J Huazhong Univ Sci Technol [Med Sci]

34(1):81-86,2014
J DOI 10.1007/s11596-014-1235-y
Huazhong Univ Sci Technol [Med Sci] 34(1):2014 81

Clinical Characteristics, Cytogenetic and Molecular Findings in

Patients with Disorders of Sex Development
Li TIAN (田 莉)1#, Ming CHEN (陈 明)1, Jian-hong PENG (彭剑鸿)2, Jian-wu ZHANG (张建武)3, Li LI (李 黎)3
1
Department of Blood Transfusion, 2Center for Gene Diagnosis, 3Department of Clinical Laboratory, Zhongnan Hospital of Wuhan
University, Wuhan 430071, China

© Huazhong University of Science and Technology and Springer-Verlag Berlin Heidelberg 2014

Summary: The clinical characteristics of patients with disorders of sex development (DSD), and the diag-
nostic values of classic cytogenetic and molecular genetic assays for DSD were investigated. In the en-
rolled 56 cases, there were 9 cases of 46,XY DSD, 6 cases of Turner syndrome (TS), one case of Super
female syndrome, 25 cases of Klinefelter syndrome, 14 cases of 46,XX DSD, and one case of autosomal
balanced rearrangements with hypospadias. The diagnosis of sex was made through physical examination,
cytogenetic assay, ultrasonography, gonadal biopsy and hormonal analysis. PCR was used to detect SRY,
ZFX, ZFY, DYZ3 and DYZ1 loci on Y and X chromosomes respectively. The DSD patients with the same
category had similar clinical characteristics. The karyotypes in peripheral blood lymphocytes of all patients
were identified. PCR-based analysis showed presence or absence of the X/Y-linked loci in several cases.
Of the 9 cases of 46,XY DSD, 6 were positive for SRY, 9 for ZFX/ZFY, 9 for DYZ3 and 8 for DYZ1 loci.
Of the 6 cases of TS, only 1 case with the karyotype of 45,X,/46,XX/46,XY was positive for all 5 loci. Of
the 25 cases of Klinefelter syndrome, all were positive for all 5 loci. In one case of rare Klinefelter syn-
drome variants azoospermia factor (AZF) gene detection revealed the loss of the AZFa+AZFb region. In
14 cases of 46,XX DSD, 7 cases were positive for SRY, 14 for ZFX, 7 for ZFY, 7 for ZYZ3, and 5 for
DYZ1. PCR can complement and also confirm cytogenetic studies in the diagnosis of sex in cases of DSD.
Key words: disorders of sex development; Turner syndrome; Klinefelter syndrome; SRY; azoospermia
factor

The development of a mammalian embryo into ei-
ther female or male is primarily dependent on the sex
chromosomal constitution, being XX and XY respectively.
In the absence of Y chromosome-derived information,
ovaries are formed, resulting in a female phenotype. The
essential step in normal male sexual differentiation re-
quires Y chromosome-derived information. Testis devel-
opment requires the activation of a cascade of both auto-
somal and Y chromosomal genes. Originally, the putative
gene on the Y chromosome that causes the bipotential
gonad to develop as testis is named testis-determining
factor (TDF). After TDF is mapped to the short arm of the
Y chromosome[1, 2], the candidate region is subsequently
narrowed down to a 35 kb interval on the Y chromosome
adjacent to the pseudoautosomal boundary, named
sex-determining region Y gene (SRY)[3]. Discordance in
chromosomal sex can lead to disorders of sex develop-
ment (DSD).
The cytogenetic analysis is a conventional method,
which can not only identify sex, but also detect other
chromosomal aberrations. It is non-invasive, inexpensive
and rapid, but mosaic karyotypes with small marker
chromosomes have been a challenge for cytogenetic
analysis. However, the combination of cytogenetic and
molecular techniques enables this problem to be solved
quite efficiently and the origin of markers in patients with
chromosomal DSD to be established. In this study, we
used this approach to examine 56 patients with DSD for
# 100 metaphases were analyzed to look at any heterozygos-
Corresponding author, Li TIAN, E-mail: litian1971@sina.com
precise karyotyping and determination of the X/Y material
in these subjects.
1 MATERIALS AND METHODS
1.1 Patients
Fifty-six patients were enrolled from Zhongnan Hos-
pital of Wuhan University from Jan. 2000 to Dec. 2012,
and they were all unrelated, with ages ranging from 5 to
32 years. Written consents were obtained from the patients
and the study was approved by the institutional review
board of the hospital. The patients included had hypoplasia
of the external genitalia and delayed puberty.
Some subjects also had gynaecomastia and obesity,
pubertal hypogonadism, testicular atrophy, and azoosper-
mia. Thirty-nine of them were ultrasonographically ex-
amined. Clinical details of each subject are presented in
table 1. The control DNA blood samples were obtained
from a DNA bank of endocrinologically normal individu-
als, with no phenotypic abnormalities.
1.2 Cytogenetic Analysis
Cytogenetic analysis was performed by standard cy-
togenetic techniques using metaphase chromosome prepa-
rations from PHA-stimulated peripheral blood lympho-
cytes. Dividing cells were arrested at metaphase stage with
colchicines and fixed in methanol:acetic acid (3:1). Fixed
cells were dropped onto glass slides and allowed to air dry.
Chromosomes were G-banded by treating the preparations
with trypsin followed by staining with Giemsa. A total of
ity among the cell populations.
 82 J Huazhong Univ Sci Technol [Med Sci] 34(1):2014

