INTRODUCTION

Pakistan's chicken industry is a remarkable livestock subsector that is crucial for economic

development(Aslam et al. 2020).In Pakistan almost 1.5 million people were employed directly

and indirectly by the estimated 1,022 million commercial hens in the nation in 2017. Chickens

bring about eggs and meat in 17,083 million and 1,270,000 tons respectively. In the

world ,Pakistan ranked at eleventh largest chicken producing country in 2015 . Since then,

public as well as private sectors have boosted their speculation, going from 200 to 700 billion

Pakistani rupees during a four year from 2015 to 2018 (4.47 billion USD). Almost 32.7% of

Pakistan total meat production is made up of chicken meat. Punjab province give rise to 70% of

that overall (Mukhtar et al. 2012). Pakistan consumption is gently increasing day by day. Poultry

have a large handout of about 1.3% to the country’s GDP. Pakistan poultry sector is an

indispensable part of the country economy. Since the 1960s, Pakistan has been producing

commercial chicken, which participate outstanding to the country population's daily protein

intake. While the business was developing, it benefited from government publicity campaign ,

but it also had to contend with problems including illness outbreaks and fluctuating retail prices

(Hussain et al. 2015).Poultry product meat and eggs are highly acceptable due to its economic

price and as a cheap source of protein. This industry is facing lots of challenges. The most

prominent challenge needs to handle is disease outbreak, limit the use of antibiotics, price

fluctuations and price of feed {Samad, 2022 #78}

One of the most frequently isolated nontyphoidal Salmonella enterica serotypes is enteritidis.

When it infects humans, the disease is called Salmonellosis which shows a wide range of

symptoms including fever, vomiting, and diarrhea. Acute Salmonellosis-related deaths are

almost equal to 400 and more than 40,000 cases of the disease are recorded each year in the US.

1
Salmonella is a member of the Enterobacteriaceae family of bacteria. These are Gram-negative

non spore forming bacilli and facultative anaerobe .Salmonella are intracellular with moving

flagella around the cell body. The biochemical characterization includes hydrogen sulphide and

catalase production. Salmonella lacks the property of oxidase enzyme and lactose fermentation

and optimal growth are seen at 37°C in a pH range of 4 to 9. The salmonella bacteria are heat-

labile and die at high temperatures about 70 °C but in some cases, it can endure extreme climatic

conditions like dust for at least two years. Salmonella enterica has six subspecies. Most

frequently, serotypes are used to identify Salmonella isolates which is based on an

oligosaccharide somatic antigen and the flagellar antigen. The most widespread serovar is

Salmonella enterica serotype enteritidis, which can cause severe clinical Salmonellosis in

humans even though it has less harmful effects on avian species. The clinical symptoms like

nausea, abdominal discomfort, diarrhea, dehydration, and mortality are more severe in low

immunity individuals. Over 80 million illnesses and 155,000 fatalities due to animal source of

foodborne salmonella . Salmonellosis and chicken production are closely intertwined. To cease

its spread and control the infection in poultry production is the main goal. Even though they

may not manifest any symptoms but the bird during the evisceration contaminate the

environment and facing a risk to human health(El-Saadony et al. 2022).Salmonella enterica

serovar Enteritidis in the chicken host has a substantial effect on the poultry industry as it acts as

a source of high zoonotic potential impact . In reality, according to the survey report of the center

of disease control and prevention more than 500 million eggs were recalled in 2010 as a result of

a widespread outbreak of salmonellosis infected with Salmonella Enteritidis species.

Additionally, the majority of Salmonella serovars are not host-restricted and can affect many

2
species of animal . So, it is more difficult to get rid of it.The possibility of disease outcomes

depending on the immunity condition of the bird and the Salmonella serovars (Mon et al. 2020).

