection
Cytokines are the key regulators of the immune system. Their
role in initiating inflammatory events in response to bacterial
exposure is well known in many animal models. The innate cyto-
kine response is critical to determining the subsequent acquired
immune response, which is crucial to the outcome of pathogen
control. To examine innate immune responses of zebrafish in
V. parahaemolyticus infections, we used qPCR method to measure
the expression of three cytokines, after bacteria challenge by
different route. The data show that the zebrafish immune system is
able to respond to V. parahaemolyticus.
163
3.5.1. Real-time PCR after exposure by immersion following dermal
abrasion
Our qPCR analysis revealed the il1b expression was not sig-
nificant (Fig. 5A), however, a difference in ifnf1 expression
levels between zebrafish infected with V. parahaemolyticus
1.2164 and V. parahaemolyticus 17 at 4 hpi (one-way ANOVA,
F ¼ 59.495, P < 0.05) and 8 hpi (F ¼ 12.466, P < 0.05) (Fig. 5B).
The tnfa mRNA expression levels at the peak showed an obvious
difference (F ¼ 541.593, P < 0.01) between the two strains
(Fig. 5C).
Expression levels of il1b, ifnf1 and tnfa in control zebrafish
and V. parahaemolyticus 1.2164 or V. parahaemolyticus 17 infected
zebrafish were similar through 2 hpi. All three cytokines showed
induction by 4 hpi. At 8 hpi, expression levels of these three
cytokines peaked, with il1b showing a 125.7-fold increase for
V. parahaemolyticus 1.2164 treatment and a 100.9-fold increase
for V. parahaemolyticus 17 treatment, respectively (Fig. 5A). The
ifnf1 expression level in V. parahaemolyticus 1.2164 infected
zebrafish reached nearly an 11.6-fold increase, and there was a
10.4-fold increase in V. parahaemolyticus 17 infected zebrafish at
8 hpi (Fig. 5B). The tnfa expression levels in V. parahaemolyticus
1.2164 and V. parahaemolyticus 17 infected zebrafish peaked at
8 hpi, with 249.0-fold and 55.0-fold increases, respectively
(Fig. 5C). At 12 hpi, il1b and tnfa mRNA expression levels fell
sharply in zebrafish treated with both V. parahaemolyticus
strains. However, the ifnf1 expression remained at high levels at
the same time. All the expression levels are compared with the
control. These results indicate that fish pathogenic bacterial
strain V. parahaemolyticus 1.2164 had stronger pathogenicity
than human pathogenic strain V. parahaemolyticus 17 in
zebrafish.
164 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168

Fig. 4. Histopathology comparisons of zebrafish infected by i.p. injection with V. parahaemolyticus 1.2164 and V. parahaemolyticus 17. Hematoxylin and eosin staining are shown. (A)
Control zebrafish liver. Liver cells and hepatic venous sinus are normal. (B) The liver of V. parahaemolyticus 1.2164 infected zebrafish displayed hepatic venous sinus necrosis (black
arrow) and severe hydropic degeneration (white arrow). (C) The liver of zebrafish infected with V. parahaemolyticus 17 showed light hydropic degeneration (white arrow). (D)
Kidney of control zebrafish. (E) Kidney of zebrafish infected with V. parahaemolyticus 1.2164. The white arrow points to kidney tissue showed hemosiderosis. (F) Kidney of zebrafish
infected with V. parahaemolyticus 17. Hemosiderosis is present (white arrow). (G) Intestinal structure of control zebrafish. (H) Intestinal structure of zebrafish infected with
V. parahaemolyticus 1.2164. The white arrow indicates intestinal mucosal epithelial cell falling off. The black arrow indicates intestinal bleeding. (I) Intestinal structure of zebrafish
infected with V. parahaemolyticus 17. The meaning of arrows is as in panel H. All amplification factors except intestine were 40 (objective) and 10 (eyepiece). Magnifications:
400. For intestine, amplifications were 20  (objective) and 10 (eyepiece). Magnifications: 200. Scale bars, 20 mm. Vp1.2164, V. parahaemolyticus 1.2164; Vp17,
V. parahaemolyticus 17.

3.5.2. Real-time PCR following exposure by i.p. injection levels of ifnf1 mRNA were different (one-way ANOVA, F ¼ 54.092,
We detected no significant difference between expression levels P < 0.01) between treatment with the two strains (Fig. 6B). The tnfa
of il1b induced by V. parahaemolyticus 1.2164 and expression levels also showed a very significant difference at 2 hpi
V. parahaemolyticus 17 at any time point (Fig. 6A). The maximum (F ¼ 131.943, P < 0.01) and 4 hpi (F ¼ 677.174, P < 0.01) (Fig. 6C).