Table 1 Clinical, cytogenetic and molecular findings in patients with DSD

Case Sex Age Height Clinical features Karyotypes PCR results
no. (year) (cm) SRY ZFX/ZFY DYZ3 DYZ1
1–9 F 14–22 165–171 Physically resembling a normal female, with 46,XY +(6) +/+ + +
normal external genitalia, absence of uterus or –(2) +/+ + +
ovaries, vaginal echo present –(1) +/+ + –
10–11 F 5–19 81–131 Short stature, webbed neck, shield-like chest, 45,X – +/– – –
primary amenorrhoea, small uterus
12–14 F 13–21 125–136 Short stature, webbed neck, primary or secondary 45,X/46,XX – +/– – –
amenorrhoea, atopic vagina, sparse auxiliary pubic
hair, small uterus
15 F 27 158 Primary amenorrhoea, poorly developed SSC, 46,XX/ – +/– – –
absence of uterus,dysgenic gonads 47,XXX

16 F 15 151 Primary amenorrhoea, no breast or pubic hair 45,X/46,XX/46,XY + +/+ + +

development, underdeveloped external genitalia,
extremely hypoplastic uterus under USG
17–30 M 16–29 140–170 Gynaecomastia, small testes, small penis, cryp- 46,XX –(7) +/– – –
torchidism and hypogonadism +(5) +/+ + +
+(2) +/+ + –
31–40 M 17–35 176–182 Small testes, sparse body hair, gynecomastia, 47,XXY + +/+ + +
infertility
41–52 M 14–42 172–186 Small testes, sparse body hair, gynecomastia, 46,XY/ + +/+ + +
hypergonadotropic hypogonadism, infertility 47,XXY
53 M 33 184 Small testes, sparse body hair and auxiliary pubic 46,XY/ + +/+ + +
hair, loss of libido, erectile dysfunction, absent 47,XYY
spermatogenesis
54 M 19 169 Testis/streak, bilateral fallopian tubes, right epidi- 45,X/46,XY/47,XXY + +/+ + –
dymis
55 M 28 179 Sparse body and auxiliary pubic hair, gynecomas- 46,XY/47,XXY/48,X + +/+ + +
tia, obesity, small testes, absent spermatogenesis XYY/49,XXXXY

56 M 17 141 Poorly developed SSC, hypospadias 46,XY,t(4;7)(p15; q21) + +/+ + +

M: male; F: female; SSC: secondary sexual characters; USG: ultrasonography; (n): positive or negative number of cases

