Biology Coursebook Answers AS - A Level

CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK
Exam-style questions and sample answers have been written by the authors. In examinations, the way marks are awarded
may be different.
Coursebook answers
Chapter 1 • Modern scientific controversies include:
• the idea that increasing concentrations
Before you start of carbon dioxide in the atmosphere are
causing global warming
• Learners should be familiar with some of • the controversy about whether the
the structures seen in cells from work done at measles, mumps and rubella (MMR)
IGCSE. Figures 1.4 and 1.5 will refresh their vaccine can increase the risk of autism.
memory of cell structure. Scientists are now agreed that there is
• The functions of the main structures are no link between the MMR vaccine and
found in the sections ‘Features that animal autism.
and plant cells have in common’ and
‘Differences between animal and plant cells’. Self-assessment questions
• As well as Figures 1.4 and 1.5, they will
1 a Structures that animal and plant cells have
find relevant information in the section
in common:
‘Differences between animal and plant cells’.
• nucleus with nucleolus and chromatin
• Yes, there are organisms other than animals
and plants. They are classified in different • cytoplasm containing mitochondria,
kingdoms which learners will learn about Golgi apparatus and other small
later. Other types of organism include fungi, a structures
group of mainly unicellular organisms called • cell surface membrane.
protoctists, bacteria and viruses.
b Structures found only in plant cells:
Science in Context • chloroplasts
• Two obvious examples are: • large, permanent central vacuole
• Darwin and Wallace’s theory of • cell wall with middle lamella and
evolution by natural selection was highly plasmodesmata.
controversial because it appeared to be in c Structure found only in animal cells:
conflict with the religious belief that God
created all species of living things and that • centriole.
humans were a special creation. 2 • Use a sharp pencil.
• Galileo was placed under house arrest for • Do not use shading / do not draw the
the rest of his life after putting forward nucleus as a solid blob.
the idea that Earth and the other planets
• Do not cross label lines.
orbited the Sun rather than the Earth
being at the centre of the solar system. • Do not use arrowheads on label lines.
Again, this appeared to contradict the • Use a ruler to draw label lines.
religious beliefs of the time.
• Make outline of cells less sketchy – lines
Other examples include: should be continuous, not broken.
• Einstein’s theory of general relativity • Write labels horizontally, not at the same
(which challenged our ideas of the link angle as the label line.
between space and time)
• Interpret what you see. For example, outlines
• Wegener’s theory of continental drift
are not very accurate (too rounded).
(which was controversial because
scientists could not explain how
continents could move).
1 Cambridge International AS & A Level Biology – Jones, Fosbery, Taylor & Gregory © Cambridge University Press 2020
3 a actual diameter = 20 µm (see caption) • The nucleus is seen to be surrounded by a

diameter on diagram = 58 mm = double membrane (envelope) with pores
58 000 µm in it.
magnification, M = size of image, • Mitochondria have a surrounding double

I membrane (envelope), the inner layer
= forming finger-like folds pointing inwards.
actual size of specimen A
• Endoplasmic reticulum is extensive
58 000
= throughout the cell, some with ribosomes
20
(rough) and some without (smooth).
therefore magnification = ×2900
• Small structures seen under the light
b magnification = ×16 000 (see caption) microscope can be distinguished by the
length on micrograph = 65 mm = electron microscope as lysosomes and
65 000 µm vesicles.
size of specimen, A = size of image, • Free ribosomes are seen throughout
the cell.
I
= • The centriole is seen to be two separate
magnification M
65 000 centrioles.
=
16 000 • Finger-like extensions of the cell surface
therefore actual size of chloroplast = 4.1 µm membrane, known as microvilli, are seen.
4 The resolution of a microscope is limited by the • Microtubules are visible in the cytoplasm.
radiation used to view the specimen. Resolution
7 Detail in a plant cell seen with the electron
equals half the wavelength of the radiation used.
microscope but not apparent using a light
The shortest wavelength of light is 400 nm,
microscope:
therefore the resolution of a light microscope
is 200 nm. The diameter of a ribosome is much • In the nucleus, chromatin can be
smaller than this, namely 25 nm. distinguished.
5 • The nuclear membrane can be seen as a
double structure (envelope), continuous
Feature Light Electron with the rough endoplasmic reticulum,
microscope microscope and with pores in it.
source of light electrons • There is extensive rough and smooth
radiation endoplasmic reticulum throughout the cell.
wavelength 400–700 nm about 0.005 nm • Free ribosomes are visible in the cytoplasm.
of radiation
used • Microtubules are visible in the cytoplasm.
maximum 200 nm 0.5 nm in • The mitochondria have a double
resolution practice membrane (envelope), the inner layer
lenses glass electromagnets having folds into the matrix.
specimen living, non- non-living or • Chloroplasts have a double outer
living or dead dead membrane (envelope).
stains coloured dyes heavy metals • Grana can be seen in the chloroplast, as
stacks of sacs connected to other grana by
image coloured black and white longer sacs (thylakoids).
6 Detail in an animal cell seen with the electron 8a diameter of nucleus (I)
microscope but not apparent using a light = 75 mm = 75 000 µm
microscope: magnification (M) = ×11 000
therefore actual diameter
• In the nucleus, chromatin can be
75 000
distinguished. of nucleus (A) = = 6.8 µm
11 000
b The nucleus may not have been sectioned
at its widest part. If you try cutting
a model sausage, the cut surface of a Mitochondrion Site of ATP synthesis in

transverse section will look like a circle. aerobic respiration
The cut surface of a longitudinal section
will look like a sausage. Other sections Golgi apparatus Makes lysosomes
will be somewhere between circles and Cilium Has a ‘9 + 2’ arrangement of
sausages. microtubules
9 Cilia in the oviduct beat in order to move the Lysosome Mainly contains digestive
egg from the ovary to the uterus. (It may be enzymes
fertilised along the way.)
10 Cell surface membrane: essential because it There are some obvious variations on this activity.
forms a partially permeable barrier between Both the structures and the descriptions can be
the cell and its environment, regulating varied. It is useful for students to choose their
movement of materials into and out of own terms and descriptions because it reinforces
the cell. This is necessary to maintain an learning. The number of cards can be varied to
environment inside the cell which is different suit the number of students involved.
from that outside the cell.
Reflection
Cytoplasm: site of metabolic activity. It
contains biochemicals in solution. What is a cell?
Ribosomes: sites of protein synthesis, an A cell is the basic unit of life. All living organisms
essential activity of all cells. (DNA controls are made of cells. All cells have a cell surface
cells by controlling which proteins are membrane, cytoplasm and genetic material in the
made.) Protein synthesis is a complex process form of DNA. All cells have a protein synthesising
involving the interaction of many molecules; machinery which includes ribosomes.
the ribosome provides a site where this can
happen in an organised way. Why are all living things made of cells?
DNA: the genetic material. DNA contains the The biochemistry of life must be separated from
information which controls the activities of the surrounding environment. This separation is
the cell. It can replicate itself, enabling new achieved by the cell surface membrane. The cell
cells to be formed. surface membrane is partially permeable and
controls what enters and leaves the cell. Without it,
Cell wall (absent in animal cells): prevents the the chemicals of life would mix with the chemicals
cell from bursting as a result of osmosis if it is of the environment and a separate chemistry of
exposed to a solution of higher water potential. life would be impossible.
Flagellum: needed for locomotion by some cells.
Comparing the success of prokaryotic
Practical activity and eukaryotic cells
Here is the table with the terms and descriptions Criteria could be:
correctly matched. • complexity of cells
• complexity of the whole organism
Chloroplast Photosynthesis occurs in
this organelle • size
Nucleus Chromosomes are found in • total biomass on the planet
this structure in eukaryotic • range of habitats they can live in
cells
• ability to survive adverse conditions
Ribosomes These are found on rough
• ability to regulate their internal environments
endoplasmic reticulum
(RER) • number and variety of species.
Cell wall This structure contains
cellulose as a strengthening
material
Nucleolus Makes ribosomes
Is this a meaningless question? max. This indicates the maximum number of

This question probably is a meaningless question, marks that can be given.
although it doesn’t stop people discussing it. All 1 A ; [1]
living things have evolved to be adapted to their 2 C ; [1]
particular environments (ecological niches) and to
this extent are equally successful. Judgements can 3 B ; [1]
be made in various ways. Eukaryotes are far more 4 nucleus ;
complex than prokaryotes. Humans (probably (smooth) endoplasmic reticulum ;
the most intelligent eukaryotes) have the greatest rough endoplasmic reticulum ;
control over their environments. Bacteria have the 25 nm / larger / 80S ribosomes ;
greatest biomass and are the most versatile of cells. linear / non-circular DNA ;
They are probably the most likely cells to survive chromatin ;
a catastrophic change in the Earth’s climate/ lysosome(s) ;
environment. Golgi apparatus ;
mitochondrion / mitochondria ;
Exam-style questions microtubule(s) ;
centriole(s) ;
The mark schemes, suggested answers and
centrosome ;
comments that appear here were written by the
vacuole(s) ;
author(s). In examinations, the way marks would
microvillus / microvilli ;
be awarded to answers like these may be different.
cilium / cilia ;
nucleolus / nucleoli ;
Notes about mark schemes nuclear envelope ;
A or accept indicates an alternative acceptable nuclear pore(s) ;
answer. AVP ; [max. 10]
R = reject. This indicates a possible answer that [Total: 10]
should be rejected.
5 a magnification is the number of times
; The bold semicolon indicates the award of
larger an image is compared with the real
1 mark.
size of the object ; AW
/ This indicates an alternative answer for the same
resolution is the ability to distinguish
mark. The alternatives may be separated from the
between two separate points / the greater
rest of the answer by commas.
the resolution, the greater the detail that
( ) Text in brackets is not required for the mark. can be seen ; AW
Underlining This is used to indicate essential a statement linking the terms, such
word(s) that must be used to get the mark. as both terms used with reference to
AW means ‘alternative wording’. It is used to microscopy ; [3]
indicate that a different wording is acceptable b light microscope uses light as a source
provided the essential meaning is the same, and it of radiation ;
is used where students’ responses are likely to vary
electron microscope uses electrons
more than usual.
as a source of radiation ; [2]
AVP means ‘additional valid point’. This means
c both organelles / both found in
accept any additional points given by the student
eukaryotic cells ;
that are not in the mark scheme, provided they
are relevant. But accept only as many additional nucleolus is located inside nucleus ;
points as indicated by the bold semicolons, e.g. nucleus controls cell activity ;
AVP ; ; means award a maximum of 2 extra
nucleolus makes ribosomes ;
marks.
AVP ; ; e.g. nucleus surrounded by

ORA means ‘or reverse argument’ and is used
envelope, no membrane round
when the same idea could be expressed in the
nucleolus [max. 4]
reverse way. For example: ‘activity increases
between pH2 and pH5 ORA’ means accept
‘activity decreases between pH5 and pH2’.
d chromatin and chromosomes both surface membrane controls exchange

contain DNA (and protein / histones / between cell and environment ;
RNA) / both found in nucleus ; cell wall freely permeable, cell surface
chromatin is the loosely coiled form of membrane partially permeable ;
chromosomes ; AVP ; [max. 4]
chromatin is the form that exists between i both have a protective function ;
cell / nuclear divisions ;
capsid found in viruses, cell walls found
chromosomes are formed just before / in eukaryotes / plants, fungi and bacteria
during, cell / nuclear division ; [max. 3] (and some protoctists) ;
e an envelope consists of two membranes capsid made of protein, cell walls contain
(one just inside / outside the other) ; strengthening material / not made of protein
a membrane is a thin (partially permeable) / made of or contain polysaccharides /
barrier found around cells and some contain cellulose, chitin or murein ;
organelles ; AVP ; [max. 4]
example of at least one organelle j both found in viruses ;
surrounded by an envelope is given ;
capsid is the protein coat surrounding
membranes found in / around all cells, the virus ;
envelopes only in eukaryotes ; [max. 3]
the protein coat is made of (many)
f both consist of flattened membrane- protein subunits called capsomeres ; [3]
bound sacs ;
[Total: 34]
both found spreading through cytoplasm
of eukaryotic cells ; 6 a nucleolus ;
smooth ER lacks ribosomes, rough ribosome ;

ER has ribosomes on surface ; centriole ;
one function of smooth ER given, centrosome ;
e.g. makes lipids / steroids ; microtubule ; [max. 3]
rough ER transports proteins made b lysosome ; ;
by ribosomes on its surface ; [max. 4]
rough ER ;
g prokaryotes have no nucleus, eukaryotes
have nucleus ; smooth ER ;
prokaryotes are smaller / simpler ; Golgi apparatus / Golgi body ;
prokaryotes have few organelles, cilium ;
eukaryotes have many organelles, some flagellum ; [max. 3]
membrane-bound ;
c nucleus ;
one other important difference given /
mitochondrion ;
eukaryotes evolved from prokaryotes ; [4]
chloroplast ; [3]
h all cells have cell surface membrane, only
some cells have cell walls / animal cells [Total: 9]
lack cell walls ; 7 a Golgi apparatus ;
cell surface membrane very thin, cell wall b nucleolus ;
relatively thick ;
c ribosome ;
cell wall outside cell surface membrane ;
d ER / rough ER ;
cell wall strong / has strengthening
e rough ER ;
material, cell surface membrane not
strong / is fragile ; f mitochondrion ;
cell wall protects cell (from mechanical g nucleus ;
damage/from bursting by osmosis), cell h chloroplast ;
i centrosome (accept centriole) ;

j nucleus ;
k membrane ;
l ribosome / microtubule ;
m cilium / flagellum ; [Total: 13]
8
Label Name of structure Function

A cell wall ; maintains the shape of the (plant) cell ;
prevents the cell bursting ; [3]
B nucleus ; contains the chromosomes / genetic material/DNA ;
the genetic code controls the activities of the cell ; [3]
C nuclear envelope ; compartmentalises / separates the DNA / genetic material
from the rest of the cell ; [2]
D nucleolus ; contains DNA that controls the manufacture of ribosomes ; [2]
E cell surface controls which substances can enter and leave the cell ;
membrane ; selectively permeable ; [3]
F mitochondrion ; site of aerobic respiration ;
organelle where (most) ATP is made ; [3]
G chloroplast ; contains chlorophyll and is the site of photosynthesis ;
in the chloroplast grana / thylakoids, light-dependent
reactions take place, producing reduced NADP and ATP ;
in the chloroplast stroma, light-independent reactions take
place, producing carbohydrates ; [max. 3]
H sap vacuole ; storage of solutes in a plant cell ; [2]
I tonoplast ; membrane around plant sap vacuole controlling which
substances can enter and leave the vacuole ; [2]
J starch grain ; storage of carbohydrate ; [2]
[Total: 25]
9 a
1 mark for each accurately measured clean, continuous lines / not sketchy ;
‘observed diameter’ (to within ±2 mm) interpretation of structures accurate ;
and 1 mark for each accurately calculated
‘actual size’ ; ; ; ; ; ; representative parts of main organelles
drawn, including those below for which
1 mark for applying the formula ; label marks are awarded ; [5]
1 mark for measuring in mm and converting labels:
mm to μm for each calculation ;
nucleus ;
1 mark for rounding up actual size to no
more than one decimal place ; [9] nuclear envelope ;
b quality of drawing: nuclear pore ;
sharp pencil used ; nucleolus ;
more than half of available space used ; rough ER ;
ribosome(s) ;
mitochondrion ; 10 a i 100 000 g