 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168 165

Fig. 5. Expression levels of inflammatory cytokines. (A) il1b, (B) ifnf1 and (C) tnfa, as determined by quantitative real-time PCR in zebrafish scraped and then immersed in
1  107 CFU/mL V. parahaemolyticus 1.2164 or V. parahaemolyticus 17. *P < 0.05; **P < 0.01.

Fig. 6. Expression levels of inflammatory cytokines. (A) il1b, (B) ifnf1 and (C) tnfa in adult zebrafish infected by i.p. injection with 1  107 CFU/mL V. parahaemolyticus 1.2164 or
V. parahaemolyticus 17. *P < 0.05; **P < 0.01.

In zebrafish infected by i.p. injection, il1b showed rapid induc-
tion (by 1 hpi), compared with the control group. The peak il1b
expression level was reached by 4 hpi, at 56.5 and 48.8-fold for
strains 1.2164 and 17, respectively, and then, they both declined by
8 hpi, when the levels were 15.0-fold higher than those in the
control group (Fig. 6A). The expression levels of ifnf1 in
V. parahaemolyticus 1.2164 infected zebrafish were similar to the
control group at 2 hpi, rose to 11.0-fold at 4 hpi and returned to the
control group level by 8 hpi. The ifnf1 expression level in
V. parahaemolyticus 17 infected zebrafish increased only slightly, to
166 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168
2.0-fold at 4 hpi. This level was maintained at 8 hpi (Fig. 6B). The
tnfa expression levels in zebrafish infected with V. parahaemolyticus
1.2164 were 5.9-fold at 1 hpi, and then rose sharply, reaching 115.4-
fold by 2 hpi and 143.0-fold by 4 hpi. The level of tnfa expression
then fell, but was still high at 8 hpi. The tnfa expression levels in
zebrafish infected with V. parahaemolyticus 17 were close to those
in the control group at 1 hpi, and 32.0-fold at 2 hpi. The level
peaked at 46.2-fold at 4 hpi, and then fell at 8 hpi (Fig. 6C).
The expression levels of ifnf1 and tnfa were different in zebra-
fish infected with the two strains of V. parahaemolyticus at the time
points when their respective expression levels peaked. The results
overall (Figs. 5 and 6) suggest a more rapid and robust induction of
il1b and tnfa than ifnf1 in zebrafish scraped and then exposed to
V. parahaemolyticus or infected by i.p. injection.
4. Discussion
Zebrafish have a proven track record as an infection model for
many zoonotic bacterial pathogens (Rowe et al., 2014), such as
Aeromonas spp. (Rodríguez et al., 2008; Li et al., 2011), Streptococcus
spp.(Neely et al., 2002; Wu et al., 2008), Mycobacterium spp. (Clay
et al., 2007; van der Sar et al., 2009) Edwardsiella tarda (Pressley
et al., 2005), Pseudomonas aeruginosa (Clatworthy et al., 2009)
and Vibrio spp. (He et al., 2011; Pan et al., 2011; Paranjpye et al.,
2013). Their advantages include low cost, small size, easy mainte-
nance, a sequenced genome, a high rate of reproduction, and a well-
developed immune system with both innate and adaptive immu-
nity that has many similarities to that of humans and other animals
(Allen and Neely, 2010). Our work presented here shows that
zebrafish can be an enabling infectious disease model to address
pathological processes in vivo and that zebrafish could be a new
infectious model for zoonotic V. parahaemolyticus. Our infection
treatment indicated that zebrafish is a sensitive host for
V. parahaemolyticus. This model could provide a convenient screen
for distinct virulent V. parahaemolyticus isolates. Such results
characterize “strain specificity” of different isolates of the same
bacterial species. Zebrafish enabled research into aquatic patho-
gens may lead to novel strategies to eliminate these pathogens
before human exposure, and practices that better target infection,
either in the vector (fish) itself or in human or other animal hosts
(Rowe et al., 2014).
