Developmental and Comparative Immunology 55 (2016) 130e137

Contents lists available at ScienceDirect

Developmental and Comparative Immunology

journal homepage: www.elsevier.com/locate/dci

Molecular characterization and functional analysis of IRF3 in tilapia

(Oreochromis niloticus)
Yi-Feng Gu a, b, 1, Qun Wei c, d, 1, Shou-Jie Tang a, Xiao-Wu Chen a, *, Jin-Liang Zhao a, **
a
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai, 201306, China
b
Department of Developmental Biology, University of Texas Southwestern Medical Center at Dallas, 6000 Harry Hines Boulevard Dallas, TX, 75390-9133,
USA
c
Department of Surgical Oncology and Institute of Clinical Medicine, Sir Run Run Shaw Hospital, College of Medicine, Zhejiang University, Hangzhou, China
d
Department of International Medicine, University of Texas Southwestern Medical Center at Dallas, 6000 Harry Hines Boulevard Dallas, TX, 75390-9133,
USA

a r t i c l e i n f o a b s t r a c t

Article history: Interferon regulatory factor 3 (IRF3) plays a key role in interferon (IFN) response and binding to the IFN
Received 6 May 2015 stimulatory response elements (ISREs) within the promoter of IFN and IFN-stimulated genes followed by
Received in revised form virus infection. In the current study, we discovered one IRF3 homologue in tilapia genome and analyzed
22 September 2015
the characterizations and functions of tilapia IRF3. Tilapia IRF3 contains 1368 bp with an ORF of 455 aa.
Accepted 12 October 2015
Available online 22 October 2015
Structurally, tilapia IRF3 protein typically shares the conserved characterizations with other species' IRF3
homologues, displaying conserved DNA-binding domain, IRF association domain, serine-rich C terminal
domain, and tryptophan residue cluster. Phylogenetic analysis illustrated that tilapia IRF3 belongs to the
Keywords:
Tilapia
IRF3 subfamily. Real-time PCR revealed a broad expression pattern of tilapia IRF3 in various tissues.
IFN (interferon) Subcellular localization analysis showed that tilapia IRF3 mainly resides in the cytoplasm, Western blot
IRF3 (Interferon regulatory factor 3) demonstrated that IRF3 was distributed in the cytoplasmic fraction. Functionally, IRF3 was found to be
ISRE (Interferon-stimulated response transcriptionally up-regulated by the poly I:C stimulation. Moreover, reporter assay elucidated that
element) tilapia IRF3 serves as a regulator in mediating IFN response by increasing the activity of IFN-b and ISRE-
ISGs (IFN-stimulated genes) containing promoter. These data supported the view that tilapia IRF3 is a potential molecule in IFN
immune defense system against viral infection.
© 2015 Elsevier Ltd. All rights reserved.

1. Introduction
Innate immunity is believed to serve as the first line of defense
against different pathogens (Mogensen, 2009). Among the innate
immunity systems, interferon (IFN), IFN regulatory factors (IRFs),
and IFN-stimulated genes (ISGs) represent the crucial components
Abbreviations: DBD, DNA binding domain; IAD, IRF association domain; IRF, IFN
regulatory factor; ISG, IFN-stimulated gene; ISRE, IFN-stimulated regulatory
element; ECL, enhanced chemiluminescence; DAPI, 40 ,6-diamidino-2-phenylindole;
poly I:C, polyinosinic: polycytidylic acid; FLAG, DYKDDDDK peptide.
* Corresponding author. College of Fisheries and Life Science, Shanghai Ocean
University, No.999, Huchenghuan Rd., Shanghai 201306, China.
** Corresponding author. College of Fisheries and Life Science, Shanghai Ocean
University, No.999, Huchenghuan Rd., Shanghai 201306, China.
E-mail addresses: gu-yifeng@hotmail.com (Y.-F. Gu), xwchen@shou.edu.cn
(X.-W. Chen), jlzhao@shou.edu.cn (J.-L. Zhao).
1
Yi-Feng Gu and Qun Wei contributed equally to this work.
to defend viral infection (Kawai and Akira, 2006). Classical type I
IFN induction is triggered by recognizing the viral products through
pattern recognition receptors (PRRs) (Takeuchi and Akira, 2007).
Generally, well-known Toll-like receptors (TLRs), such as TLR3,
monitor viruses from the cell surface or within the endosomal
compartment in immune cell lineages (Akira et al., 2006; Meylan
et al., 2006), and RIG-I-like receptors, such as RIG-I and MDA5,
obtain cytosolic viral products in most cell types (Hou et al., 2011;
Kawai and Akira, 2006). Recognition events initiate the recruitment
of various adaptors and signaling transductions, leading to the
activation of TBK1, which phosphorylates IRF3 to induce the tran-
scription of IFN-a and -b, as well as other IFN-induced genes
(Fitzgerald et al., 2003a; Sharma et al., 2003).
IRF3 is a member of the IRF family, including 9 members in
mammals (Barnes et al., 2002; Taniguchi et al., 2001), 10 members
in birds (Huang et al., 2010), and 11 members in fish (Holland et al.,
2008; Li et al., 2014; Xiang et al., 2010). IRF3 is characterized by

