See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/51686479

Biogeographic disjunction between Eastern Asia and North America in the

Adiantum pedatum complex (Pteridaceae)

Article in American Journal of Botany · September 2011

DOI: 10.3732/ajb.1100125 · Source: PubMed

CITATIONS READS

35 861

6 authors, including:

Jin-mei lu De-Zhu Li
Kunming Istitute of Botany, CAS, Kunming, China Kunming Institute of Botany CAS
23 PUBLICATIONS 436 CITATIONS 741 PUBLICATIONS 19,593 CITATIONS

SEE PROFILE SEE PROFILE

Akiko Soejima Tingshuang Yi

Kumamoto University Kunming Insitute of Botany, Chinese Academy of Sciences
44 PUBLICATIONS 4,108 CITATIONS 125 PUBLICATIONS 6,741 CITATIONS

SEE PROFILE SEE PROFILE

All content following this page was uploaded by Jin-mei lu on 11 April 2014.

The user has requested enhancement of the downloaded file.

 American Journal of Botany 98(10): 1680–1693. 2011.

BIOGEOGRAPHIC DISJUNCTION BETWEEN EASTERN ASIA AND

NORTH AMERICA IN THE ADIANTUM PEDATUM COMPLEX
(PTERIDACEAE)1
Jin-Mei Lu2–4, De-Zhu Li2,3, Sue Lutz4, Akiko Soejima5, Tingshuang Yi3,
and Jun Wen4,6
2Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming,

Yunnan 650204, China; 3Plant Germplasm and Genomics Center, Germplasm Bank of Wild Species, Kunming, Yunnan 650204,
China; 4Department of Botany, National Museum of Natural History, MRC 166, Smithsonian Institution, Washington, D.C.
20013-7012 USA; 5Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami,
Kumamoto 860-8555, Japan

• Premise of the study: Biogeographic analyses of ferns with an eastern Asian–North American disjunction are few. The
Adiantum pedatum complex has such a disjunct distribution. The monophyly of the complex needs to be tested and diversifica-
tion history of the four species needs to be reconstructed.
• Methods: Plastid (atpA, atpB, rbcL, trnL-F, and rps4-trnS) sequences of 100 accessions representing the biogeographic diversity
of Adiantum were analyzed with parsimony and Bayesian inference. Biogeography of the Adiantum pedatum complex was
inferred using programs DIVA and LAGRANGE. Divergence times of clades were estimated with the program BEAST.
• Key results: The A. pedatum complex is monophyletic and sister to the eastern Asian A. edentulum. Accessions of A. pedatum
do not form a clade; instead three subgroups are recognizable. The clade of A. aleuticum and A. viridimontanum is nested within
A. pedatum. The Asian A. myriosorum is sister to the A. pedatum-A. aleuticum clade. Both DIVA and LAGRANGE analyses
suggest an eastern Asian origin of the A. pedatum complex. The age of the crown A. pedatum complex is dated to be at 4.27
(2.24–6.57) million years ago.
• Conclusions: The currently recognized eastern Asian–North American disjunct species A. pedatum needs to be segregated into
three species, corresponding to populations in eastern North America, China, and Japan. The eastern Asian–North American
disjunction in the complex is inferred to be the result of two intercontinental migrations, one from eastern Asia into North
America in the late Tertiary and the other from North America back to eastern Asia in the Pleistocene.

Key words: Adiantum pedatum; biogeography; eastern Asia; eastern North America; North America; intercontinental
disjunction; phylogeny; Pteridaceae.

The intercontinental disjunctions between eastern Asia
(EA) and North America (NA) have attracted much attention
from evolutionary biologists in the last two decades (Parks and
Wendel, 1990; Wen, 1998, 1999; Xiang et al., 1998; Manchester,
1999; Manos and Donoghue, 2001; Donoghue and Smith, 2004;
Wen et al., 2010). The EA-NA disjunction was suggested to
have involved multiple historical events at different geologic
times in different groups (Tiffney, 1985a, b; Manchester, 1999;
Wen, 1998, 1999; Xiang et al., 1998). Many recent phyloge-
1 Manuscript received 18 March 2011; revision accepted 27 June 2011.
The authors thank L. Janeway, M. Stensvold, T. Heutte, T. Oka, T.
Satoshi, and B. D. Liu for sample collection, E. A. Zimmer for providing
primers, and J. Hunt, R. Li, Y. J. Zuo, and L. Xie for their assistance in the
laboratory.
The study was supported by grants from the John D. and Catherine T.
MacArthur Foundation (to J. Wen, R. Ree, and G. Mueller), National Basic
Research Program of China (973 Program, grant no. 2007CB411601), the
National Natural Science Foundation of China (grant nos. 30828001,
31070199, and 30800063), the Project of Knowledge Innovation Program
of the Chinese Academy of Sciences (grant no. 2010KIBA02), the Re-
search Fund for the Large-Scale Scientific Facilities of the Chinese Acad-
emy of Sciences (grant no. 2009-LSF-GBOWS-01), and the project
sponsored by SRF for ROCS, SEM.
6 Author for correspondence (e-mail: wenj@si.edu)
doi:10.3732/ajb.1100125
American Journal of Botany 98(10): 1680–1693, 2011; http://www.amjbot.org/ © 2011 Botanical Society of America
netic analyses were conducted to better understand this inter-
continental disjunct pattern using phylogenetic analyses, fossil-
calibrated molecular dating, and reconstruction of ancestral
geographic ranges. Analyses so far have emphasized seed
plants (reviewed in Wen et al., 2010).
Biogeographic analyses on ferns are relatively few in general
in comparison with those on seed plants and animals. Some re-
cent biogeographic studies were carried out on Australasian
ferns (Perrie et al., 2003) and Hawaiian ferns (e.g., Geiger and
Ranker, 2005; Driscoll and Barrington, 2007; Geiger et al.,
2007). Most disjunctions between eastern Asia and North
America in flowering plants are at the generic level or among
species groups, whereas most fern taxa are closely related spe-
cies or even the same species (Li, 1952; Wen, 1999). Iwatsuki
and Ohba (1994) recorded five taxa distributed exclusively in
eastern North America and Japan. Iwatsuki (1994) included 10
species occurring only in North America and Japan. Zang
(1998) reported four genera disjunct between China and North
America. Osmunda has a long evolutionary history with fossils
fronds nearly identical to those of the living O. claytoniana dat-
ing back to the Triassic (Phipps et al., 1998). Both Osmunda
claytoniana and Osmundastrum cinnamomeum occur in North
America and eastern Asia (Iwatsuki, 1994; Iwatsuki and Ohba,
1994). The phylogenetic analysis and classification of Osmun-
daceae by Metzgar et al. (2008) provided important insights
into the biogeographic divergence within this ancient family.