Our results shed light on the parallel pathogenicity of fish and
human pathogenic V. parahaemolyticus. We compared in zebrafish
the gross symptoms, histopathology and innate immune related
cytokines induced by these two strains. The results indicate that the
characteristics of pathogenicity are more obvious in
V. parahaemolyticus 1.2164 infected zebrafish than in
V. parahaemolyticus 17 treated fish. Our data showed that intra-
peritoneal injection was the most efficient method to establish the
sepsis model. Our results are in agreement with those of Pressley
et al. (Pressley et al., 2005) and Paranjpye et al. (Paranjpye et al.,
2013). Both Paranjpye et al. and we compared differences in the
virulence of V. parahaemolyticus isolated from the environment or
the clinic. We used strains V. parahaemolyticus 1.2164 (fish isolate)
and V. parahaemolyticus 17 (human/clinical isolate), while Para-
njpye et al. used V. parahaemolyticus strains 846 (oyster isolate),
SPRC 10290, RIMD2210633 and 901128 (clinical isolates), and 551
and 805 (water isolates). They also studied wild-type RIMD2210633
and isogenic pilin mutants DpilA, DmshA and a double mutant. We
aimed to focus on aquatic zoonotic pathogens using the zebrafish
model. Meanwhile, we evaluated the inflammatory response
induced by V. parahaemolyticus with tnfa, il1b and ifnf1 cytokine,
which is different from Paranjpye's study.
The host inflammatory response can be viewed as a balanced
response between proinflammatory mediators (referred to as the
systemic inflammatory response syndrome (SIRS)), and anti-
inflammatory mediators (referred to as the compensatory anti-
inflammatory response syndrome (CARS)) (Bone, 1996). During
the development of septic shock, regulated expression of SIRS and
CARS mediators is lost, resulting in an exaggerated and dysfunc-
tional inflammatory response (Buras et al., 2005). This response is
mediated by the proinflammatory cytokines il1b and tnfa, which
play a critical role in initiating other cytokines cascade, and in
recruitment and activation of innate immune cells at the major
sites of inflammation in the body. Both il1b and tnfa have been
isolated from several fish, including zebrafish (Pressley et al., 2005).
In this study, tnfa and il1b, the two major markers of host sepsis on
challenge by V. parahaemolyticus, increased. Our results concur
with those of Doi and colleagues, higher production of tnfa and il1b
resulted in a state of sepsis-induced acute kidney and liver injury, a
life-threatening condition (Doi et al., 2009). We suggest that tnfa
and il1b, play a robust role in V. parahaemolyticus infection and lead
the process of acute sepsis.
Data in the present study support the hypothesis that tnfa plays
an important role in V. parahaemolyticus infection and the immune
response in zebrafish. In the past, the proinflammatory cytokine
tnfa has been well documented and is a potential therapeutic target
in multiple clinical trials. In our study, the histopathology results
showed hydropic degeneration and hepatic venous sinus conges-
tion in the liver, indicating acute pathology and severe infection.
Our data indicate that high amounts of tnfa may be related to the
acute liver necrosis, because the liver has a substantial capacity for
TNF production due to the liver Kupffer cell, which is the largest
fixed macrophage population in the body. For TNF and other cy-
tokines produced by the body, there seems to be a fine line between
benefit and harm, an agent that is helpful in the local control of
injury and infection may be toxic when it is released in large
amounts or in the wrong place (Old, 1988).