crista or cristae ; ii 1000 g
Golgi apparatus ; iii 10 000 g ; [1]
Golgi vesicle / secretory vesicle ; [max. 9] b lysosomes are, similar in size to / slightly
c mitochondria will appear circular if smaller than, mitochondria ;
they are cut, in transverse section / therefore sediment at same / similar, g
across (the long axis) ; AW [1] force / speed ;
d i A: protein made on the ribosome is therefore contaminate mitochondrial
moving into the rough ER ; sample ; AW
B: rough ER buds off small vesicles ; therefore cannot be sure whether effects
vesicles fuse to form the Golgi due to mitochondria or lysosomes in any
apparatus ; (therefore) protein moves experiments ; [4]
into Golgi apparatus ; protein may [Total: 5]
be modified / processed inside Golgi
apparatus ;
C: Golgi apparatus buds off Golgi
vesicles ;
D: Golgi vesicles travel to cell surface
membrane ; Golgi vesicle(s) fuses with
cell surface membrane ; protein /
enzyme leaves cell ; exocytosis /
secretion ; [max. 8]
ii ribosome / messenger RNA ; [1]
iii nuclear pore ; [1]
iv ATP ; [1]
[Total: 35]
may be different.
Coursebook answers
Chapter 2 4 • macromolecules / polymers
• polysaccharides
Science in Context • made from α-glucose
Students may have a limited knowledge of key • glucose units held together by 1,4 links
scientific problems associated with AI, but they might (glycosidic bonds formed by condensation)
talk about its applications for predicting earthquakes,
• branches formed by 1,6 links
space exploration, designing robots, designing useful
proteins, more efficient waste disposal, or tackling 5 Some possible answers are shown in the table
climate change, among other issues. below. When comparing two things, make the
two features in each row genuine comparisons.
Self-assessment questions For example, in the first row in the table, the
type of glucose used is the property compared.
1 a C3H6O3 or (CH2O)3
b C5H10O5 or (CH2O)5 Amylose Cellulose
made from made from β-glucose
2 a You would need excess of the reagent to
α-glucose
make sure that all of the sugar reacts with
the Benedict’s reagent. all glucose units successive glucose units
have the same are at 180° to each
b Prepare a range of samples of reducing
orientation other
sugar (e.g. glucose) of known concentration.
Carry out a Benedict’s test on each molecule is not fibrous molecule –
solution. This will give you a range of fibrous – chains chains held together by
different colours, each colour representing a not attracted to hydrogen bonds to form
different known concentration of reducing each other microfibrils and fibres
sugar. These samples are known as colour 6 Similarities:
standards. The test must be carried out in
exactly the same way for each sample • macromolecules
(e.g. same volumes). • fibrous structure
• structural role
If you have a colorimeter, take a reading
• fibres held together by hydrogen bonds
for each concentration and plot the
reading against concentration on a graph. • insoluble
This is called a calibration curve. If you do Differences:
not have a colorimeter, line the tubes up in
Cellulose Collagen
a rack. Then carry out the test in exactly
the same way on your unknown sample. carbohydrate / protein
If you are using a colorimeter, obtain a polysaccharide
reading for it and use the graph to read off made from beta made from amino acid
the concentration. If not, hold your tube glucose subunits subunits / monomers
against the row of colour standards and /monomers
judge by eye which is the closest match. found in plants found in animals
3 hydrolysis molecules are individual molecules
straight chains have a helical structure
7 Property Importance
Description Word/term The Water is Water is needed
transport of a good for transport by
term for water-hating hydrophobic
glucose and solvent. diffusion or active
broken by a reduction disulfide ions in a transport into, out
reaction bond mammal of and within cells.
formed by a condensation disaccharide It is also needed
reaction for circulation
characteristic of globular hydrophilic in blood so that
proteins nutrients can reach
the sites where
has two alpha chains and two haemoglobin they are needed.
beta chains Chemical reactions
can be broken by pH changes ionic bond take place in
aqueous solution.
8 • primary structure (the sequence of amino
acids) Much Water has A more constant
smaller a high environment
• the chemical nature of the R groups (e.g. temperature specific heat results, protecting
if they are hydrophilic or hydrophobic) fluctuations capacity. organisms from
• how secondary structures such as the alpha in lakes and extremes of
helix and beta-pleated sheet are formed oceans than temperature which
in terrestrial could be harmful.
• the types of bonds and interactions that
(land-based)
can hold amino acids together (disulfide,
habitats
ionic, hydrogen, hydrophobic)
• the primary, secondary, tertiary and Reflection
quaternary structures of proteins whose
three-dimensional structures are known Biological significance of simple
• where previous attempts at prediction molecules
have failed Simple molecules can be joined together to make
• conditions in which the protein is found larger molecules. Monomers form polymers.
(e.g. pH and temperature of its cell Polymers include proteins, polysaccharides,
environment) polynucleotides (DNA and RNA). Polymers have
important structural and metabolic roles. From
This is an ‘open-ended question’ – you may be a few types of simple molecule a great variety of
able to think of other useful information! larger molecules can be made. For example, from
9 20 amino acids an infinite variety of proteins can
be made. Biochemical evolution progressed from
Property Importance simple inorganic molecules to simple organic
The cooling Water Heat energy is molecules to more and more complex molecules
of skin requires a transferred to that became the basis of life.
during relatively water molecules in
sweating large sweat allowing the Why is water essential for life?
amount of water to evaporate
The main reason is that water is a solvent and the
heat energy from the skin. Skin
chemistry of life takes place in aqueous solution.
to evaporate therefore cools
Molecules are free to move about and interact in
– that is, down, helping to
water. There are other reasons – see high specific
water has a prevent the body
heat capacity and high latent heat of vaporisation
high latent from overheating.
in the text of the Coursebook. Also water is an
heat of A relatively large
important reagent, as in hydrolysis reactions and
vaporisation. amount of heat can
photosynthesis (where it is a source of hydrogen
be lost with minimal
to use as a fuel in cells and a source of oxygen
loss of water from
in the atmosphere, therefore allowing aerobic
the body.
respiration). You could also mention water as
a transport medium (blood, lymph, xylem sap, / This indicates an alternative answer for the same
phloem sap); density (ice is less dense than water) mark. The alternatives may be separated from the
and freezing properties. rest of the answer by commas.
( ) Text in brackets is not required for the mark.
Why is carbon essential for life? Underlining This is used to indicate essential
Carbon forms four stable and strong covalent word(s) that must be used to get the mark.
bonds and can bond to other carbon atoms, thus AW means ‘alternative wording’. It is used to
forming straight chain and ring structures which indicate that a different wording is acceptable
act as a skeleton on which chemically active atoms provided the essential meaning is the same, and is
and groups can be attached. Life on Earth is used where students’ responses are likely to vary
described as carbon-based. All organic molecules more than usual.
contain carbon (the definition of an organic
molecule is a molecule containing carbon).
Exam-style questions are relevant. But accept only as many additional
The mark schemes, suggested answers and points as indicated by the bold semicolons, e.g.
comments that appear here were written by the AVP ; ; means award a maximum of 2 extra marks.
author(s). In examinations, the way marks would ORA means ‘or reverse argument’ and is used
be awarded to answers like these may be different. when the same idea could be expressed in the
Notes about mark schemes between pH2 and pH5 ORA’ means accept
A or accept indicates an alternative acceptable ‘activity decreases between pH5 and pH2’.
answer. max. This indicates the maximum number of
R = reject. This indicates a possible answer that marks that can be given.
should be rejected.
1 D ; [1]
; The bold semicolon indicates the award of 1 mark.
2 C; [1]
3 B ; [1]
4
(e.g. haemoglobin)
Globlular protein
Monosaccharide
Fibrous protein
(e.g. collagen)
Disaccharide
Glycogen
Cellulose
Starch
Lipid
monomer ✘ ✘ ✔ ✘ ✘ ✘ ✘ ✘
polymer ✔ ✔ ✘ ✘ ✔ ✔ ✔ ✘
macromolecule ✔ ✔ ✘ ✘ ✔ ✔ ✔ ✘
polysaccharide ✘ ✘ ✘ ✘ ✔ ✔ ✔ ✘
contains subunits that form branched ✘ ✘ ✘ ✘ ✔ ✔ ✘ ✘
chains
contains amino acids ✔ ✔ ✘ ✘ ✘ ✘ ✘ ✘
made from organic acids and glycerol ✘ ✘ ✘ ✘ ✘ ✘ ✘ ✔
contains glycosidic bonds ✘ ✘ ✘ ✔ ✔ ✔ ✔ ✘
contains peptide bonds ✔ ✔ ✘ ✘ ✘ ✘ ✘ ✘
one of its main functions is to act as an ✘ ✘ ✘ accept ✔ ✔ ✘ ✔
energy store
✔ or ✘
(e.g. haemoglobin)
Globlular protein
Monosaccharide
Fibrous protein
(e.g. collagen)
Disaccharide
Glycogen
Cellulose
Starch
Lipid
usually insoluble in water ✘ ✔ ✘ ✘ ✔ ✔ ✔ ✔
usually has a structural function ✘ ✔ ✘ ✘ ✘ ✘ ✔ ✘
can form helical or partly helical structures ✔ ✔ ✘ ✘ ✘ ✔ (see ✘ ✘
amylose)
contains only carbon, hydrogen and ✘ ✘ ✔ ✔ ✔ ✔ ✔ ✔
oxygen
Award 1 mark for each correct column. [8]

5 d
OH on C atom 1 above
Function Example ring (β-galactose)
6CH OH
structural collagen ; keratin ; AVP 2
e.g. elastin, viral coat 5 O

protein ; [max. 2] OH
H
OH
enzyme AVP e.g. amylase ; 4 1

DH H
hormone ; insulin H H
3 2
respiratory haemoglobin and H OH
pigment / AW ; myoglobin
galactose
defence antibodies / fibrinogen / (drawn according to convention)
AVP ;
contraction / actin and myosin H OH
AW ; 3
H 2 H
storage casein / ovalbumin / AVP ; OH H
4 1
[8] H
OH OH
6 dissolve easily in water ; 5
O
sweet ; 6CH OH
2
general formula (CH2O)n / contain the galactose

elements carbon, hydrogen and oxygen / (molecule rotated 180° in order
to line up with α-glucose)
hydrogen and oxygen are present in ratio
of 2 : 1 ; [3]
6CH OH
7 a lactose could be a source of energy ; 2
5 O
it could be digested to, monosaccharides H H
/ glucose and galactose, which could H
4 1
then be used as building blocks for larger OH H
molecules ; [2] OH 2 OH
3
b condensation ; [1] H OH
c glycosidic bond ; [1] OH on C atom 1
α-glucose
below ring
glucose correctly drawn ;

galactose correctly drawn ; [2]

Carbon atoms need not be numbered. iii water ; [1]
Note that galactose will probably be drawn iv ring drawn around –OH or whole
‘upside down’ as in the disaccharide – the R group (–CH2OH) of serine ; [1]
conventional way of drawing it is also
shown in the diagram answer. The form v r ings drawn around two peptide
used to make the disaccharide is the beta bonds and bonds labelled
form of galactose, but students will not appropriately ; [1]
need to know this, other than for interest. vi ring drawn around –NH group one
e alpha glucose / α-glucose ; side of a peptide bond and group
labelled A ; [1]
the –OH group on carbon atom 1 is
below the ring ; [2] b held in place by hydrogen bonding ;
secondary structures ;
f carry out a Benedict’s test on both
solutions ; all the –NH and –C=O groups of, peptide
bonds / polypeptide backbone, are
lactose would give a brick-red / brown involved ; [3]
precipitate, sucrose would not ;
c molecule made from repeating subunits ;
a ccept positive result for lactose,
negative result for sucrose [2] subunits similar or identical to each other ;
[Total: 10] giant molecule / macromolecule ;[max. 2]
8 a i d i XXX, XXY, XYY,
OH XYX, YYY,
YYX, YXX, YXY ; [1]
CH3 H CH2
H O H O ii 2 ;H
3
O [1]
N C C N C C N C C [Total: 15]
H OH H OH H OH
H H 9 a A identified as lipid,
H
alanine glycine B identified as phospholipid

serine ; [1]
OH
b i junction between head and tail for all
CH3 H CH2 three tails is indicated on diagram ; ;
O H O H O allow 1 mark if only one or two
C C N C C N C C junctions indicated [2]
OH H OH H OH
H H H ii fatty acids ;
nine glycine serine glycerol ; [2]
c head of phospholipid is labelled
OH phosphate ; [1]
d i phospholipid / B ; [1]
H CH2
O H O ii phosphate is, charged / polar /
C C N C C hydrophilic ; [1]
OH H OH
H H e lipid:
lycine serine energy store / insulator / buoyancy /
source of metabolic water / any other
C
of COOH joined to N of NH2 for suitable example ;
both peptide bonds ; phospholipid:
p
eptide bonds shown as C=O
any reference to the importance of
joined to –NH (i.e. water has been
phospholipids in structure of
eliminated) ;
membranes ; [2]
a ll three amino acids joined and in
[Total: 10]
correct sequence ; accept even if errors
in bonding [3]
ii primary structure ; [1]
10 a
Collagen Haemoglobin
1 Globular fibrous globular
or fibrous?
2 Entirely entirely partly
or partly
helical?
3 Type of triple helix / alpha
helix extended
helix / three-
stranded
4 Prosthetic no yes
group
present?
5 Soluble in no / insoluble yes / soluble
water?
Award 1 mark for each correct row. No half marks
[5]
b
1 mark for structural feature, 1 mark for
linking this feature to its function,
e.g. haemoglobin contains iron ; iron
combines with oxygen ; [2]
c molecule has more than one polypeptide
chain ; [1]
R molecule has four polypeptide chains
d carbon, hydrogen, oxygen, nitrogen, iron ; ;
2 marks for all five correct, 1 mark for
four correct, 0 marks for three or fewer
correct [2]
[Total: 10]
may be different.
Coursebook answers
Chapter 3 The catalase enzyme has evolved to
be the correct shape to catalyse the
decomposition of hydrogen peroxide
Before you start efficiently.
•• Two important properties of catalysts: • Pure catalase was more efficient than
•• Catalysts speed up chemical reactions. the liver and potato: The concentration
•• Catalysts remain unchanged at the end of of the pure enzyme is higher than the
the reaction. concentration in liver and potato. The
•• Properties of proteins that might make them higher the concentration of an enzyme,
suitable to act as catalysts in living cells: the faster it works.
•• Proteins can have an infinite variety of • Liver was more efficient than potato: Liver
shapes. is an animal tissue. Animal tissues have a
higher metabolic rate than plant tissues.
•• Proteins have precise three-dimensional
Hydrogen peroxide therefore probably
shapes.
builds up faster in liver cells than potato
•• Proteins can be made by living cells. cells and must therefore be got rid of
•• Proteins can be assembled from simple faster. Liver cells therefore probably have
subunits. a higher concentration of catalase than
•• Proteins can be coded for by the genetic potato cells.
material DNA. • Ground-up liver was more efficient than
•• Prosthetic groups can be added – this can pieces of liver: Grinding up the liver
increase the effectiveness, or facilitate breaks open the cells and releases the
the functioning of enzymes, for example, contents, including catalase. The catalase
catalase contains four iron-containing therefore has easier access to the substrate
haem groups. (hydrogen peroxide).
2 In case of inaccuracy of measurement at
Science in Context 30 seconds. The overall shape of the curve is
Research into the defence mechanism of the more likely to give an accurate value.
bombardier beetle could be regarded as pure 3 a
research if there is no obvious commercial or
practical reason for studying it. Pure research is
Amount of starch in mixture
regarded as valuable and essential because no one

can predict whether new knowledge is going to be
useful. There are many examples of pure research
leading to useful practical applications. For
example, without knowledge of Einstein’s theories
of Special and General Relativity, we would not
be able to have precise satellite navigation systems
(Satnav, GPS and other systems).
Time
Self-assessment questions
1 Explanation of results:
b Calculate the slope of the curve right at
• Catalase, liver and potato were much more
the beginning of the reaction.
efficient than the inorganic catalysts:
4 Measure the volume of oxygen given off over remain in the control tubes. Plot rate of
regular time intervals for several hydrogen reaction (1/time taken) against pH.
peroxide–catalase reactions at different 7
temperatures. In each case, all conditions
other than temperature must remain constant.
If substrate
In particular, the volume and concentration of becomes
hydrogen peroxide solution, and the volume limiting, the
Initial rate of reaction

and concentration of catalase solution must addition of
be kept constant each time. Plot volume extra enzyme
of oxygen against time for each reaction. cannot increase
Calculate the slope of the line at the beginning the rate of
of the reaction in each case to give the initial reaction.
reaction rate. Then plot initial reaction rate
against temperature.
Alternatively, the volume of oxygen given
off in a given time period, for example Enzyme concentration
1 or 2 minutes, could be found for each
temperature. The volume is proportional to 8 As soon as the reaction starts, the substrate
the rate, so a graph of volume (rate) against starts to be used up, so the substrate
temperature could be plotted. Another concentration starts to fall. This results in a
alternative would be to time how long it takes corresponding fall in the rate of reaction. It is
to collect a given volume of oxygen for each the initial rate at the start of the experiment
temperature. In this case, the inverse of the that is the true rate.
time taken would be a measure of rate. 9 a carbonic anhydrase
5 a Haemoglobin is the coloured pigment b lysozyme, because it has the lowest Km
that causes bloodstains. Haemoglobin
is a protein. Protein-digesting enzymes 10 a
(proteases) catalyse the hydrolysis of
haemoglobin to amino acids, which are
colourless. They are also soluble, so will enzyme B
wash away in water.
Rate of reaction
b Many protein-digesting enzymes have an enzyme A

optimum temperature of around 40 °C,
which is a relatively low temperature for
a washing machine. Washing at lower
temperatures also helps to save money.
c Other components of washing powders,
such as the oil-removing detergents, work Substrate concentration
best at high temperatures.
b i enzyme B
6 One possible answer is as follows; other answers
ii enzyme B
might be equally acceptable.
iii enzyme B
Set up two sets of five tubes containing equal
volumes of the same concentration of milk iv enzyme B
suspension. Make up five buffer solutions 11 a Prepare a solution of lactase and a
of varying pH. Add equal volumes of buffer separate sample of lactase immobilised
solution, one of each pH, to each set of five in alginate beads. Suspend the beads in
tubes containing milk suspension. To one water. Heat separate samples of lactase
set of tubes, add equal volumes of trypsin in solution and immobilised lactase
solution. To the other set of tubes, add the beads suspended in water at a range of
same volume of water; these act as controls. temperatures (e.g. 40 °C to 100 °C) for
Time the disappearance of cloudiness in each 10 minutes each. Allow to cool to room
tube containing trypsin. Cloudiness should temperature.
If the enzyme is still active, it will catalyse • ability to stick to a substrate for
the hydrolysis of lactose to glucose and immobilisation
galactose: 1 mole of lactose will produce 1 • longevity when immobilised / resistance to
mole of glucose and 1 mole of galactose. denaturation; disulfide bonds may increase
All are reducing sugars, stability
but the concentration of reducing sugar
will double as a result of the reaction. • ability to add useful prosthetic groups.
A semi-quantitative Benedict’s test on a There are many possible new uses for enzymes.
sample before and after the reaction Being able to break down plastics using enzymes is
can therefore be used to find out if the an obvious use. Scientists would like to be able to
enzyme is active. This can be done by carry out nitrogen fixation using enzymes.
mixing the enzyme with lactose (or milk)
at a suitable temperature (e.g. 37 °C), and Exam-style questions
leaving it for a few minutes. In the case of
the lactase beads, you would first have to The mark schemes, suggested answers and
tip the beads into a sieve to remove the comments that appear here were written by the
surrounding water before adding them to author(s). In examinations, the way marks would
a solution of lactose. be awarded to answers like these may be different.
b Suspend the lactase beads in water. Leave Notes about mark schemes
samples of the enzyme solution and the
A or accept indicates an alternative acceptable
immobilised lactase beads for different
answer.
lengths of time at 90 °C. Then test for
enzyme activity as in a above. R = reject. This indicates a possible answer that
should be rejected.
c Prepare a series of lactase solutions of
different pH using appropriate buffer ; The bold semicolon indicates the award of
solutions. For each pH, use some of 1 mark.
the solution to make alginate beads / This indicates an alternative answer for the same
containing immobilised enzyme. Then mark. The alternatives may be separated from the
carry out the reaction using milk or rest of the answer by commas.
lactose as a substrate and test for enzyme
activity as in a above. ( ) Text in brackets is not required for the mark.
12 Immobilised enzymes do not contaminate the Underlining This is used to indicate essential
product. They are not lost, so they can be re- word(s) that must be used to get the mark.
used. They are able to work at a wider range AW means ‘alternative wording’. It is used to
of pHs than enzymes in free solution, and also indicate that a different wording is acceptable
at a wider range of temperatures. They are provided the essential meaning is the same, and is
more resistant to denaturation. used where students’ responses are likely to vary
more than usual.
Reflection AVP means ‘additional valid point’. This means
A range of answers is possible, which may include accept any additional points given by the student
the following: that are not in the mark scheme, provided they
are relevant. But accept only as many additional
• amino acid sequence / primary structure points as indicated by the bold semicolons, e.g.
• tertiary structure (to match any potential AVP ; ; means award a maximum of 2 extra marks.
substrate) ORA means ‘or reverse argument’ and is used
• temperature optimum when the same idea could be expressed in the
• range of temperatures over which effective reverse way. For example: ‘activity increases
• pH optimum and range ‘activity decreases between pH5 and pH2’.
• affinity for substrate max. This indicates the maximum number of
• Vmax marks that can be given.
1 C ; [1] 9 a succinic acid ; [1]