1680
October 2011] Lu et al.—Biogeographic disjunction in the ADIANTUM PEDATUM complex
Onoclea is distributed in eastern Asia and eastern North Amer-
ica, but fossils referable to Onoclea were widely distributed in
the northern hemisphere during the Cretaceous and early Ter-
tiary (Kato, 1993). Onoclea sensibilis is native to North Amer-
ica and eastern Asia and has become naturalized in western
Europe, with two varieties recognized: var. interrupta in east-
ern Asia and var. sensibilis in eastern North America (Iwatsuki
and Ohba, 1994). The walking ferns are another well-known
example showing the disjunction between these two continents.
The eastern North American Asplenium rhizophyllum and the
eastern Asian A. ruprechtii (i.e., Camptosorus sibiricus Rupr.)
inhabit similarly shaded cliffs and mossy boulders and possess
the same “walking” habit (Kato, 1993; Judd et al., 2008). In the
Adiantum pedatum complex (Pteridaceae), the eastern Asian
populations are often inferred to be sister to all North American
populations (e.g., Lee et al., 1996; Xiang et al., 1998; Wen,
1999). Kato (1993) suggested that the eastern Asian–eastern
North American disjunct pattern in some fern taxa may have
arisen multiple times via complex climatic and geologic
events.
Adiantum comprises 150–200 species, with a wide distribu-
tion except in extremely cold or dry regions (Ching, 1957;
Tryon and Tryon, 1982; Lin, 1990; Tryon et al., 1990; Paris,
1993; Hoshizaki and Moran, 2001). Most species of this genus
occur in tropical to subtropical regions, with the greatest diver-
sity in the neotropics (Huiet and Smith, 2004). Recent analyses
suggest that Adiantum may be paraphyletic (Schuettpelz and
Pryer, 2007; Bouma et al., 2010). The Adiantum pedatum com-
plex includes four species distributed in North America and
eastern Asia extending to the Himalayas (Fig. 1). This complex
is characterized by its pedately divided frond in clusters from
the clump-forming rhizome. The A. pedatum complex contains the
northernmost taxa in Adiantum and can extend to Sitka (57° N),
Fig. 1. Distribution of the Adiantum pedatum complex showing biogeographic disjunctions between eastern Asia and North America (modified from
Paris, 1991b). Adiantum pedatum: red; A. myriosorum: green; A. aleuticum: blue; and A. viridimontanum: yellow.
1681
Alaska in North America [Adiantum aleuticum (Rupr.) C.A.
Paris] and to Xiaoxinganling (50° N) of Heilongjiang province
of China in eastern Asia (A. pedatum L.). There are two species
(A. pedatum and A. myriosorum Baker) in eastern Asia, three
species (A. pedatum, A. aleuticum, and A. viridimontanum
C. A. Paris) in eastern North America, and only A. aleuticum in
western North America (Lin, 1990; Paris, 1993). Adiantum viri-
dimontanum has been proposed as an allotetraploid derivative
of a sterile hybrid between A. pedatum and A. aleuticum (Paris
and Windham, 1988), and it is restricted to north-central Ver-
mont, USA and adjacent southern Quebec, Canada (Paris,
1991a).
The Adiantum pedatum complex has received much attention
from botanists. Paris and Windham (1988) showed that the
eastern serpentine maidenhair is a disjunct element of the west-
ern North American A. aleuticum, and A. pedatum in eastern
Asia and eastern North America exhibits little morphological
differentiation. Adiantum pedatum and A. myriosorum are mor-
phologically highly distinct (Lin, 1990). Therefore, the A. pe-
datum complex may provide some unique insights into the rates
of molecular and morphological evolution of disjunct ferns be-
tween eastern Asia and North America. Paris (1991b) reported
three diploid lineages, a Japanese lineage, a western North
American lineage, and an eastern North American lineage, in
the A. pedatum complex; however, the relationships among the
three lineages were not resolved. She proposed that A. aleuti-
cum and the Japanese species shared a common ancestor. Paris
(1991b) hypothesized that the A. pedatum complex arose as a
component of the mixed mesophytic forest that was widespread
throughout the northern hemisphere during much of the Ter-
tiary, and the ancestor of the A. aleuticum-Japanese species was
from eastern Asia and migrated to western North America
through the Bering land bridge in the late Tertiary. Nakato and
1682 American Journal of Botany
Kato (2005) proposed it is likely that the x = 29 diploid(s) origi-
nated within the x = 30 diploid populations of the Adiantum
pedatum complex in Asia, then spread to North America via the
Bering land bridge during the late Tertiary and the Quaternary.
Our objectives for this study were to (1) elucidate the phylo-
genetic relationships among the four species of the complex
and (2) explore the biogeographic diversification of interconti-
nental disjunctions of this complex. We employed sequences of
five chloroplast markers (atpA, atpB, rbcL, trnL-F, and rps4-
trnS) and examined all four species of the A. pedatum complex
and their close relatives.
MATERIALS AND METHODS
Taxon sampling—We sampled all four species of the A. pedatum complex
from both eastern Asia and North America. To test the monophyly of the com-
plex and provide a broader phylogenetic framework to estimate divergence
times of clades, we sampled 100 accessions representing 41 species and variet-
ies and 12 unidentified taxa covering the biogeographic diversity of Adiantum.
All taxa included in this study, together with voucher information and collec-
tion sites, are listed in Appendix 1.
DNA extraction, amplification, and sequencing—Total DNAs were ex-
tracted from 15 mg of silica-gel-dried leaf material using Dneasy (QIAGEN,
Santa Clara, California, USA) extraction kits. All amplifications were per-
formed in a 25-µL reaction mixture using primers as shown in Table 1. The
PCR reactions contained 1 U Taq DNA polymerase (Bioline, Taunton, Massa-
chusetts, USA), 10× buffer, 0.25 mmol/L dNTP, 1.5 mmol/L Mg2+, 0.5 mmol/L
of each primer, 1 mg/ml BSA, and 25–60 ng sample DNA. For atpA and atpB,
reactions were incubated at 95°C for 3 min, then cycled 35 times (95°C for 1
min, 50°C for 1 min, 72°C for 100 s), followed by a final extension for 10 min
at 72°C. For rbcL and trnL-F, reactions were incubated at 95°C for 3 min, then
cycled 35 times (95°C for 1 min, 51°C for 1 min, 72°C for 80 s), followed by a
final extension for 10 min at 72°C. For rps4-trnS, reactions were incubated at
95°C for 3 min, then cycled 35 times (94°C for 30 s, 58°C for 45 s, 72°C for 80 s),
followed by a final extension for 10 min at 72°C.
The PCR products were purified using the polyethylene glycol (PEG)–NaCl
method of Kusukawa et al. (1990). Sequencing reactions were conducted with
BigDye Terminator v3.1 Cycle Sequencing chemistry (Applied Biosystems,
Foster City, California, USA), and the sequencing reactions were run on an ABI
3730 automated sequencer (Applied Biosystems). Total reaction volume was
10 µL (1 µL PCR template, 1.75 µL 5× Sequencing Buffer, 0.5 µL primer
[5 µmol/L], 0.25 µL BigDye Terminator, and 6.5 µL ddH2O).
The resulting sequences were assembled using the program Sequencher
4.8 (Gene Codes Corp., Ann Arbor, Michigan, USA). Sequences obtained
in this study have been deposited in GenBank (Appendix 1). They were
aligned using the program CLUSTAL_X version 1.83 (Thompson et al.,
1997), followed by manual adjustments using the program Se-Al v.2.0a11
(Rambaut, 2007).
Table 1. Primers used in this study, including sequences, target regions, and references.
Primer names Primer sequences (5′-3′)
ESATPF412F GARCARGTTCGACAGCAAGT
ESATPA535F ACAGCAGTAGCTACAGATAC
ESATPA877R CATCTCCCGGATATGCTTCTCG
ESTRNR46F GTATAGGTTCRARTCCTATTGGACG
ESATB172F AATGTTACTTGTGAAGTWCAACAAT
ESATPE45R ATTCCAAACWATTCGATTWGGAG
RbcL-1F ATGTCACCACAAACAGAAACTAAAGCAAGT
RbcL-1379R TCACAAGCAGCAGCTAGTTCAGGACTC
TrnLF-c CGAAATCGGTAGACGCTACG
TrnLF-f ATTTGAACTGGTGACACGAG
TrnLF-p1 TCAAGTGGYAGCCCCCAGATTC
trnS TTACCGAGGGTTCGAATCCCTC
rps4.5 ATGTCSCGTTAYCGAGGACCT
[Vol. 98
Phylogenetic analyses—Phylogenetic trees were constructed using maxi-
mum parsimony (MP) and Bayesian Markov chain Monte Carlo (MCMC) in-
ference (BI; Yang and Rannala, 1997). The MP analysis was performed using
the program PAUP* version 4.0b10 (Swofford, 2003), treating gaps as missing
data and using the heuristic search options with 1000 random replicates, step-
wise data addition, tree-bisection-reconnection (TBR) swapping and MulTrees
option on. Bootstrap analysis (Felsenstein, 1985) was performed with 1000 rep-
licates to evaluate internal support, with 100 random taxon addition replicates
saving all optimal trees at each step. It is difficult to code the indel in a matrix
including many outgroups, and we conducted an additional analysis based on
a small data set excluding Vittaria and most tropical Adiantum species and
coded all informative indels as binary or multistate characters (Simmons and
Ochoterena, 2000).
The optimal model of molecular evolution was determined by the Akaike
information criterion (AIC) using the program MODELTEST version 3.7
(Posada and Crandall, 1998; Posada and Buckley, 2004). Bayesian analyses
were implemented in the program MrBayes 3.1 (Ronquist and Huelsenbeck,
2003) with the model GTR+I+G. We used four chains, with random initial
trees. Trees were generated for 2 000 000 generations, sampling every 100 gen-
erations. Trees sampled before stable posterior probability (PP) values had been
reached were excluded from consensus as a burn-in phase (initial 20% of the
sampled trees). Nodes receiving bootstrap support (BS) of <70% in the MP
analyses, or PP of <0.95 in the BI analyses, were not considered as well
supported.
Congruence between plastid data sets was tested using the incongruence
length difference (ILD) test (Farris et al., 1994), as implemented by the parti-
tion homogeneity test in PAUP* for 100 replicates (heuristic search, simple
addition, TBR branching swapping), each saving a maximum of 100 trees per
replicate (Norup et al., 2006).
Biogeographic analyses—The dispersal–vicariance (DIVA) (Ronquist,
1996) and the maximum likelihood-based analyses with the program
LAGRANGE (Ree and Smith, 2008) were performed to infer the biogeographic
diversification history of the A. pedatum complex. Seven areas of endemism
were defined to reflect our emphasis on intercontinental diversification of Adi-
antum: EA, NA, New Zealand and Australia, tropical America, tropical Asia,
continental Africa, and Madagascar. The program DIVA reconstructs ancestral
distributions in a given phylogeny without any prior assumptions about area
relationships, and considers vicariance, dispersal and extinction as viable bio-
geographic events (Ronquist, 1996, 1997). The DIVA analyses were conducted
using DIVA version 1.1 (Ronquist, 1996). Ancestral areas were inferred with
the ‘‘maxareas’’ constrained to 2 because few species (e.g., A. capillus-veneris)
occur in more than two areas (Donoghue et al., 2001). LAGRANGE version 2.0
(Ree and Smith, 2008) was employed to run the analysis with a simple model
of one rate of dispersal and extinction constant over time and among lineages.
The program cannot only find the most likely ancestral areas at a node and the
split of the areas in the two descendant lineages, it also calculates the probabili-
ties of the most likely areas at each node (Ree et al., 2005; Ree and Smith,
2008). Analyses were conducted on an ultrametric tree estimated using the log-
normal relaxed clock model (Drummond et al., 2006) implemented in an
MCMC with the program BEAST version 1.4.8 (Drummond and Rambaut,
2007), using the ML tree as the start tree and a GTR+I+G model of nucleotide
substitution, with a total run of 10 million generations. This tree was imported
Target region References
atp A Schuettpelz et al. (2006)
atp A Schuettpelz et al. (2006)
atp A Schuettpelz et al. (2006)
atp A Schuettpelz et al. (2006)
atpB Schuettpelz and Pryer (2007)
atpB Schuettpelz and Pryer (2007)
rbcL Little and Barrington (2003)
rbcL Little and Barrington (2003)
trnL-F Taberlet et al. (1991)
trnL-F Taberlet et al. (1991)
trnL-F Lu et al. (2005)
rps4-trnS Shaw et al. (2005)
rps4-trnS Souza-Chies et al. (1997)
October 2011] Lu et al.—Biogeographic disjunction in the ADIANTUM PEDATUM complex 1683