http://dx.doi.org/10.1016/j.dci.2015.10.011
0145-305X/© 2015 Elsevier Ltd. All rights reserved.
 Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137
displaying the DNA-binding domain (DBD) in the N-terminal,
basically containing five conserved tryptophan (W) resides forming
a helix-turn-helix motif, which facilitates affinitive binding to the
IFN-stimulated response elements (ISRE) element on the promoter
of IFN-b and ISGs (Honda and Taniguchi, 2006; Paun and Pitha,
2007). In addition to DBD, IRF3 encompasses an IRF association
domain (IAD), which conducts the interaction with other IRF family
members or transcription factors to the promoters of downstream
genes (Bergstroem et al., 2010; Clement et al., 2008; Panne et al.,
2007).
IRF3 function has been extensively studied. IRF3 is demon-
strated to be an indispensable regulator in the induction of type I
IFN followed by viral infection. Stimulated by viral infection, PRRs
mediate signaling transduction and activate TBK1 kinase to phos-
phorylate a couple of serine and threonine residues in the C-ter-
minal serine-rich region of IRF3, in which phosphorylated IRF3 is
translocated to the nuclei and mediates the transcription of IFN-a
and -b, as well as other IFN-induced genes (Fitzgerald et al., 2003a;
Tanaka and Chen, 2012).
Recently, great progress has been made in fish innate immunity,
which is similar to mammalian innate immunity; fish have an IFN
induction system against viral infection (Aggad et al., 2010; Briolat
et al., 2014; Levraud et al., 2007). Fish IFN induction by viral
infection represents antiviral activity and promotes the expression
of ISGs to inhibit viral replication (Lopez-Munoz et al., 2009). A
series of IRFs has been retrieved in the fish genome (Feng et al.,
2011; Hu et al., 2011; Li et al., 2014; Shi et al., 2013; Yao et al.,
2012), among which IRF3 has been reported to play key roles in
modulating IFN response (Holland et al., 2008; Sun et al., 2010). In
the present study, we identified the full-length cDNA of tilapia IRF3,
which is considered the homologue of IRF3 using the protein
structure and phylogenetic analysis. Further experiments
confirmed that tilapia IRF3 is a positive regulator that triggers the
activity of IFN-b and ISRE-containing promoter. The current study
can improve understanding of IFN-associated signaling and
response in fish immunity.
2. Materials and methods
2.1. Experimental fish
Two-month-old tilapia (Oreochromis niloticus) with average
weight of 60 g and 12 cm length of both sexes were raised in
running water at 24  C in large aquariums and fed with brine
shrimp twice a day. The fish were maintained in the laboratory for
three weeks prior to experiments to allow acclimatization and
evaluation of overall health. Only healthy fish were used for
experiment, judging by the following criteria: fish with normal
body color; no bleeding or wounds found at the body surface and
gills; no obvious symptoms of infection by bacteria or fungal; fish
with normal diet; competing for snatching bait. All animal exper-
imental procedures were performed in accordance with the Reg-
ulations for the Administration of Affairs Concerning Experimental
Animals approved and authorized by the State Council of People's
Republic of China.
2.2. Sequence retrieval and molecular cloning of tilapia IRF3
Tilapia IRF3 sequence was found in the tilapia genome of the
UCSC database using zebrafish IRF3 protein sequence
(NP_001137376.1) as probe. The retrieved sequence was validated
by Genscan and BLAST. The testis cDNA for PCR was synthesized by
a BD SMART RACE cDNA Amplification kit (Clontech). To verify
whether IRF3 cDNA is correct and really exist in the Tilapia tissues,
the specific primers (Table 1), Tilapia IRF3-FL-F: 50 -ATG TTA GAA
131
Table 1
The primers used in the present study.
Primer Sequence 50 e30 Use
Tilapia IRF3-FL-F ATGTTAGAAGACGTGTTCGG ORF amplification
Tilapia IRF3-FL-R TCAAATCTGGTTCGGGAAC ORF amplification
IRF3-qPCR-F ACCGACGGCTTTACAGAGAA Real-time PCR
IRF3-qPCR-R TCCTCGTCACTGCAGTCTTT Real-time PCR
IRF3-FLAG-F GCTTCTAGAATGTTAGAAGACGTG Vector construction
IRF3-FLAG-R GCCGGATCCTCAAATCTGGTTCGG Vector construction
b-actin-F TCCACCTTCCAGCAGATGTG Real-time PCR
b-actin-R AGCATTTGCGGTGGACGAT Real-time PCR
GAC GTG TTC GG and Tilapia IRF3-FL-R: 50 -TCA AAT CTG GTT CGG
GAA C were designed based on the predicted sequence of tilapia
IRF3. PCR products were purified by a gel extraction kit (Qiagen)
and cloned into the pMD18-T vector (Takara) for competent cell
transformation. The positive clones were sent out to Invitrogen
Company for sequencing.
2.3. RT-PCR and real-time PCR
Total RNA was extracted using Trizol (Invitrogen) from different
tissues of tilapia. First-strand cDNA synthesis was conducted using
the BD SMART RACE cDNA Amplification kit (Clontech). PCR was
conducted to amplify tilapia IRF3 using a specific primer. The
following PCR conditions were used: initial denaturation at 94  C
for 3 min; followed by 35 cycles of 94  C for 30 s, 55  C for 30 s, and
72  C for 90 s; and a final extension at 72  C for 10 min.
To determine the tissue distribution of tilapia IRF3, total RNA
from various tissues, including brain, gill, skin, head kidney,
spleen, liver, intestine, ovary, and testis, in experimental (10 fish
were intraperitoneally injected with 10 ml of 1 mg/ml poly I:C for
12 h) and control (10 fish with PBS treatment) fish groups was
extracted. Real-time PCR amplification was performed on the Bio-
Rad PCR system using iTaq Universal SYBR Green Supermix (Bio-
Rad) following the manufacturer's instructions. In brief, all real-
time PCR reactions were performed in a 20 ml reaction volume.
The experimental conditions were as follows: initial denaturation
for 20 s at 95  C; 40 cycles for 5 s at 95  C; 15 s at 60  C; and
melting curve analysis using 65  Ce95  C, at 0.5  C increments for
2e5 s. Relative IRF3 mRNA expression was evaluated by the 2DDCT
method with initial normalization of IRF3 against b-actin. In all
experiments, each PCR trial was conducted with triplicate samples
and repeated at least three times. The real-time PCR primer is
shown in Table 1.
2.4. Structural characterization of IRF3 and phylogenetic tree
construction
Multiple alignments were performed with ClustalX program
(version 1.83). The functional domain was validated by SMART
(smart.embl-heidelberg.de). The phylogenetic tree was con-
structed by the neighbor-joining method with MEGA 3.0 for 100
replicates.
2.5. Plasmid construction, transfection, and luciferase assays
To verify the potential function of tilapia IRF3, the over-
expression plasmid was made. Xba I and BamH I restriction sites
were respectively introduced to the upstream and downstream of
IRF3 by PCR amplification with primers IRF3-FLAG-F: 50 - GCT TCT
AGA ATG TTA GAA GAC GTG and IRF3-FLAG-R: 50 - GCC GGA TCC
TCA AAT CTG GTT CGG. The amplified IRF3 with restriction sites
was inserted into pCMV3-FLAG (Sigma) to generate pCMV3-
132 Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