2 D ; [1] b malonic acid acts as a competitive
3 D ; [1] inhibitor ;
4 B ; [1] it has a similar shape / structure to
succinic acid ;
5 C ; [1]
it therefore competes with succinic acid
6 straight line drawn from origin at zero to for a place in the active site of the
show steepest gradient of curve ; [1] enzyme ; [3]
7 a maximum activity / optimum pH, is pH 5.5 ; c i cysteine ; [1]
activity gradually increases between pH 2 ii – SH groups form disulfide bridges ;
and pH 5.5, and decreases from pH 5.5 to
pH 10 ; activity very low at pH 2 and pH used to determine tertiary structure ;
10 ; AW [max. 2] heavy metal would prevent formation
b pH is a measure of the hydrogen ion of disulfide bridges ;
concentration ; could change shape of active site ;
hydrogen ions are positively charged ; heavy metal could affect shape either by
hydrogen ions can interact with the R binding directly in the active site, or by
groups of amino acids ; binding at another site which then results
in change in shape of the active site ;
affects ionic bonding / affects ionisation
of R groups ; substrate would not be able to fit into
active site ; [max. 4]
affects tertiary structure / affects 3D shape
of enzyme ; [Total: 9]
therefore substrate may not fit active 10 a carry out Benedict’s test on solutions A, B
site (as precisely) ; [max. 4] and C ;
[Total: 6] a positive result / brick-red precipitate will
be seen, with the glucose solution ;
8 a optimum temperature ; [1]
heat separate samples of the two
b 37 °C ; accept 40 °C [1] remaining solutions, in boiling water
c as temperature increases the kinetic bath / to high temperature (e.g. 80 °C),
energy of the molecules increases ; for suitable time / at least two minutes
the rate of collision between substrate (enzyme will be denatured) ; for each
and, enzyme / active site, increases ; heated solution, mix it with an unheated
sample of the other solution ;
rate of reaction increases ; [3]
leave several minutes / suitable time (for
d the enzyme is gradually being denatured ; reaction to take place) ;
when the rate is zero the enzyme is carry out Benedict’s test on the two tubes ;
completely denatured ; only one will give a positive result (due to
ORA enzyme loses tertiary structure ; presence of maltose) and this will be the
substrate no longer fits into active site one which contained the unheated enzyme ;
/ active site loses its (specific) shape so Accept alternative wording for all steps in

substrate does not fit ; the procedure, provided the same logical
AVP e.g. hydrogen bonds broken / sequence is described [max. 6]
increased vibration of enzyme molecule ; b hydrolysis ; [1]
[max. 3]
[Total: 7]
e the extra energy which must be given to
the substrate ; 11 a replication increases reliability ; AW [1]
before it can be converted into the product ; b to act as a reference to show what
[2] happens if there is no denaturation ;
AW [1]
[Total: 10]
c 40 °C is (close to) the optimum h

temperature for a mammalian enzyme ; [1]
24
d enzyme / amylase (molecules) diffuse(s)
from wells into the agar ; 20
enzyme / amylase digests the starch ;
to maltose ; 16
Diameter / mm
forms rings / halos, of digested starch
12
around the wells ;
amount of digestion / rate of digestion, 8
is related to degree of denaturation of
enzyme / amylase ; [max. 4] 4
e the more enzyme / amylase added, the
greater the amount of digestion of starch 0
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30
or Time at 60˚C / minutes
want results to be due to differences in
x-axis (horizontal axis) is labelled ‘Time
preheating times, not to differences in
(heated) at 60 °C’, y-axis (vertical axis) is
amount of amylase / enzyme ; AW [1]
labelled ‘Diameter’ (if the rule IV for the
f Time (heated) at Diameter of x-axis, DV for the y-axis is taught) ;
60 °C / min halo / mm units given on axes, min / minutes and
0 24 mm; regular intervals on both axes (check
that 0, 1, 5, 10, 30 are not regularly spaced
1 19
on x-axis) ;
5 10
points plotted accurately ;
10 6
points joined with straight lines or
30 0 smooth curve ; [5]

table drawn with lines for border and to i enzyme was completely denatured after
separate columns and headings (ideally 30 minutes ;
ruled lines and lines between rows, but not rate of denaturation was rapid at first and
essential for mark) ; then gradually slowed down ;
correct headings to columns with units ; data quoted ;
if this is the rule taught, first column is enzyme loses tertiary structure ;
independent variable (Time heated at
60 °C) ; substrate no longer fits into active site /
active site loses its (specific) shape so
correct measurements of halos ; [4] substrate does not fit ;
g measure the four halos and calculate VP e.g. hydrogen bonds broken /
A
the mean ; [1] increased vibration of enzyme molecule ;
(any anomalous results should be ignored) [max. 4]
j heat samples of mammalian, fungal and
bacterial amylases at different temperatures ;
suitable range, e.g. between 40 °C and
120 °C ;
40 °C is a control (for reference to find out
size of halo with no denaturation) ;
at least five temperatures, e.g. 40, 60, 80,
100, 120 °C ;
heat for suitable length of time (e.g. one
hour, at least ten minutes) ;
cool to room temp / 40 °C, add equal d inhibitor A is competitive, B is non-

volumes to wells in starch–agar plates, competitive ;
replicate wells in each plate (e.g. four), A is competitive because:
leave 24 hours, test for starch, measure
diameters of halos ; [max. 5] it increased Km / did not affect Vmax ;
decreased the affinity of the enzyme for its
ackground information: amylase enzymes
B substrate ;
from the bacterium Bacillus licheniformis
and the fungus Aspergillus have been the substrate is competing with the
developed by biotechnology companies for inhibitor for the active site ;
use in industrial processes. For example, the inhibition is overcome by increasing
a bacterial amylase that functions in the substrate concentration ; [max. 4]
range 90–110 °C has been developed and is or
used in beer brewing and other processes,
and a fungal amylase that operates in the Alternative ways of explaining the same
range 50–60 °C is used for pastry baking marking points:
and maltose syrup production. B is non-competitive because:
k pH ; it did not affect Km/decreased Vmax ;
substrate concentration ; it did not affect the affinity of the enzyme
enzyme concentration ; [3] for its substrate ;
[Total: 30] the substrate is not competing with the
inhibitor for the active site ;
12 a
see Figure 3.13. Award 1 mark for each
correct label ; ; ; [3] the inhibition cannot be overcome by
increasing substrate concentration ;
b inhibitor A had no effect on Vmax ; and
increased Km ; [2] [Total: 11]
c inhibitor B decreased Vmax ; and had
no effect on Km ; [2]
may be different.
Coursebook answers
• Experimenting on non-human animals but
Chapter 4 not humans is an example of speciesism,
which is just as bad as sexism, ageism, etc.
• Drugs may be safe to use on non-human
Before you start animals but not safe to use on humans.
• The biochemistry of life must be separated from Most drugs fail safety tests when brought
the surrounding environment. This separation is to trial on humans.
achieved by the cell surface membrane. The cell • There are alternatives such as cell or
surface membrane is partially permeable and tissue culture, non-invasive imaging and
controls what enters and leaves the cell. Without computer modelling.
it, the chemicals of life would mix with the • Possible suggestions on animal rights include:
chemicals of the environment and a separate
chemistry of life would be impossible. • Testing should minimise pain and
suffering.
• The membrane allows certain ions and
molecules to cross it (is permeable to certain • Tests should be reduced to a minimum.
ions and molecules) but not others. • Testing of non-vital products should be
• Phospholipids form a bilayer in an aqueous banned.
environment. They have hydrophilic heads • Non-human primates should not be
which face outwards into the aqueous used at all in testing because they are too
environment inside and outside the cell. They similar to humans.
have hydrophobic tails which face inwards. • Animals should be kept in conditions
The bilayer is a stable structure. It is the basic which do not cause additional suffering.
structure of all cell membranes. • If animals continue to suffer after testing,
• Microvilli – folding increases the surface area they should be euthanized.
for absorption of digested food in the gut;
cristae – folding increases the surface area for Self-assessment questions
some of the reactions of aerobic respiration in
mitochondria. 1 Refer to Section 4.3, Roles of the molecules
found in membranes.
• a one membrane: ER, Golgi apparatus,
lysosome, vacuole, vesicle, (cilium). 2 The interior of the membrane is made up of
the tails of phospholipid molecules which
• b two membranes: mitochondrion,
provide a hydrophobic environment. If a
chloroplast, nucleus.
hydrophobic molecule reaches the cell surface
membrane, it can easily cross the membrane.
Science in Context
3 Large number of possible reasons: for
• Arguments for: example, to gain nutrients, to remove waste
• It avoids using humans. Using humans products such as carbon dioxide from
would be morally wrong. respiration, to gain oxygen for respiration,
• Without experiments on living organisms, to secrete hormones, to secrete enzymes, to
progress would be slower. maintain constant pH and ionic concentration.
Arguments against: 4 Cube A: SA 6, vol 1; SA : vol ratio 6 : 1
• Some animals can feel pain and Cube B: SA 24, vol 8; SA : vol ratio 3 : 1
experience emotions such as fear, just like Cube C: SA 54, vol 27; SA : vol ratio 2 : 1
humans.
5 Larger organisms cannot rely on diffusion as a cell walls. This increases the water
means of transport for essential requirements potential of the cells. This will continue
such as oxygen and nutrients. This means until equilibrium is reached when the
that special long-distance transport systems contents of the cells reach the same
must be present, such as the blood system in water potential as the water. The cells
animals and the vascular system in plants. will then be turgid.
This is discussed further at the beginning of ii 1 mol dm–3 sucrose solution has a lower
Chapter 7. water potential than that of cells A and
6 a The water potentials are equal. B. There is therefore a net movement of
b i B water out of cells A and B by osmosis
through their partially permeable cell
ii Because the water potential surface membranes. As water leaves
in A is the same as in B. The the cells, the protoplasts shrink and the
pressure applied to B prevents net pressure they exert on the cell walls drops.
movement of water from A to B This decreases the water potential of
by osmosis. the cells. Eventually, the pressure inside
7 a the pure water or dilute solution the cell drops to zero and the cells are
at incipient plasmolysis. As shrinkage
b the solution with the same concentration
continues, the protoplasts pull away
as the red cell
from the cell walls – this is plasmolysis.
8 The animal cell does not have a cell wall. The sucrose solution can pass freely
Plasmolysis is the pulling away of cytoplasm through the permeable cell walls and
from the cell wall. remains in contact with the protoplasts.
9 a The skin represents the cell surface As water leaves the cells, the contents
membrane. of the protoplasts get more and more
concentrated and their water potential
b The balloon would burst, like an animal
gets lower. Equilibrium is reached when
cell would.
the water potential of the cells equals that
c The balloon would not burst. Eventually of the sucrose solution.
it would be impossible to pump any
11 a The water potential of a tissue varies with
more air into the balloon if the box was
the external environment. If, for example,
stronger than the pump. This is like trying
a beetroot was removed from the soil
to pump up a bicycle tyre – it gets harder
and left in a dry atmosphere, its water
and harder as the tyre inflates. Plant cells
potential would gradually decrease as
are similar – the cell wall is strong enough
water evaporated from the surface of the
to prevent further expansion when the
beetroot.
pressure is high enough.
b Once cut, the chips would begin to
10 a from A to B
lose water by evaporation in a typical
b Water molecules can move from A to B laboratory atmosphere. This would result
and from B to A, but more move from A to in a decrease in water potential.
B in a given time period. Overall, therefore,
c Length involves one measurement
A loses water and B gains water – the
only. Measuring volume would require
overall movement is the net movement.
measurements in three planes (and, in
c A has a higher water potential than B practice, would probably not be any more
and water always moves from regions of accurate).
higher to lower water potential.
d Replication increases reliability of results.
d i Pure water has a water potential that
e They were covered to reduce evaporation
is higher than that of cells A and B.
from the chips.
There is therefore a net movement of
water into cells A and B by osmosis f Easier/quicker. To measure change in
through their partially permeable mass requires drying the chips before
cell surface membranes. As water weighing. This is not only more time-
enters, the volume of the protoplasts consuming but is difficult to standardise.
increases, exerting pressure on the
g Change in mass directly reflects the glycolipid – Both are types of lipid.
amount of water lost or gained by phospholipid Glycolipid has a carbohydrate
the tissue, which is the variable being chain attached; phospholipid
investigated. It is therefore likely to be has phosphate attached.
more reliable and valid if the procedure is
carried out correctly. phospholipid – Phospholipid has a hydrophilic
hydrophilic phosphate group.
12 Pancreatic acinar cells carry out secretion by
glycolipid – Glycolipid has a hydrophilic
the process of exocytosis. Exocytosis requires
water carbohydrate portion which
energy in the form of ATP. Mitochondria
is attracted to water so it
make ATP as a result of respiration. The more
faces the right way in the
mitochondria, the more ATP is available.
membrane.
Reflection phospholipid Phospholipids form bilayers
– fluid mosaic which are the basic structures
There may be more than one suitable response for model found in the fluid mosaic
some pairs, depending on the explanation for the model of membrane structure.
connection. Here are some suggested answers.
hydrophilic Facilitated diffusion can take
β-glucose – cell wall cellulose – facilitated place through channel proteins
monomer – protein amino acid diffusion that have hydrophilic pores to
allow the passage of water-
Michaelis−Menten enzyme soluble ions.
constant – affinity
water – fluid The fluid mosaic model of
centrosome – MTOC (microtubule
mosaic model membrane structure explains
microtubule organising centre)
how phospholipids can
animal storage product – glycogen arrange themselves to form a
1,4 and 1,6 linkages bilayer in water.
nm – mm µm fluid mosaic The fluid mosaic model
Golgi apparatus – lysosome model – of membrane structure
hydrolytic enzymes facilitated includes proteins that allow
ribosome – amino acid protein diffusion facilitated diffusion across the
membrane.
amino acid – protein peptide bond
water – Water molecules are attracted
α-glucose – plant storage starch hydrogen bond to each other by hydrogen
product bonding.
monomer – polymer condensation (or fluid mosaic In the fluid mosaic model of
hydrolysis) model – protein membrane structure, proteins
microtubule – 9 + 2 cilium / flagellum form a mosaic pattern in the
induced fit – lock and key enzyme fluid phospholipid bilayer.
peptidoglycan – cellulose cell wall facilitated The fluid mosaic model
diffusion – of membrane structure
pinocytosis – phagocytic endocytosis
active transport includes proteins that allow
vacuole
active transport across the
fatty acid – triglyceride ester bond / ester membrane.
linkage or glycerol or
hydrogen Hydrogen bonds are
condensation
bond – protein important in maintaining
ligand – G protein signalling receptor secondary and tertiary
nucleolus – protein ribosome structure of proteins (e.g.
synthesis alpha helix, beta-pleated
sheet).
There may be more than one suitable response
for some pairs in the grid, depending on the protein – active Active transport requires
explanation for the connection. Here are some transport carrier proteins.
suggested answers.
Exam-style questions substances across membranes, and in the

answer to SAQ10dii.
comments that appear here were written by the Award 1 mark for each term correctly
author(s). In examinations, the way marks are used. [13]
awarded to answers like these may be different. [Total: 25]
6 a A phosphate head (of phospholipid) ;
Notes about mark schemes
B fatty acid tail(s) (of phospholipid) ;
answer. C phospholipid bilayer / membrane ; [3]
R = reject. This indicates a possible answer that b
Award max. of 2 marks: two or three
should be rejected. correct answers 1 mark, four correct
; The bold semicolon indicates the award of 1 mark. answers 2 marks.
/ This indicates an alternative answer for the same i hydrophilic ;
mark. The alternatives may be separated from the ii hydrophobic ;
iii hydrophobic ;
iv hydrophilic ; [max. 2]
Underlining This is used to indicate essential
word(s) that must be used to get the mark. c ions move by diffusion ;
AW means ‘alternative wording’. It is used to channel has shape which is specific for
indicate that a different wording is acceptable particular ion ;
provided the essential meaning is the same, and is channel is hydrophilic / water-filled /
used where students’ responses are likely to vary allows movement of polar substance ;
more than usual.
ions move down concentration gradient ;
AVP means ‘additional valid point’. This means [max. 3]
d both intrinsic proteins ;
are relevant. But accept only as many additional both have specific shape ; [2]
points as indicated by the bold semicolons, e.g. e channel proteins have a fixed shape /
AVP ; ; means award a maximum of 2 extra marks. carrier proteins have a variable shape ; [1]
ORA means ‘or reverse argument’ and is used f width of C measured in mm ;
reverse way. For example: ‘activity increases mm converted to µm and µm converted to
between pH2 and pH5 ORA’ means accept nm ;
‘activity decreases between pH5 and pH2’. correct formula used. Magnification:
max. This indicates the maximum number of M = I/A = width of C/7. Accept mm, µm or
marks that can be given. nm ;
1 C ; [1] correct answer in nm ; [4]
2 D ; [1] [Total: 15]
3 C ; [1]
4 C ; [1]
5 a
Information for answering this question
can be found in Section 4.5, Movement of
substances across membranes, and in the
answer to SAQ10di.

Award 1 mark for each term correctly
used. [12]
b Information for answering this question
can be found in Section 4.5, Movement of
Process Uses energy Uses proteins Specific Controllable by cell

diffusion ✘ ✘ ✘ ✘
osmosis ✘ ✘ ✔ ✘
facilitated diffusion ✘ ✔ ✔ ✘
active transport ✔ ✔ ✔ ✔
endocytosis and exocytosis ✔ ✘ ✔ ✔
[20]
NB: It could be argued that facilitated diffusion is controllable, because the number of channel
proteins in the membrane can affect the rate.
8 explanation:
water (always) moves from a region of higher
Feature Cell wall Cell
water potential to a region of lower water
membrane
potential ;
is the µm nm
thickness (in this case) by osmosis ;
normally through the partially permeable cell surface
measured in membrane of the cell ;
nm or µm? as the cell fills with water, the cell / protoplast
cell location surrounds some surrounds expands and pressure increases ;
cells / does not all cells until the water potential of the cell = zero / is
surround animal (and some the same as the water potential of pure water ;
cells / only organelles) /
found outside may be the cell wall is rigid / will not stretch (far), and
cells / found found prevents entry of more water ;
outside plant, inside cells cell is turgid ; [max. 5]
fungal and
[Total: 8]
prokaryote (or
bacterial) cells 10 a the greater the concentration difference,
the greater the rate of transport ; [1]
permeability freely partially
permeable permeable b rate of transport is zero for diffusion and
facilitated diffusion at zero concentration
fluid or rigid rigid fluid
difference / rate of transport is the same in
Award 1 mark for each correct row. [4] both directions ;
9 description: active transport can take place at zero
rate of entry of water is rapid at first but slows concentration difference ; [2]
down gradually ; c (net) diffusion and facilitated diffusion
until rate is zero / no further entry of water or only take place if there is a concentration
water enters until water potential of difference across a membrane (due to
random motion of molecules or ions) ;
cell = water potential of pure water ;
active transport does not depend on
curve is not linear / curve is exponential ;
a concentration difference because
rate depends on / rate is proportional to, molecules or ions are pumped (using
difference in water potential between cell and, energy from ATP) ; [2]
external solution / water ; [max. 3]
d i active transport ; [1]
ii active transport depends on a supply
of ATP ;
provided by respiration ; [2]
e the graph for diffusion is linear / a straight c i 85% ; [1]

line (with no maximum rate) ; ii incipient plasmolysis is the point at
diffusion is a purely physical process / which the protoplast is about to pull
diffusion is not dependent on, transport away / shrink away, from the cell wall /
proteins / channel or carrier proteins ; the point at which plasmolysis is about
the graph for facilitated diffusion is a to occur ; AW [1]
curve with a maximum rate ; AW iii t he cell / protoplast, continues to lose
facilitated diffusion depends on the water / shrink ;
presence of, transport / channel / carrier t he protoplast pulls away from the
proteins ; cell wall ;
as concentration increases, the (receptor t he water potential of the cell
sites of the), transport/channel/carrier, continues to decrease ;
proteins become more and more saturated ; u
ntil the water potential of the cell
the more saturated the, receptor sites / equals that of the external solution ;
proteins, become, the less the effect of [max. 3]
increasing concentration ; [Total: 12]
rate of transport reaches a maximum, 12 a if it were diffusion, there would be
when all, transport / channel / carrier (net) movement of ions from a region
proteins, are working at full capacity / of higher concentration to a region of
when all receptor sites are, full / saturated ; lower concentration until equilibrium
NB: This is similar to the effect of substrate is reached when concentration inside =
concentration on rate of enzyme activity. concentration outside ; AW [1]
[max. 5] R because concentrations different inside