Surprisingly, our data suggest the possibility that ifnf1 plays a
key antibacterial role in chronic adult zebrafish infection. The
means of “chronic” refers to the speed of infection symptoms
appearing in the “exposure by immersion only” and “exposure by
immersion following dermal abrasion” methods, which contrast
with the acute symptoms appearing after infection by the other
two methods, intramuscular injection and intraperitoneal injec-
tion. We noted that the level of ifnf1 mRNA was upregulated at an
early time point in V. parahaemolyticus infected zebrafish in our
study, even though, ifnf1 is usually thought to be induced by vi-
ruses. Previous studies found that group I zebrafish interferon was
able to protect the fish against bacterial infection and exerted a
slow but powerful induction of several proinflammatory genes,
which might explain the dual antiviral and antibacterial activities of
these interferons (Lopez-Munoz et al., 2009). In our study, all
zebrafish were purchased from SIBCB, and no specific viruses were
found in our rearing and circulating water system by conventional
pathogen detection. Moreover, none of the zebrafish used in our
experiments showed signs of disease caused by a virus, so we can
rule out the possibility that viral infection occurred in the treat-
ment system. Therefore, we presume that ifnf1 may be able to elicit
a slow, powerful expression of antibacterial genes, leading to the
protection of zebrafish against chronic V. parahaemolyticus infec-
tion. Accordingly, we can perhaps explain why mortality of
V. parahaemolyticus 17 infected zebrafish was lower than of
V. parahaemolyticus 1.2164 infected zebrafish scraped and then
immersed in different concentrations of bacteria (Fig. 3A). The ifnf1
level at 4 hpi is higher in V. parahaemolyticus 17 infected zebrafish
than in V. parahaemolyticus 1.2164 infected zebrafish and slightly
higher than the il1b and tnfa levels (Fig. 5B). In contrast, in the acute
infection caused by i.p. injection, il1b and tnfa were induced more
rapidly and to a greater extent than in chronic infection (Fig. 6B),
 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168
while ifnf1 was unable to produce a rapid protection of zebrafish
against the V. parahaemolyticus infection, explaining the high
mortality of V. parahaemolyticus 1.2164 infected zebrafish relative
to that of V. parahaemolyticus 17 infected zebrafish inoculated by i.p.
injection (Fig. 3C). Considerable progress has been made toward
understanding IFNs and their effects on virusehost interaction, but
bacteriaehost interactions need to be studied further. It will be
interesting to determine whether and how the zebrafish distin-
guish between viral and bacterial induced IFN signaling pathways
(Stein et al., 2007).
In summary, the present study establishes a zebrafish model for
V. parahaemolyticus infection that is efficient in assessing the
virulence of V. parahaemolyticus isolated from fish and human. This
is the first work to compare the characteristics of pathogenicity,
histopathology and innate immune response induced by two
different zoonotic aquatic V. parahaemolyticus strains using the
zebrafish infectious model. The model will be useful in further
studies of other zoonotic pathogens, especially aquatic pathogens.
Acknowledgments
We thank Dr. Tyler Buchinger in Michigan State University for
critical review of the manuscript. This work was supported by the
Innovation Program of Shanghai Municipal Education Commission
[grant number 13ZZ127], the Project Sponsored by the Scientific
Research Foundation for the Returned Overseas Chinese Scholars,
State Education Ministry [grant number D-8002-15-0042], and the
Doctor Startup Fund of Shanghai Ocean University [grant number
A-0209-13-0105344].
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.dci.2015.10.021.
References
Aldridge, K.E., Schiro, D.D., 1994. Anaerobic susceptibility testing. Slight differences
in inoculum size can make a difference in minimum inhibitory concentrations.
Diagn Microbiol. Infect. Dis. 18, 191e195.
Allen, J.P., Neely, M.N., 2010. Trolling for the ideal model host: zebrafish take the
bait. Future Microbiol. 5, 563e569.
Bone, R.C., 1996. Sir Isaac Newton, sepsis, SIRS, and CARS. Crit. Care Med. 24,
1125e1128.
Boutin, B.K., Townsend, S.F., Scarpino, P.V., Twedt, R.M., 1979. Demonstration of
invasiveness of Vibrio parahaemolyticus in adult rabbits by immunofluores-
cence. Appl. Environ. Microbiol. 37, 647e653.
Broberg, C.A., Calder, T.J., Orth, K., 2011. Vibrio parahaemolyticus cell biology and
pathogenicity determinants. Microbes Infect. 13, 992e1001.
Brown, D.F., Spaulding, P.L., Twedt, R.M., 1977. Enteropathogenicity of Vibrio para-
haemolyticus in the ligated rabbit ileum. Appl. Environ. Microbiol. 33, 10e14.
Buras, J.A., Holzmann, B., Sitkovsky, M., 2005. Animal models of sepsis: setting the
stage. Nat. Rev. Drug Discov. 4, 854e865.