Fig. 2. Strict consensus tree of four maximally parsimonious trees derived from the analysis of atpA, atpB, rbcL, trnL-F, and rps4-trnS sequences
(tree length = 6028 steps, CI = 0.543, and RI = 0.909). The bootstrap values for 1000 replicates are shown above the branches, the Bayesian posterior prob-
abilities are shown below the branches. ENA, eastern North America.
1684 American Journal of Botany
into LAGRANGE 2.0 (Ree and Smith, 2008) using the LAGRANGE configu-
ration module.
Molecular dating—The combined data set of rbcL/atpA/atpB was used to
date the divergence times of the Adiantum pedatum complex. Sequences of 25
species were downloaded from GenBank (Appendix 2). Time estimates were
made based on a relaxed molecular clock and fossil data. Bayesian dating ap-
proaches, based on a relaxed clock model, were used in the time estimates
(Drummond et al., 2006).
The Bayesian coalescent approach to estimating the divergence times of
each clade in Adiantum and their credibility intervals was implemented in the
program BEAST 1.4.8 (Drummond and Rambaut, 2007), which employs a
Bayesian MCMC to co-estimate topology, substitution rates, and node ages.
Two tree prior models (constant size and exponential growth) were imple-
mented in each analysis, with rate variation across branches assumed to be un-
correlated and lognormally distributed (Drummond et al., 2006). The final
estimates were obtained using the model that yielded the highest posterior prob-
ability. Posterior distributions of parameters were approximated using three
independent MCMC analyses of 20 000 000 generations with 10% burn-in. The
convergence of three analyses was checked using the program Tracer 1.4 and
three chains, which yielded similar results were combined by the program Log-
Combiner v1.4.8 (Drummond and Rambaut, 2007).
Fossil calibration—The earliest and the most reliable fossil assigned to
Pteridaceae is Pteris sp. from the mid-Cenomanian fish beds of Nammoura,
Lebanon (Krassilov and Bacchia, 2000). The Cenomanian is dated to about
99.6–93.5 Ma (million years ago) (De Bodt et al., 2005). Although the pinnule
morphology and the presence of pseudoindusia allow the fossil to be assigned
to the extant genus Pteris, such forked leaves can occasionally occur in the vit-
tarioids. Schneider et al. (2004) used additional calibration points and obtained
the molecular age 97.41(100.75 ± 6.72) Myr for the pteridoids (PT) (node 16 in
fig. 1 of Schneider et al., 2004, i.e., the crown of Pteridaceae), thus we used 93.5
Myr to calibrate the crown of Pteridaceae. The oldest fossil record of Acrosti-
chum was discovered in the Deccan Intertrappean beds of India from the Maas-
trichtian (Bonde and Kumaran, 2002). The Maastrichtian is the last stage of the
Cretaceous period, which spanned from 70.6 ± 0.6 Ma to 65.5 ± 0.3 Ma. There-
fore, we used 65.2 Ma as the lower bound to constrain the crown of the ceratop-
teridoids clade (CE). Furthermore, we used 93.5 Ma to constrain the divergence
time between pteridoid and eupolypod ferns, and 65.2 Ma to calibrate the diver-
gence time between the CE clade and the PT clade (see Schuettpelz et al., 2007)
as in Schneider et al. (2004) (also see Pryer et al., 2004; Schuettpelz and Pryer,
2009).
Schneider et al. (2004) used a middle Eocene fossil of Hewardia regia
Gardner and Ettingsh. to constrain the divergence of the cheilanthoid and the
adiantoid ferns. Hewardia J. Smith was sometimes considered to be the closest
relative of Adiantum (e.g., Lin, 1990) and was even treated as a synonym of
Adiantum (Tryon and Tryon, 1982; Tryon et al., 1990). However, this fossil
was not used as a calibration point in our analysis because Gardner and Etting-
shausen (1879–1882) noted that even the nearest living species differed very
widely from the fossil, Chandler (1963) considered its determination to Hewar-
dia as doubtful, and Collinson (2001) suggested that the record of Hewardia
regia is best considered as unconfirmed. This fossil is thus not used as a calibra-
tion point in our analysis.
RESULTS
Phylogenetic analyses— The topologies derived from analy-
ses of the individual data sets were similar to those obtained
from the combined data. We thus emphasized the result of the
combined data. The five-marker data set had a total length of
6028 nucleotides and included 99 accessions. This data set con-
Fig. 3. Biogeographic analyses of the Adiantum pedatum complex and its close relatives were based on the DIVA (shown above the branches) and the
ML (shown below the branches) analyses (A: eastern Asia, B: North America, C: New Zealand and Australia, D: tropical America, E: tropical Asia, F:
continental Africa, G: Madagascar). The optimal ancestral areas at each node presented under LAGRANGE are the ones with the highest likelihood scores
and the highest probabilities among the alternatives. The probabilities of other solutions with likelihood scores nearly equal to the highest are much lower,
thus are not presented. A slash in the result under LAGRANGE indicates the split of areas in two daughter lineages, i.e., left/right, where ‘‘left” and ‘‘right”
are the ranges inherited by each descendant branch (‘‘left” is the upper branch, and ‘‘right” the lower branch).
[Vol. 98
tained 2341 variable sites (38.8%), of which 1994 were phylo-
genetically informative (33.1%). The MP analysis on the
five-marker data set yielded four maximally parsimonious trees
of 5806 steps, a consistency index (CI) of 0.543, and a retention
index (RI) of 0.909.
The strict consensus of the four most parsimonious trees
(Fig. 2) revealed the monophyly of the adiantoid clade (i.e.,
the AD clade, BS, 100; PP, 1.00) as well as Adiantum (BS,
100; PP, 0.93). Adiantum taxa from the temperate regions
formed two clades (clade I and clade II) nested within a large
pantropical grade (Fig. 2). The temperate clade I consisted of
the Adiantum pedatum complex plus the eastern Asian A.
edentulum.
Our analysis strongly supported the monophyly of the A. pe-
datum complex (BS, 99; PP, 1.00) (Fig. 2). The eastern Asian
A. edentulum was sister to the A. pedatum complex (BS, 99; PP,
1.00). The Asian A. myriosorum was sister to the A. pedatum-A.
aleuticum clade (BS, 99; PP, 1.00). The sister relationship be-
tween the Chinese A. pedatum group and the A. aleuticum group
was supported by posterior probability (PP, 0.97) but only
weakly supported by bootstrap value (BS, 52), and A. viridi-
montanum was nested within A. aleuticum. The eastern North
American A. pedatum group was sister to the clade of Chinese
A. pedatum-A. aleuticum-A. viridimontanum (BS, 99; PP, 1.00).
The Japanese A. pedatum was sister to the aggregate of other
taxa of the complex except for A. myriosorum (BS, 99; PP,
1.00).
The small five-marker data set had 5900 nucleotides and 34
indels and included 74 accessions. This data set contained 1743
variable sites (29.4%), of which 1394 were phylogenetically
informative (23.5%). The MP analysis on the small five-marker
data set yielded two maximally parsimonious trees of 3238
steps, a consistency index (CI) of 0.655, and a retention index
(RI) of 0.937.
The overall topology of the five-marker trees based on small
data set was similar to Fig. 2 concerning major clades; thus,
the figure was not presented here. The analysis also strongly
supported the monophyly of the A. pedatum complex (BS,
100; PP, 1.00). The close relationship between the A. prin-
ceps-A. tenerum clade and the aggregate of the temperate
clade I and one Adiantum species from Central America (Wen
6773) was strongly supported (BS, 98; PP, 0.99). The sister
relationship between the Chinese A. pedatum group and the A.
aleuticum group was also supported by posterior probability
(PP, 0.96).
Biogeographic analyses— The DIVA and the maximum
likelihood analyses using LAGRANGE suggested that the an-
cestral area of the A. pedatum complex was eastern Asia and
that it subsequently migrated into North America (Fig. 3). Then
the ancestor of the Chinese A. pedatum-A. aleuticum clade dis-
persed from North America back to eastern Asia.
Divergence times of the Adiantum pedatum complex— The
divergence of the AD clade (including Adiantum, Vittaria,
→
October 2011] Lu et al.—Biogeographic disjunction in the ADIANTUM PEDATUM complex 1685
1686 American Journal of Botany
Rheopteris, and their allied groups) from the cheilanthoids was
estimated to be 73.73 (60.79–85.19) Ma. The divergence of
Adiantum from the vittarioids was estimated to be 61.74 (48.15-
74.15) Ma. The crown Adiantum was dated to be 50.53 (36.88-
64.02) Ma (Fig. 4).
The divergence of the A. pedatum complex from A. edentu-
lum was estimated to be 6.7 (3.59–10.26) Ma, and the crown of
the A. pedatum complex was dated to be 4.27 (2.24–6.57) Ma
(Fig. 4, Table 2). The divergence between the Japanese A. pe-
datum and the A. aleuticum-Chinese A. pedatum-eastern North
American A. pedatum clade was 2.87 (1.39–4.64) Ma. The di-
vergence of the eastern North American A. pedatum and the
Chinese A. pedatum-North American A. aleuticum clade was
estimated to be 1.25 (0.52–2.11) Ma. The divergence between
the Chinese A. pedatum and the North American A. aleuticum
clade was 0.81(0.28–1.41) Ma.
The divergence of the A. pedatum complex was estimated to
be 5.76 (3.07–8.95) Ma, and the crown of the A. pedatum com-
plex was dated to be 3.69 (1.9–5.68) Ma (Table 2) when the
second calibration scheme (93.5 Ma for the divergence time
between pteridoid and eupolypod ferns and 65.2 Ma for the di-
vergence time between the CE clade and the PT clade) was
used.
DISCUSSION
Phylogenetic position and relationships of the Adiantum
pedatum complex— The Adiantum pedatum complex is sup-
ported as a monophyletic group (BS, 99; PP, 1.00, Fig. 2). The
monophyly of the clade is also defined by morphological syna-
pomorphies of fan-shaped blade and glabrous stipes and ra-
chises, and one indel CCAGC. Within the A. pedatum complex,
the eastern Asian A. myriosorum is sister to the A. pedatum-A.
aleuticum (including A. viridimontanum) clade with strong sup-
port (BS, 99; PP, 1.00; Fig. 2). Morphologically, A. pedatum
and A. myriosorum can be distinguished easily. The lower leaf
surface of A. myriosorum is glaucous (vs. green in A. pedatum).
The lobes at segment apices have sharply triangular serrate
teeth in A. myriosorum (vs. obtuse in A. pedatum). The sinuses
at acroscopic margin of segment are shallow in A. myriosorum,
whereas they are deep (1/3–1/2) in A. pedatum (Lin, 1990). Fur-
thermore, there is a significant ecological difference in the two
Asian maidenhair species. Adiantum myriosorum is an under-
story component in thermophilic forests in lower latitudes in
Central and southwestern China, Taiwan, and northern Burma
and may extend to Bhutan, Nepal, and Pakistan; whereas Asian
A. pedatum is widely distributed in deciduous woodland forests
of eastern Asia in Far East Russia, Japan, Korea, and northern
and northeastern China.
Adiantum pedatum is not monophyletic because the clade of
A. aleuticum and the hybrid A. viridimontanum is nested within
it (Fig. 2). Three subgroups of A. pedatum are recognizable: the
Chinese group, the eastern North American group, and the Jap-
anese group (Fig. 2). With the type of A. pedatum from eastern
North America (Linnaeus, 1753), the Chinese A. pedatum and
the Japanese A. pedatum should each be recognized at the spe-
cies level, if A. aleuticum is to be maintained as a distinct spe-
cies. Our examination of the herbarium specimens suggests that
there is a low level of morphological differentiation among the
three geographic subclades of A. pedatum. The overall morpho-
logical similarities in the eastern Asian and the eastern North
American A. pedatum may be attributable to convergence from
[Vol. 98
adapting to similar deciduous forest habitat in both eastern Asia
and eastern North America. Similar habitats have been pro-
posed to explain the maintenance of morphological similarities
of some EA-ENA disjunct seed plants (Parks and Wendel,
1990; Wen, 1999, 2001; Nie et al., 2006).
The Japanese A. pedatum clade is sister to the clade com-
posed of other A. pedatum accessions and A. aleuticum (includ-
ing A. viridimontanum) with strong support (BS, 99; PP, 1.00;
Fig. 2). Taxonomic and phylogenetic diversity of A. pedatum in
Japan may be more complicated than presently revealed in our
sampling. Cytogeographic study indicated that there may be
two taxa in the Japanese A. pedatum complex, one with x = 29,
and the other with x = 30 (Paris, 1991b; Nakato and Kato, 2005).
The diploids with 2n = 60 are widely distributed in Japan,
whereas those with 2n = 58 are known only from two lowland
sites in eastern Hokkaido (Nakato and Kato, 2005). Although
chromosome counts have not been carried out in the current
study, we assume that the chromosome base number of the Jap-
anese samples we analyzed was x = 30 because they are from
Osaka Prefecture, Shizuoka Prefecture, and Nagano Prefecture
of Honshu. In the UPGMA tree based on isozyme data (Paris,
1991b), the Japanese A. pedatum grouped with A. aleuticum.
Even the two populations FKM and KAM from Hokkaido were
nested within the A. aleuticum group (see fig. 3.2 of Paris,
1991b). The chromosome count showed that the chromosome
base number of KAM was x = 29 (Paris, 1991b), which implied
that the Japanese populations with x = 29 are more closely re-
lated to A. aleuticum than those with x = 30. The present phylo-
genetic results imply that the Chinese A. pedatum, the Japanese
A. pedatum (x = 30), and the eastern North American A. peda-
tum are not the same taxon. The ancestral chromosome base
number in Adiantum was suggested to be x = 30, from which
x = 29 and other aneuploid numbers diverged (Tryon and Tryon,
1982; Paris, 1991b; Nakato and Kato, 2005). The occurrence of
x = 29 or its multiples in several species indicated a second se-
ries that may have derived from loss or fusion of individual
chromosomes (Tryon and Tryon, 1982; Nakato and Kato,
2005). Japanese members of the A. pedatum complex have the
chromosome base numbers of both x = 29 and 30, whereas
North American plants are known to have only x = 29 (Paris,
1991b; Nakato and Kato, 2005). Adiantum edentulum, the clos-
est relative of the A. pedatum complex, has x = 30 (Wang et al.,
1984; Kato et al., 1992). Nakato and Kato (2005) inferred that
the cytotype of x = 29 in the A. pedatum complex originated in
Asia and plants with x = 29 subsequently migrated to North
America.
Accessions of A. aleuticum from eastern and western North
America form a clade, with eastern North American accession
(J. Wen 10452) nested within A. aleuticum from western North
America (Fig. 2), supporting the treatment of the eastern North
American serpentine maidenhair as conspecific with the west-
ern North American A. aleuticum by Paris (1991a, b). Ruprecht
(1845) published A. pedatum var. aleuticum based on the mate-
rial from Unalaschka and Kodiak Island, Alaska. Fernald (1905)
compared the materials from the Gaspé Peninsula, Canada and
the typical A. pedatum and reported the differences between the
two concerning their stature, texture, venation, teeth of pin-
nules, and indusium morphology. He designated the Gaspé
plant as A. pedatum var. aleuticum Ruprecht. Calder and Taylor
(1965) published A. pedatum subsp. aleuticum (Rupr.) Calder
& Roy L. Taylor in their studies of the flora of the Queen Char-
lotte Islands, British Columbia. Cody (1983) thought that the
plants of serpentine and dolomitic rocks are even more distinct
October 2011] Lu et al.—Biogeographic disjunction in the ADIANTUM PEDATUM complex 1687