[Total: 13] and outside
11 a the living contents of a plant cell ; [1] b active transport ;
b i 100% ; [1] active transport involves pumping ions

against a concentration gradient ; [2]
ii the water potential increases ;
c if respiration is inhibited, no ATP is
( because) pressure builds up inside produced ;
the cell ;
active transport uses ATP as an energy
d
ue to (more and more) water source ;
entering the cell ;
active transport stops ;
t he rate of increase in, water
potential/pressure, increases as water diffusion continues ;
enters the cell ; AW ions move down concentration gradients
the cell wall is stretched ; by diffusion until equilibrium is reached ;
w
hen the cell wall is fully stretched, no [max. 4]
more water can enter ; [Total: 7]
t his is the point where the cell is at
100% relative cell volume ; [max. 5]
may be different.
Coursebook answers
Chapter 5 b It suggests that any change in the primary
structure would threaten survival – in
other words, the precise tertiary structure
Before you start of the histones is vital for survival. It
Structural features of the eukaryotic nucleus: highlights the critical importance of
• surrounded by two membranes, the nuclear histones. Only organisms with conserved /
envelope unchanged molecules are likely to survive.
function: separates the biochemistry of c 8.7 cm = 87 mm = 87 000 µm
the nucleus from that of the cytoplasm / 87 000 µm of DNA is packed into 10 µm
continuous with the ER of chromosome
• the nuclear envelope is perforated by nuclear
therefore packing ratio = 87 000 ÷ 10 =
pores
8700
function: helps to control what enters and
leaves the nucleus, e.g. mRNA, ribosomes d total length of chromosomes = 46 × 6 µm =
• contains the chromosomes/chromatin/ 276 µm
euchromatin and heterochromatin/DNA 1.8 m = 1800 mm = 1 800 000 µm
(and histones) 1 800 000 µm of DNA is packed into
function: chromatin contains the DNA 276 µm of chromosomes
and histones; DNA is the genetic material;
histones provide a scaffolding for DNA to therefore packing ratio = 1 800 000 ÷ 276 =
allow it to be packaged without tangling 6522
• contains the nucleolus e Histones provide a scaffolding around
function: the nucleolus makes ribosomes. which DNA molecules can coil. A coiled
strand can be packed into a smaller
Science in Context volume than a straight strand.
Some possible issues are listed below: 2 Microtubules can be shortened by removal of
tubulin subunits (depolymerisation).
• Is it an advantage for the human race that its
individual members grow old and die? 3 Asexual reproduction involves production of
new individuals that are genetically identical
• Should the treatment be universally available?
to the parent. The nuclei in the cells of these
If not, who should benefit?
individuals must be genetically identical.
• If you had a choice, would you choose to
Mitosis is the type of nuclear division
extend your natural life? What if you did and
required to produce genetically identical
your partner didn’t?
nuclei.
• How long would you like to live for, assuming
you would be healthy for most of your life? 4 a 92 chromatids
• Should you be entitled to a particular b 92 DNA molecules (each chromatid
number of years of healthy life before the contains one DNA molecule)
treatment was withdrawn? If so, would this c 92 kinetochores
create a black market for any drugs or other
d 46 chromatids
treatments involved?
e 92 chromatids
1 a The primary structure of a protein is the
amino acid sequence.
5 a Exam-style questions
author(s). In examinations, the way marks are
awarded to answers like these may be different.

answer.
R = reject. This indicates a possible answer that
metaphase should be rejected.

b ; The bold semicolon indicates the award of
1 mark.
word(s) that must be used to get the mark.
AW means ‘alternative wording’. It is used to
indicate that a different wording is acceptable
anaphase provided the essential meaning is the same, and is

used where students’ responses are likely to vary
6 Their function is to hold chromatids together
more than usual.
and to attach chromosomes to the spindle.
7 Of 75 000 cells, 9 were undergoing mitosis.
Mitosis lasts one hour. Therefore, cell cycle is
75 000 / 9 hours long
= 8333 hours points as indicated by the bold semicolons, e.g.
= 8333 / 24 days AVP ; ; means award a maximum of 2 extra marks.
= 347 days. ORA means ‘or reverse argument’ and is used
(Cell cycles vary in length in adult animals reverse way. For example: ‘activity increases
from less than eight hours to more than one between pH2 and pH5 ORA’ means accept
year.) ‘activity decreases between pH5 and pH2’.
8 It suggests that specialisation is not due to max. This indicates the maximum number of
different genes being present in different cells, marks that can be given.
but that different genes are switched on in
different cells. In a liver cell, for example, only 1 D ; [1]
the genes that control the activities of a liver 2 B ; [1]
cell are switched on, even though liver cells
3 D ; explanation: as an example, human
contain all the information to make any cell.
cells contain 46 chromosomes. At S phase
9 Cancer cells are immortal. They achieve this in the cell cycle, each chromosome makes
by renewing their telomeres after each division. a copy of itself, forming two chromatids.
To do this, telomerase is required. (A normal Therefore there are 92 chromatids going into
cell would eventually use up its telomeres and mitosis. After mitosis, each daughter nucleus
die if it divided repeatedly like a cancer cell.) contains 46 chromatids. These are now called
chromosomes. The term chromosome can
therefore be confusing. The confusion arises
because the term ‘chromosome’ was originally
applied to the structures which appear
during mitosis, each of which consists of two centromere leading for each chromatid ;[3]
chromatids (duplicate chromosomes) and the [Total: 6]
term chromosome is now also applied to the
46 structures found in the interphase nucleus 9 a microtubules are made out of tubulin
between cell divisions. [1] molecules ;
4 B ; [1] the tubulin molecules stick together in a
particular pattern to form the microtubules,
5 A ; [1]
so the presence of colchicine would
6 centrosome: interfere with this ; AW [2]
a microtubule organising centre ; b spindle ;
makes spindle during mitosis ; centrioles ; [2]
contains two centrioles ; c (held up in) prophase ;
located just outside nucleus ; spindle cannot form (due to presence of
centriole: colchicine) ;
has nine triplets of microtubules ; so, metaphase / subsequent phases,
no function (during mitosis) ; cannot occur ; [3]
part of centrosome ; award this mark only if [Total: 7]

not mentioned under centrosome 10 Award 1 mark for correct statement, True or
centromere: False. No explanation is required.
region of a chromosome that holds two A True ;

chromatids together ; Centrosomes replicate during interphase,
point of attachment for microtubules during before M phase begins.
mitosis ; B True ;
point of attachment of chromatids to spindle ; Sister chromatids are formed by the
AVP ; replication of DNA. Each contains one
daughter DNA molecule identical to the
[max. 6 with a max. of 3 for centrosome] parent molecule.
7 a A anaphase ; C False ;
B prophase ; Microtubules extend from the kinetochore
C metaphase ; [3] to the nearest pole. The kinetochores
b
Information for this answer can be found in in sister chromatids are connected to
Figure 5.9 in the Coursebook. opposite poles.
Award 1 mark for each correct summary.[3] D False ;
[Total: 6] This occurs during M phase during

spindle manufacture (polymerisation)
8 a i metaphase ; [1] and chromatid movement
ii prophase drawing shows two single (depolymerisation).
chromosomes, each with a centromere E False ;
(not paired chromatids), ‘randomly’
distributed, surrounded by cell surface Kinetochores are found on chromatids.
membrane but with no spindle ; [1] F False ;
b a long and a short chromatid, each with Telomeres are the caps at the ends of
a centromere, are shown inside each chromosomes. Microtubules are attached
new nucleus ; [1] at the centromeres (kinetochores).
c six chromatids about half-way between G True ;
equator and each pole (12 chromatids in Chromatids separate at the start of
all) ; two long, two short, two hooked in anaphase.
each direction ;
[Total: 7]
11 The following table of data is based on valid point) in the marking scheme is
data obtained from the same source as the indicative of this.
figure used for the question (visit https:// the total number of cancer sufferers
ourworldindata.org). The figure is interactive has increased ;
on the website. The following table of data
may help teachers when marking. has (roughly) doubled ;
that could just be a result of
Year 1990 Year 2016 population increase ;
Age millions % Age millions % could be due to people living longer ;
group group
could be due to the fact that exposure
70+ 6.52 34.2 70+ 15.67 37.3
to risk factors is increasing / could be
50 – 69 8.73 45.8 50 – 69 19.27 45.9 due to changes in lifestyle / could be
15 – 49 3.36 17.6 15 – 49 6.51 15.5 due to increasing pollution / could
under 0.46 2.4 under 0.55 1.3 be due to increased smoking (of
–15s –15s tobacco) ;
Total 19.07 100 Total 41.99 100 there is no / little change in the
number of cancer cases among the
a cancer is caused by mutation ; under-15s (actually gone down from
2.4% to 1.2% of total) ;
in, genes / a gene, controlling, cell division
/ mitosis ; would expect an increase if there were
more under-15s in 2016 than 1990 ;
a mutated gene causing cancer is called an
oncogene ; [max. 2] could be due to better medical
treatment of cancer in under-15s ;
b a, substance / chemical, (or environmental
factor) that can cause cancer ; [1] there is no / little change in the actual
number of cancer cases among the
c i 50–69 ; [1]
under-15s, although the % has gone
ii it contains the greatest number of down from 2.4% to 1.3% of total
people ; (almost halved) ;
the people have had longer to therefore, no new factors / no change
accumulate mutations than younger in factors, causing cancer (?) ;
age groups ;
any comment suggesting that further
the death rate in the 70+ age group is information is needed to fully
higher, so fewer remaining sufferers interpret the trends ;
of cancer ; [3]
any calculation of percentages ;
iii
Questions asking students to comment
AVP ; ; ; [max. 5]
on data can elicit a great variety of
answers, so some judgement is often [Total: 12]
needed in deciding what is a suitable
marking point. The use of AVP (any
may be different.
Coursebook answers
Chapter 6 3 A = T and G = C for all organisms (within
experimental error)
Before you start 4 a DNA, (DNA) nucleotides, DNA
• DNA is found in the nucleus. polymerase, DNA ligase
• DNA is the molecule of inheritance. It carries b Nucleotides are needed to make DNA
the code that controls the activities of the cell (DNA is a polynucleotide).
and therefore controls ‘life’. It can replicate itself. DNA polymerase copies the DNA, lining
• There are a number of ways of justifying the up nucleotides.
importance of the discovery of the structure
DNA ligase joins neighbouring
of DNA. Knowledge of the structure of
nucleotides with phosphodiester bonds.
DNA and the genetic code and genome
sequencing technology will continue to bring c nucleus
many medical and commercial benefits. It
5 a The two daughter molecules should have
has helped to revolutionise understanding of
one blue and one red strand each.
the evolutionary relationships between living
organisms. Genetic fingerprinting is useful b One daughter molecule should have two
in forensics and establishing kinship between blue strands and one should have two red
living organisms. More philosophically, it strands.
provides a fundamental understanding of 6 4n, where n = number of bases coding for one
humans as a species and of the nature of life. amino acid
Science in Context 7 The fact that the code is universal (the same
in all organisms) suggests that all living
Concerns commonly raised are: organisms have evolved from a single common
• the safety, effectiveness and implications for ancestor that used this code.
society as a whole 8 TTT = Lys (lysine), GAA = Leu (leucine),
• whether or not gene editing in human embryos CCC = Gly (glycine)
will create division between ‘haves’ and ‘have- 9
nots’ (treated and untreated)
• whether or not parents will want desirable Feature DNA messenger
traits added – that is, to make designer babies. RNA
sugar deoxyribose ribose
Self-assessment questions present in
structure
1 a diagram as Figure 6.2 with sugar labelled
as deoxyribose and base labelled as bases adenine, guanine, adenine,
adenine, guanine, thymine or cytosine used in thymine, cytosine guanine,
structure uracil,
b diagram as Figure 6.2 with sugar labelled cytosine
as ribose and base labelled as adenine,
number of 2 1
guanine, thymine or uracil
strands
2 a peptide bond overall double helix single linear /
b glycosidic bond structure unfolded
strand
location in nucleus nucleus and

cell cytoplasm
function instructions for carries
cell / code for code for a
making proteins polypeptide
/ molecule of from DNA /
inheritance / nucleus to a
genetic molecule ribosome
10 There are various possible flow diagrams or word-only flow diagrams you could use. Examples are
shown.
DNA unwinds and the two strands separate

↓
complementary mRNA molecule built up against
one DNA strand (transcription)
↓
mRNA molecule attaches to ribosome
↓
complementary tRNA, loaded with appropriate
amino acid pairs, with one codon on mRNA
(translation)
↓
peptide bond forms between adjacent
amino acids
nucleus translation
ribosome
DNA mRNA mRNA
tRNA
transcription
nuclear amino acid-tRNA

pore
amino acid
polypeptide
In the nucleus, DNA unwinds and the two strands separate → one strand is copied to make a
complementary mRNA molecule (transcription) → mRNA leaves the nucleus via a nuclear pore and
travels to and attaches to a ribosome → complementary tRNA carrying an appropriate amino acid
pairs with first codon on the mRNA (translation) → process is repeated with second amino acid-tRNA
→ peptide bond forms between neighbouring amino acids → process continues to make a polypeptide.
Exam-style questions Notes about mark schemes

The mark schemes, suggested answers and A or accept indicates an alternative acceptable
comments that appear here were written by the answer.
author(s). In examinations, the way marks are R = reject. This indicates a possible answer that
awarded to answers like these may be different. should be rejected.
; The bold semicolon indicates the award of 1 mark. 6 mRNA tRNA DNA triplet from
/ This indicates an alternative answer for the same codon anticodon which mRNA was
mark. The alternatives may be separated from the transcribed
rest of the answer by commas. UUA AAU AAT
( ) Text in brackets is not required for the mark. UUG AAC AAC
Underlining This is used to indicate essential CUU GAA GAA
word(s) that must be used to get the mark. CUC GAG GAG
AW means ‘alternative wording’. It is used to CUA GAU GAT
CUG GAC GAC
provided the essential meaning is the same, and is
used where students’ responses are likely to vary Award 1 mark for each correct entry. [12]
more than usual.
7 a substitution ; [1]
accept any additional points given by the student b the genetic code is degenerate / redundant ;
that are not in the mark scheme, provided they some amino acids are coded for by
are relevant. But accept only as many additional more than one triplet ; [max. 2]
points as indicated by the bold semicolons, e.g. c change in the amino acid coded for ;
AVP ; ; means award a maximum of 2 extra
marks. primary structure of polypeptide changed ;
ORA means ‘or reverse argument’ and is used may affect tertiary structure ;
when the same idea could be expressed in the therefore may affect functioning of
reverse way. For example: ‘activity increases polypeptide ; [max. 3]
between pH 2 and pH 5 ORA’ means accept d all gametes produced by that cell will
‘activity decreases between pH 5 and pH 2’. be affected ;
max. This indicates the maximum number of all cells in any individual produced
marks that can be given. from that gamete will be affected ; [2]
1 B; [1] e a single deletion or addition results in a
2 C; [1] frame shift ; AW
3 D; [1] all triplets after the mutation are affected ;
4 D; [1] a triplet may be altered to a stop signal ;
5 labels should include: if three bases are added or deleted a frame
shift will not occur ;
parent, molecule / DNA ;
after the third addition or deletion ;
daughter molecules ;
because the code is read in sets of three
parent / old / original DNA, acts as template ; bases ;
new strands / DNA, made from nucleotides one amino acid will be added or deleted
binding to, old strands / DNA, by from final polypeptide ;
complementary base pairing ;
this may not be harmful / affect
semi-conservative ; [max. 4] polypeptide functioning ; [max. 4]
[Total: 12]
8 10 a the DNA in the spleen and thymus of the

same organism is the same / the DNA in
Transcription Translation
all the cells of an organism is the same /
site in cell nucleus ribosome (in the same genes are present in both
where it cytoplasm) organs ; [1]
occurs
b the DNA in different species is different /
molecule used DNA mRNA different genes are present ; [1]
as a template
c the numbers of A and T, and of C and
molecule mRNA polypeptide / G, are similar because A pairs with T
produced protein and C pairs with G ; [1]
component (RNA) amino acids
d no base pairing occurs (because the
molecules nucleotides
DNA is single stranded) ; [1]
(monomers)
of molecule [Total: 4]
produced
one other RNA tRNA / rRNA /
molecule that polymerase ribosomal
is essential for protein /
the process to enzyme that
occur adds amino
acid to tRNA
Award 1 mark for each correct entry. [10]

9 a U mRNA ;
V ribosome ;
W amino acid ;
X tRNA ;
Y polypeptide ; [5]
b peptide bond ; [1]
c the ribosome is moving along the mRNA ;
it moves three bases / one codon, at a
time ;
as the code is being read ;
each time a tRNA brings in another
amino acid ; AVP [max. 3]
[Total: 9]
may be different.
Coursebook answers
Chapter 7 • increasing human population means more
farming land is needed
Before you start • timber can be used as a fuel.
• The surface area : volume ratio of a structure • How to manage forests:
decreases with increasing size. • Remove trees on a sustainable basis
• A leaf has a large surface area : volume ratio (by allowing as many to re-grow as are cut
because it is thin. The folding of the cell down) – don’t remove all the trees.
surface membrane which forms microvilli • Remove only the most mature trees and
increases the surface area : volume ratio of replace them with young trees.
cells with microvilli. • Set up protected areas to preserve some of
• Large multicellular organisms have a relatively the existing forests.
low surface area : volume ratio. As explained • Get regional, national and international
in Chapter 4 (see answer to Self-assessment organisation(s) to agree on priorities.
question 5), diffusion is a relatively slow
• Search for alternative materials.
process, so larger organisms cannot rely on
diffusion as a means of transport for essential
requirements like oxygen and nutrients. This Self-assessment questions
means that special long-distance transport 1 a
a sugar molecule consisting of two
systems must be present, such as the blood monosaccharides joined together by a
system in animals and the vascular system glycosidic bond
in plants. This is discussed further at the
b glucose and fructose
beginning of Chapters 7 and 8.
c β-glucose
• Transport systems would be expected to have
the following features: d α-glucose
• a system of tubes or enclosed spaces in e in regions of growth (meristems) to help
which to transport fluid containing the make the cell walls of new cells
materials to be transported 2 Pencil is not sharp.
• a means of moving the fluid (by mass
Lines are not clear and continuous.
flow); may consume energy and require
a pumping mechanism or a way of Individual cells are drawn in a low-power plan.
generating regions of high and low Tissues are not completely enclosed by lines.
pressure
A ruler has not been used for label lines.
• the system would need to be extensive
enough to serve all the cells of the body Label lines cross.
• there must be a way of loading and 3 This is a way of conserving water. The upper
unloading materials into and out of epidermis is more exposed to sunlight, so loss
the system of water by transpiration would be greater
from this surface.
• there may be specific mechanisms for
carrying important materials (such as 4 a Increased wind speed moves water vapour
haemoglobin carrying oxygen). away from the leaf more rapidly, thus
maintaining a steeper water potential
Science in Context gradient between the air spaces of the leaf
and the surrounding air.
• Factors, apart from logging, responsible for
forest decline include:
b A rise in temperature increases the rate c The wider the diameter, the more water
of evaporation from the cell walls into can be moved up through a xylem vessel
the air spaces. This is because the kinetic per unit time. However, if the vessels
energy of water molecules increases, are too wide, there is an increased
making them move, and therefore diffuse, tendency for the water column to
more rapidly. High temperatures may also break, introducing an air bubble that
decrease the humidity of the air (as warm will stop flow. The diameter of xylem
air can hold more water), so increasing vessels is a compromise between these
the diffusion gradient. two requirements.
5 d The lignified walls provide support,
preventing the vessels from collapsing
Xerophytic How it helps Example inwards when the water column is under
feature of to conserve (name of tension.
leaves water plant)
e Pits in the walls of the vessels allow water
thick cuticle waxy cuticle is marram grass, to move into and out of the vessels.
impermeable Sitka spruce
to water 7 Cohesion is the term given to the tendency
of water molecules to stick to each other,
leaf rolling see Figures marram grass
which helps mass flow to occur. Tension is
7.16a and
the sucking force caused by transpiration.
7.17
As water leaves the plant by transpiration,
hinge cells see Figures marram grass the water molecules are pulled through
7.16a and the plant because of the cohesion of the
7.17 water molecules. This pulling is called
stomata only see Figures marram grass transpirational pull.
in upper 7.16a and 8 Examples include:
epidermis in 7.17
a proteins, amino acids, nucleic acids (RNA
rolled leaf
and DNA), chlorophyll, NAD, NADP
hairy see Figure marram grass,
7.16d Phlomis italica b RNA, DNA, ATP, ADP, NADP,
phospholipids
reduced see Figure Opuntia,
surface 7.16b and e cardon, Sitka c the amino acids cysteine and methionine.
area : volume spruce 9 sucrose, amino acids, ATP and plant growth
ratio / spiny substances
or needles 10 a nectary: sink
or small
b developing fruit: sink
sunken see Figures marram grass,
stomata 7.16c and Sitka spruce c sprouting potato tuber: source
(in pits or 7.17 d potato tuber forming: sink
grooves)
11 It is highly soluble in water so large quantities
outer (lower) see Figure marram grass can be transported in a relatively small volume
epidermis 7.17 of xylem sap (by mass flow).
has few or no
Because it is relatively inert metabolically, it
stomata
is less likely to be used along the route from
source to sink.
6 a The total lack of cell contents provides 12 a actual length = observed length ÷
an uninterrupted pathway for the flow of magnification or A = I / M
water. observed length of sieve tube element =
b The lack of end walls also provides an 50 mm (±1 mm)
uninterrupted pathway for the flow of actual length = 50 mm / 200 = 0.25 mm or
water. if you convert mm to µm the answer is
250 µm
b i 1 metre = 1000 mm Reflection