FLAG-IRF3 in which FLAG tag was fused to the N-terminal of
tilapia. For IFN-b luciferase reporter plasmid, human interferon-b
promoter (300 to þ25) was cloned into luciferase vector
(Clontech).
HeLa and 293T cells were maintained in Dulbecco's modified
Eagle's medium supplemented with 10% fetal bovine serum, peni-
cillin (100 U/ml), and streptomycin (100 mg/ml) at 37  C in 5% CO2.
Cells were transfected with plasmid using Lipofectamine 2000 ac-
cording to the manufacturer's protocol.
293T cells were seeded on a 24-well plate and co-transfected
with different doses of pCMV3-FLAG-IRF3, 100 ng of luciferase re-
porter plasmid of human IFN-b promoter or ISRE-containing pro-
moter (Clontech), and 10 ng of pRL-TK (Promega). At 24 h post-
transfection, 293T cells were lysed using Reporter Lysis Buffer
(Promega), and luciferase activity was measured using Dual-
Luciferase Assay Reagent (Promega).
2.6. Cytoplasmic and nuclear fractions, Western blot, and
immunostaining
pCMV3-FLAG-IRF3 was transfected into HeLa cells. At 48 h
post-transfection, whole cell lysates were solubilized in Western
lysis buffer (50 mM TriseHCl (pH 7.4), 250 mM NaCl, 0.5% NP-40),
whereas cytoplasm and nuclei were extracted by hypotonic buffer
(20 mM TriseHCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.1% NP40).
In brief, FLAG-IRF3-transfected HeLa cells were washed twice with
PBS and suspended in hypotonic buffer for 15 min, followed by
centrifugation at 13,000 rpm at 4  C. The supernatant was cyto-
plasmic fraction, and the remaining cell pellets were the nuclei,
which were solubilized in Western lysis buffer. For Western blot,
equal amounts of protein fraction with 25 ml of 1.5 mg/ml were
separated on 10% SDS-PAGE gels and then electrophoretically
transferred to a PVDF membrane. The membrane was blocked

Fig. 1. Structural characterizations of tilapia IRF3. (A) Full-length cDNA of tilapia IRF3. The initiation codon (ATG) and stop codon (TGA) are shown in bold. (B) Deduced amino acid
sequence of tilapia IRF3. (C) Left image: chromosome synteny of three homologous IRF3 genes. Right image: functional domain of IRF3 homologues.
 Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137 133