REVIEW OF LITERATURE

The foresightedness of the chicken production is hindered due to a variety of reasons which

include bird natural and adaptive immunity against diseases. The current situation of poultry

production and its future will continuously affect the consumer trust on the product quality and

the reappearance of the diseases. Poultry products are a major source of zoonotic and foodborne

diseases. The major challenge to the industry is the wholesome meat and egg production so that

foodborne and zoonotic pathogens can be eradicated. Good management provides a significant

role to reduce disease outbreaks. The risks to public health is an antibiotic residues which causes

major health problem by inducing antibiotic resistance(Hafez and Attia 2020).The primary

intention of the poultry production is disease management ,zoonotic control , high output with

good product quality and affordable chicken product available for the consumer. In order to

prevent disease spread in community along with better health of the consumer the need is to

produce antibiotic free chicken (Cavani et al. 2009).The food chain is a source of conveyance

for many foodborne diseases outbreak in the world. Salmonella is the most common source of

food born disease outbreak that comes mainly from poultry product. World is facing a new

problem that is bacteria resistance to antibiotics because of the inappropriate use of antibiotic in

the broiler farms as a growth promoter. In order to reduce zoonotic foodborne pathogen it is

important to understand the mechanism of pathogen entry and colonization into the body and

how its managing to escape from the bird immunity (Hafez 2005)((Hafez 2010) . As the first

3
line of defense against infectious diseases, meticulous biosecurity and enhance natural immunity

is needed to cease the spread of disease. Global poultry farming has actively chosen that attribute

that maximize the feed utilization which in turn promote growth and reduce risk of diseases by

targeting better immunity genetic line in poultry. All these factors enhance the farm

profitability(Hafez and Attia 2020). Antibiotic resistance is a consistent problem not only for

human but also a threat for livestock production unit (Attia et al. 2017; Mulder 2011) .The safety

of animal products as the effects on human health are visible are major intention point while

using antibiotic into the feed as a growth promoter . Due to a better gut health that promotes

beneficial microbes’ growth enhances the digestion and absorption of nutrients which lead to

increase in production and profitability for a farmer. In 2006 many countries banned the use of

antibiotics as a growth enhancer due to the raise awareness to its detrimental effect (Hafez 2011).

The main component in disease prevention and animal protection is the body’s own response

against diseases. Animal health is determined by the immunity, infection risk, and pathogen

invasion. Animals build their immune systems at different times during their lives(Dar et al.

2018).Animals also rely on a variety of immune systems to defend themselves, including natural

and adaptive immunity that prevent pathogen growth and release them from cells. Phagocytes

(natural killer cells), which engulf and kill infections and kill some malignant cells, are in control

of innate cellular immunity. Instead of attack a particular diseases, innate immunity defends

against all invasive pathogen(Jackwood and De Wit 2013).

A variety of approaches needed to manage salmonella in broiler farm including phytochemical as

a replacer of antibiotic to overcome antibiotics multi drug resistance bacteria. It is the necessity

of time due to a rise in confirmed human salmonellosis cases observed in the Europe during the

past ten years(Iwiński et al. 2022).A significant hazard to human and veterinary health

4
worldwide is antimicrobial resistance (AMR). One of the animal industries that is rapidly and

dynamically expanding worldwide is poultry production. This significantly contributes to the rise

in the use of antibiotics medication in veterinary field and indirectly to the rise in antibiotic drug

resistance in general. It also works in conjunction with other aspects of poultry farming, such as

inadequate biosecurity, high stocking densities, and the growing threat of viral diseases that

cause immunosuppression. The most recent survey revealed that more than 70% antimicrobial

drugs are utilized in the field of food animals globally(Iwiński et al. 2022).