Calia, F.M., Johnson, D.E., 1975. Bacteremia in suckling rabbits after oral challenge
with Vibrio parahaemolyticus. Infect. Immun. 11, 1222e1225.
Clatworthy, A.E., Lee, J.S., Leibman, M., Kostun, Z., Davidson, A.J., Hung, D.T., 2009.
Pseudomonas aeruginosa infection of zebrafish involves both host and path-
ogen determinants. Infect. Immun. 77, 1293e1303.
Clay, H., Davis, J.M., Beery, D., Huttenlocher, A., Lyons, S.E., Ramakrishnan, L., 2007.
Dichotomous role of the macrophage in early Mycobacterium marinum infec-
tion of the zebrafish. Cell Host Microbe 2, 29e39.
Doi, K., Leelahavanichkul, A., Yuen, P.S., Star, R.A., 2009. Animal models of sepsis and
sepsis-induced kidney injury. J. Clin. Invest 119, 2868e2878.
Feng, H., Zhang, Y., Zhang, Q., Li, Z., Zhang, Q., Gui, J., 2015. Zebrafish IRF1 regulates
IFN antiviral response through binding to IFNf1 and IFNf3 promoters down-
stream of MyD88 signaling. J. Immunol. 194, 1225e1238.
Goldsmith, J.R., Jobin, C., 2012. Think small: zebrafish as a model system of human
pathology. BioMed Res. Int. 2012, 1e12.
Goody, M.F., Sullivan, C., Kim, C.H., 2014. Studying the immune response to human
viral infections using zebrafish. Dev. Comp. Immunol. 46, 84e95.
Gratacap, R.L., Wheeler, R.T., 2014. Utilization of zebrafish for intravital study of
eukaryotic pathogenehost interactions. Dev. Comp. Immunol. 46, 108e115.
Haenen, O.L., Evans, J.J., Berthe, F., 2013. Bacterial infections from aquatic species:
167
potential for and prevention of contact zoonoses. Revue Sci. Tech. Int. Office
Epizootics) 32, 497e507.
Hamming, O.J., Lutfalla, G., Levraud, J., Hartmann, R., 2011. Crystal structure of
Zebrafish interferons I and II reveals conservation of type I interferon structure
in vertebrates. J. Virol. 85, 8181e8187.
He, H., Wang, Q., Sheng, L., Liu, Q., Zhang, Y., 2011. Functional characterization of
Vibrio alginolyticus twin-arginine translocation system: its roles in biofilm
formation, extracellular protease activity, and virulence towards fish. Curr.
Microbiol. 62, 1193e1199.
Hiyoshi, H., Kodama, T., Iida, T., Honda, T., 2010. Contribution of Vibrio para-
haemolyticus virulence factors to cytotoxicity, enterotoxicity, and lethality in
mice. Infect. Immun. 78, 1772e1780.
Hlavsa, M.C., Roberts, V.A., Anderson, A.R., Hill, V.R., Kahler, A.M., Orr, M.,
Garrison, L.E., Hicks, L.A., Newton, A., Hilborn, E.D., Wade, T.J., Beach, M.J.,
Yoder, J.S., 2011. Surveillance for waterborne disease outbreaks and other health
events associated with recreational water e- United States, 2007e2008.
MMWR Surveill. Summ. 60, 1e32.
Hoashi, K., Ogata, K., Taniguchi, H., Yamashita, H., Tsuji, K., Mizuguchi, Y.,
Ohtomo, N., 1990. Pathogenesis of Vibrio parahaemolyticus: intraperitoneal and
orogastric challenge experiments in mice. Microbiol. Immunol. 34, 355e366.
Izutsu, K., Kurokawa, K., Tashiro, K., Kuhara, S., Hayashi, T., Honda, T., Iida, T., 2008.
Comparative genomic analysis using microarray demonstrates a strong corre-
lation between the presence of the 80-kilobase pathogenicity island and
pathogenicity in Kanagawa phenomenon-positive Vibrio parahaemolyticus
strains. Infect. Immun. 76, 1016e1023.
Kanther, M., Rawls, J.F., 2010. Hostemicrobe interactions in the developing zebra-
fish. Curr. Opin. Immunol. 22, 10e19.