1000 / 0.25 = 4000 The tables give some possible comparisons of
or xylem and phloem.
1 metre = 1 000 000 µm Similarities
1 000 000 / 250 = 4000 structure tubes made from cells joined end
ii sieve pores to end
c (sieve tube element is 0.25 mm long) function transport fluids (called sap)
(1 hour = 3600 seconds) carry out long-distance transport
3600 seconds to travel 1 metre fluid moves by mass flow
therefore: 0.25 / 1000 × 3600 seconds to fluid moves down a pressure
travel 0.25 mm (or you may use 250 and gradient
1 000 000 instead of 0.25 and 1000).
solutes transported dissolved
= 0.9 seconds (to one decimal place)
in water
Table 7.2: Comparing xylem and phloem – similarities

(completed).
Differences
Feature Xylem Phloem
tubes are called vessels sieve tubes
cells/tubes living or dead dead living
cell/tube contents empty thin layer of cytoplasm (no nucleus or
ribosomes)
walls lignified, strong normal plant cell walls with cellulose as
strengthening material
end walls of tubes none sieve plates with pores
substances transported water and mineral salts / assimilates / organic solutes such as
ions sucrose and amino acids
functional unit vessels work in isolation sieve tubes /sieve tube elements work
with companion cells
mechanism of movement passive active
passive or active
direction of movement up the plant only up and down the plant
pressure gradient from high tension (low water from high hydrostatic pressure at the
potential) in the leaves to source to low hydrostatic pressure at
low tension (high water the sink
potential) in the roots
other function support none
Table 7.3: Comparing xylem and phloem – differences (completed).
Exam-style questions c Refer to Section 7.4, The transport of

water (Movement of water from xylem
The mark schemes, suggested answers and across the leaf). 1 mark for each valid point
comments that appear here were written by the up to a max. of 3 [max. 3]
author(s). In examinations, the way marks are
awarded for answers like these may be different. [Total: 10]
6 soil solution > root hair cell > xylem vessel
Notes about mark schemes contents > mesophyll cell > dry atmospheric
A or accept indicates an alternative acceptable air ; [1]
answer. 7 a the lower the relative humidity, the higher
R = reject. This indicates a possible answer that the tension in the xylem ; ORA
should be rejected. more evaporation from leaf (mesophyll
; The bold semicolon indicates the award of cells) when low relative humidity ;
1 mark. because water potential gradient between
/ This indicates an alternative answer for the same leaf and atmosphere is steeper ;
mark. The alternatives may be separated from the results in lower water potential in leaf
rest of the answer by commas. (mesophyll cells) ;
( ) Text in brackets is not required for the mark. therefore more water moves from xylem
Underlining This is used to indicate essential (vessels to replace water lost from leaf) ;
word(s) that must be used to get the mark. down a water potential gradient ;
AW means ‘alternative wording’. It is used to sets up tension in the xylem vessels ;
[max. 4]
used where students’ responses are likely to vary b highest tension is at the top of the tree ;
more than usual. ORA
AVP means ‘additional valid point’. This means because water is being lost at the top of
accept any additional points given by the student the tree ;
that are not in the mark scheme, provided they there is a tension gradient in the xylem
are relevant. But accept only as many additional vessels ; [3]
points as indicated by the bold semicolons, e.g.
[Total: 7]
AVP ; ; means award a maximum of 2 extra marks.
8 transpiration / loss of water vapour / loss of
water by evaporation, from the leaves occurs
during the day ;
between pH 2 and pH 5 ORA’ means accept because the stomata are open ;
‘activity decreases between pH 5 and pH 2’. this results in tension in the xylem
max. This indicates the maximum number of (vessels) ;
marks that can be given. walls of xylem vessels are pulled slightly
1 A ; [1] inwards / vessels shrink slightly ; AW
2 B ; [1] overall effect is for diameter of tree trunk
to, shrink / get smaller ;
3 B ; [1]
stomata close at night, so no transpiration
4 B ; [1]
at night ; [max. 4]
5 a
Refer to Section 7.4, The transport of
9 a the loss of water vapour ;
water (Movement of water from the soil
into root hairs). 1 mark for each valid point from the leaves / from the surface of a
up to a max. of 3 [max. 3] plant ; [2]
b
Refer to Section 7.4, The transport of b light (intensity) ;
water (Movement of water across the root temperature ; [2]
from root hairs to xylem). 1 mark for each
valid point up to a max. of 4 [max. 4]
c rate of water uptake shows the same c ATP is needed for the active transport of
pattern as rate of transpiration ; AW hydrogen ions out of the cell ; [1]
but there is a time delay, with changes [Total: 4]
in rate of transpiration occurring before 11 a i when seed is forming / just after
changes in water uptake ; AW [2] fertilisation ; [1]
d transpiration causes water uptake ; ii germination ; [1]
loss of water (by transpiration) sets up a iii
young immature leaf / leaf that is
water potential gradient in the plant ; still growing ; [1]
water potential in roots is lower than iv mature photosynthesising leaf ; [1]
water potential in soil ;
v hen food is being accumulated / when
w
therefore water enters plant through roots ; storage organ is, growing (in size) /
time delay between rate of transpiration developing / end of plant’s growing
and rate of water uptake is due to time season / just before winter ; [1]
taken for effect of transpiration to be vi when plant starts to grow (using food
transmitted through the plant ; AW from the storage organ) ; [1]
[max. 4] b i to make starch ;
[Total: 10] respiration ; [2]
10 a hydrogen ions are actively transported out ii to make cellulose ;
of the companion cell ; [1]
respiration ; [2]
b there are, more hydrogen ions / there is
a build-up of hydrogen ions, outside the [Total: 10]
companion cell compared with inside ;
hydrogen ions are positively charged ; [2]
may be different.
Coursebook answers
Chapter 8 b Oxygenated blood can be pumped
around the body at a higher pressure,
and therefore faster, in a mammal than
Before you start in a fish, because pressure is lost in the
Learners’ answers to these questions will provide capillaries in the gills. This can provide
some indication of their current understanding of a more efficient oxygen supply to
the structure of the mammalian transport system. mammalian cells than to fish cells.
They are likely to mention arteries, veins and c Mammals regulate their body
capillaries, but they may not be aware of arterioles temperature. This involves using
and venules. They should know that blood respiration in cells to generate heat, and
contains plasma, platelets, white cells and red cells, this uses a lot of oxygen. Fish do not
and they may be able to name phagocytes and regulate their temperature. Mammals
lymphocytes. There are many different facts that therefore need to be able to deliver oxygen
they may suggest about each component, and it to cells more quickly than fish do.
may be interesting to write all of their suggestions
on the board to provide a summary of the class’s 2 Blood cells, and haemoglobin in red blood
current knowledge. cells, would cause scattering and absorption
of light before it reached the retina. The
Science in Context aqueous humour supplies the cornea with its
requirements.
Learners are likely to come up with a range of
3 a Gravity pulls blood downwards.
ideas about the advantages and disadvantages of
Normally, contraction and relaxation of
an artificial heart rather than a heart transplant,
leg muscles squeezes in on leg veins; valves
which could include:
in them ensure blood moves upwards
• advantages: overcomes the need for a and not downwards. When standing to
matching heart from a donor; can keep attention, these muscles are still, so blood
someone alive until a suitable donor heart accumulates in the feet.
becomes available
b As thoracic volume increases, pressure
• disadvantages: have to carry a battery around inside the thorax decreases. This decreases
in a backpack; probably will not last forever so the pressure in the blood vessels in the
will need to be replaced if a donor heart does thorax. The effect is very small in the
not become available; may restrict activity of arteries, but more significant in the veins.
the recipient. The relatively low pressure of the blood in
the veins in the thorax, compared with the
Self-assessment questions pressure in veins elsewhere in the body,
produces a pressure difference causing
1 a The fish has a single circulatory system,
blood movement towards the thorax.
whereas the mammal has a double
circulatory system. 4 Answers should include reference to:
In the fish, blood leaves the heart and • the fluctuating pressure in arteries
travels to the gills, where it picks up • why the fluctuations become gradually
oxygen, before continuing around the smaller as the blood passes through the
body. In the mammal, the blood returns arterial system
to the heart after picking up oxygen at
• the rapid drop in pressure as the blood
the lungs and is then pumped around the
flows along the arterioles and capillaries,
body.
and reasons for this
• the rise of pressure as blood enters the pulmonary circulation via the right-hand side of the heart,
and the even higher rise in pressure in the aorta, and reasons for this.
5 There are many ways in which learners might design this table, and there is no one ‘correct’ answer.
The table summarises some of the ideas that they might include. Answers to b will depend on the
comparisons that learners make between each other’s tables. Learners should be encouraged to make
changes to their tables, after making these comparisons, if they wish.
Feature Artery Vein Capillary

elastic large amount, particularly in small amount none
tissue in elastic arteries
wall
This allows the wall to stretch Blood in veins is at low
and recoil as high-pressure pressure, as there is no
blood pulses through. need for walls to be elastic.
smooth relatively large amount, small amount none
muscle in particularly in muscular arteries
wall
Contraction of this muscle All blood in veins is
reduces the size of the lumen, travelling back to the heart,
which can divert blood from so there is no need to
one area to another. divert it to different tissues.
thickness relatively thick relatively thin only one cell thick with
of wall cells thin and flattened,
so the wall is a thin as
possible
Artery walls must be strong The blood is at low This allows rapid
enough to withstand the high pressure, so there is no transfer of substances
pressure of the blood flowing need for a thick wall. by diffusion between
inside them. the blood and tissue
fluid.
valves none present present none
These prevent the low-
pressure blood from
flowing backwards.
diameter relatively small relatively large tiny – many are only
of lumen just wide enough to
allow a red blood cell
to pass through
This ensures that large This reduces the resistance This brings the blood
volumes of blood, at high to flow of the blood inside as close as possible to
pressure, move quickly from them, which helps to keep cells in the surrounding
the heart to the tissues. the low-pressure blood tissues, speeding
moving back towards the up the exchange of
heart. substances between
them.
6 The larger the relative molecular mass (RMM) • The haemoglobin molecule is a protein
of a substance, the lower the permeability of with quaternary structure.
capillary walls to that substance. This is true • Hydrogen bonds, ionic bonds and van der
in all cases – there are no exceptions in this Waals forces hold the protein in its three-
table. For example, water has the smallest dimensional shape.
RMM (18) and the largest permeability
(1.00), while the substance with the largest • The primary structure of each
RMM is albumin (69 000) and it has the polypeptide chain determines how the
smallest permeability (0.000 01). However, chain will fold / where the bonds will form
the relationship is not linear. For example, a (thus determining its three-dimensional
relatively small difference in RMM between shape).
haemoglobin and albumin results in a very • The haemoglobin molecule has R groups
large difference in permeability. with small charges on its outer surface
7 Albumin in the blood plasma raises its solute (hydrophilic R groups), which help to
concentration (lowers its water potential), make it soluble in water.
thus helping to draw water back from the • This allows it to dissolve in the cytoplasm
tissue fluid into capillaries as it moves down of a red blood cell.
the water potential gradient. If albumin could • Each haemoglobin molecule is made up
diffuse out of capillaries into tissue fluid, more of four polypeptide chains, each with a
water would accumulate in the tissue fluid. haem group at its centre.
8 If plasma protein concentrations are low, then • Each haem group can bind reversibly with
the water potential of the blood will be higher one oxygen molecule.
than normal. There will no longer be a steep
water potential gradient between the tissues • When one oxygen molecule binds with
and blood, and so water will not be drawn one of the haem groups, it slightly
back into capillaries from tissue fluid. This will changes the shape of the haemoglobin
result in a build-up of tissue fluid and swelling. molecule so that it becomes easier for
more oxygen molecules to bind with the
9 2.1 × 1011 other haem groups.
10 a Protein synthesis – no. There is no DNA, 14 a (The word ‘gradually’ is not correct.)
so no mRNA can be transcribed.
The partial pressure of oxygen is high in
b Cell division – no. There are no the lungs and low in muscle and does not
chromosomes, so mitosis cannot occur, change gradually as the blood flows from
nor are there centrosomes for spindle the lungs to the muscle (because it is only
formation. when it gets to the muscle that the blood
c Lipid synthesis – no. This occurs on the is in contact with anything that is using
smooth endoplasmic reticulum, and there oxygen).
is none. b (Arteries do not pump blood.)
d Active transport – yes. This occurs across Elastic artery walls enable the artery
the cell surface membrane, and can be to expand and recoil as pulses of high-
fuelled by ATP produced by anaerobic pressure blood pass through. The recoil of
respiration. the artery wall does help to give the blood
11 a 195 cm3 a further ‘push’ in between these pulses,
b 25 cm3 but this is not ‘pumping’ and is due only
to elasticity, not to muscle contraction.
12 a i 96.5%
c (The student has confused a haemoglobin
ii 1.25 cm3 molecule with a red blood cell.)
b i 24.0% Each haemoglobin molecule can combine
ii 0.31 cm3 with eight oxygen atoms. One red cell
13 Points that could be made are given as bullet contains well over 200 million
points. You could award a mark for each point haemoglobin molecules.
made.
d (Red blood cells do have a large surface −− The vessels in plants are made of rows of
area, but oxygen does not attach to their single cells with rigid walls. In mammals,
surface.) they are much larger, and are made of
The large surface area allows more oxygen many cells that form their flexible walls.
to diffuse in and out at any one time, Learners could give more detail about the
therefore increasing the rate at which the structures of the walls of xylem, phloem,
cell can take up and release oxygen. Once arteries, veins and capillaries.
inside the cell, the oxygen does not attach −− Plants rely on passive processes
to its surface but to the haemoglobin (transpiration) to provide the pressure
molecules within its cytoplasm. differences to move water and dissolved
15 For the first heart beat shown: ions through xylem, and active transport
atrial systole: between 0 and 0.125 s to produce pressure differences that move
ventricular systole: between about 0.125 s water and dissolved assimilates through
and 0.325 s phloem. Mammals have a heart that
ventricular diastole: between about 0.325 s provides these pressure differences, using
and 0.625 s muscle contraction. Learners could give
more detail about these processes.
16 The valves in the heart normally prevent
backflow from the ventricles to the atria, or
from the main arteries to the ventricles. If the
Exam-style questions
atrioventricular valves do not close correctly, The mark schemes, suggested answers and
some blood will move back into the atria comments that appear here were written by the
rather than into the arteries as the ventricles author(s). In examinations, the way marks are
contract. Similarly, if the semilunar valves do awarded to answers like these may be different.
not close correctly, some blood will flow back
from the arteries into the ventricles as the Notes about mark schemes
ventricles relax. A or accept indicates an alternative acceptable
Both of these events will mean that less blood answer.
is pushed out of the heart and around the R = reject. This indicates a possible answer that
body, or to the lungs. This can have several should be rejected.
effects, but the main one is likely to be that
less oxygen is delivered to the tissues. The
1 mark.
person may feel tired, as there is less oxygen
available for respiration in the muscles. The / This indicates an alternative answer for the same
heart may beat more quickly or more strongly mark. The alternatives may be separated from the
as the body attempts to ‘make up for’ this lack, rest of the answer by commas.
which – over time – may increase the risk of ( ) Text in brackets is not required for the mark.
heart failure.
Reflection
Ideas that might be raised include: indicate that a different wording is acceptable
• Similarities: in both flowering plants and provided the essential meaning is the same, and is
mammals, fluids move inside tubes that used where students’ responses are likely to vary
distribute them around the body of the more than usual.
organism. AVP means ‘additional valid point’. This means
• Differences: accept any additional points given by the student
−− Plants have two separate systems (xylem
and phloem) with different functions.
Learners could outline what these
functions are, and compare them with the
functions of mammalian blood. ORA means ‘or reverse argument’ and is used
between pH2 and pH5 ORA’ means accept 6 a blood goes through heart twice on one
‘activity decreases between pH5 and pH2’. complete circuit of the body ; [1]
max. This indicates the maximum number of b has more smooth muscle / elastic tissue ;
marks that can be given. to withstand higher (blood) pressure ;
1 C ; [1] to withstand fluctuating (blood)
2 C ; [1] pressure ; [max. 2]
3 D; [1] c to prevent blood flowing into the capillary
4 B; [1] bed / to divert blood to other capillary
beds ; [1]
5 a reference to diffusion ;
d permeable walls / reference to pores in
down concentration gradient ; walls ;
through the wall of a capillary ; [max. 2] allow water / dissolved ions / dissolved
b lower pressure ; substances (from plasma) to pass out ;
lower concentration of oxygen ; do not allow large protein molecules / cells
to pass out ;
lower concentration of glucose ;
reference to greater hydrostatic pressure
lower water potential ;
inside capillary than in tissue fluid ;
lower concentration of proteins / amino
[max. 3]
acids / fatty acids / other named nutrient ;
e (plasma contains) more proteins ;
higher concentration of urea ; [max. 3]
has lower water potential ;
c i carbonic anhydrase ; [1]
has lower, carbon dioxide / HCO3–
ii ydrogencarbonate ions diffuse out of
h
concentration ;
red blood cells ;
has greater glucose concentration ;
( hydrogencarbonate ions) are
transported in solution in blood plasma ; has greater oxygen concentration ;
conversion of CO2 to [max. 3]
hydrogencarbonate reduces [Total: 10]
concentration of CO2 in the blood ;
7 a i about 0.75 seconds ; [1]
w
hich maintains diffusion gradient
ii 60 ÷ 0.75 = 80 beats per minute ; [1]
for CO2 to diffuse into the blood from
respiring tissues ; [max. 3] For b, c, d, e and f, see diagram.
d i 73%, 62% ; [1]
16 semilunar semilunar
ii resence of carbon dioxide causes
p valves open valves close
14
affinity of haemoglobin for oxygen aorta
to decrease ; 12
Pressure / kPa
10
hydrogen ions (from the dissociation left
of H2CO3) bind with haemoglobin ; 8
ventricle
c ause change in shape of Hb 6 atrioventricular atrioventricular right