Pathogenesis:

Salmonella bacteria attacks the digestive tract in poultry and infection is transmitted through

contaminated water or food. Mostly it causes acute gastroenteritis. In the early stage the

salmonella pathogenicity island genes encode three secretion systems translocate effectors

around the host cell membrane. These phenomena ensure the entry of bacteria into the intestinal

cells {Herawati, 2022 #47}. A knowledge of neurochemical approach is needed to understand

the interaction of host microbe relation to regulates bacterial pathogenicity. Norepinephrine,

epinephrine and dopamine like compounds have been illustrated to cause the normal

physiological function changes in bacterial species {Lyte, 2022 #79}. Broad host Salmonella

serovars in chickens cause the intestine to become immunotolerant by an increase in regulatory

T cells which are immunity cells. Immunity regulatory cells block the inflammatory responses

required to eliminate Salmonella. Hence, limiting activity in the stomach may enhance

Salmonella antimicrobial responses. The interplay between the neurological and immune

systems, or neuroimmunology, is a largely unexplored area of biology in chickens. Immune cells

and neurons in the intestine are extensively interconnected, allowing for communication via

neurochemical transmission. Treg function is inhibited by reserpine because Tregs in mammals

5
produce their own intracellular reserves of catecholamine neurochemicals. However, it is

unknown if chicken Tregs have comparable neurochemical reserves. During an experiment,

reserpine increases antimicrobial responses against Salmonella by causing the release of

norepinephrine which are inside the cell from chicken ceca cell in the cell culture medium and

regulatory T cells in the intestine. Birds treated with reserpine tablet showed lower gut

Enterobacteriaceae and Salmonella challenge. Moreover, during experiment of reserpine therapy

stimulated T cells, decreased cytotoxic T-lymphocyte associated antigen (CTLA-4 )gene

expression which are immunity check point and inactivated metabolic pathways like epidermal

growth factor signaling and mammalian target of rapamycin (mTOR) signaling which play

important role for cell growth and differentiation (Redweik et al. 2021).The necessity is to find

new and efficient solutions as an increase result of microorganisms resistance. May be

secondary metabolites phytoalexins, phytoanticipins, and phytoncides provide a better and potent

substitute and as antibiotic replacer {Duka, 2010 #52}.

Salmonella invades non-phagocytic human host cells; it exhibits a surprising trait. Salmonella

enters the cell by actually triggering the phagocytosis process of its own. Salmonella brings

change in its gene clusters and encoding for the structures required in the invasion process. This

phagocytosis contains the surprising genetics underlying this clever tactic mechanism.

Salmonella enters the digestive tract through polluted items and penetrates the intestinal wall

epithelial cell and into the cytoplasm using type III secretion systems and multi-channel protein.

The host cells activate the signal which causes the epithelial cell membrane to extend outward to

engulf the bacteria as a protective mechanism of body . Under normal circumstances, the

presence of the bacterial foreign body in the membrane bounded vacuole would stimulate the

lysosomal enzyme and the secretion of digesting enzymes to digest the bacteria inside the cell.

6
However, Salmonella modifies the process by introducing additional proteins into the vacuole

via the type III secretion system. This modification prevents the digestion of bacteria by the

lysosomal enzymes and the digestive enzymes allowing the bacteria to grow and replicate

Salmonella survive inside the host cells and escape from the host immunity . The bacteria can

survive inside the macrophages, they can travel through the reticuloendothelial system (Eng et

al. 2015).

Prevalence:

The main source of foodborne illness and Salmonella enterica contamination in the America is

due to poultry products. It costs about $400 million a year and results in 1.35 million illnesses.

Many significant attempts have been made to reduce Salmonella prevalence in poultry but

success cannot be achieved. Salmonella isolates that show antibiotic resistance are due to the

transmission of resistance genes. Moreover, live vaccine and probiotics are frequently used as

preventative measures in commercial chicken to reduce the amount of Salmonella, however the

success rate are variable. In order to successfully reduce Salmonella in hens, present methods

must be improved or changed. To do this, a deeper understanding of the biological mechanisms

of Salmonella colonization and how it is managing to escape from chicken immunity is required