Kanwal, Z., Wiegertjes, G.F., Veneman, W.J., Meijer, A.H., Spaink, H.P., 2014.
Comparative studies of toll-like receptor signalling using zebrafish. Dev. Comp.
Immunol. 46, 35e52.
Kodama, T., Hiyoshi, H., Gotoh, K., Akeda, Y., Matsuda, S., Park, K.S., Cantarelli, V.V.,
Iida, T., Honda, T., 2008. Identification of two translocon proteins of Vibrio
parahaemolyticus type III secretion system 2. Infect. Immun. 76, 4282e4289.
Li, J., Ni, X.D., Liu, Y.J., Lu, C.P., 2011. Detection of three virulence genes alt, ahp and
aerA in Aeromonas hydrophila and their relationship with actual virulence to
zebrafish. J. Appl. Microbiol. 110, 823e830.
Li, L., Wong, H.C., Nong, W., Cheung, M.K., Law, P.T., Kam, K.M., Kwan, H.S., 2014.
Comparative genomic analysis of clinical and environmental strains provides
insight into the pathogenicity and evolution of Vibrio parahaemolyticus. BMC
Genomics 15, 1135.
Lieschke, G.J., Currie, P.D., 2007. Animal models of human disease: zebrafish swim
into view. Nat. Rev. Genet. 8, 353e367.
Lopez-Munoz, A., Roca, F.J., Meseguer, J., Mulero, V., 2009. New insights into the
evolution of IFNs: zebrafish group II IFNs induce a rapid and transient
expression of IFN-dependent genes and display powerful antiviral activities.
J. Immunol. 182, 3440e3449.
Meijer, H.A., Spaink, P.H., 2011. Host-pathogen interactions made transparent with
the zebrafish model. Curr. Drug Targets 12, 1000e1017.
Moyer, T.R., Hunnicutt, D.W., 2007. Susceptibility of zebra fish Danio rerio to
infection by Flavobacterium columnare and F. johnsoniae. Dis. Aquat. Organ 76,
39e44.
Neely, M.N., Pfeifer, J.D., Caparon, M., 2002. Streptococcus-zebrafish model of bac-
terial pathogenesis. Infect. Immun. 70, 3904e3914.
Okada, N., Iida, T., Park, K., Goto, N., Yasunaga, T., Hiyoshi, H., Matsuda, S.,
Kodama, T., Honda, T., 2009. Identification and characterization of a novel type
III secretion system in trh-positive Vibrio parahaemolyticus strain TH3996
reveal genetic lineage and diversity of pathogenic machinery beyond the spe-
cies level. Infect. Immun. 77, 904e913.
Old, L.J., 1988. Tumor necrosis factor. Sci. Am. 258, 59e60, 69-75.
Pan, C., Wu, J., Hui, C., Lin, C., Chen, J., 2011. Insights into the antibacterial and
immunomodulatory functions of the antimicrobial peptide, epinecidin-1,
against Vibrio vulnificus infection in zebrafish. Fish. Shellfish Immun. 31,
1019e1025.
Paranjpye, R.N., Myers, M.S., Yount, E.C., Thompson, J.L., 2013. Zebrafish as a model
for Vibrio parahaemolyticus virulence. Microbiology 159, 2605e2615.
Park, K.S., Ono, T., Rokuda, M., Jang, M.H., Okada, K., Iida, T., Honda, T., 2004.
Functional characterization of two type III secretion systems of Vibrio para-
haemolyticus. Infect. Immun. 72, 6659e6665.
Phelps, H.A., Runft, D.L., Neely, M.N., 2009. Adult zebrafish model of streptococcal
infection. Curr. Protoc. Microbiol. 1De9D.
Pineyro, P., Zhou, X., Orfe, L.H., Friel, P.J., Lahmers, K., Call, D.R., 2010. Development
of two animal models to study the function of Vibrio parahaemolyticus type III
secretion systems. Infect. Immun. 78, 4551e4559.
Pressley, M.E., Phelan, P.E., Witten, P.E., Mellon, M.T., Kim, C.H., 2005. Pathogenesis
and inflammatory response to Edwardsiella tarda infection in the zebrafish.