ventricle
molecule ; [max. 2] 4
valves close valves open
iii Bohr shift ; [1] 2

left
atrium
iv causes more release of oxygen (than if 0

this effect did not occur) ; 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1 1.2 1.3
Time / s
in respiring tissues ;
w
here demand for oxygen is high / Marks for correctly indicating the positions of
where production of carbon dioxide the following:
is high ; [3] b i ventricular systole ; [1]
[Total: 16] ii ventricular diastole ; [1]
c i atrial systole ; [1] b

ii atrial diastole ; [1] Event during the cardiac Number
d points at which atrioventricular valves cycle
open and close ; [1] atrioventricular (bicuspid) 6
valve opens
e points at which semilunar valves open
and close ; [1] ventricular systole 1;
f line to show probable pressure in right semilunar (aortic) valve closes 5;
ventricle ; [1] left ventricle and left atrium 2;
[Total: 9] both relaxing
8 a i right ventricle ; semilunar (aortic) valve opens 4;
pulmonary vein ; [2] [4]
ii they open to allow blood to flow from c SAN produces rhythmic pulses of
atria to ventricles ; electrical activity ;
t hey close during ventricular systole / which spread across the muscle in the
when ventricles contract ; atria ; causes muscle in atria to contract ;
specialised tissue, in septum / near AVN,
r eference to closure being caused by
slows spread / delays transfer to ventricles ;
differences in pressure in atria and
Purkyne tissue conducts impulses down
ventricles ; [max. 2]
through septum ;
impulses spread upwards through
ventricle walls ;
causing ventricles to contract from
bottom upwards ;
delay of 0.1–0.2 s after atrial walls ;
[max. 5]
[Total: 13]
may be different.
Coursebook answers
Chapter 9 • Does your answer change depending on how
invasive the screening test is?
Before you start Self-assessment questions
The discussion should give an opportunity to
1 formula:
consider the relevance of surface area : volume
(SA : V) ratios to gas exchange. The features of actual width = width of cartilage on image
magnification
gas exchange surfaces could also be reviewed, trachea:
particularly the need for a thin surface to
width of cartilage on photomicrograph of
facilitate the diffusion of oxygen and carbon
trachea = 30 mm = 30 000 μm
dioxide between blood and the surroundings. The
principles of SA : V are covered in Chapter 4. actual length = 30 000 ÷ 65
Points that could be introduced into the discussion = 462 μm
include: bronchus:
• how to estimate the surface area of mammals width of cartilage on photomicrograph of
• the surface area of a typical adult human is bronchus = 20 mm = 20 000 μm
1.6–1.9 m2 actual length = 20 000 ÷ 300
• the volume of a person with a body mass of
= 67 μm
70 kg is 70 dm3
2 a The smooth muscle layer is only a few
• the alveoli in the lungs are the gas exchange
cells thick; smooth muscle
surface for mammals
cells are elongated (long) cells; thin nuclei;
• total surface area of alveoli in the human the ring of smooth muscle is incomplete;
lungs is estimated at about 70–75 m2 smooth muscle is stained pink.
• mammals have small SA : V ratios compared
b Smooth muscle in the airways contracts
with single-celled organisms and small
to reduce the diameter and relaxes to
multicellular animals
increase the diameter so adjusting the
• the body surface of a mammal is far too small passage of air in and out of the lungs;
to act as a gas exchange surface when demand for oxygen increases,
• the gas exchange surface has to be internal to smooth muscle relaxes to allow more air
avoid too much water loss into the alveoli per breath.
• the skin of a mammal is too thick to be an 3 Each alveolus is very small (only about
effective gas exchange surface. 250 μm in diameter); gas exchange requires
a huge surface area so that sufficient oxygen
Science in Context can diffuse into the blood and carbon
dioxide can diffuse out. Diffusion is a passive
Students could consider the following questions:
process relying on maintaining concentration
• What diseases do you think doctors would gradients between air and blood. Oxygen
want to screen for? is not very soluble in water so large surface
• If you agree that screening should be compensates for this.
compulsory, what should the threshold for ‘at 4 drawing:
risk’ be? lines at top and bottom to show depth of
• Does your answer change if the screening tests epithelium
themselves carry a level of medical risk? cilia indicated by a narrow band at the top
shapes of no more than five nuclei shown
thin lines to show divisions between cells (cell 8 a During exercise the bronchioles are wider
membranes are not visible) to allow more air to reach the alveoli to
quality of drawing: supply the large quantities of oxygen
lines are thin and continuous (not feathery) needed during exercise and to remove
carbon dioxide.
labels:
goblet cell b Five – into and then out of a squamous
droplets of mucus epithelial cell in alveolar wall, into and
ciliated epithelial cell then out of an endothelial cell and then
cilia into a red blood cell.
nucleus / nuclei 9 The thinnest parts of squamous epithelial
cytoplasm cells are only about 25 nm thick; this is
actual depth of epithelium: much less than the resolution of the light
depth of epithelium measured from microscope (200 nm in the best microscope);
Figure 9.6a =35 mm in a light microscope it looks as if the
calculation shown as depth of epithelium on alveolar wall is incomplete as the thinnest
Figure 9.6a divided by magnification parts of the squamous epithelial cells cannot
= 35 000 μm ÷ 550 be seen.
= 64 μm 10 plan diagrams:
5 for details of microvilli and cilia, see Chapter 1 quality of drawing:
both are extensions of the cell surface; lines are thin and continuous (not feathery)
both are surrounded by cell surface membrane; plan diagrams of appropriate size (not smaller
cilia move back and forth microvilli do not; than the photographs)
cilia move fluid over the surface of an lines used to show tissues (no cells drawn)
epithelium (also move small organisms, relative sizes of the tissues shown correctly
e.g. Stentor (Chapter 18)); no shading
cilia have a 9 + 2 arrangement of microtubules
microvilli do not; labels for the trachea:
microvilli increase surface area of cell surface lumen
membrane for absorption cilia are not used ciliated epithelium
for absorption. mucous glands (between epithelium and
cartilage)
6 some examples: (C-shaped / incomplete) ring of cartilage
cell surface membrane (only 7 nm thick so not smooth muscle between ends of cartilage ring
visible in LM) labels for a bronchus:
mitochondria lumen
Golgi apparatus ciliated epithelium
rough endoplasmic reticulum / smooth mucous glands (between epithelium and
endoplasmic reticulum cartilage)
ribosomes blocks of cartilage
nuclear pores smooth muscle
microtubules
annotations:
7 a Mouth/nostril → nasal cavity → cartilage stained purple in trachea
pharynx → trachea → bronchus → terminal cartilage stained blue in bronchus
and respiratory bronchioles → alveolar smooth muscle stained red
duct → alveolus → epithelium → connective epithelia stained purple
tissue (elastic fibres) → endothelium of trachea circular in cross section, bronchus
capillary → plasma → red blood cell not circular
b Large surface area; thin epithelium
(e.g. 25 nm at thinnest), therefore short Reflection
diffusion distance between air and blood; This planning activity is a good opportunity to
well supplied with many blood capillaries. apply some principles of practical investigative
Not... thin membrane because all cell work covered in Chapters 2, 3 and 4 to a more
surface membranes are about the same complex example.
thickness, e.g. 7–10 nm.
Points that should be considered in a discussion: points as indicated by the bold semicolons, e.g.
• choice of subjects, e.g. athletes that compete in AVP ; ; means award a maximum of 2 extra marks.
different sports = independent variable ORA means ‘or reverse argument’ and is used
• choose athletes of same sex and age when the same idea could be expressed in the
• choice of parameters to measure – between pH2 and pH5 ORA’ means accept
question mentions breathing rate, depth ‘activity decreases between pH5 and pH2’.
of breathing, oxygen uptake, pulse rate
and oxygen saturation of blood entering max. This indicates the maximum number of
capillaries = dependent variables marks that can be given.
• number of different intensities of exercise – at 1 C ; [1]

least five may be suggested based on earlier 2 D ; [1]
practical work 3 A ; [1]
• range of intensity of exercise, i.e. light exercise 4 C ; [1]
to strenuous exercise; the most strenuous
exercise should not be more extreme than 5 a i A squamous epithelial cell ;
subjects can cope with B red blood cell ;
• length of exercise at each intensity C endothelial cell ; [3]
• number of readings for each athlete at each ii D (blood) plasma ; [1]
intensity (to calculate means) b formula:
• process results by calculating means length of line X−Y
actual distance =
length of scale bar
• presenting results as bar charts or line graphs.
× distance represented by
scale bar ;
correct
measurement of the line
The mark schemes, suggested answers and X−Y = 42 mm
author(s). In examinations, the way marks would actual distance = (42 ÷ 13) × 10 ;
be awarded to answers like these may be different. actual distance = 32 μm ; [3]
c (very) large number forming a large
Notes about mark schemes surface area ;
squamous epithelial cells are very thin to
answer.
give short diffusion distance ;
surrounded by capillaries so well supplied
should be rejected.
with blood ;
capillaries are very close to the squamous
/ This indicates an alternative answer for the same epithelium so short diffusion distance ;
well ventilated so air constantly refreshed ;
ventilation maintains concentration
gradients for oxygen and carbon dioxide ;
Underlining This is used to indicate essential [max. 4]
[Total: 11]
6 a i P ciliated epithelial cell ;
provided the essential meaning is the same, and is R goblet cell ; [2]
used where students’ responses are likely to vary ii S cilium / cilia ;
more than usual.
T mitochondrion ;
U Golgi
body / Golgi apparatus /
Golgi complex ;
are relevant. But accept only as many additional W nucleolus
; [4]
b i (T / mitochondria) provide, energy / mucus and pathogens swallowed ;

ATP ; destroyed by acid in stomach ;
for
movement of cilia ; [2] macrophages / phagocytes, in the
ii (U / Golgi body / AW) packages alveoli ;
proteins into vesicles ; engulf and digest any pathogens ; [max. 5]
for
secretion ; [2] c elastic fibres (to max. 3)
c formula: stretch / expand, on inhalation and recoil
length of diagram of cell ;
actual length = on exhalation ;
magnification
length of diagram of cell R contraction

P = 80 mm = 80 000 μm (stretch) to increase, surface area for, gas
actual length = 80 000 ÷ 750 ; exchange (by diffusion) ;
= 107 μm ; [3] (stretch) to increase volume of air held in
A P = 80–82 mm, actual length
alveoli ;
= 107–109 μm (recoil) to help, expel air / force air out ;
d cell P – cilia beat / move back and forth ; A expel carbon dioxide
move mucus ; prevent alveoli, bursting / breaking apart /
upwards / towards throat ; AW ;
cell R – secretes mucus ; smooth muscle (to max. 3)
mucus traps, dust / bacteria / viruses / contracts to decrease the, diameter /

pollen / AW ; width, of the (named) airways ;
prevents their entry to, alveoli / gas A trachea / bronchi / bronchioles

exchange surface ; [max. 4] relax to increase the, diameter / width, of
[Total: 17] the (named) airways ;
7 a relax to increase volume of air into lungs

Structure Trachea Respiratory during, breathing / ventilation ; [max. 5]
bronchiole [Total: 15]
smooth ✓ ✗
8 a i oxygen diffuses down its concentration
muscle gradient ;
ciliated ✓ ✓
from alveolar air into, blood / red
epithelium
blood cells ;
mucous ✓ ✗
gradient = 13.9 kPa → 5.3 kPa / 8.6 kPa ;
glands
carbon dioxide diffuses down its
cartilage ✓ ✗
concentration gradient ;
elastic fibres ✓ ✓
from, red blood cells / plasma, to
Award 1 mark for each row. [5] alveolar air ;
b mucus secreted ; gradient = 6.0 kPa → 5.3 kPa / 0.7 kPa ;
by mucous glands (in the trachea) / goblet diffusion pathway – across squamous
cells (in trachea and bronchi) ; epithelial cells of alveolus (through
bacteria / viruses / pathogens, stick to connective tissue with elastic fibres)
mucus ; and across endothelial cells of
capillary ; [max. 4]
cilia move mucus, upwards / towards
throat ;
ii oxygen diffuses down its concentration b breathing / ventilation ;

gradient ; introduces, fresh air / atmospheric air ;
from, blood / red blood cells, into, removes, stale air / air rich in carbon
tissue fluid / (respiring) cells ; dioxide ; [3]
c increase:
gradient = 13.3 kPa → 5.3 kPa / 8.0 kPa ; depth of breathing ;
carbon dioxide diffuses down its rate of breathing ;
concentration gradient ; expansion of alveoli to give a larger
surface area ;
from, (respiring) cells / tissue fluid,
diameter of airways ; [max. 3]
into, plasma / red blood cells ;
[Total: 14]
gradient = 6.0 kPa → 5.3 kPa / 0.7 kPa ;
diffusion pathway – across cell
membrane of respiring cells, through
tissue fluid, across endothelial cells of
capillary, across cell surface membrane
of red blood cells (to react with water,
catalysed by carbonic anhydrase –
see Chapter 8) ;
[max. 4]
may be different.
Coursebook answers • Use personal hygiene, e.g. wash hands

Chapter 10 after using the toilet.
• Use antiseptics to reduce chances of
infection through the skin.
Before you start
• Do not share items of personal hygiene,
• How human parasites survive and how they such as toothbrushes and razors.
transfer from one person to another: • Use disinfectants to clean surfaces in
• Parasites are organisms that live in or live bathrooms and kitchens.
on a host. They derive their source of • Make sure that children are vaccinated
energy by feeding on the tissues of the host. according to the programme of
• The discussion might start by dealing vaccination available in your country.
with external parasites of humans, such • Find out which vaccinations are required
as fleas, ticks and lice. These parasites when travelling abroad.
survive by having adaptations for
attaching to the hosts’ skin and hair so are • Take precautions when near wild animals
therefore difficult for the host to remove. and stray dogs and cats, e.g. keep a
distance if they are likely to have rabies
• The parasites covered in this chapter are and do not touch them with bare hands.
internal parasites that live in body spaces
(cholera bacteria) and inside cells (HIV, Other precautions are included in the chapter.
TB bacteria and the malarial parasite).
To survive, these parasites must have Science in Context
adaptations to gain supplies of energy The details of the discussion will depend on how
from the host and must also be able to much you know about modern technology as
evade attack by conditions in the body, applied to medicine and disease control. Some
such as the low pH in the stomach, and ideas which can be researched are:
evade the host’s immune system.
• use of GPS to track outbreaks of disease
• Parasites that cause harm to the host are (see Figure 10.1). Recording where and when
pathogens. If they cause so much harm outbreaks occur can give scientists ideas about
that the human host has a high chance how the pathogen is transmitted
of dying, it is important that they can
transfer to new hosts. • use of electronic communication, e.g. mobile
phones and email, to link health professionals
• External parasites can transfer to new who may be working in remote areas to
hosts when they are in close proximity scientists in research facilities (e.g. universities,
or via bedding. Internal parasites can national and international organisations)
transfer in body fluids, such as blood and
semen. Some are transferred by external • use of databases to store large amounts of
parasites that suck blood. Others may be information about outbreaks
transferred in drinking water or in food. • use of web-based resources for communicating
•• Some ways people can protect themselves information about outbreaks to national and
from infection by harmful parasites: international organisations
• Make sure food is prepared and handled • artificial intelligence to analyse all the data
carefully, e.g. keep uncooked meat in a collected about outbreaks of disease
refrigerator. • use of computer modelling to predict when
• Make sure that food is prepared hygienically. and where outbreaks will happen
• Wash hands before and after preparing • use of DNA sequencing to help identify the
food and before eating. type of pathogen.
Self-assessment questions the malarial parasite. These develop into the

infective stage which enters the salivary glands
1 a Each cell has a nucleus. They also of the mosquito. The parasite is transmitted
have membrane-bound organelles, when the mosquito takes another blood meal
such as mitochondria, Golgi body and from an uninfected person.
endoplasmic reticulum.
8 Plasmodium is eukaryotic so has a nucleus
b Viruses do not have a cellular structure. and membranous organelles (as can be seen
Each virus consists of a nucleic acid core in Figure 10.5). Human red blood cells do
(RNA or DNA) surrounded by a protein not have nuclei as they are lost during their
coat. Prokaryotes have cells with cell development from stem cells. Mature red
walls, cell membranes and cytoplasm. blood cells do not have any membranous
2 Viruses have nucleic acid (DNA or RNA) organelles either. See Chapter 8 for
inside a protective protein capsid. Some are structural adaptations of mammalian red
surrounded by envelopes derived from the blood cells.
cell surface membrane of the cells that they 9 a i Both numbers of cases and numbers
parasitise. Viruses cannot reproduce without of deaths from malaria began to
entering cells (prokaryote or eukaryote decrease from 2002. Between 1999 and
depending on the type of virus) and using 2002, the number of cases was 10 000
their ‘machinery’ of nucleic acid production a year and the number of deaths
and protein synthesis to make new viral about 375 a year. By 2008, the number
particles. Bacteria have cells with all the of cases had decreased to less than
enzymes needed to sustain life, including those 1000 a year and number of deaths to
for hydrolysis of food substances, respiration, 75 a year.
DNA replication and protein synthesis.
ii The decrease in numbers of cases
3 Faeces from an infected person contain Vibrio could be due to better diagnosis of
cholerae. These bacteria are transmitted malaria so people received treatment
to uninfected people in drinking water, without having to be admitted
contaminated food (e.g. vegetables irrigated to hospital. Prophylactic drugs
with raw sewage or food prepared by a may have been provided to those
symptomless carrier), or when washing at risk of malaria in the season
or bathing in contaminated water. This is when mosquitoes are most active.
sometimes called the faecal−oral route of Insecticide-treated nets may have
transmission. been provided to the population so
1013
4 reducing transmission of the disease.
106 = 10 million
Mosquito control programmes
5 Public services, such as provision of clean
may have been started or existing
water and safe removal and treatment of
programmes became more effective.
sewage, are disrupted. People are at risk of
drinking water that is contaminated by cholera iii Data could have been collected for
bacteria. Survivors of these natural disasters the number of people who were
often do not have access to proper sanitation, diagnosed with malaria and the
clean water or uncontaminated food. number of people who were treated
for malaria without attending
6 The visitor can drink bottled or boiled water
hospital.
and avoid eating salads and raw vegetables.
If the person is visiting a place where there b The results of the initial tests may be false.
is an outbreak of cholera or is going to work Results that suggest someone is infected
in places where taking the precautions listed by Plasmodium when in fact they are free
above is likely to be difficult, then they should of the disease are known as false-positive
receive the cholera vaccine. If their stay is results. Providing them with drugs is an
going to be longer than two years, they should unnecessary expense.
receive a booster as the vaccine only gives
short-term protection.
7 When a female Anopheles mosquito bites an
infected person, she takes up some gametes of
10 Factors that make malaria difficult to control small samples of the population, for
include: example the people who are tested
• the resistance of mosquitoes to for HIV.
insecticides 13 Practise safer sex (e.g. use condoms); do not
use unsterile needles; have one sexual partner;
• the difficulty of controlling the breeding
do not donate blood if at risk of HIV infection;
of mosquitoes because they lay eggs in
do not use prostitutes (male or female); have a
small bodies of water
blood test to find out if you are HIV+.
• the resistance of some strains of 14 HIV is a blood-borne virus; blood donations
Plasmodium to anti-malarial drugs such may not be screened or heat-treated for HIV.
as chloroquine and mefloquine.
15 It is important for people to know whether
11 People can avoid being bitten by mosquitoes, they are living with HIV so that they can
sleep under nets impregnated with insecticide, make sure that they reduce the chances of
use repellents and use anti-malarial drugs transmitting the virus to others.
as prophylactics (but not those to which
16 a some suggestions:
Plasmodium is resistant).
• incidence of TB / number of new cases
12 a i 27.7% / 28%
of TB per 100 000 people per year = 154
ii ‘Living with HIV’ means people per 100 000 people per year for 2018
who have been infected with HIV,
• number of new cases of TB found to
including those who have symptoms
be living with HIV per 100 000 per
of AIDS and those who show no
year = 15 per 100 000 people per year
symptoms at all.
for 2018
b i The estimated number of people living • mortality rate / number of deaths
with HIV has increased by 28% / from from TB per 100 000 people per year
28.9 million to 36.9 million / by = 17 deaths per 100 000 people per
8 million between 2000 and 2017. year for 2018
The estimated number of people b some suggestions:
receiving treatment has increased
by 2613% / from 0.8 million to • number of people diagnosed with
21.7 million / by 20.9 million between TB who started treatment within a
2000 and 2017. specific year
• number of people who completed
The estimated proportion of people
treatment successfully within a
living with HIV and receiving
specific year (e.g. 2018)
treatment has increased from 0.03 to
0.59 between 2000 and 2017. • length of time each person who
was treated successfully was on the
Apart from 2016 there has been treatment programme (this could be
an increase year on year for the used to calculate the median length
numbers estimated to be living with of time)
HIV. The estimated numbers and
the proportion of people receiving • number of people who started the
treatment increased year on year. treatment programme who did not
conclude it (because they failed to
ii Many people who are infected with collect drugs / take drugs under
HIV have not been diagnosed. supervision / died / other reasons)
Many who have been diagnosed
may not have been recorded by 17 HIV/AIDS decreases the number of
health authorities. Countries may T-lymphocytes, weakening the ability of
underreport the numbers as they have the body to mount an effective immune
not collected sufficient data. Countries response against HIV and other pathogens.
may also overreport the numbers About one-third of the human population
perhaps in order to receive more is infected with M. tuberculosis, and this
funding from international donors. may progress to cause the symptoms of TB
The numbers may be estimated from if the immune system is weakened by HIV
infection.
18 some suggested precautions: 22 a he more frequently antibiotics are used,