{Duka, 2010 #52}.Almost 3% of the world's bacterial foodborne disease were caused by

salmonella-contaminated animal products(El-Saadony et al. 2022). Pakistan has a high annual

incidence rate of typhoid fever. Typhoid fever is an endemic disease in Pakistan. In the end of

2016, a large-scale drug-resistant typhoid fever outbreak began in the Sindh province's

Hyderabad district and quickly spread to the entire province(Batool et al. 2022). The age range

was 5-7.5 years most significantly with a 61.5% male preponderance. The majority (53.8%)

were from Karachi's urban slum regions, and 52% were admitted between 7 and 14 days after

7
high fever. 79% of the salmonella isolates from blood cultures had multi drug resistance

infection (Memon et al. 2022) .

Antimicrobial resistance:

In summary, there was an existence of close association between clustered regularly interspaced

short palindromic repeats(CRISPR-which are the hallmark of a bacterial defense system ) and

drug resistance in Salmonella. This was hypothesized that it led the development of drug-

resistant plasmids and resistant fragments. Moreover, CRISPR-Cas9-based gene editing tool

precisely modifies the genes which are resistant in Salmonella (Wang et al. 2022).Antimicrobial

resistance is a bacteria ability to interfere with the antibiotic. Different species have different

abilities to resist antibiotics. Worldwide salmonella is considered as a multi drug resistance

bacterium. Almost 26 % of species show resistance to ciprofloxacin and cefotaxime.

Aminoglycosides,tetracycline, chloramphenicol, quinolones and sulfonamides are the most

common antibiotics against which salmonella reduce the activity. It happens by changing

membrane permeability, energy dependent removal of antimicrobial by changing the membrane

bound efflux pumps and bring changes at a site of drug action. It may replace the site of target

protein. Aminoglycosides resistance is due to enzymatic modification. Genetic change in

plasmid is responsible for this process. Moreover, resistance to fluoroquinolones is due to

multiple location mutation in a gene {Tan, 2022 #81}.

Control:

Antibiotic resistance can be reduced by the use of phytochemicals as a feed additive in broiler.

Rauwolfia serpentina medicinal herb:

The Apocynaceae family member Rauwolfia serpentina (also known as R. serpentina) is a well-

known medicinal plant. Rauwolfia have anti-inflammatory, antibacterial and antifungal

8
properties (Alshahrani et al. 2021) .Ajmaline and Reserpine are two of the main R. serpentina

alkaloids' active compound. Ajmalinine, reserpinine, rawolscine, serpenticine,

isoajmalinerawolfinine, and renoxycine are the other phytoconstituents. serpentine, sarpagine,

reserpine, reserpilline, and tetraphyllicine(Dymock 1891). This plant has a wide range of herbal

medicinal characteristics such as herbal treatment in high blood pressure, sleeplessness,

intestinal inflammation , headache, malaria, respiratory problem, and in case of skin allergies.

Several doctors recommended this herbal medicine to calm down paranoid and schizophrenic

patients (Alshahrani et al. 2021). Antibiotics are no longer as effective as they once .The reason

behind is multi-drug resistance bacterial strains, which increased the range of bacterial infections

that were untreatable (Huh and Kwon 2011). Yet, a lot of medical professionals are still in search

of cancer treatment and the toxicity of chemotherapy drugs. Finding new medications with fewer

side effects is urgent, therefore it's critical to do it as soon as you can. Accepted facts state that

different kinds of herbs and their chemical constituents are essential in order to get a therapeutic

effect(Shendge Rauwolfia and Belemkar 2018; Yalavarthi and Thiruvengadarajan 2013).These

phytoconstituents have the potential to serve as precursors for new medications. Aqueous extract

from Rauwolfia serpentina exhibited strong antibacterial properties. At a concentration of 100

mg/mL extract of R. serpentina in water show the greatest efficacy against S. aureus, E. coli, B.

subtilis, and S. pyogenes (Alshahrani et al. 2021). Rauwolfia vomitoria both ethanol and

aqueous root extracts have the ability to reduce inflammation during arthritis in rat paws.