with 5% bovine serum albumin for 1 h, incubated with rabbit anti-
FLAG antibodies (Cell Signaling #14793, 1:1000 dilution) at room
temperature for 2 h, and incubated with goat anti-Rabbit IgG at
room temperature for 1 h. The membrane was washed three times
with TBST buffer (25 mM TriseHCl (pH 7.5), 150 mM NaCl, and
0.1% Tween 20) and then developed by ECL solution. In addition,
the membranes were also blotted with Tubulin (Cell Signaling
#2144, 1:5000 dilution) and Menin (Bethyl Laboratories, 1:5000
dilution).
For immunostaining, pCMV3-FLAG-IRF3 was transfected into
HeLa cells. At 48 h post-transfection, cells were fixed with 3% (v/v)
formaldehyde for 10 min and then permeabilized with 0.2% Triton
X-100 in PBS for 15 min. The fixed cell was blocked with 5% (v/v)
goat serum at 37  C for 1 h and incubated with rabbit anti-FLAG
antibodies (1:200 dilution) at 37  C for 1 h, followed by FITC-
labeled goat anti-rabbit IgG secondary antibodies at 37  C for 1 h.
Furthermore, the cells were dyed with DAPI (nuclei marker) for
1 min, and the fluorescence image was captured under a fluores-
cent microscope.
2.7. Statistical analysis
Statistical evaluation of differences between experimental
group means was conducted by ANOVA and multiple Student t
tests. The p values *p < 0.05 and **p < 0.01 means statistical
significance. The sample numbers of each group were ten fish of
equal body weight. Data points were analyzed from at least three
independent experiments. All mean values are presented with
the standard deviation.
3. Results
3.1. Characterization of tilapia IRF3
The tilapia IRF3 gene sequence was retrieved by searching the
UCSC genome database with zebrafish IFR3. Based on the searched
sequence, the specific primers were designed to amplify the full-
length cDNA of tilapia IRF3. The nucleotides and deduced amino
acids are shown in Fig. 1A and B. The full-length transcripts of
tilapia IRF3 is 1368 bp long with an ORF of 455 aa, with a theoretical
molecular weight of 51,817.65 and isoelectric point of 5.5.
Tilapia IRF3 displays high homology with various vertebrates
(Fig. 2) containing putative DBD and IAD. The conservation is found
in the signature of four W residues, which constitute the “W clus-
ter” in the DBD. In addition, the conserved serine-rich domain is
predicted in the carboxy-terminal region. Prediction of tilapia IRF3
protein domains by SMART online software indicates the IRF and
IRF3 domains in the N- and C-terminals, respectively, and both
domains are also analogously found in mammals and other teleosts
(Fig. 1C). By blasting the full-length tilapia IRF3 with the corre-
sponding genomic sequences, the organization of IRF3 genes is
illustrated in Fig. 1C. The tilapia gene is located on the chromosome
LG7 within a 4.5 kb genomic fragment containing 10 exons and 9
introns, and the conserved canonical splice sites GT/AT are found at
the 50 and 30 ends of introns. To some degree, the number of IRF3
exons of tilapia differs between teleosts and mammals.

Fig. 2. Multiple alignment of tilapia IRF3 with other homologues. Residues shaded in black are completely conserved across all species, and residues shaded in gray are similar with
respect to side chains. Dashes in the amino acid sequences indicate gaps introduced to maximize alignment. Putative DNA-binding domain (DBD) in the N-terminal and interaction
association domain (IAD) in the C-terminal are underlined. Serine-rich C terminal domain is boxed. Black triangle represents the tryptophan residue clusters.
134 Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

75 Dicentrarchus labrax CBN81356.1 IRF3

51 Larimichthys crocea AFE88606.1 IRF3
Paralichthys olivaceus ACY69212.1 IRF3(V1)
73 73 Scophthalmus maximus ADQ52415.1 IRF3
100 Oncorhynchus mykiss NP 001244191.1 IRF3
99 Salmo salar NP 001165753.1 IRF3
53 Oreochromis niloticus XP 005448376.1 IRF3(like X1)
100 100 Oreochromis niloticus XP 005448377.1 IRF3(like X2)
Oryzias latipes XP 004080549.1 IRF3-like
Cyprinus carpio ADZ55456.1 IRF3

IRF3 Subfamily
69
100 Danio rerio NP 001137376.1 IRF3
100 Xenopus (Silurana) tropicalis XP 002940288.1 IRF3-like
Xenopus laevis NP 001079588.1 IRF3
50 Homo sapiens NP 001562.1 IRF3
100
Mus musculus NP 058545.1 IRF3
100 Rattus norvegicus NP 001006970.1 IRF3
95 97 Bos taurus NP 001098510.1 IRF7
77 Sus scrofa NP 001090897.1 IRF7
100 Homo sapiens NP 004022.2 IRF7(isoform d)
99 Mus musculus NP 001239530.1 IRF7(isoform 3)
100 Rattus norvegicus NP 001028863.1 IRF7
Gallus gallus AAK58583.1 IRF3
100 Gallus gallus NP 990703.1 IRF3
78 100 Cyprinus carpio ADZ55457.1 IRF7
Danio rerio NP 956971.1 IRF7
41 Salmo salar NP 001130020.1 IRF7
99
Oreochromis niloticus XP 003440542.2 IRF3-like
99
Scophthalmus maximus ADQ52413.1 IRF7
89
63
Larimichthys crocea ADD14594.1 IRF7
67 Paralichthys olivaceus ACY69214.1 IRF7
Mus musculus NP 058547.2 IRF6

IRF5 Subfamily
100
70
Rattus norvegicus NP 001102329.1 IRF6
100
Homo sapiens NP 006138.1 IRF6(isoform 1)
Gallus gallus XP 417990.4 IRF6
Danio rerio NP 956892.1 IRF6
100 Gallus gallus NP 001026758.1 IRF5
99 Salmo salar NP 001133324.1 IRF5
65 Danio rerio XP 005164675.1 IRF5(isoform X1)
44 Homo sapiens NP 001092097.2 IRF5
100
Mus musculus NP 001239311.1 IRF5(isoform 1)
97 Rattus norvegicus NP 001100056.1 IRF5
97 Mus musculus NP 001152889.1 IRF9(isoform 1)
100 Rattus norvegicus NP 001012041.1 IRF9
96
Homo sapiens NP 006075.3 IRF9