1.3 Molecular Analysis (sY84, sY86), AZFb (sY127, sY134), and AZFc (sY254,
DNA was extracted from peripheral blood leuko- sY255) were amplified by PCR to look for the pres-
cytes of the patients with DSD, and DNA samples were ence/absence of these genes. Primers specific for the
quantified spectrophotometrically by measuring the ab- spermatogenic genes were taken from our earlier stud-
sorbance (A) at 260 nm. A set of oligoprimers represent- ies[4]. The reactions contained 100 ng of DNA, 1.5
ing five different loci (SRY, ZFX, ZFY, DYZ3, DYZ1) mmol/L MgCl2, 200 pmol/L dNTPs, 10 pmol of each
of the X and Y chromosome encompassing both the arms primer, and 1 U of Taq polymerase in a final volume of
were used for PCR amplifications. For the SRY locus, 25 µL. Amplification conditions consisted of initial de-
two sets of primers were selected for typing all the sam- naturation for 5 min at 94°C, and 30 cycles for 20–30 s
ples. The other set of primers encompassing the HMG at 94°C, 30 s at 52–65°C, and 30–45 s at 72°C, with a
box was used for analyzing the DNA from the pheno- final extension for 5 min at 72°C. After electrophoresis,
typic females positive for all the 5 Y-linked loci. The PCR products were visualized under a UV transillumi-
details of the PCR primers, and size of the expected am- nator on a 2% agarose gel stained with ethidium bromide
plicons are given in table 2. Spermatogenic genes AZFa (fig. 1).
Table 2 Specific primer pairs used in the PCR analysis of genomic DNA
Genes Primer sequences (5′–3′) Product size (bp)
SRY1 TTCAATTTTGTCGCAACTCTCC 237
GATCGAATGCGTTCATGGGTC
SRY2 TCGCACTCTCCTTGTTTTTG 585
CGTTGATGGGCGGTAAGT
ZFX ACCGCTGTACTGACTGTGATTACAC 495
GCACCTCTTTGGTATCCGAGAAAGT
ZFY GGTCTGCAGACTCTTCTAAC 603
TTCTTGCAGTACTCACACCG
DYZ3 TCCTTTTCCACAATAGACGTCA 170
GGAAGTATCTTCCCTTAAAAGCTA
DYZ1 TACGGGTCTCGAATGGAATA 236
TCATTGCATTCCTTTCCATT
J Huazhong Univ Sci Technol [Med Sci] 34(1):2014 83

chromosome as well as the SRY gene. DYZ3 was found

2 RESULTS to be present in the maximum number of cases, suggest-
ing its more stable nature and important biological roles.
The clinical characteristics, social sex, age, karyo- One sample (case 55) represented azoospermia, with
types and histology of the gonads at biopsy or gonadec- rare 46,XY/47,XXY/48,XXYY/49,XXXXY Klinefelter
tomy in all DSD patients are listed in table 1. syndrome variants (fig. 2). PCR-based Y-microdeletion
In a total of 56 cases of DSD enrolled in this study, analysis was performed in the Molecular Genetics Labo-
the karyotypes of the chromosomes from the peripheral ratory. Multiplex PCR was used to detect AZF-candidate
blood lymphocytes were determined. There were 32 genes as follows: sY84, sY86, sY127, sY129, sY134,
cases of sex chromosome DSD, including 5 cases of sY254, sY255, sY242 and sY152. The deletion sites were
45,X Turner syndrome (TS) and variants, 24 cases of sY86 and sY127, and AZFa+AZFb deletion of AZF re-
47,XXY Klinefelter syndrome and variants, 2 cases of gion was identified (fig. 3).
45X/46XY mixed gonadal disgenesis (MGD), and one
case of choromosomal ovotesticular DSD. There were 9
cases of 46,XY DSD. These patients were characterized
by ambiguous or female external genitalia. There were
14 cases of 46,XX DSD. There was one case of auto-
somal rearrangements.
PCR-based analysis showed the X/Y-linked loci in
several cases where the Y chromosome was not detect-
able cytogenetically. Of the 9 cases of 46,XY DSD, 6
were positive for SRY, 9 for ZFX/ZFY, 9 for DYZ3 and
8 for DYZ1 loci. Of the 6 cases of TS, one case of
45,X/46,XX/46,XY was positive for all 5 loci, and the
rest 5 cases were found to be negative. Thus, the major-
ity of the patients with TS showed varying levels of ab-
errant Y chromosome. Of the 14 cases of 46,XX DSD, 7
were positive for SRY,14 for ZFX, 7 for ZFY, 7 for
Fig. 1 Gel electrophoresis of the PCR amplicons of the SRY
DYZ3 and 5 for DYZ1 loci. Seven samples were nega- gene
tive for 4 loci. Of the 25 cases of Klinefelter syndrome A: SRY amplification with the first set of the primer
and variants, all of samples were positive for all 5 loci. (237 bp); B: SRY amplification with the second set of
The case 56, an XY autosomal balanced rearrangements primer (585 bp). Lanes 1–9: peripheral blood DNA
male representing hypospadias, was positive for all the from patients; Lane M: 100–600 bp ladder; Lane 10:
Y-linked loci. Of all the Y-linked loci studied, DYZ1 blank control
corresponded to the pericentromeric region of the Y