Fig. 4. Chronogram of Adiantum inferred from BEAST with atpA, atpB, and rbcL sequences. Clade constraints are indicated with black asterisks (the
first calibration scheme) and black hexagons (the second calibration scheme). Node 1: A. aleuticum and A. viridimontanum; node 2: A. aleuticum- Chinese
A. pedatum; node 3: eastern North American A. pedatum-A. aleuticum and Chinese A. pedatum; node 4: Japanese A. pedatum-eastern North American and
Chinese A. pedatum, and A. aleuticum; node 5: the A. pedatum complex; node 6: A. edentulum-A. pedatum complex.
1688 American Journal of Botany [Vol. 98

Table 2. Divergence times (Ma) of disjunct clades in the Adiantum pedatum complex.

Calibration points Node Clades Node age Height_95%_HPD

93.5 Ma: crown of Pteridaceae 1 A. aleuticum and A. viridimontanum 0.43 0.08–0.85

65.2 Ma: crown of CE clade 2 A. aleuticum-Chinese A. pedatum 0.81 0.28–1.41
3 eastern North American A. pedatum-A. aleuticum and Chinese 1.25 0.52–2.11
A. pedatum
4 Japanese A. pedatum- eastern North American and Chinese A. pedatum, 2.87 1.39–4.64
and A. aleuticum
5 A. pedatum complex 4.27 2.24–6.57
6 A. edentulum-A. pedatum complex 5.76 3.07–8.95
93.5 Ma: divergence time 1 A. aleuticum and A. viridimontanum 0.38 0.08–0.75
between pteridoid and 2 A. aleuticum-Chinese A. pedatum 0.7 0.26–1.24
eupolypod ferns 65.2 Ma: 3 eastern North American A. pedatum-A. aleuticum and Chinese 1.09 0.46–1.84
divergence time between CE A. pedatum
clade and PT clade 4 Japanese A. pedatum-eastern North American and Chinese A. pedatum, 2.47 1.17–4.04
and A. aleuticum
5 A. pedatum complex 3.69 1.9–5.68
6 A. edentulum-A. pedatum complex 5.76 3.07–8.95