Rauwolfia vomitoria ethanol, and aqueous root extracts at 400, 600, and 800 mg/kg body weight

show a remarkable change in paw edema of rats but in high doses have greatest anti-

inflammatory effect. In rats cytokines level also reduces and study proved that Rauwolfia have

antarthritic activity .Time and concentration both affected the efficacy of herbal medicine. The

9
inclusion of several Rauwolfia vomitoria active components have anti-inflammatory and anti-

oxidant activities (Nkiru et al. 2018).

STATEMENT OF PROBLEM:

The most common causes of foodborne disease which almost impacting around 83.3 million

individuals in both developing and industrialized nations are because of salmonella.

Consumption of infected foods such as mutton, beef, poultry, and both direct and indirect contact

with animals and their products can result in human infection. The alarming situation arising by

the use of excessive antibiotics and growth boosters in broilers which in turn lead to multi-drug

resistant Salmonella strains in field ,according to numerous research. In Pakistan, foodborne

infections are a major source of economic loss and health issues. Therefore, the present study has

been designed to find out how phytochemicals enhance the innate immunity in broiler and

decrease the spread of zoonotic salmonella in community.

Objectives:

• Use of Phytochemical as an alternative source of antibiotics .

• Control of multidrug resistance salmonella.

10
 MATERIAL AND METHOD

Experimental trial will be conducted in pathology department of university of veterinary and

animal sciences Lahore. Rauwolfia Serpentina root powder (phytochemical source) and

Rauwolfia Serpentina extract (as a source of reserpine) are collected from a local herbal store .A

total of 100 Hubbard classic, A-grade day old chick will be procured commercially and will be

raised in the experimental open sided poultry house of the Pathology Department, UVAS,

Lahore. They will be divided into 4 groups of 25 chicks each with following treatment plan:

GROUP DAY Treatment Dose Challenge day

A 0-7 0.3 %Rauwolfia powder in feed +challenge 0.3 % 4th day of age

{Kulkarni, 2017 #76}

B 0-7 400mg/kg Rauwolfia extract in water + 400mg/ 4th day of age

challenge. {Ezeani, 2018 #77} kg

C Challenge only 4th day of age

D Control

11
Chemical analysis will be performed for powder and extract of Rauwolfia. One day old chick

will be treated with Rauwolfia serpentina powder and extract. At 4th day of age, chicks will be

challenged with Salmonella Gallinarum orally. Quantification of m RNA gene P20K, SOCS3

and MHC class IIβ will be performed at day 7. Primers will be designed for SOCS3 (F-

5′GCCCCAGGTGATGGTGTA3’, R- 5′CTTAGAGCTGAACGTCTTGAGG3’ ) P20K (F-

5′CTAGGGAGCGGAACTACACG’3, R- 5′GTTTGGGAAGCAGCATTCAT3’ ) and MHC

class IIβ (F- 5′GTGCAGAGGAGCGTGGAG3’, R- 5′CGTTCAGGAACCACTTCACC3’) by

using web-based software.(Kaiser et al. 2022) .Quantitative PCR (qRT-PCR) will be performed

by using a SYBR Green dye.

Number genes sequence

1. SOCS3 (F- 5′GCCCCAGGTGATGGTGTA3’, R-

5′CTTAGAGCTGAACGTCTTGAGG3’ )
2. P20K (F-
5′CTAGGGAGCGGAACTACACG’3, R-
5′GTTTGGGAAGCAGCATTCAT3’ )
3. MHC class IIβ (F- 5′GTGCAGAGGAGCGTGGAG3’,
R- 5′CGTTCAGGAACCACTTCACC3’)

Parameter:
Quantification of mRNA, Enteric histopathology, weight gain & feed conversion ratio will be

measured.

Statistical analysis:

The expected proportion of prevalence will be calculated through analysis of variance.