T
• Avoid close contact with people known to the more frequently resistant bacteria
have active TB, for example avoid staying will be selected for. If antibiotic use is
in hostels where such people sleep. infrequent, then other selection pressures
will be more important in bacterial
• Only consume pasteurised, sterilised or populations, decreasing the likelihood of
UHT milk and milk products made from resistant bacteria surviving.
these types of milk.
b hanging the antibiotic changes the
C
• Those at high risk of developing TB selection pressure. Different strains
should have a tuberculin skin test to see of bacteria will be selected for when a
if they are infected with Mycobacterium different antibiotic is used, decreasing the
tuberculosis or M. bovis before they leave. likelihood of a resistant strain for each
The test should be repeated when they antibiotic becoming widespread.
return to see if they have contracted the
disease while travelling. c I t is far less likely that any individual
bacterium will be resistant to two antibiotics
• Consult a medical professional to see if than to any single antibiotic. Using two
they should be given the BCG vaccine. antibiotics together therefore decreases the
19 Viruses do not have targets for antibiotics; chance of any bacteria surviving.
for example, viruses are not cells, so they have 23 B and E. These have inhibition zones larger
no cell walls. Also they do not have the cell than the minimum required to be in the
machinery for making proteins – they use the sensitive range. These antibiotics could be
ribosomes and enzymes of their host cells used together.
to make their proteins. The antibiotics that
we use to control bacterial infections do not
interfere with human proteins, so none of
Reflection
them will inhibit the reproduction of viruses. Some points that are likely to be made in the
presentation:
20 some ways in which bacteria can resist the
effects of antibiotics: • Many people are becoming infected with
antibiotic-resistant strains of bacteria.
• a thick cell wall that is impermeable to
antibiotics • Data to support this statement should be
included, especially for TB but for other
• membrane proteins that inactivate
bacterial diseases as well.
antibiotics
• Reasons for the increase in antibiotic
• enzymes that catalyse the breakdown
resistance should be listed – see this chapter
of antibiotics (e.g. β-lactamase enzymes
and supplement with research to find other
including penicillinases)
reasons.
• membrane proteins that pump antibiotics
• Examples are using antibiotics when they are
out of the cell
not necessary (e.g. to treat viral diseases) and
• changing the part of the protein to which using antibiotics that are not suitable for the
the antibiotic binds so this is not possible treatment of the bacterial diseases concerned.
21 MRSA evolved because antibiotics are used • Some strains of bacteria are very difficult to
in hospitals and act as a selection pressure. treat and some cannot be treated with any
Also there has been transfer of genes between antibiotics.
different types of bacteria, for example
• Examples are methicillin-resistant
Staphylococcus aureus and Enterococcus
Staphylococcus aureus (MRSA), Carbapenem-
faecalis, which is an intestinal bacterium.
resistant Enterobacteriaceae (CRE) and
E. faecalis was the source of vancomycin
Clostridium difficile.
resistance in S. aureus. MRSA is common in
prisons because many people are kept in close • Antibiotics act as an agent of natural selection
proximity and a disease is easily transmitted (see Chapter 17).
once it is present in such a community. • No new class of antibiotic has been developed
since 1987, although teixobactin, discovered
in 2016, could give rise to a new class of 1 A ; [1]

antibiotics. 2 C ; [1]
• Consider strategies to cope with antibiotic 3 D ; [1]
resistance, for example not using certain
antibiotics for a long time, rotating 4 C ; [1]
antibiotics, etc. 5 a unprotected sexual intercourse ;
• Include strategies for developing new sharing needles (between intravenous drug
antibiotics, for example use of genome users) / reuse of unsterilised needles ;
sequencing and designing new proteins to (via) blood transfusion / blood products ;
inhibit processes that occur in bacteria.
(mother to child) across the placenta / at
birth / in breast milk ; [max. 3]
b doctor’s / hospital, records ;
comments that appear here were written by the tests for HIV status (e.g. at antenatal
author(s). In examinations, the way marks would clinics for pregnant women) ;
be awarded to answers like these may be different. death certificates ;
data recorded by (named), national /
Notes about mark schemes international, organisations (e.g. World
A or accept indicates an alternative acceptable Health Organization) ; [max. 3]
answer.
c determine how numbers of people
R = reject. This indicates a possible answer that infected are changing ;
should be rejected.
see where medical resources should be
; The bold semicolon indicates the award of 1 mark. targeted ;
/ This indicates an alternative answer for the same e.g. drugs for treating HIV infection ;
monitor success of HIV/AIDS programmes:
( ) Text in brackets is not required for the mark. in reducing spread of HIV infection ;
Underlining This is used to indicate essential in treating people who are HIV+ so they
word(s) that must be used to get the mark. do not develop AIDS ;
AW means ‘alternative wording’. It is used to to see if more education is required ;
indicate that a different wording is acceptable to provide support to national / regional
provided the essential meaning is the same, and is health organisations ;
AVP ; ; [max. 3]
more than usual.
730 000
AVP means ‘additional valid point’. This means d i = 0.029
25 500 000
accept any additional points given by the student ratio = 0.029 : 1 ; [1]
are relevant. But accept only as many additional ii better health care in North America ;
points as indicated by the bold semicolons, e.g. better diagnosis, so people who
AVP ; ; means award a maximum of 2 extra marks. are tested as living with HIV start
ORA means ‘or reverse argument’ and is used treatment early ;
when the same idea could be expressed in the more affluent countries, so
reverse way. For example: ‘activity increases antiretroviral drugs available to (nearly)
between pH2 and pH5 ORA’ means accept all people who are living with HIV ;
‘activity decreases between pH5 and pH2’. AVP ; [max. 3]
max. This indicates the maximum number of [Total: 13]
marks that can be given.
6 a female Anopheles (mosquito) ;
takes a blood meal from an infected person ;
transfers, parasite / pathogen / 7 a bacteria pass out in faeces of infected

Plasmodium, in saliva when takes a blood person ;
meal from an uninfected person ; [3] carried in, water / food, consumed by
b decrease in, number / concentration, of uninfected person ; [2]
red blood cells ; b poor sanitation ;
less haemoglobin to transport oxygen ; not enough clean drinking water ;
increase in risk of anaemia ; poverty ;
more likely to be, tired / fatigued ; lowered immunity / malnutrition / HIV
AVP ; [max. 3] infection ; [max. 3]
447
c i osquito nets, reduce chances /
m c i × 100 = 1.08 ; [1]
41 421
prevent, mosquitoes, feeding on ii treatment for cholera involves supply
humans / taking blood meals ; of oral rehydration therapy ;
osquitoes are killed by insecticides
m and provision of safe drinking water ;
(on nets / on internal surfaces of
houses) ; etter response to emergencies (in
b
some countries) ;
insecticides are long-lasting so, nets do
not need to be renewed often / houses e ffectiveness of response may depend
do not need to be sprayed often ; on number of cases ;
children (under 5) are, most r ef to very high number of cases in
susceptible to malaria / more likely to Haiti ;
die from malaria ; ay depend on remoteness of regions
m
drugs kill, Plasmodium / malarial affected by cholera ;
parasite, when it enters the body ; r ways in which, emergency supplies /
o
rainy season is when mosquitoes breed ; personnel, can reach affected areas ;
osquitoes / Anopheles / vector, breeds
m r ef to high case fatality rates in,
in small pools of water ; Nigeria / Somalia ;
(therefore) higher risk of transmission ; se of data to compare case fatality
u
AVP ; [max. 4] rates in individual country with
global rate ; [max. 3]
ii provision of, nets / insecticides / drugs,
is dependent on funding ; iii cholera is a serious disease ;
availability of, health workers / d
eath can occur very quickly after
volunteers, to distribute, nets / drugs ; infection ;
availability of workers to spray s preads quickly in population
buildings ; (especially after a disaster) ;
ability to reach, all / most, of the deaths are avoidable ;
population ; if oral rehydration therapy (ORT) is
A refs to infrastructure such as available immediately ;
roads / transport
d
ata is useful to predict, situations
mosquitoes become resistant to / places, where cholera may occur ;
insecticides ; WHO can coordinate responses to
need to be several insecticides so the outbreaks ; [max. 3]
same one is not used in the same d i infected person travelled from an area
places year after year ; with an outbreak of cholera ; [1]
nets have to be, looked after carefully /
ii water supply is not contaminated with
kept intact / kept undamaged ;
(human), sewage / faeces ;
P lasmodium becomes resistant to drugs ;
piped water / water supply is treated to
AVP ; ; [max. 3] kill bacteria ;
[Total: 13]
V. cholera destroyed in sewage poor access to health care ;

treatment ; [max. 2] poorly organised treatment for people
e cholera outbreaks occur after natural with TB ; [max. 5]
disasters before medical aid can be [Total: 13]
provided / AW ;
9 a i as antibiotic use increases so does the
e.g. during wars / civil unrest, when
percentage of resistant bacteria ;
medical aid cannot be provided ;
a ccurate data quotes for a minimum
oral rehydration therapy is not started
of two countries taken from the
soon enough ;
scatter graph ;
death occurs within 24 hours if no
e .g. country [4] 13 units and 3%,
treatment provided ; [max. 2]
country [19] 38 units and 42% ; [2]
[Total: 17]
ii either
8 a i ycobacterium tuberculosis ;
M
a minimum of any two countries with
A Mycobacterium bovis [1]
similar antibiotic use, but different
ii infected person, coughs / sneezes / percentage resistance ;
spits ;
or
aerosol / droplets, containing bacteria,
a minimum of any two countries with
breathed in by uninfected person ; [2]
similar percentage resistance, but
b i idea that the total populations of different antibiotic use ;
the five countries are different ;
and
allows valid comparisons between
a ccurate data quotes for a minimum
the countries ; [2]
of two countries to support ;
ii number of new cases / incidence,
e .g. any two countries with antibiotic
of TB increased from 1990 in all
use between 20 and 30 units show
countries ;
antibiotic resistance between 15%
between 2000 and 2005 numbers and 33% ;
of new cases, reached a maximum /
e .g. any two countries with antibiotic
remained constant ;
resistance between 10% and 20% have
except in Belarus which reached antibiotic use between 2 and 20 units ;
maximum number before 2000 ; [2]
number of new cases remained b
examples of steps to reduce antibiotic
constant and then decreased ; resistance:
except in Belarus where decrease did doctors should not prescribe antibiotics
not continue to 2013 ; for viral infections ;
use of figures for numbers of new antibiotics should not be used as
cases with year(s) to illustrate any of preventative medicines ;
the points above ;
antibiotics should only be used (for
(minimum of two data quotes from treatment) when necessary ;
the graph, e.g. two countries for the
doctors / hospitals, should use the most
same year or one country for two
effective antibiotic(s) ;
years) ; [max. 3]
e.g. carry out antibiotic sensitivity tests (see
iii t ransmission where there is,
Figure 10.17 and ESQ3) / find the minimum
overcrowding / poor housing ;
inhibitory concentration (see ESQ10) ;
high rates of transmission are linked
carry out genetic tests to find resistance
with poverty ;
genes in pathogens ;
ref to drug-resistant forms of TB ;
doctors / health authorities, should ensure
poor ventilation of housing ; people take the correct dose ;
poor nutrition ;
ensure that people complete the course of indicates susceptibility / resistance ;

their antibiotic ; indicates degree of resistance ;
A ensure people follow the instructions ensures a suitable dosage of antibiotic is
ensure people do not use, ‘left-over’ / used ;
other people’s, antibiotics ; AVP ; [max. 4]
antibiotics should, only be supplied on c shape of, growth / ellipse, the same as in
prescription / not be supplied ‘over the the diagram in the question ;
counter’ or for sale on the internet / AW ;
8 μg cm–3 shown in the same relative
use more than one antibiotic (at the same position as on E-test strips in the diagram ;
time) / use antibiotics in combination ;
no growth of bacteria shown at
A ‘a mixture of antibiotics’ concentrations higher than 8 μg cm–3 ;
different antibiotics should not be used all
the time ; ε
D
i.e. some antibiotics should be rotated µg cm−3
so that they are used for a year and then

replaced by a different antibiotic for a while
some antibiotics should be kept to use as
a ‘last resort’ ;
the same antibiotics should not be used
for animals and for humans ; 8
use of antibiotics in, food production /