than A. pedatum subsp. aleuticum is from A. pedatum subsp.
pedatum after he examined 400 sheets of specimens of the A.
pedatum complex. He proposed a new name A. pedatum subsp.
calderi for the plants of the serpentine and dolomitic rocks from
southeastern Quebec, northern Vermont, western Newfound-
land, California, and Washington. Paris and Windham (1988)
showed that the eastern North American serpentine populations
(A. pedatum subsp. calderi) were nested within the western
North American A. pedatum var. aleuticum and treated the east-
ern serpentine maidenhair fern as a disjunct element of the
western North American A. aleuticum. Paris (1991b) published
the new combination A. aleuticum and treated five infraspecific
taxa as synonyms. These were A. boreale, A. pedatum var.
aleuticum, A. pedatum subsp. aleuticum, A. pedatum subsp.
calderi, and A. pedatum var. subpumilum, a dwarf coastal vari-
ety proposed by Wagner and Boydston (1978). Paris and Wind-
ham (1988) demonstrated that there is an allotetraploid
derivative (= A. viridimontanum) of a sterile hybrid between A.
pedatum and A. aleuticum. Paris (1993) noted that the morpho-
logical differences between the eastern North American A. pe-
datum and the rocky-wood western North American A.
aleuticum are obscured by the serpentine A. aleuticum and the
hybrid A. viridimontanum. Paris (1991a) also noted that A. viri-
dimontanum generally bears greater resemblance to A. aleuti-
cum on the serpentines (e.g., at the type location in Vermont,
USA), whereas it shows greater resemblance to the woodland
A. pedatum in shady conditions. Our analysis shows that A. viri-
dimontanum is nested within the A. aleuticum clade, which sup-
ports the hypothesis of a close relationship between A.
viridimontanum and A. aleuticum by Paris (1991b). With the
maternal inheritance of chloroplast DNA in ferns (Yatskievych
et al., 1988), the present result with A. viridimontanum nested
within the A. aleuticum clade suggests that the maternal parent
of A. viridimontanum may be A. aleuticum, supporting Paris’
(1991b) conclusions based on chloroplast DNA restriction frag-
ment data (also see Paris and Windham, 1988).
Superficially the A. pedatum complex is more similar to A.
hispidulum and A. flabellulatum in the frond architecture, shar-
ing a dichotomous branching flabellate lamina. Nayar (1961)
included A. hispidulum, A. flabellulatum, and A. pedatum in his
pedatum group. In the present study, the A. pedatum complex
was nested within the temperate clade I, whereas A. hispidulum
was nested within the pantropical grade and A. flabellulatum
was nested in the temperate clade II (Fig. 2). In the A. pedatum
complex, the blade is fan-shaped; frond architecture is rela-
tively simpler in the other Adiantum species. Furthermore, the
stipes, rachises, petiolules, and pinnules are all glabrous in the
A. pedatum complex; the stipes, rachises, and petiolules are
densely covered with hispid hairs in A. hispidulum; and the sti-
pes are glabrous, but upper regions of rachises and their branches
are covered with hairs in A. flabellulatum. False indusia of the
A. pedatum complex are oblong to crescent-shaped, whereas
they are round, covered with reddish brown, stiff, and needle-
like bristles in A. hispidulum; and those of A. flabellulatum are
semirounded to oblong. The A. pedatum complex is distributed
in the North Temperate zone; A. myriosorum, the earliest di-
verged member in the A. pedatum complex, is distributed in
southwestern China, overlapping with A. edentulum; and A. his-
pidulum and A. flabellulatum are in tropical and subtropical
Asia (Lin, 1990; Paris, 1993). The eastern Asian Adiantum
edentulum is shown to be sister to the A. pedatum complex al-
though this relationship does not seem to be well defined by any
morphological synapomorphies.
Evolution of intercontinental disjunctions between eastern
Asia and North America in the A. pedatum complex— The
molecular dating result suggests an ancient origin of the Adian-
tum group, with the Adiantum crown group dated to 50.53
(36.88–64.02) Ma in the early Eocene (Fig. 4). Our results sup-
port a relatively recent origin of the A. pedatum complex, with
the crown A. pedatum complex dated to 4.27 (2.24–6.57) Ma in
the Pliocene. The biogeographic analyses and the Bayesian dat-
ing suggest an eastern Asian origin of the A. pedatum complex
and its spread into North America in the Pliocene to early Pleis-
tocene (Table 2; Figs. 3, 4).
Biogeographic relationships have been established by vari-
ous factors, of which dispersal and vicariance are two major
events (Briggs, 1991). In comparison with the seed plants, long-
distance dispersal is more common in ferns (Barrington, 1993;
Smith, 1993). Ferns are dispersed by small, wind-dispersed
spores that are produced in very large numbers and capable of
dispersing thousands of kilometers (Wolf et al., 2001). Homo-
sporous ferns have independently living, sometimes bisexual
gametophytes, which can undergo intragametophytic breeding
to give rise to sporophytes singly, and can thus establish new
populations in distant localities even by dispersal of single
spores (Kato, 1993). Thus, distributions in most ferns are as-
sumed to be a function of dispersal rather than vicariance (Wolf
October 2011] Lu et al.—Biogeographic disjunction in the ADIANTUM PEDATUM complex
et al., 2001). Paris (1991b) demonstrated that gametophytes of
A. aleuticum are usually unisexual, and Peck et al. (1990)
showed that A. pedatum carries high levels of genetic load,
which restricts the intragametophytic selfing of gametophytes.
Paris (1991b) pointed out that long-distance dispersal is un-
likely in the A. pedatum lineage because intergametophytic
mating is probably the rule for this complex. Paris (1991b) pos-
tulated that speciation in the A. pedatum complex was a conse-
quence of the fragmentation of the Tertiary mixed mesophytic
forest, in which the complex presumably originated widespread
throughout the northern hemisphere during much of the Ter-
tiary period. The estimated recent disjunct distribution in the A.
pedatum complex may be explained by the dispersal and migra-
tion of the complex across the Bering land bridge and adjacent
areas. The Bering land bridge was available for exchanges of
temperate deciduous plants between eastern Asia and North
America almost throughout the Tertiary, at least until 3.5 Ma
(Hopkins, 1967), which is similar to the estimated divergence
time of the entry of the A. pedatum clade from Asia to North
America (node 4 in Fig.4, Table 2).
The biogeographic analyses and the Bayesian dating suggest
that there was a migration of the ancestor of the Chinese A. pe-
datum and the North American A. aleuticum clade from North
America back to Asia (China) dated around 0.8 (0.28–1.41)
Ma. Adiantum aleuticum is currently distributed in western
North America, including the Aleutian islands of the Northern
Pacific Ocean. The migration of the ancestor of A. aleuticum
and the Chinese A. pedatum from North America to Asia was
most likely via the Aleutian Islands south of the Bering Sea.
Adiantum aleuticum is disjunct in wet rock fissures in west-
ern North America and serpentine in eastern North America
(Newfoundland, Quebec, Maine, Maryland, Pennsylvania, and
Vermont) (Paris, 1993). The Bayesian dating suggests that the
disjunction of A. aleuticum between western and northeastern
North America was very recent, in the late Pleistocene. The
phylogenetic result suggests a western North American origin
of A. aleuticum and its spread into eastern North America (Fig. 2).
Fernald (1925) proposed that some plants in the Gaspé Penin-
sula in Quebec were once widespread and represented disjunct
populations of western Cordilleran species and that these spe-
cies survived the Pleistocene glaciations in the Gaspé Peninsula
on ice-free mountaintops. Paris (1989) suggested that the west-
ern A. aleuticum had an incremental migration (a series of more
local dispersals) along the highly distributed terrain exposed
with the retreat of the Wisconsin ice, followed by its restric-
tion to serpentine substrates in northwestern North America.
Barrington (1993) and Wolf et al. (2001) accepted the vicari-
ance hypothesis for the A. pedatum complex in North America.
Barrington and Paris (2007) further presumed that A. aleuticum
migrated eastward as the glacial retreat proceeded in the Holo-
cene. A detailed phylogeographic analysis of A. aleuticum with
an ENA-WNA disjunction is needed to test its diversification
history in North America.
The EA-NA biogeographic disjunctions have involved mul-
tiple historical events at different geologic times in different
groups (Tiffney, 1985a, b; Kato, 1993; Manchester, 1999; Wen,
1998, 1999; Xiang et al., 1998; Wen et al., 2010). The Bering
and the North Atlantic land bridges are inferred to be the most
likely migration route for floristic exchanges between Asian
and North American in Tertiary (Tiffney, 1985a, b; Xiang et al.,
1998; Nie et al., 2006, 2008) in seed plants. The phylogenetic
and biogeographic results, in combination with the divergence
time of the complex, suggest that the current intercontinental
1689
disjunction of the A. pedatum complex can be explained by two
events of dispersal/migration between eastern Asia and North
America. First, the ancestor of this complex migrated from
eastern Asia (Japan) into North America in the late Pliocene or
the early Pleistocene via the Bering land bridge. Second, the
ancestor of the Chinese A. pedatum-A. aleuticum clade migrated
from North America back to eastern Asia in the mid Pleisto-
cene, most likely via the Aleutian islands near the Bering Sea.
LITERATURE CITED
Barrington, D. S. 1993. Ecological and historical factors in fern bioge-
ography. Journal of Biogeography 20: 275–280.
Barrington, D. S., and C. A. Paris. 2007. Refugia and migration
in the Quaternary history of the New England flora. Rhodora 109:
369–386.
Bonde, S. D., and K. P. N. Kumaran. 2002. The oldest macrofossil record
of the mangrove fern Acrostichum L. from the Late Cretaceous Deccan
Intertrappean beds of India. Cretaceous Research 23: 149–152.
Bouma, W. L. M., P. Ritchie, and L. R. Perrie. 2010. Phylogeny and ge-
neric taxonomy of the New Zealand Pteridaceae ferns from chloroplast
rbcL DNA sequences. Australian Systematic Botany 23: 143–151.
Briggs, J. C. 1991. Historical biogeography: The pedagogical problem.
Journal of Biogeography 18: 3–6.
Calder, J. A., and R. L. Taylor. 1965. New taxa and nomenclatural
changes with respect to the flora of the Queen Charlotte Islands,
British Columbia. Canadian Journal of Botany 43: 1387–1400.
Chandler, M. E. J. 1963. The Lower Tertiary Floras of southern England.
3. Flora of the Bournemouth Beds, the Boscombe and the Highcliff
Sands. British Museum (Natural History), London, UK.
Ching, R. C. 1957. On the genus Adiantum L. of China with notes on some
related species from neighbouring regions. Acta Phytotaxonomica
Sinica 6: 301–354.
Cody, W. J. 1983. Adiantum pedatum ssp. calderi, a new subspecies in
northeastern North America. Rhodora 85: 93–96.
Collinson, M. E. 2001. Cainozoic ferns and their distribution. Brittonia
53: 173–235.
De Bodt, S., S. Maere, and Y. Van de Peer. 2005. Genome duplication
and the origin of angiosperms. Trends in Ecology & Evolution 20:
591–597.
Donoghue, M. J., C. D. Bell, and J. Li. 2001. Phylogenetic patterns in
Northern Hemisphere plant geography. International Journal of Plant
Sciences 162: S41–S52.
Donoghue, M. J., and S. A. Smith. 2004. Patterns in the assembly of temper-
ate forests around the Northern Hemisphere. Philosophical Transactions
of the Royal Society, B, Biological Sciences 359: 1633–1644.
Driscoll, H. E., and D. S. Barrington. 2007. Origin of Hawaiian
Polystichum (Dryopteridaceae) in the context of a world phylogeny.
American Journal of Botany 94: 1413–1424.
Drummond, A. J., S. Y. W. Ho, M. J. Phillips, and A. Rambaut. 2006.
Relaxed phylogenetics and dating with confidence. PLoS Biology 4:
699–710.
Drummond, A. J., and A. Rambaut. 2007. BEAST: Bayesian evolution-
ary analysis by sampling trees. BMC Evolutionary Biology 7: 214.
Farris, J. S., M. Källersjö, A. G. Kuge, and C. Bult. 1994. Testing
significance of incongruence. Cladistics 10: 315–319.