Fig. 2 Karyotyping of Klinefelter syndrome variant in peripheral blood lymphocytes detected by using conventional G-banding
A: 48,XXYY karyotype (56%); B: 47, XXY karyotype (30%); C: 46,XY karyotype (12%); D: 49,XXXXY karyotype (2%)
 84 J Huazhong Univ Sci Technol [Med Sci] 34(1):2014

Fig. 3 Gel electrophoresis of the multiplex PCR amplicons of the AZF genes
A: AZF amplification with the first set of the primer (ZFX/ZFY, SY254, SY86, SY127); B: AZF amplification with the sec-
ond set of the primer (ZFX/ZFY, SY134, SY242, SY255); C: AZF amplification with the third set of the primer (ZFX/ZFY,
SRY, SY152); D: AZF amplification with the fourth set of the primer (ZFX/ZFY, SY84, SY129). Lane 1: a normal male; Lane
2: a patient; Lane 3: the patient’s father; Lane 4: the patient’s mother; Lane 5: a normal female; Lane 6: blank control; Lane M:
100–600 bp ladder

the Y-chromosome in TS patients is correlated with an

3 DISCUSSION
Sex chromosome DSD is associated with a numeri-
cal sex chromosome abnormality leading to abnormal
gonadal development[5–8], including 45,X TS and variants,
47,XXY Klinefelter syndrome and variants, 45X/46XY
MGD, and choromosomal ovotesticular DSD
(46XX/46XY chimeric type or mosaic type). Sex chro-
mosome DSD was formerly termed as gonadal dysgene-
sis in most of the patients. If patient’s testis is poorly
formed, it is called a dysgenetic testis, and if an ovary is
poorly formed, it is called a streak gonad. Klinefelter
syndrome and TS are the most frequently encountered
sex chromosomal abnormalities[9–11].
TS is characterized by gonadal dysgenesis, short
stature, and dysmorphic features (neck webbing amongst
others). In this study, cases 10–14 have similar clinical
characteristics. The case 16 with chromosomal DSD as a
result of a 45,X/46,XX/46,XY karyotype presented with
a wide spectrum of phenotypes ranging from normal
male through ambiguous genitalia to female with a TS
phenotype. Only in this case all 5 loci were positive. This
type of MGD is characterized by the presence of dys-
genetic testis and/or streak gonads, with persistence of
the Müllerian ducts and inadequate virilization.
Y-chromosome mosaicism may lead to virilization and
modifications in the female phenotype of TS patients,
although a direct correlation between presence of the
Y-chromosome and gonadal differentiation pattern has
not been clear[12, 13]. The presence of a specific region of
increased risk of developing a germ cell tumor/cancer
(GCC)[14, 15], but the actual percentage of Y chromo-
some-bearing cells in the neoplastic tissue remains un-
clear.
Bashamboo et al used DYZ1 repeat fraction as
probe for fluorescence in situ hybridization (FISH) and
its core sequences for DNA typing[16]. The high copy
number of DYZ1 (2000–4000 copies per Y chromosome)
facilitated the detection of the Y chromosome even in the
aberrant forms. Y chromosome mosaicism in TS cases
was found to be about 57%. Cryptic mosaicism of the Y
chromosome has been reported to be a rare event and
may be less than 1%[17]. Shahid et al described a mosaic
TS patient, with gonadoblastoma, having a frameshift
mutation in SRY which was inherited from the father[18].
The patient was found to be mosaic for the SRY mutation
and had oligoasthenozoospermia and a testicular GCC,
which are signs of mild testicular dysgenesis syndrome.
However, the study by Cools et al revealed no clear cor-
relation between peripheral blood karyotype and gonadal
karyotype, or between the gonadal karyotype and differ-
entiation pattern found in the gonads[19]. Two subsequent
case reports and analysis of a larger series of samples
show no correlation between the degree of gonadal mo-
saicism and differentiation pattern.