IRF4 Subfamily
Danio rerio NP 991273.1 IRF9
35 Homo sapiens XP 006721250.1 IRF8(isoform X1)
85 Rattus norvegicus NP 001008722.1 IRF8
98
100 Mus musculus NP 032346.1 IRF8
100
Gallus gallus NP 990747.1 IRF8
Danio rerio NP 001002622.1 IRF8
100 Gallus gallus NP 989889.1 IRF10
35
Danio rerio NP 989889.1 IRF10
52
Salmo salar NP 001133454.1 IRF4
Gallus gallus NP 989630.1 IRF4
100 Homo sapiens NP 001182215.1IRF4(isoform 2)
100 Mus musculus NP 038702.1 IRF4
95 Rattus norvegicus NP 001099578.1 IRF4
Danio rerio NP 001035442.1 IRF1
96 Homo sapiens NP 990527.1 IRF2
IRF1 Subfamily

100 Mus musculus NP 032417.3 IRF2

79 Gallus gallus NP 990527.1 IRF2
100 97 Oncorhynchus mykiss NP 001117910.1 IRF2
100 Salmo salar NP 001239280.1 IRF2
Danio rerio NP 001008614.1 IRF2
100 Oncorhynchus mykiss NP 001117765.1 IRF1
100 100 Salmo salar NP 001239290.1 IRF1
Danio rerio NP 991310.1 IRF1
83 Gallus gallus NP 990746.1 IRF1
0.1
Mus musculus NP 032416.1 IRF1
93
100
Homo sapiens NP 002189.1 IRF1
42 Rattus norvegicus NP 036723.1 IRF1

Fig. 3. Phylogenetic tree of IRF family members was constructed with the neighbor-joining method by Mega 3.0. Node values represent percent bootstrap confidence derived from
100 replicates.
 Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137
3.2. Phylogenetic analysis of IRF3
A phylogenetic tree was constructed by comparing the IRF1-
IRF10 subfamily members of various species using the neighbor-
joining method. The results demonstrated that tilapia IRF3 be-
longs to the IRF3 subfamily with high bootstrap support (Fig. 3).
Noticeably, tilapia IRF3 was found to be merged into the teleost
subgroup, and amphibian and mammalian homologues are clus-
tered into their corresponding subgroups.
3.3. IRF3 mRNA expression profile
Real-time PCR was applied to validate the mRNA expression
trends of tilapia IRF3 in different tissues of healthy and poly I:C
treatment fish. PCR confirmed that tilapia IRF3 was widely
distributed in brain, gill, skin, head kidney, spleen, liver, intestine,
ovary, and testis. After poly I:C stimulation for 12 h, a significant
increase in mRNA expression was observed in most of the tissues
compared with untreated fish (Fig. 4).
3.4. Subcellular localization of tilapia IRF3
To detect the subcellular localization of tilapia IRF3, the N-ter-
minal FLAG-tagged IRF3 over-expression plasmid (pCMV3-FLAG-
IRF3) and empty plasmids (control) were each transfected into
HeLa cells. After 48 h post-transfection, some transfected cells were
lysed for Western blot. Meanwhile, the cytoplasmic and nuclear
fractions of the transfected cells were extracted by hypertonic
buffer. Western blot results proved that tilapia IRF3 protein was
expressed in HeLa cells with correct molecular weight of approxi-
mately 53 kDa (Fig. 5A). Subsequent data indicated that tilapia IRF3
protein was distributed in the cytoplasmic fraction but not in the
nuclear fraction through Western blot (Fig. 5A). Furthermore, the
imaging data of the FITC-anti-FLAG-labeled IRF3 displayed its
cytoplasm subcellular localization in the majority of the transfected
cells (Fig. 5B). Therefore, the findings of biochemistry detection and
fluorescence imaging showed good agreement, which suggested
that tilapia IRF3 was localized in the cytoplasm.
6 and Pitha, 2007). By contrast, one IRF3 domain was also uncov-
* *
PBS
Relative IRF3 expression level
5 Poly I:C
* viral infection (Kawai and Akira, 2006). All these characterizations
4
* other immune responses.
* *
3
* adaptors necessary for antiviral response (Briolat et al., 2014;
2 *
*
1 and is a “natural” stimulant of TLR3 (Fortier et al., 2004). In mam-
0
Fig. 4. Transcriptional induction of tilapia IRF3 with poly I:C stimulation. Real-time
PCR data illustrated the tilapia IRF3 expression pattern in various tissues in control
fish and poly I:C treatment fish. IRF3 mRNA expression was evaluated using real-time
quantitative PCR, and the findings are expressed relative to the gene expression of b-
actin (IRF3/b-actin). Values are the mean ± SEM. The quantitative PCR value was
averaged from three duplicates, each of which contained >10 fish. *p < 0.05.
135
3.5. Tilapia IRF3 up-regulates the interferon-b and ISRE signaling
pathway
The family of IRF transcription factors is believed to play
important roles in the regulation of IFN expression in response to
viral infection and the induction of ISGs. To investigate whether
tilapia IRF3 is involved in the IFN-b and ISRE signaling pathway, the
typical promoter of IFN-b and ISRE-containing dual luciferase re-
porter assay was performed. As shown in Fig. 6A, the dual luciferase
reporter assay showed that the over-expression of tilapia IRF3 in
293T cells significantly activated IFN-b promoter activity compared
with empty vector (p < 0.01). Moreover, the ISRE-containing pro-
moter was further found to be activated in a dose-dependent
manner in the presence of tilapia IRF3 (p < 0.01) (Fig. 6B). These
data strongly suggested that tilapia IRF3 is supposed to be involved
in the IFN signaling pathway in innate immunity.
4. Discussion
Lower vertebrate teleosts evolve to contain the relatively intact
innate immunity system to defend pathogen invasion. Some key
transcription factors are found in teleosts involved in regulating the
immunity response, including NF-kB, JAK-STAT, and IRFs (Zhu et al.,
2013). Notably, IRF3, a main focus in teleosts, is considered an
essential transcription factor regulating IFN expression to defend
viral infection (Holland et al., 2008; Sun et al., 2010). In the present
study, the full-length cDNA of tilapia IRF3 was retrieved, which is
1368 bp long with a prediction of 455 aa. By BLAST analysis of IRF3
cDNA with the UCSC genome database, tilapia IRF3 is found to
consist of 10 exons and 9 introns, similar to the stickleback IRF3 (10
exons, 9 introns) gene (Huang et al., 2010), but it is considerably
different not only with other fish species, such as zebrafish (8 exons
and 7 introns) and Scophthalmus maximus (9 exons and 8 introns)
(Huang et al., 2010) but also different from mammalian human (8
exons and 7 introns) homologues. These differences suggested that
the gene size and exons of IRF3 genes varied among the vertebrates.
Deduced tilapia protein encompassed an IRF domain in the N-
terminal, functioning as a DBD, which is also found in other fish and
mammals (Honda and Taniguchi, 2006; Sun et al., 2010). Similar to
mammals, IRF3 displayed five cluster W residues in DBD, and these
W residues are indispensable for DNA binding in mammals (Paun
ered at the C-terminal, which exerts great influence on activating
the double-stranded RNA-activated factor 1 and defense against
indicated that tilapia IRF3 played key roles in IFN activation and
In mammals, tilapia IRF3 was detected to be constitutively
distributed in various tissues examined. Currently, fish are believed
to contain many molecules of the ligands, receptors, and signaling
Levraud et al., 2007; Zhu et al., 2013). Structurally, poly I:C is
similar to double-stranded RNA, which is present in some viruses
mals, IRF3, which is a downstream adaptor of the TLR3 signaling
pathway, is activated to trigger IFN response by poly I:C stimulation
(Taniguchi et al., 2001). In the present study, similar to other fish
IRF3, tilapia IRF3 was significantly induced upon poly I:C stimula-
tion, suggesting that fish IRF3 might play key roles in viral infection.
Mammalian IRF3 is predominantly distributed in the cytoplasm,
activated, and shuttles to the nuclei following by viral infection or
poly I:C stimulation (Fitzgerald et al., 2003b). However, the nuclei
of fish IRF3 diverge. Crucian carp IR3 is not detectable in nuclei
without any stimulation, but it shows more accumulation in the
nuclei in the presence of poly I:C (Sun et al., 2010). Trout IRF3
136 Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137