Felsenstein, J. 1985. Confidence limits on phylogenies: An approach
using the bootstrap. Evolution 39: 783–791.
Fernald, M. L. 1905. An alpine Adiantum. Rhodora 7: 190–192.
Fernald, M. L. 1925. Persistence of plants in unglaciated areas of
Boreal America. Memoirs of the American Academy of Science 15:
239–342.
Gardner, J. S., and C. B. Ettingshausen. 1879–1882. A monograph of the
British Eocene Flora, vol. I, Filices. Parts I–III. Monographs of the
Palaeontographical Society, London, UK.
Geiger, J. M. O., and T. A. Ranker. 2005. Molecular phylogenetics and
historical biogeography of Hawaiian Dryopteris (Dryopteridaceae).
Molecular Phylogenetics and Evolution 34: 392–407.
1690 American Journal of Botany
Geiger, J. M. O., T. A. Ranker, J. M. R. Neale, and S. T. Klimas.
2007. Molecular biogeography and origins of the Hawaiian fern
flora. Brittonia 59: 142–158.
Hopkins, D. M. 1967. The Bering Land Bridge. Stanford University Press,
Stanford, California, USA.
Hoshizaki, B. J., and R. Moran. 2001. Fern grower’s manual: Revised
and expanded edition. Timber Press, Portland, Oregon, USA.
Huiet, L., and A. R. Smith. 2004. Phylogenetic relationships
in Adiantum inferred from chloroplast coding and non-coding
sequences. Botany 2004, Salt Lake City, Utah, USA, 697 [ab-
stract]. Website http://2004.botanyconference.org/engine/search/
index.php?func=detail&aid=697. Botanical Society of America, St.
Louis, Missouri, USA.
Iwatsuki, K. 1994. Comparison of pteridophyte flora between North
America and Japan. In A. Miyawaki, K. Iwatsuki, and M. M. Grandtner
[eds.], Vegetation in eastern North America, 89–97. University of
Tokyo Press, Tokyo, Japan.
Iwatsuki, K., and H. Ohba. 1994. The floristic relationship between
East Asia and eastern North America. In A. Miyawaki, K. Iwatsuki,
and M. M. Grandtner [eds.], Vegetation in eastern North America,
61–74. University of Tokyo Press, Tokyo, Japan.
Judd, W. S., C. S. Campbell, E. A. Kellogg, P. F. Stevens, and M. J.
Donoghue. 2008. Plant systematics: A phylogenetic approach, 3rd
ed. Sinauer, Sunderland, Massachusetts, USA.
Kato, M. 1993. Biogeography of ferns: Dispersal and vicariance. Journal
of Biogeography 20: 265–274.
Kato, M., N. Nakato, and X. Cheng. 1992. A cytotaxonomic study
of ferns of Yunnan, southwestern China. Botanical Magazine 105:
105–124.
Krassilov, V. A., and F. Bacchia. 2000. Cenomanian florule of
Nammoura, Lebanon. Cretaceous Research 21: 785–799.
Kusukawa, N., R. Uemori, K. Asaca, and I. Kato. 1990. Rapid and
reliable protocol for direct sequencing of material amplified by the
polymerase chain reaction. BioTechniques 9: 66–72.
Lee, N. S., T. Sang, D. J. Crawford, S. H. Yeau, and S. C. Kim. 1996.
Molecular divergence between disjunct taxa in eastern Asia and east-
ern North America. American Journal of Botany 83: 1373–1378.
Li, H. L. 1952. Floristic relationships between eastern Asia and eastern
North America. Proceedings of the Academy of Natural Sciences of
Philadelphia 42: 371–429.
Lin, Y. X. 1990. Adiantiaceae. In R. C. Ching and K. H. Shing [ed.], Flora
Reipublicae Popularis Sinicae, vol. 3, part 1. Science Press, Beijing,
China.
Linnaeus, C. 1753. Species plantarum, vol. 2. Impensis Laurentii Salvii,
Stockholm, Sweden.
Little, D. P., and D. S. Barrington. 2003. Major evolutionary
events in the origin and diversification of the fern genus Polystichum
(Dryopteridaceae). American Journal of Botany 90: 508–514.
Lu, J. M., D. Z. Li, L. M. Gao, X. Cheng, and D. Wu. 2005. Paraphyly
of Cyrtomium (Dryopteridaceae): Evidence from rbcL and trnL-F se-
quence data. Journal of Plant Research 118: 129–135.
Manchester, S. R. 1999. Biogeographical relationships of North
American Tertiary floras. Annals of the Missouri Botanical Garden
86: 472–522.
Manos, P. S., and M. J. Donoghue. 2001. Progress in Northern
Hemisphere phytogeography: An introduction. International Journal
of Plant Sciences 162: S1–S2.
Metzgar, J. S., J. E. Skog, E. A. Zimmer, and K. M. Pryer. 2008. The
paraphyly of Osmunda is confirmed by phylogenetic analyses of
seven plastid loci. Systematic Botany 33: 31–36.
Nakato, N., and M. Kato. 2005. Cytogeography of the Adiantum
pedatum complex (Pteridaceae, subfamily Adiantoideae). Acta
Phytotaxonomica et Geobotanica 56: 85–96.
Nayar, B. K. 1961. Ferns of India 1. Adiantum. Bulletin of the National
Botanic Gardens 52: 1–38.
Nie, Z. L., H. Sun, H. Li, and J. Wen. 2006. Intercontinental bioge-
ography of subfamily Orontioideae (Symplocarpus, Lysichiton, and
Orontium) of Araceae in eastern Asia and North America. Molecular
Phylogenetics and Evolution 40: 155–165.
[Vol. 98
Nie, Z. L., J. Wen, H. Azuma, Y. L. Qiu, H. Sun, Y. Meng, W. B. Sun,
and E. A. Zimmer. 2008. Phylogenetic and biogeographic com-
plexity of Magnoliaceae in the Northern Hemisphere inferred from
three nuclear data sets. Molecular Phylogenetics and Evolution 48:
1027–1040.
Norup, M. V., J. Dransfield, M. W. Chase, A. S. Barfod, E. S.
Fernando, and W. J. Baker. 2006. Homoplasious character com-
binations and generic delimitation: A case study from the Indo-Pacific
arecoid palms (Arecaceae: Areceae). American Journal of Botany 93:
1065–1080.
Paris, C. A. 1989. Maidenhair fern biogeography and M.L. Fernald’s
hypothesis of a Gaspé refugium. Rhodora 91: 143.
Paris, C. A. 1991a. Adiantum viridimontanum, a new maidenhair fern in
eastern North America. Rhodora 93: 105–122.
Paris, C. A. 1991b. Molecular systematics of the Adiantum pedatum
complex: Phylogeny, biogeography, and a taxonomic reconsidera-
tion of the group in North America. Ph.D. dissertation, University
Vermont, Burlington, Vermont.
Paris, C. A. 1993. Adiantum. In Flora of North America Editorial
Committee [eds.], Flora of North America, vol. 2, Pteridophytes and
gymnosperms, 125–130. Oxford University Press, New York, New
York, USA.
Paris, C. A., and M. D. Windham. 1988. A biosystematic investigation of
the Adiantum pedatum complex in eastern North America. Systematic
Botany 13: 240–255.
Parks, C. R., and J. F. Wendel. 1990. Molecular divergence between
Asian and North American species of Liriodendron (Magnoliaceae)
with implications for interpretation of fossil floras. American Journal
of Botany 77: 1243–1256.
Peck, J. H., C. J. Peck, and D. R. Farrar. 1990. Influences of life history
attributes on formation of local and distant fern populations. American
Fern Journal 80: 126–142.
Perrie, L. R., P. J. Brownsey, P. J. Lockhart, E. A. Brown, and M. F.
Large. 2003. Biogeography of temperate Australasian Polystichum
ferns as inferred from chloroplast sequence and AFLP. Journal of
Biogeography 30: 1729–1736.
Phipps, C. J., T. N. Taylor, E. L. Taylor, N. R. Cuneo, L. D. Boucher,
and X. Yao. 1998. Osmunda (Osmundaceae) from the Triassic of
Antarctica: An example of evolutionary stasis. American Journal of
Botany 85: 888–895.
Posada, D., and T. R. Buckley. 2004. Model selection and model av-
eraging in phylogenetics: Advantages of the AIC and Bayesian ap-
proaches over likelihood ratio tests. Systematic Biology 53: 793–808.
Posada, D., and K. A. Crandall. 1998. MODELTEST: Testing the
model of DNA substitution. Bioinformatics 14: 817–818.
Pryer, K. M., E. Schuettpelz, P. G. Wolf, H. Schneider, A. R. Smith,
and R. Cranfill. 2004. Phylogeny and evolution of ferns (monilo-
phytes) with a focus on the early leptosporangiate divergences.
American Journal of Botany 91: 1582–1598.
Rambaut, A. 2007. Se-Al, version 2.0a11 for Mac. Computer program
and documentation distributed by the author. Website http://tree.bio.
ed.ac.uk/software/seal/.
Ree, R. H., B. R. Moore, C. O. Webb, and M. J. Donoghue. 2005. A
likelihood framework for inferring the evolution of geographic range
on phylogenetic trees. Evolution 59: 2299–2311.
Ree, R. H., and S. A. Smith. 2008. Maximum-likelihood inference of
geographic range evolution by dispersal, local extinction, and clado-
genesis. Systematic Biology 57: 4–14.
Ronquist, F. 1996. DIVA: Dispersal–vicariance analysis, version 1.1.
Uppsala University, Uppsala, Sweden.
Ronquist, F. 1997. Dispersal–vicariance analysis: A new approach to
the quantification of historical biogeography. Systematic Biology 46:
195–203.
Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics 19:
1572–1574.
Ruprecht, F. J. 1845. Distributio cryptogamarum vascularium in
Imperio Rossico. Buchdruckerei der Kaiserlichen Akademie der
Wissenschaften, St. Petersburg, Russia.
October 2011] Lu et al.—Biogeographic disjunction in the ADIANTUM PEDATUM complex
Schneider, H., E. Schuettpelz, K. M. Pryer, R. Cranfill, S.
Magallón, and R. Lupia. 2004. Ferns diversified in the shadow of
angiosperms. Nature 428: 553–557.
Schuettpelz, E., P. Korall, and K. M. Pryer. 2006. Plastid atpA data
provide improved support for deep relationships among ferns. Taxon
55: 897–906.
Schuettpelz, E., and K. M. Pryer. 2007. Fern phylogeny inferred
from 400 leptosporangiate species and three plastid genes. Taxon 56:
1037–1050.
Schuettpelz, E., and K. M. Pryer. 2009. Evidence for a Cenozoic ra-
diation of ferns in an angiosperm-dominated canopy. Proceedings of
the National Academy of Sciences, USA 106: 11200–11205.
Schuettpelz, E., H. Schneider, L. Huiet, M. D. Windham, and
K. M. Pryer. 2007. A molecular phylogeny of the fern family
Pteridaceae: Assessing overall relationships and the affinities of pre-
viously unsampled genera. Molecular Phylogenetics and Evolution
44: 1172–1185.
Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. Miller,
K. C. Siripun, et al. 2005. The tortoise and the hare II: Relative
utility of 21 noncoding chloroplast DNA sequences for phylogenetic
analysis. American Journal of Botany 92: 142–166.
Simmons, M. P., and H. Ochoterena. 2000. Gaps as characters in sequence-
based phylogenetic analyses. Systematic Biology 49: 369–381.
Smith, A. R. 1993. Phytogeographic principles and their use in understand-
ing fern relationships. Journal of Biogeography 20: 255–264.
Souza-Chies, T. T., G. Bittar, S. Nadot, L. Carter, E. Besin, and B.
Lejeune. 1997. Phylogenetic analysis of Iridaceae with parsimony
and distance methods using the plastid gene rps4. Plant Systematics
and Evolution 204: 109–123.
Swofford, D. L. 2003. PAUP*: Phylogenetic analysis using parsi-
mony (*and other methods), version 4.10b. Sinauer, Sunderland,
Massachusetts, USA.
Taberlet, P., L. Gielly, G. Pautou, and J. Bouvet. 1991. Universal prim-
ers for amplification of three non-coding regions of chloroplast DNA.
Plant Molecular Biology 17: 1105–1109.
Thompson, J. D., T. J. Gibson, F. Plewniak, F. Eanmougin, and D. G.
Higgins. 1997. The CLUSTAL_X Windows interface: Flexible strat-
egies for multiple sequence alignment aided by alignment aided by
quality analysis tools. Nucleic Acids Research 24: 4876–4882.
Tiffney, B. H. 1985a. Perspectives on the origin of the floristic similar-
ity between eastern Asia and eastern North America. Journal of the
Arnold Arboretum 66: 73–94.
Tiffney, B. H. 1985b. The Eocene North Atlantic land bridge and its
importance in Tertiary and modern phytogeography of the Northern
Hemisphere. Journal of the Arnold Arboretum 66: 243–273.
Appendix 1.Voucher information and GenBank accession numbers for taxa used in this study.
Taxon; Voucher specimen (Herbarium), Collection locality; GenBank accessions: rbcL, atpB, atpA, trnL-F, and rps4-trnS.
Adiantum aethiopicum L.; J. Wen 10780 (US); New Zealand; JF935350;
JF935432; JF937305; JF980695; JF980616. Adiantum aleuticum (Rupr.)
C.A. Paris; J. Wen 6697 (US); California, USA; JN052802; JN052887;
JN052840; JN052908; JN052829. Adiantum aleuticum; J. Wen 10452
(US); Quebec, Canada; JN052804; JN052888; JN052852; JN052910;
JN052831. Adiantum aleuticum; Janeway 9461 (US); California, USA;
JN052806; JN052875; JN052853; JN052909; JN052830. Adiantum
aleuticum; Janeway 9591 (US); California, USA; JN052805; JN052883;
JN052841; JN052907; JN052827. Adiantum aleuticum; Stensvold 5359
(US); Alaska, USA; JN119855; JN052884; JN052851; JN052921;
JN052828. Adiantum aleuticum; Heutte s.n. (US); Alaska, USA;
JF935362; JF935447; JF937320; JF980709; JF980631. Adiantum
bonatianum Brause; J.-M. Lu 216 (KUN); Yunnan, China; JF935294;
1691
Tryon, R. M., A. F. Tryon, and K. U. Kramer. 1990. Pteridaceae. In K.
U. Kramer and P. S. Green [eds.], The families and genera of vascular