Klinefelter syndrome is characterized by a progres-
sive testicular failure causing small testes, androgen
deficiency, and azoospermia. It is the most prevalent
chromosome aberration occurring in w1 in 660 newborn
males[20]. It is one of the commonest congenital chromo-
J Huazhong Univ Sci Technol [Med Sci] 34(1):2014
some disorders resulting in hypogonadism and geneti-
cally-determined infertility[21, 22]. 80% of Klinefelter
syndrome patients have the 47,XXY karyotype. The re-
maining 20% have either mosaic 47,XXY/46,XY, su-
pernumerary X chromosome aneuploidy (48,XXXY;
49,XXXXY), one or several additional Y chromosome(s)
(e.g. 48,XXYY), or structurally abnormal additional X
chromosomes[23, 24]. In 25 cases of Klinefelter syndrome,
there were 10 cases of 46,XXY, 12 cases of
46,XY/46,XXY, one case of 45,X/46,XY/47,XXY, one
case of 46,XY/47,XYY, and one case of
46,XY/47,XXY/48,XXYY/49,XXXXY rare syndrome
variants. The 46,XY/47,XXY/48,XXYY/49,XXXXY
patient shows similar features of individuals carrying
47,XXY and 47,XYY karyotypes, including tall stature,
narrow shoulders, broad hips, sparse body hair, gyneco-
mastia, normal to slightly decreased verbal intelligence
and hypergonadotropic hypogonadism and infertility.
Clinically some differences are found: The first condition
shows facial dysmorphism and congenital malformations
and also has a lower IQ with frequent and severe behav-
ioral and psychiatric problems, including autism spec-
trum disorders and mood and tic disorders. Cytogenetic
analysis by standard cytogenetic techniques indicated a
line proportion of 56% 48,XXXY, 30% for 47,XXY, 12%
for 46,XY and 2% for 49,XXXXY (fig. 2). PCR-based
analysis revealed that the patient was positive for all 5
X/Y-linked loci. Y chromosome AZF microdeletion was
found in the patient at the sites of sY86 and sY127. The
parents were found consistency between SRY gene and
chromesome gender, and no Y chromosome AZF mi-
crodeletion.
46,XY DSD can result either from disorders of tes-
ticular development or disorders in androgen synthe-
sis/androgen action[25]. These patients are characterized
by ambiguous or female external genitalia, caused by
incomplete intrauterine masculinization. Male gonads are
palpable in the majority of 46,XY DSD patients. In 23
patients with sex reversal in this study, there were 9 cases
of 46,XY DSD and 14 cases of 46,XX DSD. Some phe-
notypic female patients were found to be positive for one
or more of the X/Y-linked loci, and some phenotypic
male patients were found to be negative for one or more
of the Y-linked loci. This suggests that Y chromosome
mosaicism is not uncommon, though the cause or the
effect of such aberration remains unclear. Patients with
genetic anomalies showed an abnormal hormonal profile,
indicating possible involvement of the autosomal genes
in the diseased phenotype. This opens up newer vistas
for the in-depth analysis of the candidate genes related to
paracrine systems.
Conflict of Interest Statement
The authors declare that there is no conflict of interest
with any financial organization or corporation or individual that
can inappropriately influence this work.
REFERENCES
1 Jacobs PA, Ross A. Structural abnormalities of the Y
chromosome in man. Nature,1966,210(5034):352-354
2 Davis RM. Localization of male-determining factors in
man: A thorough review of structural anomalies of the Y
chromosome. J Med Genet, 1981,18(3):161-195
3 Sinclair AH, Berta P, Palmer MS, et al. A gene from the
85
human sex-determining region encodes a protein with
homology to a conserved DNA-binding motif. Nature,
1990,346(6281):240-244
4 Tian L, Zhang JW, Shen CX, et al. Cytogenetics and Y