Expected outcomes:

There is an increase expression of mRNA which enhances the natural immunity of the bird

against salmonella.

12
 SUMMARY
Background:
Excessive use of antibiotics in broiler feed led to development of multi-drug resistant

Salmonella strains. Therefore, the present study has been designed to find out replacer of

antibiotics.

Hypothesis:
Rauwolfia Serpentina powder and extract as a source of reserpine improves salmonella resistance

in chicken intestine via a neuro-immunometabolic signaling.

Methodology:
In the present study Rauwolfia Serpentina root powder and extract will be used as a antibiotic

replacer in broiler . A total of 100 broiler chicks will be divided into 4 groups . Group A will be

treated with powder 0.3% in feed(Kulkarni et al. 2017)+ challenge. Group B will be treated with

extract 400mg/kg orally + challenge. Group C will receive challenge only and Group D will be

control. Chemical analysis will be performed for Rauwolfia. One day old chick will be treated

with Rauwolfia serpentina powder and extract. At 4th day of age, chicks will be challenged with

13
Salmonella gallinarum orally. Primers will be designed for quantification of mRNA gene P20K,

SOCS3 and MHC class IIβ will be performed at day 7 by using a SYBR green dye.(Kaiser et al.

2022) .

Parameter:
Quantification of mRNA, Enteric histopathology, weight gain & feed conversion ratio will be
measured.
Statistical design:
Data analysis will be performed by using the statistical analysis program, Analysis of Variance .

Outcome:
There is an increase expression of mRNA .

References:
Alshahrani MY, Rafi Z, Alabdallah NM, Shoaib A, Ahmad I, Asiri M, Zaman GS, Wahab S,

Saeed M, Khan S. 2021. A Comparative Antibacterial, Antioxidant, and Antineoplastic

Potential of Rauwolfia serpentina (L.) Leaf Extract with Its Biologically Synthesized

Gold Nanoparticles (R-AuNPs). 10(11): 2278.

Aslam HB, Alarcon P, Yaqub T, Iqbal M, Häsler B. 2020. A Value Chain Approach to

Characterize the Chicken Sub-sector in Pakistan. 7.

Attia YA, Al-Harthi MA, El-Shafey AS, Rehab YA, Kim WKJAoAS. 2017. Enhancing tolerance

of broiler chickens to heat stress by supplementation with vitamin E, vitamin C and/or

probiotics. 17(4): 1155.

Batool R, Qureshi S, Yousafzai MT, Kazi M, Ali M, Qamar FN. 2022. Risk Factors Associated

with Extensively Drug-Resistant Typhoid in an Outbreak Setting of Lyari Town Karachi,

Pakistan %J The American Journal of Tropical Medicine and Hygiene. 106(5): 1379-

1383.

14
Cavani C, Petracci M, Trocino A, Xiccato GJIJoAS. 2009. Advances in research on poultry and

rabbit meat quality. 8(sup2): 741-750.

Dar MA, Mumtaz PT, Bhat SA, Nabi M, Taban Q, Shah RA, Khan HM, Ahmad SMJAog,

science gip. 2018. Genetics of disease resistance in chicken. 162-174.

Duka R, Ardelean DJJMA. 2010. Phytoncides and phytoalexins–vegetal antibiotics. 13(3): 19-

25.

Dymock WJPI. 1891. Rauwolfia alkaloids. 2: 415.

El-Saadony M, Salem H, Eltahan A, Ali T, Soliman S, Khafaga A, Swelum A, Ezzat Ahmed A,

Alshammari F, El-Hack M. 2022. The control of poultry salmonellosis using organic

agents: an updated overview. Poultry Science. 101: 101716.

Eng S-K, Pusparajah P, Ab Mutalib N-S, Ser H-L, Chan K-G, Lee L-HJFiLS. 2015. Salmonella:

a review on pathogenesis, epidemiology and antibiotic resistance. 8(3): 284-293.