plants, vol. 1. Pteridophytes and gymnosperms, 230–256. Springer-
Verlag, Berlin, Germany.
Tryon, R. M., and A. F. Tryon. 1982. Ferns and allied plants, with spe-
cial reference to tropical America. Spinger-Verlag, New York, New
York, USA.
Wagner, W. H. Jr., and K. E. Boydston. 1978. A dwarf coastal variety
of maidenhair fern, Adiantum pedatum. Canadian Journal of Botany
56: 1727–1729.
Wang, Z. R., Q. Xia, and Z. X. Zhang. 1984. Cytological observa-
tions on 25 species of Chinese ferns. Acta Botanica Sinica 26:
595–604.
Wen, J. 1998. Evolution of the eastern Asian and eatern North American
disjunct pattern: Insights from phylogenetic studies. Korean Journal of
Plant Taxonomy 28: 63–81.
Wen, J. 1999. Evolution of eastern Asian and eastern North American
disjunct distributions in flowering plants. Annual Review of Ecology
and Systematics 30: 421–455.
Wen, J. 2001. Evolution of eastern Asian–North American biogeographic
disjunctions: A few additional issues. International Journal of Plant
Sciences 162: S117–S122.
Wen, J., S. M. Ickert-Bond, Z. L. Nie, and R. Li. 2010. Timing and
modes of evolution of eastern Asian–North American biogeographic
disjunctions in seed plants. In M. Long, H. Gu, and Z. Zhou [eds.],
Darwin’s heritage today: Proceedings of the Darwin 200 Beijing
International Conference, 252–269. Higher Education Press, Beijing,
China.
Wolf, P. G., H. Schneider, and T. A. Ranker. 2001. Geographic dis-
tributions of homosporous ferns: Does dispersal obscure evidence of
vicariance? Journal of Biogeography 28: 263–270.
Xiang, Q. Y., D. E. Soltis, and P. S. Soltis. 1998. The eastern
Asian and eastern and western North American floristic disjunction:
Congruent phylogenetic patterns in seven diverse genera. Molecular
Phylogenetics and Evolution 10: 178–190.
Yang, Z., and B. Rannala. 1997. Bayesian phylogenetic inference us-
ing DNA sequences: A Markov chain Monte Carlo method. Molecular
Biology and Evolution 14: 717–724.
Yatskievych, G., D. B. Stein, and G. J. Gastony. 1988. Chloroplast
DNA evolution and systematics of Phanerophlebia (Dryopteridaceae)
and related genera. Proceedings of the National Academy of Sciences,
USA 85: 2589–2593.
Zang, D. K. 1998. A preliminary study on the ferns flora in China. Acta
Botanica Boreal-Occident Sinica 18: 459–465.
JF935371; JF937247; JF980639; JF980556. Adiantum capillus-junonis
Rupr.; J.-M. Lu 111 (KUN); Guangxi, China; JF935314; JF935395;
JF937269; JF980662; JF980578. Adiantum capillus-veneris L.; J. Wen
10360 (US); Russia; JF935345; JF935427; JF937300; JF980690;
JF980611. Adiantum capillus-veneris; J.-M. Lu 138 (KUN); Guangxi,
China; JF935320; JF935401; JF937274; JF980666; JF980584. Adiantum
capillus-veneris; J.-M. Lu 295 (KUN); Chongqing, China; JF935322;
JF935403; JF937276; JF980667; JF980586. Adiantum capillus-veneris;
J. Wen 8192 (US); Chongqing, China; JF935332; JF935413; JF937286;
JF980676; JF980597. Adiantum capillus-veneris; J. Wen 8297 (US);
Luzon, Philippines; JF935334; JF935415; JF937288; JF980678;
JF980599. Adiantum caudatum L.; J.-M. Lu 209 (KUN); Hainan, China;
JF935296; JF935373; JF937249; JF980641; JF980558. Adiantum
1692 American Journal of Botany
chilense Kaulf.; J. Wen 7313 (US); Nuble, Chile; JF935336; JF935418;
JF937291; JF980681; JF980602. Adiantum cuneatum; J. Wen 10119
(US); West Java, Indonesia; JF935339; JF935421; JF937294; JF980684;
JF980605. Adiantum cunninghamii Hook.; J. Wen 10782 (US); New
Zealand; JF935351; JF935433; JF937306; JF980696; JF980617.
Adiantum davidii Franch.; X. Cheng 001 (KUN); Yunnan, China;
JF935316; JF935397; JF937271; —; JF980580. Adiantum davidii var.
longispinum Ching; J.-M. Lu 247 (KUN); Yunnan, China; JF935292;
JF935369; JF937245; JF980638; JF980554. Adiantum diaphanum
Blume; J.-M. Lu 208 (KUN); Hainan, China; JF935301; JF935379;
JF937254; JF980647; JF980563. Adiantum diaphanum; J. Wen 10727
(US); Indonesia; ——; JF935439; JF937312; JF980702; JF980623.
Adiantum edentulum H. Christ; J.-M. Lu 222 (KUN); Yunnan, China;
JF935291; JF935368; JF937244; JF980637; JF980553. Adiantum
edgeworthii Hook.; J.-M. Lu 114 (KUN); Guangxi, China; JF935311;
JF935392; JF937266; JF980660; JF980575. Adiantum excisum Kunze; J.
Wen 7326 (US); Concepcion, chile; JF935337; JF935419; JF937292;
JF980682; JF980603. Adiantum fengianum Ching; J.-M. Lu 228 (KUN);
Yunnan, China; JF935308; JF935388; JF937262; JF980656; JF980571.
Adiantum fimbriatum Christ; J.-M. Lu 215 (KUN); Yunnan, China;
JF935321; JF935402; JF937275; —; JF980585. Adiantum flabellulatum
L.; J.-M. Lu 192 (KUN); Guizhou, China; JF935315; JF935396; JF937270;
JF980663; JF980579. Adiantum flabellulatum; J.-M. Lu 450 (KUN);
Guangdong, China; JF935295; JF935372; JF937248; JF980640;
JF980557. Adiantum flabellulatum; J. Wen 6585 (US); Hainan, China;
JF935325; JF935406; JF937279; JF980670; JF980589. Adiantum
formosum R. Br.; J. Wen 10779 (US); New Zealand; JF935352; JF935434;
JF937307; JF980697; JF980618. Adiantum fulvum Raoul; J. Wen 10781
(US); New Zealand; JF935353; JF935435; JF937308; JF980698;
JF980619. Adiantum gravesii Hance; J.-M. Lu 129 (KUN); Guangxi,
China; JF935312; JF935393; JF937267; ——; JF980576. Adiantum
gravesii; J.-M. Lu 451 (KUN); Guangdong, China; JF935317; JF935398;
JF937272; JF980664; JF980581. Adiantum hispidulum Sw.; J. Wen
10243 (US); Sulawesi, Indonesia; JF935341; JF935423; JF937296;
JF980686; JF980607. Adiantum hispidulum; J. Wen 10771 (US); Virginia
cultivated, USA; JF935349; JF935431; JF937304; JF980694; JF980615.
Adiantum induratum H. Christ; J.-M. Lu 210 (KUN); Hainan, China;
JF935309; JF935389; JF937263; JF980657; JF980572. Adiantum
jordanii C.H. Mull.; J. Wen 10778 (US); Califoria,USA; JF935348;
JF935430; JF937303; JF980693; JF980614. Adiantum leveillei H. Christ;
J.-M. Lu 163 (KUN); Guangxi, China; JF935313; JF935394; JF937268;
JF980661; JF980577. Adiantum lianxianense Ching & Y. X. Lin; J.-M.
Lu 441 (KUN); Guangdong, China; JF935306; JF935385; JF937259;
JF980653; JF980569. Adiantum malesianum Ghatak; J.-M. Lu 050
(KUN); Yunnan, China; JF935297; JF935374; JF937250; JF980642;
JF980559. Adiantum mariesii Baker; J.-M. Lu 120 (KUN); Guangxi,
China; JF935302; JF935380; JF937255; JF980648; JF980564. Adiantum
myriosorum Baker; J.-M. Lu 251 (KUN); Yunnan, China; JN052789;
JN052868; JN052845; JN052899; JN052812. Adiantum myriosorum; J.-
M. Lu 268 (KUN); Yunnan, China; JN052788; JN052872; JN052843;
JN052897; JN052811. Adiantum myriosorum; J.-M. Lu 278 (KUN);
Chongqing, China; JN052787; JN052866; JN052848; JN052898;
JN052813. Adiantum myriosorum; J.-M. Lu 297 (KUN); Chongqing,
China; JF935359; JF935444; JF937317; JF980706; JF980628. Adiantum
myriosorum; J.-M. Lu 313 (KUN); Yunnan, China; JN052786; JN052869;
JN052847; JN052900; JN052815. Adiantum myriosorum; J.-M. Lu 384
(KUN); Sichuan, China; JN052784; JN052870; JN052846; JN052896;
JN052810. Adiantum myriosorum; J.-M. Lu 435 (KUN); Yunnan, China;
JN052785; JN052871; JN052844; JN052895; JN052814. Adiantum
pedatum L.; B.-D. Liu 001 (KUN); Heilongjiang, China; JN052793;
JN052891; JN052854; JN052903; JN052832. Adiantum pedatum; J. Wen
10100 (US); Maryland, USA; JF935361; JF935446; JF937319; JF980708;
JF980630. Adiantum pedatum; J. Wen 10389 (US); Virginia, USA;
JN052796; JN052867; JN052862; JN052915; JN052824. Adiantum
pedatum; J. Wen 10400 (US); Maryland, USA; JN052795; JN052886;
JN052837; JN052919; JN052823. Adiantum pedatum; J. Wen 10511
(US); Tennessee, USA; JN052799; JN052880; JN052839; JN052912;
JN052819. Adiantum pedatum; J. Wen 10516 (US); Tennessee, USA;
JN052794; JN052885; JN052864; JN052916; JN052820. Adiantum
pedatum; J. Wen 10784 (US); Virginia, USA; JN052792; JN052882;
JN052863; JN052913; JN052822. Adiantum pedatum; J. Wen 8006 (US);
Gansu, China; JN052807; JN052879; JN052855; JN052906; JN052835.
[Vol. 98
Adiantum pedatum; J. Wen 9952 (US); Minnesota, USA; JN052800;
JN052881; JN052838; JN052917; JN052826. Adiantum pedatum; J.-M.
Lu 343 (KUN); Shanxi, China; JF935360; JF935445; JF937318;
JF980707; JF980629. Adiantum pedatum; J.-M. Lu 345 (KUN); Shanxi,
China; JN052809; JN052877; JN052858; JN052920; JN052836.
Adiantum pedatum; J.-M. Lu 377 (KUN); Gansu, China; JN052808;
JN052876; JN052857; JN052904; JN052834. Adiantum pedatum; J.-M.
Lu 383 (KUN); Sichuan, China; JN052803; JN052878; JN052856;
JN052905; JN052833. Adiantum pedatum; J.-M. Lu 01 (US); Pennsylvania,
USA; JN052801; JN052889; JN052861; JN052911; JN052818. Adiantum
pedatum; A. Soejima1087; Osaka, Japan; JF935363; JF935448; JF937321;
JF980710; JF980632. Adiantum pedatum; T. Oka 001(KUN); Shizuoka,
Japan; JN052791; JN052873; JN052849; JN052902; JN052817. Adiantum
pedatum; Satoshi 001 (KUN); Nagano, Japan; JN052790; JN052874;
JN052850; JN052901; JN052816. Adiantum pedatum; X.-W. Xu 107
(US); Vermont, USA; JN052798; JN052890; JN052860; JN052918;
JN052825. Adiantum pedatum; X.-W. Xu 115 (US); Quebec, Canada;
JN052797; JN052892; JN052859; JN052914; JN052821. Adiantum
peruvianum Klotzsch; J.-M. Lu 338 (KUN); India; JF935288; JF935365;
JF937241; JF980634; JF980550. Adiantum philippense L.; J. Wen 8257
(US); Luzon, Philippines; JF935330; JF935412; JF937285; JF980675;
JF980595. Adiantum philippense; J. Wen 10206 (US); Indonesia;
JF935340; JF935422; JF937295; JF980685; JF980606. Adiantum
princeps T. Moore; J. Wen 10777 (US); Yuc, Mexico; JF935356; JF935438;
JF937311; JF980701; JF980622. Adiantum raddianum C. Presl; J. Wen
9521 (US); Antsiranana, Madagascar; JF935323; JF935404; JF937277;
JF980668; JF980587. Adiantum reniforme L. var. sinense Y.X. Ling;
J.-M. Lu 238 (KUN); Hubei, China; JF935287; JF935364; JF937240;
JF980633; JF980549. Adiantum roborowskii Maxim, J.-M. Lu 279
(KUN); Chongqing, China; JF935289; JF935366; JF937242; JF980635;
JF980551. Adiantum sinicum Ching; J.-M. Lu 269 (KUN); Yunnan,
China; JF935300; JF935378; JF937253; JF980646; JF980562.
Adiantum soboliferum Wall.; Y.-X. Zhang 009 (KUN); Yunnan, China;
JF935299; JF935376; JF937252; JF980644; JF980561. Adiantum sp.;
J. Wen 6773 (US); Costa Rica; —; JF935440; JF937313; —; JF980624.
Adiantum sp.; J. Wen 6893 (US); Cartago, Costa Rica; —; JF935417;
JF937290; JF980680; JF980601. Adiantum sp.; J. Wen 8295(US);
Luzon, Philippines; JF935329; JF935411; JF937284; JF980674; JF980594.
Adiantum sp.; J. Wen 8296 (US); Luzon, Philippines; —; JF935410;
JF937283; —; JF980593. Adiantum sp.; J. Wen 8333 (US); Malaysia;
JF935344; JF935426; JF937299; JF980689; JF980610. Adiantum sp.; J.
Wen 8681 (US); Oaxaca, Mexico; JF935338; JF935420; JF937293;
JF980683; JF980604. Adiantum sp.; J. Wen 9616 (US); Antsiranana,
Madagascar; JF935326; JF935407; JF937280; JF980671; JF980590.
Adiantum sp.; J. Wen 9648 (US); Antsiranana, Madagascar; JF935327;
JF935408; JF937281; JF980672; JF980591. Adiantum sp.; Nee & Wen
53798 (US); Bolivia; —; JF935390; JF937264; JF980658; JF980573.
Adiantum sp.; Nee & Wen 53842 (US); Bolivia; —; JN052865; JN052842;
JN052894; JN052893. Adiantum sp.; Nee & Wen 53851 (US); Bolivia;
JF935333; JF935414; JF937287; JF980677; JF980598. Adiantum sp.; Nee
& Wen 53885 (US); Bolivia; JF935335; JF935416; JF937289; JF980679;
JF980600. Adiantum tenerum Sw.; J. Wen 10775 (US); Yuc, Mexico;
JF935355; JF935437; JF937310; JF980700; JF980621. Adiantum
viridescens Colenso; J. Wen 10783 (US); New Zealand; JF935354;
JF935436; JF937309; JF980699; JF980620. Adiantum viridimontanum
C. A. Paris; Paris 856 (US); Vermont, USA; JF935347; JF935429;
JF937302; JF980692; JF980613.
Cheilanthes eckloniana Mett.; J. Wen 10088 (US); Kwazulu Natal, South
Africa; JF935343; JF935425; JF937298; JF980688; JF980609.
Pellaea calomelanos (Sw.) Link; J. Wen 10082 (US); Kwazulu Natal, South
Africa; JF935346; JF935428; JF937301; JF980691; JF980612. Pellaea
sp.; J. Wen 9479 (US); Ihosy, Madagascar; JF935324; JF935405;
JF937278; JF980669; JF980588. Pellaea sp.; J. Wen 9490 (US);
Toamasina, Madagascar; JF935328; JF935409; JF937282; JF980673;
JF980592. Pteris sp.; J. Wen 10179 (US); Indonesia; JF935342; JF935424;
JF937297; JF980687; JF980608.
Vittaria flexuosa; WP1246 (KUN); Vietnam; JF935357; JF935441; JF937314;
JF980703; JF980625. Vittaria flexuosa; WP1506 (KUN); Vietnam; —;
JF935442; JF937315; JF980704; JF980626. Vittaria sp.; J. Wen 6478 (US);
Yunnan, China; JF935358; JF935443; JF937316; JF980705; JF980627.
 October 2011] Lu et al.—Biogeographic disjunction in the ADIANTUM PEDATUM complex 1693