Fig. 5. Subcellular localization of tilapia IRF3. (A) FLAG-IRF3 plasmids were transfected into HeLa cells. At 48 h post-transfection, the whole cell lysis, cytoplasm, and nuclei were
extracted for Western blot using FLAG antibodies. As shown in the pictures, IRF3 fused with FLAG tag was ectopically expressed in HeLa cells compared with empty vectors. Further
Western blot results showed that IRF3 expression was predominantly found in the cytoplasmic fraction. Tubulin, cytoplasmic marker. Menin, nuclear marker. WCL, whole cell lysis;
Cy, cytoplasmic fraction; Nu, nuclear fraction. (B) FLAG-IRF3 was transfected into HeLa cells. At 48 h post-transfection, cells were fixed and stained with FITC-anti-FLAG antibodies
and DAPI (nuclear counterstain). As shown in the picture, tilapia IRF3 predominantly resides in the cytoplasm. Bar, 50 mm.

resides both in the cytoplasm and nuclei in the absence of poly I:C tilapia IRF3 was over-expressed in HeLa cells. Subsequent West-
(Holland et al., 2008), and no migration from the cytoplasm to the ern blot confirmed that tilapia was expressed with the correct
nuclei was observed with poly I:C stimulation. In the present study, molecular weight in HeLa cells. Simultaneously, tilapia was found
to investigate the potential roles of tilapia IRF3, the FLAG-tagged to be distributed in the cytoplasmic fraction but not in the nuclear

A B
0.25 0.16
** 0.14
**
IFN Rel. lucif. act.

ISRE Rel. lucif. act.

0.2
0.12
0.15 0.1 **
0.08
0.1
0.06

0.05 0.04 *
0.02
0 0
EV IRF3 IRF3 IRF3 EV IRF3 IRF3 IRF3
200ng 400ng 600ng 200ng 400ng 600ng