Ezeani N editor.; 2018.

Hafez HJWP. 2010. Poultry health-looking ahead to 2034. 25: 16-17.

Hafez HJWsPSJ. 2005. Governmental regulations and concept behind eradication and control of

some important poultry diseases. 61(4): 569-582.

Hafez HM. 2011. Enteric diseases of poultry with special attention to Clostridium perfringens.

Hafez HM, Attia YA. 2020. Challenges to the Poultry Industry: Current Perspectives and

Strategic Future After the COVID-19 Outbreak. 7.

Huh AJ, Kwon YJJJocr. 2011. “Nanoantibiotics”: a new paradigm for treating infectious

diseases using nanomaterials in the antibiotics resistant era. 156(2): 128-145.

Hussain J, Rabbani I, Aslam S, Ahmad HA. 2015. An overview of poultry industry in Pakistan.

World's Poultry Science Journal. 71: 689-700.

15
Iwiński H, Wódz K, Chodkowska K, Nowak T, Różański H. 2022. In Vitro Evaluation of

Antimicrobial Effect of Phytobiotics Mixture on Salmonella spp. Isolated from Chicken

Broiler. Antibiotics (Basel). 11(7).

Jackwood MW, De Wit SJDop. 2013. Infectious bronchitis. 139-159.

Kaiser MG, Hsieh J, Kaiser P, Lamont SJ. 2022. Differential immunological response detected in

mRNA expression profiles among diverse chicken lines in response to Salmonella

challenge. Poultry Science. 101(2): 101605.

Kulkarni RC, Mandal A, Dey S, Salunke VMJIRJoEE. 2017. Rauwolfia serpentina: A Stress

Alleviator of Coloured Broilers Using Incentive to Feed In Extreme Summer. 85-88.

Memon H, Saeed F, Iqbal M, Saboohi E, Hanif S, Mallick AHH. 2022. Association of

extensively drug resistant salmonella infection in children with typhoid fever. Pakistan

Journal of Medical Sciences. 38(7).

Mon KKZ, Zhu Y, Chanthavixay G, Kern C, Zhou H. 2020. Integrative analysis of gut

microbiome and metabolites revealed novel mechanisms of intestinal Salmonella carriage

in chicken. Scientific Reports. 10(1): 4809.

Mukhtar N, Khan S, Khan RJWsPSJ. 2012. Structural profile and emerging constraints of

developing poultry meat industry in Pakistan. 68(4): 749-757.

Mulder R. 2011. Current EU regulations for the production and processing of (safe) poultry

meat. In: Published 10/20/2011 http://en. engormix. com/MA-poultry-industry/health ….

Nkiru, Ezeani N, Ibiam U, Obasi U, Orji O, Patrick M, Aja U, Alum C, Offor E. 2018.

CODEN(USA): PCJHBA Effects of Aqueous and Ethanol Root Extracts of Rauwolfia

Vomitori on Inflammatory Parameters in Complete Freund's Adjuvant-Collagen Type II

Induced Arthritic Albino Rat. 72-83.

16
Redweik GAJ, Kogut MH, Arsenault RJ, Lyte M, Mellata M. 2021. Reserpine improves

Enterobacteriaceae resistance in chicken intestine via neuro-immunometabolic signaling

and MEK1/2 activation. Communications Biology. 4(1): 1359.

Shendge PN, Belemkar SJFip. 2018. Therapeutic potential of Luffa acutangula: A review on its

traditional uses, phytochemistry, pharmacology and toxicological aspects. 9: 1177.

Wang Y, Ge H, Wei X, Zhao X. 2022. Research progress on antibiotic resistance of Salmonella.

Food Quality and Safety. 6: fyac035.

Yalavarthi C, Thiruvengadarajan VJIjorips. 2013. A review on identification strategy of phyto

constituents present in herbal plants. 4(2): 123-140.

17