Appendix 2. Samples examined in the study to estimate divergence times.

Taxon: GenBank accessions, rbcL, atpB, atpA.

Acrostichum danaeifolium: EF452129, EF452008, EF452065. Adiantopsis Jamesonia verticalis: EF452155, EF452038, EF452099.
radiata: EF452131, EF452010, EF452067.
Llavea cordifolia: U27726, EF452039, EF452100.
Adiantum tetraphyllum: EF452135, EF452015, EF452073. Anetium
citrifolium: U21284, EF452017, EF452075.
Monogramma graminea: EF452157, EF452040, EF452102.

Antrophyum latifolium: EF452138. EF452018, EF452076. Asplenium

unilaterale: EF452140, EF452020, EF452078. Astrolepis sinuata: Nephrolepis cordifolia: U05933, EF452041, EF452103. Neurocallis
EF452141, EF452021, EF452079. praestantissima: EF452158, EF452042, EF452104. Notholaena
aschenborniana: EF452159, EF452043, EF452105.

Blechnum occidentale: U05909, U93838, EF452080.

Onychium japonicum: U05641, EF452045, EF452107.

Ceratopteris richardii: AB059585, AY612691, EF452082. Coniogramme

fraxinea: AM177359, AY612693, AM176470; Cryptogramma crispa:
EF452148, EF452027, EF452087.
Dennstaedtia punctilobula: U05918, U93836, EF452090.
Haplopteris elongata: EF452153, EF452035, EF452096. Hecistopteris pumila:
U21286, EF452036, EF452097.
Pellaea intermedia: EF452163, EF452047, EF452109. Polytaenium cajenense:
U20934, EF452052, EF452114. Pteridium esculentum: U05940,
U93834, EF452115. Pteris argyraea: EF452169, EF452054, EF452117.
Pterozonium brevifrons: EF452175, EF452061, EF452124.
Vittaria graminifolia: U21295, EF452064, EF452128.

View publication stats