Fig. 6. Tilapia IRF3 activates the activity of IFN-b- or ISRE-containing promoter. FALG-IRF3 or empty vector (negative control) along with luciferase reporter plasmids (IFN-b- or
ISRE-containing promoter) and pRL-TK plasmids (internal control reporter) were co-transfected into 293T cells. At 24 h post-transfection, the cells were lysed for luciferase assay.
Reporter assay indicated that tilapia IRF3 was able to activate both IFN-b- (A) and ISRE-containing (B) promoter activity in a dose-dependent manner, suggesting that IRF3 may be
involved in IFN signaling pathway in innate immunity.
 Y.-F. Gu et al. / Developmental and Comparative Immunology 55 (2016) 130e137
fraction. Furthermore, HeLa cells were transfected with FLAG-IRF3,
fixed, and stained with FITC-anti FLAG antibodies. The immuno-
staining images showed that tilapia IRF3 was mainly localized in
the cytoplasm, which mirrored the distribution of tilapia IRF3 in the
cytoplasmic fraction by Western blot. This results suggested that
tilapia IRF3 initially displayed cytoplasm localization in the absence
of viral infection or poly I:C stimulation. The dynamic process by
which tilapia IRF3 shuttles from the cytoplasm to nuclei needs
further studies.
Mammalian IRF3 serves as the key transcriptional factor in
mediating type I IFN-dependent immune responses defending DNA
or RNA viral infection (Honda and Taniguchi, 2006; Taniguchi et al.,
2001). Mammalian IRF3 is proven to activate the mRNA transcrip-
tion of type I IFN genes (IFN-a and -b) and ISGs by binding to the
ISRE on their promoters (Honda and Taniguchi, 2006; Paun and
Pitha, 2007). The potential roles of fish IRF3 in IFN response were
recently confirmed by the evidence that over-expressed fish IRF3
can induce the activity of IFN-b and ISRE-containing promoter
(Holland et al., 2008; Sun et al., 2010). Subsequent luciferase re-
porter assays in this study indicated that the ectopic expression of
tilapia IRF3 could elicit significant activation of IFN-b and ISRE-
containing promoter in mammalian 293T cells. Together with the
characterization of IRF3 function domain, tilapia IRF3 was sug-
gested to be a functional and crucial regulator in the IFN response
signaling pathway.
In this study, the protein structure and expression pattern of
tilapia IRF3 were identified and described. Subcellular localization
and functional characterizations indicated that tilapia IRF3 served
as a regulator in triggering the activity of IFN promoter and ISRE-
containing promoter, notably implicating an evolutionary conser-
vation of the IFN response signaling pathway from fish to mam-
mals. These findings may improve our understanding of innate
immune systems in fish.
Acknowledgments
This research was supported by Grants from the China Agri-
culture Research System (Grant no. CARS-49), Key Laboratory of
Healthy Mariculture for the East China Sea (Grant no:
2013ESHML10) and Shanghai Universities First-class Disciplines
Project of Fisheries.
References
Aggad, D., Stein, C., Sieger, D., Mazel, M., Boudinot, P., Herbomel, P., Levraud, J.P.,
Lutfalla, G., Leptin, M., 2010. In vivo analysis of Ifn-gamma1 and Ifn-gamma2
signaling in zebrafish. J. Immunol. 185, 6774e6782.
Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immu-
nity. Cell 124, 783e801.
Barnes, B., Lubyova, B., Pitha, P.M., 2002. On the role of IRF in host defense. Journal
of interferon & cytokine research. Off. J. Int. Soc. Interferon Cytokine Res. 22,
59e71.
Bergstroem, B., Johnsen, I.B., Nguyen, T.T., Hagen, L., Slupphaug, G., Thommesen, L.,
Anthonsen, M.W., 2010. Identification of a novel in vivo virus-targeted phos-
phorylation site in interferon regulatory factor-3 (IRF3). J. Biol. Chem. 285,
24904e24914.
Briolat, V., Jouneau, L., Carvalho, R., Palha, N., Langevin, C., Herbomel, P.,
Schwartz, O., Spaink, H.P., Levraud, J.P., Boudinot, P., 2014. Contrasted innate
responses to two viruses in zebrafish: insights into the ancestral repertoire of
vertebrate IFN-stimulated genes. J. Immunol. 192, 4328e4341.
Clement, J.F., Bibeau-Poirier, A., Gravel, S.P., Grandvaux, N., Bonneil, E., Thibault, P.,
Meloche, S., Servant, M.J., 2008. Phosphorylation of IRF-3 on Ser 339 generates a
hyperactive form of IRF-3 through regulation of dimerization and CBP
137
association. J. Virol. 82, 3984e3996.
Feng, H., Liu, H., Kong, R., Wang, L., Wang, Y., Hu, W., Guo, Q., 2011. Expression
profiles of carp IRF-3/-7 correlate with the up-regulation of RIG-I/MAVS/TRAF3/
TBK1, four pivotal molecules in RIG-I signaling pathway. Fish Shellfish Immunol.
30, 1159e1169.
Fitzgerald, K.A., McWhirter, S.M., Faia, K.L., Rowe, D.C., Latz, E., Golenbock, D.T.,