Dev. Comp. Immunol. 29, 501e513.
Rodríguez, I., Novoa, B., Figueras, A., 2008. Immune response of zebrafish (Danio
rerio) against a newly isolated bacterial pathogen Aeromonas hydrophila. Fish.
Shellfish Immun. 25, 239e249.
Rowe, H.M., Withey, J.H., Neely, M.N., 2014. Zebrafish as a model for zoonotic
aquatic pathogens. Dev. Comp. Immunol. 46, 96e107.
Runft, D.L., Mitchell, K.C., Abuaita, B.H., Allen, J.P., Bajer, S., Ginsburg, K., Neely, M.N.,
Withey, J.H., 2014. Zebrafish as a natural host model for Vibrio cholerae colo-
nization and transmission. Appl. Environ. Microb. 80, 1710e1717.
Stein, C., Caccamo, M., Laird, G., Leptin, M., 2007. Conservation and divergence of
168 Q. Zhang et al. / Developmental and Comparative Immunology 55 (2016) 159e168
gene families encoding components of innate immune response systems in
zebrafish. Genome Biol. 8, R251.
Sullivan, C., Kim, C.H., 2008. Zebrafish as a model for infectious disease and immune
function. Fish. Shellfish Immun. 25, 341e350.
Takahashi, A., Kenjyo, N., Imura, K., Myonsun, Y., Honda, T., 2000. Cl(-) secretion in
colonic epithelial cells induced by the vibrio parahaemolyticus hemolytic toxin
related to thermostable direct hemolysin. Infect. Immun. 68, 5435e5438.
van der Sar, A.M., Appelmelk, B.J., Vandenbroucke-Grauls, C.M., Bitter, W., 2004.
A star with stripes: zebrafish as an infection model. Trends Microbiol. 12,
451e457.
van der Sar, A.M., Spaink, H.P., Zakrzewska, A., Bitter, W., Meijer, A.H., 2009. Spec-
ificity of the zebrafish host transcriptome response to acute and chronic
mycobacterial infection and the role of innate and adaptive immune compo-
nents. Mol. Immunol. 46, 2317e2332.
Varela, M., Diaz-Rosales, P., Pereiro, P., Forn-Cuní, G., Costa, M.M., Dios, S.,
Romero, A., Figueras, A., Novoa, B., 2014. Interferon-induced genes of the
expanded IFIT family show conserved antiviral activities in non-mammalian
species. PLoS One 9, e100015.
Vongxay, K., Wang, S., Zhang, X., Wu, B., Hu, H., Pan, Z., Chen, S., Fang, W., 2008.
Pathogenetic characterization of Vibrio parahaemolyticus isolates from clinical
and seafood sources. Int. J. Food Microbiol. 126, 71e75.
Westerfield, M., 2000. The Zebrafish Book: a Guide for the Laboratory Use of
Zebrafish (Danio rerio), fourth ed. (Oregon, OR).
Wu, Z., Zhang, W., Lu, C., 2008. Comparative proteome analysis of secreted proteins
of Streptococcus suis serotype 9 isolates from diseased and healthy pigs.
Microb. Pathog. 45, 159e166.
Xiong, R., Nie, L., Xiang, L., Shao, J., 2012. Characterization of a PIAS4 homologue
from zebrafish: insights into its conserved negative regulatory mechanism in
the TRIF, MAVS, and IFN signaling pathways during vertebrate evolution.
J. Immunol. 188, 2653e2668.
Yang, Y., Chen, I., Lee, C., Chen, C., Lin, S., Hor, L., Tseng, T., Huang, Y.,
Sritunyalucksana, K., Thitamadee, S., 2014. Draft genome sequences of four
strains of Vibrio parahaemolyticus, three of which cause early mortality syn-
drome/acute hepatopancreatic necrosis disease in shrimp in China and
Thailand. Genome announc.. 2, e814ee816.
Zou, J., Secombes, C.J., 2011. Teleost fish interferons and their role in immunity. Dev.
Comp. Immunol. 35, 1376e1387.
Zou, J., Tafalla, C., Truckle, J., Secombes, C.J., 2007. Identification of a second group of
type I IFNs in fish sheds light on IFN evolution in vertebrates. J. Immunol. 179,
3859e3871.