chromosome AZF microdeletions in infertile patients
with mosaic karyotype Klinefelter syndrome. Zhonghua
Nan Ke Xue (Chinese), 2012,18(6):545-550
5 Barthold JS. Disorders of sex differentiation: a pediatric
urologist’s perspective of new terminology and recom-
mendations. J Urol, 2011,185(2):393-400
6 Aaronson IA. Terminology for disorders of sex develop-
ment: clarity or confusion. J Urol, 2011,185(2):388-389
7 Nishi MY, Costa EM, Oliveira SB, et al. The role of SRY
mutations in the etiology of gonadal dysgenesis in pa-
tients with 45,X/46,XY disorder of sex development and
variants. Horm Res Paediatr, 2011,75(1):26-31
8 Wijchers PJ, Yandim C, Panousopoulou E, et al. Sexual
dimorphism in mammalian autosomal gene regulation is
determined not only by SRY but by sex chromosome
complement as well. Dev Cell, 2010,19(3):477-484
9 Siklar Z, Berberoglu M, Adiyaman P, et al. Disorders of
gonadal development: a broad clinical, cytogenetic and
histopathologic spectrum. Pediatr Endocrinol Rev,
2007,4(3):210-217
10 Oliveira RM, Verreschi IT, Lipay MV, et al. Y chromo-
some in Turner syndrome: review of the literature. Sao
Paulo Med J, 2009,127(6):373-378
11 Khandelwal A, Agarwal A, Jiloha RC. A 47,XXY female
with gender identity disorder. Arch Sex Behav,
2010,39(5):1021-1023
12 Tilford CA, Kuroda-Kawaguchi T, Skaletsky H, et al. A
physical map of the human Y chromosome. Nature,
2001,409(6822):943-945
13 Cools M, Pleskacova J, Stoop H, et al. Gonadal pathol-
ogy and tumor risk in relation to clinical characteristics in
patients with 45,X/46, XY mosaicism. J Clin Endocrinol
Metab, 2011,96(7):E1171-1180
14 Lau YF, Li Y, Kido T. Gonadoblastoma locus and the
TSPY gene on the human Y chromosome. Birth Defects
Res C Embryo Today, 2009,87(1):114-122
15 Hersmus R, de Leeuw BH, Wolffenbuttel KP, et al. New
insights into type Ⅱ germ cell tumor pathogenesis based
on studies of patients with various forms of disorders of
sex development (DSD). Mol Cell Endocrinol,
2008,291(1-2):1-10
16 Bashamboo A, Rahman MM, Prasad A, et al. Fate of SRY,
PABY, DYS1, DYZ3 and DYZ1 loci in Indian patients
harbouring sex chromosomal anomalies. Mol Hum Re-
prod, 2004,11(2):117-127
17 Yorifugi T, Muroi J, Kawai M, et al. PCR-based detection
of mosaicism in Turner syndrome patients. Hum Genet,
1997,99(1):62-65
18 Shahid M, Dhillon VS, Khalil HS, et al. A SRY-HMG
box frame shift mutation inherited from a mosaic father
with a mild form of testicular dysgenesis syndrome in
Turner syndrome patient. BMC Med Genet, 2010,11(19):
131
19 Cools M, Boter M, van Gurp R, et al. Impact of the
Y-containing cell line on histological differentiation pat-
terns in dysgenetic gonads. Clin Endocrinol (Oxf),
2007,67(2):184-192
20 Bojesen A, Juul S, Gravholt CH. Prenatal and postnatal
prevalence of Klinefelter syndrome: a National Registry
 86
Study. J Clin Endocrinol Metab, 2003,88(2):622-626
21 Lanfranco F, Kamischke A, Zitzmann M, et al. Klinefel-
ter’s syndrome. Lancet, 2004,364(9430):273-283
22 Nieschlag E, Behre HM, Wieacker P, et al. Störungen im
Bereich der Testes. In: Nieschlag E, Behre HM, Niesch
lag S (eds.): Andrologie: Grundlagen und Klinik der re-
produktiven Ge-sundheit des Mannes. 3rd edition. Hei-
delberg: Springer, 2009:199-244
23 Tüttelmann F, Gromoll J. Novel genetic aspects of Kline-
J Huazhong Univ Sci Technol [Med Sci] 34(1):2014
felter’s syndrome. Mol Hum Reprod, 2010,16(6),386-395
24 Maiburg M, Repping S, Giltay J. The genetic origin of
Klinefelter syndrome and its effect on spermatogenesis.
Fertil Steril, 2012,98(2):253-260
25 Damian D, Paulo S. Disorder of sexual development: Still
a big challenge. J Pediatr Endocrinol Metab, 2007,20(7):
749-750
(Received Sep. 10, 2013; revised Dec. 25, 2013)