Coyle, A.J., Liao, S.M., Maniatis, T., 2003a. IKKepsilon and TBK1 are essential
components of the IRF3 signaling pathway. Nat. Immunol. 4, 491e496.
Fitzgerald, K.A., Rowe, D.C., Barnes, B.J., Caffrey, D.R., Visintin, A., Latz, E., Monks, B.,
Pitha, P.M., Golenbock, D.T., 2003b. LPS-TLR4 signaling to IRF-3/7 and NF-
kappaB involves the toll adapters TRAM and TRIF. J. Exp. Med. 198, 1043e1055.
Fortier, M.E., Kent, S., Ashdown, H., Poole, S., Boksa, P., Luheshi, G.N., 2004. The viral
mimic, polyinosinic:polycytidylic acid, induces fever in rats via an interleukin-
1-dependent mechanism. Am. J. Physiol. Regul. Integr. Comp. Physiol. 287,
R759eR766.
Holland, J.W., Bird, S., Williamson, B., Woudstra, C., Mustafa, A., Wang, T., Zou, J.,
Blaney, S.C., Collet, B., Secombes, C.J., 2008. Molecular characterization of IRF3
and IRF7 in rainbow trout, Oncorhynchus mykiss: functional analysis and tran-
scriptional modulation. Mol. Immunol. 46, 269e285.
Honda, K., Taniguchi, T., 2006. IRFs: master regulators of signalling by Toll-like
receptors and cytosolic pattern-recognition receptors. Nature Rev. Immunol.
6, 644e658.
Hou, F., Sun, L., Zheng, H., Skaug, B., Jiang, Q.X., Chen, Z.J., 2011. MAVS forms func-
tional prion-like aggregates to activate and propagate antiviral innate immune
response. Cell 146, 448e461.
Hu, G.B., Xia, J., Lou, H.M., Chen, X.L., Li, J., Liu, Q.M., 2011. An IRF-3 homolog that is
up-regulated by DNA virus and poly I: C in turbot, Scophthalmus maximus. Fish
Shellfish Immunol. 31, 1224e1231.
Huang, B., Qi, Z.T., Xu, Z., Nie, P., 2010. Global characterization of interferon regu-
latory factor (IRF) genes in vertebrates: glimpse of the diversification in evo-
lution. BMC Immunol. 11, 22.
Kawai, T., Akira, S., 2006. Innate immune recognition of viral infection. Nat.
Immunol. 131e137.
Levraud, J.P., Boudinot, P., Colin, I., Benmansour, A., Peyrieras, N., Herbomel, P.,
Lutfalla, G., 2007. Identification of the zebrafish IFN receptor: implications for
the origin of the vertebrate IFN system. J. Immunol. 178, 4385e4394.
Li, S., Lu, L.F., Feng, H., Wu, N., Chen, D.D., Zhang, Y.B., Gui, J.F., Nie, P., Zhang, Y.A.,
2014. IFN regulatory factor 10 is a negative regulator of the IFN responses in
fish. J. Immunol. 193, 1100e1109.
Lopez-Munoz, A., Roca, F.J., Meseguer, J., Mulero, V., 2009. New insights into the
evolution of IFNs: zebrafish group II IFNs induce a rapid and transient
expression of IFN-dependent genes and display powerful antiviral activities.
J. Immunol. 182, 3440e3449.
Meylan, E., Tschopp, J., Karin, M., 2006. Intracellular pattern recognition receptors in
the host response. Nature 442, 39e44.
Mogensen, T.H., 2009. Pathogen recognition and inflammatory signaling in innate
immune defenses. Clin. Microbiol. Rev. 22, 240e273. Table of Contents.
Panne, D., McWhirter, S.M., Maniatis, T., Harrison, S.C., 2007. Interferon regulatory
factor 3 is regulated by a dual phosphorylation-dependent switch. J. Biol. Chem.
282, 22816e22822.
Paun, A., Pitha, P.M., 2007. The IRF family, revisited. Biochimie 89, 744e753.
Sharma, S., tenOever, B.R., Grandvaux, N., Zhou, G.P., Lin, R., Hiscott, J., 2003. Trig-
gering the interferon antiviral response through an IKK-related pathway. Sci-
ence 300, 1148e1151.
Shi, J., Zhang, Y.B., Zhang, J.S., Gui, J.F., 2013. Expression regulation of zebrafish
interferon regulatory factor 9 by promoter analysis. Dev. Comp. Immunol. 41,
534e543.
Sun, F., Zhang, Y.B., Liu, T.K., Gan, L., Yu, F.F., Liu, Y., Gui, J.F., 2010. Characterization of
fish IRF3 as an IFN-inducible protein reveals evolving regulation of IFN response
in vertebrates. J. Immunol. 185, 7573e7582.
Takeuchi, O., Akira, S., 2007. Recognition of viruses by innate immunity. Immunol.
Rev. 220, 214e224.
Tanaka, Y., Chen, Z.J., 2012. STING specifies IRF3 phosphorylation by TBK1 in the
cytosolic DNA signaling pathway. Sci. Signal. 5, ra20.
Taniguchi, T., Ogasawara, K., Takaoka, A., Tanaka, N., 2001. IRF family of transcription
factors as regulators of host defense. Annu. Rev. Immunol. 19, 623e655.
Xiang, L.X., He, D., Dong, W.R., Zhang, Y.W., Shao, J.Z., 2010. Deep sequencing-based
transcriptome profiling analysis of bacteria-challenged Lateolabrax japonicus
reveals insight into the immune-relevant genes in marine fish. BMC Genom. 11,
472.
Yao, C.L., Huang, X.N., Fan, Z., Kong, P., Wang, Z.Y., 2012. Cloning and expression
analysis of interferon regulatory factor (IRF) 3 and 7 in large yellow croaker,
Larimichthys crocea. Fish Shellfish Immunol. 32, 869e878.
Zhu, L.Y., Nie, L., Zhu, G., Xiang, L.X., Shao, J.Z., 2013. Advances in research of fish
immune-relevant genes: a comparative overview of innate and adaptive im-
munity in teleosts. Dev. Comp. Immunol. 39, 39e62.