(livestock) agriculture, should be
reduced ;
use other antimicrobial drugs ;
develop new, types of antibiotics / drugs ;
improve, knowledge of antibiotic
resistance among, healthcare professionals [3]
/ the general population ; d growth only occurs next to E-test strip ;
improve disease prevention methods with from top of E-test strip down to 6 µg cm–3 ;
an example ; (e.g. vaccines / good hygiene [2]
in hospitals) [Total: 12]
break transmission cycle of resistant
bacteria / described example ; (e.g. put
people infected with antibiotic resistant
strains in quarantine)
[max. 5]
[Total: 9]
10 a A 1.5 µg cm ;
–3
B 0.094 µg cm–3 ;
C 0.25 µg cm–3 ; [3]
b ref to ease of reading the E-test strip ;
where edge of, growth / ellipse, intercepts
the test strip ;
gives quantitative results ;
avoids measuring areas of inhibition as
with card discs (Figure 10.17) ;
may be different.
Coursebook answers
Chapter 11 c A person who is blood group A recognises
red blood cells of type B as non-self and
produces anti-B antibodies. These will
Science in Context cause clotting of the transferred blood
The following could form part of the discussion: which could be fatal.
• reasons for hostility to vaccination (e.g. false 2 he lymphocyte nucleus takes up most of the
T
rumours about vaccines used to sterilise cell; there is very little cytoplasm. Neutrophils
children) have a lobed nucleus, with a larger amount of
• reasons for parents being suspicious about cytoplasm. The neutrophil is larger than the
vaccination (e.g. the reported link between the lymphocyte.
MMR vaccine and autism, and the failure of 3 a The width of the largest bacterium is 0.8 μm
vaccines to give immunity in some children);
working
• these reasons have been grouped into four
categories: religious reasons, personal beliefs, length of largest bacterium in Figure 11.3
safety concerns, and requiring more information = 5 mm = 5000 μm
from doctors or other health workers actual width = 5000 ÷ 6000
• the type of evidence that could be used to = 0.8 / 1.0 μm
convince people of the benefits of vaccination
b 8.5 − 10.0 μm
• the sources of this evidence (e.g. as shown in
working
Figure 11.17)
• protection of the individual from vaccine- width of neutrophil in Figure 11.3
preventable diseases = 50 mm = 50 000 μm
• protection of society from vaccine-preventable accept any measurement between 50 and
diseases – the idea that parents are acting 60 mm
altruistically to give immunity to their children e.g. actual width = 50 000 ÷ 6000
to reduce the risk of infectious diseases passing
= 8.3 − 10.0 μm
to those who do not respond to vaccines.
4 The cells have lobed nuclei.
Self-assessment questions 5 The explanation should make the following
1 a Antibodies are produced in the body by two points:
cells of the immune system. • pathogens are organisms that cause
Antibiotics are medicinal drugs that are disease
produced outside the body and are given • antigens are substances, such as proteins;
by mouth or by injection. they are not whole organisms.
Antibodies are (glyco)protein molecules. Pathogens, such as bacteria and viruses, have
Antibiotics have different chemical antigens on their surfaces. Viruses have few
structures and are not all made of one type antigens on their surfaces as they are so small.
of substance as is the case with antibodies. Bacteria have many more. Some pathogens
release substances that are antigens. An
b an example: example is the toxin choleragen, released by
Red blood cells of type A are considered Vibrio cholerae.
to be ‘self’ in a person who is blood group
A, but in a person of blood group B they
are ‘non-self’.
6 The activation of the specific clones of same DNA. The plasma cells will be identical
lymphocytes only happens when antigens on to the original B cell and will therefore all
the surface of the pathogen make contact produce exactly the same antibody molecules.
with the receptors on the surface of B cells. Also the memory cells will be identical, so the
In that sense the pathogen does ‘choose’ the same antibody molecules will be produced
lymphocytes that can destroy it. ‘Choose’ during any subsequent immune response to
suggests that the pathogen actively searches the same antigen.
out the appropriate lymphocytes, which it 12 The cytoplasm of plasma cells is full of
does not. The interaction between pathogen rough endoplasmic reticulum where protein is
and lymphocytes occurs at random as the made. There are Golgi bodies for modifying
pathogen passes through places where there proteins to become antibody molecules and
are large numbers of lymphocytes, such as in packaging them into vesicles for exocytosis.
the spleen and in the lymph nodes. The mitochondria provide energy for protein
7 The B cell receptors give each B cell its synthesis and for moving vesicles to the cell
specificity. The receptors are proteins with a surface membrane for secretion by exocytosis.
specific shape that is complementary to only 13 The secondary immune response is faster and
one antigen. This means that all the B cells with produces a higher concentration of antibody
the same specificity (B cell clone) will become molecules.
active only when that antigen is detected. In
turn this means that only the B cells with the 14 The primary response to an antigen is slow.
greatest chance of producing antibodies that It can take several weeks to produce enough
will attach to the pathogen with that antigen antibody molecules to fight the infection
will be produced. This saves resources (amino effectively. During this time, we usually show
acids needed to make antibodies) and the energy the symptoms of the disease concerned.
needed to make them. The discussion should 15 All antibodies have the same constant region
build on knowledge of protein structure from so they will all be recognised by the same
Chapter 2, enzyme–substrate specificity from receptor on the surface of phagocytes. This
Chapter 3 and cell signalling from Chapter 4. makes it much easier for phagocytes to
8 The analogy must convey the idea that among recognise pathogens coated in antibodies all
a very large group there is a small number of with different specificities, which means, all
items that are complementary to a specific with different variable regions.
antigen. 16 a Each of the four polypeptides has
An example: anti-virus software looks for a a primary, secondary and tertiary
specific electronic virus that is only found in structure.The secondary and tertiary
the devices that have been ‘infected’. structures are visible in Figure 11.9. Each
antibody molecule is composed of four
9 Only cells in clone Y have B cell receptors of polypeptides (two heavy and two light);
the correct specificity. as each molecule is composed of more
10 12.3 μm than one polypeptide it shows quaternary
working structure. Note that quaternary structure
does not mean that there must be four
width of plasma cell in Figure 11.7 polypeptides. Some enzyme molecules have
= 74 mm = 74 000 μm two polypeptides and they show quaternary
accept 74 ± 1 mm structure as well.
e.g. actual width = 74 000 ÷ 6000 b The heavy polypeptides have a chain of
sugar molecules attached.
= 12.3 μm
17 Polysaccharides are made from only a small
accept 12.2 − 12.5 μm
number of different sugars – unlike proteins,
11 During the development of B cells, the DNA which are made from 20 different amino acids.
of the antibody genes is reorganised to give a Polysaccharides would not give the same huge
specific arrangement that codes for a specific number of different molecular shapes in the
antibody. Mitosis produces cells that are variable region of antibodies as is achieved
genetically identical so all the cells in the clone with proteins.
that develops from one B cell will have the
18 Cytokines are small proteins, so they interact 23 a The concentration of maternal antibodies
with cell surface receptors in the same way as increases during pregnancy as they cross
shown in Chapter 4. The diagram should show the placenta. The concentration of these
the activation of T-helper cells and the release antibodies decreases after birth as they
of cytokines to activate B-lymphocytes, are removed from the circulation. This is
T-killer cells and macrophages. The diagram natural passive immunity.
can include cell surface receptors on these cells The fetus does not produce its own
that are complementary in shape to the shapes antibodies, because it does not have any
drawn for the cytokines. mature B cells or T cells and develops in a
19 a B cells with receptors complementary sterile environment in the uterus. The infant
to the toxin are activated and divide by produces its own antibodies shortly after
mitosis to form plasma cells and memory birth as it is infected by microorganisms.
cells. The plasma cells secrete antitoxins This is natural active immunity.
that combine with molecules of the b The infant is protected against diseases
diphtheria toxin and make it harmless. If which are endemic and which the mother
there is another infection, then the memory has caught or been vaccinated against. For
cells will be activated and there will be a example, measles is a serious childhood
much faster secondary immune response. infection; the infant is protected for
b T-killer cells with receptors several months by its mother’s antibodies.
complementary to antigens on the surface (Note that the infant will not gain passive
of the measles virus are activated and immunity to any diseases that the mother
divide to form a larger clone of cells that has not encountered.)
recognise the measles antigens. These 24 People may be immune to a disease because
T-killer cells search for any cells that are they have many memory cells which can mount
infected with the measles virus and kill a fast immune response when the pathogen
them so preventing the reproduction of enters their bodies. They can make the specific
the virus within infected cells in the gas antibodies and T cells required to defend
exchange system. themselves immediately the pathogen enters.
20 Immunity to one strain does not provide A bacterium may be resistant to an antibiotic.
immunity to all strains, as they do not all This means that it is able to survive even in the
share the same antigens. presence of the antibiotic. For example, it may
21 Natural immunity is immunity gained produce enzymes, such as penicillinases, that
by being infected (active) or by receiving break down the antibiotic penicillin.
antibodies from the mother across the 25 The primary immune response cannot take
placenta or in breast milk (passive). place as soon as the antigen enters the body.
Artificial immunity is immunity gained This is because there are very few cells in
either by vaccination (active) or by injecting the B cell and T cell clones that recognise
antibodies (passive). this specific antigen. First the antigen has
22 Artificial active: antigens are introduced into the to come into contact with the lymphocytes
body by injection or by mouth, and stimulate with cell surface receptors complementary
an immune response by specific B cells and T to the antigen. This takes time as the B and
cells. This provides long-term immunity but is T cells are scattered throughout the body in
not immediate, as the immune response takes the blood and in lymphoid tissue. Once the
several weeks to become effective. specific cells are activated (clonal selection),
it takes time for them to divide by mitosis
Artificial passive: antibodies are injected into (clonal expansion). Further time is required
the body to give immediate protection against for B cells to differentiate into plasma cells
a pathogen or toxin. Antibodies are soon and T-helper cells to secrete cytokines to
removed from circulation and no immune activate the immune response. Even more
response has occurred, so this is a temporary time is needed for the plasma cells to carry
form of immunity. out transcription and translation and secrete
antibody molecules into the blood.
The secondary immune response can occur between active and passive immunity and
almost immediately as there are many between natural and artificial immunity.
memory B cells and memory T cells which 29 a
have receptors specific for the antigen. There
is a much higher chance that these cells will Agglutination of red blood cells
recognise the antigen as there are more of Blood
type Mab Mab Mab
these cells scattered throughout the body than anti-A anti-B anti-D
was the case before clonal expansion occurred
in the primary response. A+ ✓ ✗ ✓
B+ ✗ ✓ ✓
26 a The WHO routine immunisation schedule
can be found here (click on ‘Immunization AB- ✓ ✓ ✗
schedules’). AB+ ✓ ✓ ✓
The schedule for the USA is here. O+ ✗ ✗ ✓
The schedule for Malaysia is here.
b It is important to check the cell surface
b The number of cases of measles has antigens of the recipient’s red blood cells to
decreased from 4.25 million in 1980 to find out their blood type. In a transfusion,
0.25 million in 2017. The steepest decrease if the person receives blood of the wrong
came between 1981 and 1987 during the type, then the donor’s red blood cells
same period of time as the immunisation will stimulate an immune response, and
coverage reached 50% of the children who antibodies will be produced which will
received one dose of the measles vaccine. cause agglutination of red blood cells and
Coverage has remained between 70% and could cause the blockage of blood vessels.
90% ever since 1990 and the numbers of This may lead to the death of the recipient.
cases has fallen from 1.5 million since then.
People do not have the capability to
27 a A second dose stimulates a secondary produce antibodies against any cell surface
immune response that increases the antigens, A, B or D, that they possess.
number of memory cells. This makes These are self antigens. They do, however,
it more likely that an immune response possess lymphocytes with the ability to
to an infection by the measles virus is mount an immune response against cell
effective and that the virus does not surface antigens that they do not possess.
spread through the body and symptoms These are non-self antigens. For example,
do not develop. a person with blood group A+ can receive
b High immunisation rates mean that nearly blood of the same blood group but not
all individuals are protected against the any blood with the B antigen. Similarly, a
disease(s) concerned. This gives herd person who is B+ can receive blood that is
immunity (or mass immunity) that also B+ but not any with the A antigen.
protects vulnerable people from the 30 a Monoclonal antibodies are highly specific
diseases. Vulnerable people are those for the protein (or other antigen) that
who cannot be vaccinated or who do not they detect by binding. As hybridomas
respond to vaccines that they are given. can be cultured continuously, there is
Herd immunity reduces the risk of a an unlimited supply of monoclonal
pathogen infecting someone who has no antibodies which makes them readily
immunity, for whatever reason. Most of the available.
vaccine preventable diseases can have very
serious effects. If people are immunised, b In theory, the monoclonal antibodies
they will not catch these diseases and will should only bind with cells that carry
not require medical treatment. This reduces the protein (or other antigen) to which
the burden on health services. they are designed to fit, so the drug that
they carry will be delivered only to these
28 The discussion will probably centre round the cells. This means that less drug is needed
roles of B-lymphocytes and T-lymphocytes than if it simply goes all over the body.
and their specificities for different non-self There is also less chance that the drug will
antigens. It may also deal with the difference adversely affect healthy body cells.
Reflection ORA means ‘or reverse argument’ and is used

Some ideas that could be used in a public health reverse way. For example: ‘activity increases
campaign: between pH2 and pH5 ORA’ means accept
• details of the diseases that are prevented by ‘activity decreases between pH5 and pH2’.
vaccination max. This indicates the maximum number of
• severity of these diseases marks that can be given.
• deaths caused in recent epidemics linked to 1 C ; [1]
low vaccination rates 2 D ; [1]
• protection of children from diseases that used 3 D ; [1]
to be common in childhood and lead to ill
health and loss of schooling 4 A ; [1]
• protection of whole communities as a result of 5 B ; [1]

herd / mass immunity 6 a red blood cells, become ‘worn out’ / do
• evidence from statistics for immunisation rates not live long / last for approx. 120 days ;
and decrease in incidence / number of cases of misshapen / damaged, red blood cells can
vaccine preventable diseases. block capillaries ;
material in red blood cells can be, reused /
Exam-style questions recycled ;
The mark schemes, suggested answers and e.g. amino acids from, haemoglobin /
comments that appear here were written by the other named protein, can be used to make
author(s). In examinations, the way marks would new proteins ;
be awarded to answers like these may be different. e.g. iron in haem groups (of haemoglobin)
used to make new haem groups ;
Notes about mark schemes e.g. phospholipids used to make new
A or accept indicates an alternative acceptable cellular membranes ;
answer.
AVP ;
[max. 3]
b red blood cells attach to surface of
should be rejected.
macrophage ;
endocytosis / phagocytosis ;
1 mark.
cell surface membrane infolds / cytoplasm
/ This indicates an alternative answer for the same extends around red blood cell (as at top of
mark. The alternatives may be separated from the the TEM) ;
membrane fusion to form a (phagocytic)
( ) Text in brackets is not required for the mark. vacuole ;
Underlining This is used to indicate essential red blood cell is enclosed in a vacuole ;
lysosomes fuse with vacuole ;
indicate that a different wording is acceptable (lysosomal) enzymes released into vacuole ;
provided the essential meaning is the same, and is proteases breaks down (named) protein(s) ;
used where students’ responses are likely to vary lipases break down phospholipids ;
more than usual.
AVP ; [max. 6]
accept any additional points given by the student [Total: 9]
7 a Experiment 1 c i a ntigen refers to any substance

30−40% of phagocytic cells (both
that stimulates the production of
neutrophils and macrophages) did not antibodies ;
take up any fungal cells ; a ntibodies are proteins produced
very few phagocytic cells took up more by, plasma cells / (activated)
than four fungal cells ; B-lymphocytes ;
no phagocytic cells took up more than six e ach antibody is specific to an
fungal cells ; antigen ; [3]
Experiment 2 ii s elf refers to antigen(s) within a

person’s body (e.g. those of the ABO
fewer phagocytic cells did not take up any blood group system which they have) ;
fungal cells (than in Experiment 1) ;
a ll the antigens that the immune
15% of macrophages and 30% of system does not recognise as
neutrophils did not take up any fungal foreign ;
cells ;
[max. 1]
more phagocytic cells took up 4 fungal
cells (than in Experiment 1) ; n
on-self refers to antigen(s) that are
more phagocytic cells took up more than not in a person’s body (e.g. those of,
4 fungal cells (than in Experiment 1) ; pathogens / the ABO system that they
do not have) ;
AVP ; ; [max. 5]
a ll the antigens that the immune
b these are the results of an experiment with system recognises as foreign ; [max. 1]
cells in isolation ;
d cell H is a memory cell ;
cells are not in their normal environment
in the body / AW ; remains in, circulation / lymph system /
body ;
behaviour of cells in culture may be
different ; is specific to an antigen on tetanus
bacteria ;
e.g. if no cytokines from T-lymphocytes
to stimulate endocytosis ; responds quickly to another infection by,
pathogen with same antigen / same (strain
e.g. if no antibodies to coat pathogen to of) pathogen ;
facilitate endocytosis ;
as there are a large number / there is a
ratios between pathogen and phagocytes large clone ;
may be different (i.e. not 1 : 1 or 3 : 1) ;
during secondary immune response ;
cells were left for only six hours ;
differentiate into plasma cells ;
phagocytes may need much longer than
this to start carrying out endocytosis ; to give large number of antibody
molecules in short space of time ; [max. 3]
this may be responsible for large number
of phagocytes that did not take up any [Total: 13]
fungal cells ; 9 a phagocyte has
AVP ; ; [max. 3] a lobed nucleus ;
[Total: 8] lysosomes ;
8 a stem cells: larger quantity of cytoplasm ;
divide repeatedly (by mitosis) ;
cytoplasm with granules / granular
for replacement of, (white) blood cells / cytoplasm ; [3]
lymphocytes ; [2] b presentation of antigen(s) by,
b i mitosis ; [1] macrophages / (other) APCs ;
ii plasma cell ; [1] some T-lymphocytes have receptors

complementary to antigen ;
iii antibody ; A immunoglobulin [1]
these are selected ; some children may not receive boosters ;

divide by mitosis ; AVP ; [max. 3]
T-helper lymphocytes secrete cytokines ; [Total: 10]
to activate B-lymphocytes ; 11 a i
= variable region / antigen-binding
X
selected B-lymphocytes divide and site ;
differentiate into plasma cells that secrete Y = constant region ; [2]
antibodies ; ii disulfide ; [1]
T-killer lymphocytes search for cells b transcription (of DNA) ;
infected by, parasite / pathogen ; translation (of mRNA) ;
T-killer lymphocytes destroy host cells assembly of amino acids to make each of
(and pathogen / and measles virus) ; the four polypeptides ;
prevent reproduction of, virus / pathogen ; assembly of polypeptides to make
[max. 6] antibody molecule ;
c B-lymphocytes can be activated by addition of sugar chains (to make
presence of, antigen / pathogen, alone ; glycoprotein) / glycosylation ;
without involvement of macrophages ; antibody molecules packaged in Golgi
B-lymphocytes differentiate into plasma body into vesicles ;
cells ; release of antibodies by exocytosis ;
secrete antibodies (T-lymphocytes do not [max. 4]
secrete antibodies) ; [max. 2] c variable region(s) are antigen-binding sites ;
[Total: 11] the two variable regions (on IgG
10 a i immunity is gained by the transfer molecules) are identical ;
of antibodies from, mother’s blood variable regions, are specific /
during pregnancy / another source ; complementary, to antigen ;
no immune response within the body ; variable regions have different amino acid
antigen(s) / pathogen(s), have not sequences for different antigens ;
entered the body ; [max. 2] 20 different amino acids can be arranged
ii natural passive immunity: to form different shapes ;
antibodies cross the placenta ; disulfide bonds hold polypeptides together ;
in, breast milk / colostrum ; [2] hinge region allows flexibility in binding
b baby has passive immunity ; to antigen ;
antibodies against measles antigens (from constant region for binding to receptors
mother) will interact with, measles on phagocytes ; [max. 4]
viruses / antigens, in vaccine ; d monoclonal antibodies used in diagnosing
so prevent an immune response ; a condition all have the same specificity ;
therefore no memory cells will be each monoclonal antibody detects only

formed ; [max. 3] one antigen ;
c some suggestions: monoclonals can be used to distinguish

between different, pathogens / strains of
difficulty in reaching nearly 100% global pathogens ;
coverage ;
monoclonals can be, labelled / tagged,
some populations difficult to reach ; with flourescent labels / radioactive labels ;
any reason, e.g. living in inaccessible / can locate position of, cancers / infection
dangerous, places ; by pathogens / blood clots ;
some children may not respond to the diagnosis can be much fast(er) than by
vaccine ; other methods ;
comparison with any other method ; ii emits gamma rays, which pass through
e.g. growing pathogen in culture ; soft tissue and so can be detected from
outside the body ;
can detect pathogens that do not grow in
culture ; weak gamma rays, reducing chance of
mutation ;
can be used to detect concentrations of,
antibodies / cells ; short half-life, so no continuing source
of gamma rays ;
any e.g. ; HIV particles / antibodies to HIV
indium has no biological role ; [max. 3]
AVP ;
[max. 4]
iii a dd, a drug / an enzyme to activate a
[Total: 15] drug, to kill cancer cells ;
12 a 2 ; 5 ; 3 ; 1 ; and 4 ; [1] in place of radioactive label ; [2]
b i inds only with tumour-associated
b [Total: 9]
antigen (TAG) glycoprotein in cancer
cells ;
source of gamma rays concentrated
by cancer ;
gamma rays can be detected from
outside the body ; [3]
may be different.
Coursebook answers
Chapter 12 by allowing information to be obtained that could
help others in the future.
Before you start
• Learners should be able to list at least some
energy-requiring processes (e.g. movement, 1 ADP + Pi(H3PO4) + 30.5 kJ → ATP + H2O
active transport). Some may also know about 2 Learners may have various ideas about this.
the need for energy when building up large They should comment on the similarity of
molecules, such as during protein synthesis. using ATP and using money – for example,
• They may be able to outline respiration, and that money exists in small packages (coins and
to write the word equation or a balanced notes), just as ATP carries a small ‘package’
equation for it. of energy, and that money can be spent in
return for services and goods, while ATP can
• They should know that respiration takes place
be ‘spent’ to obtain benefits from energy-
in every cell in the body.
requiring processes. They may also think
about parallels between acquiring money and
Science in Context acquiring ATP.
There are no right answers to these questions. 3 The carbon dioxide diffuses out of the
Some learners may feel that the process is entirely mitochonrial matrix, across the inner and
justified, whereas others may have serious outer membrane of the envelope, and into
misgivings about it. the cytoplasm. It then diffuses across the cell
Reasons for supporting the use of the process surface membrane, through the tissue fluid,
are likely to include allowing the couple to have across the endothelium of a blood capillary.
children while avoiding the chance of a baby being It may then be transported in solution in the
born that will die. blood plasma, as carbaminohaemoglobin, or as
Reasons against it could include: hydrogencarbonate ions. At the lungs, carbon
dioxide diffuses from the capillary, across its
• possible identity issues for the child, if it endothelium, and across the wall of the alveolus.
knows that it has three parents It is moved out of the body in expired air,
• the chance that the mitochondria from the through the bronchioles, bronchus and trachea.
donor could be passed on to the child’s
4 By decarboxylation, citrate, a six-carbon
children (although if the child is a boy, as it
compound, can be converted to five-carbon
was in this case, this is unlikely)
and four-carbon compounds, finally giving
• possible health issues if some of the mother’s oxaloacetate, which can act as an acceptor
mitochondria were accidentally transferred for an incoming two-carbon unit from acetyl
along with her nucleus, so that the child has coenzyme A, giving citrate again.
mitochondria from both its actual mother and
5 a
NAD: a hydrogen carrier molecule: it
the donor – these two types of mitochondria
accepts a hydrogen from one reaction and
might not work well together.
donates it to another
Do not credit vague answers such as ‘We should
not play God.’ b
coenzyme A: a carrier of an acetyl group
from the link reaction to the Krebs cycle
Similarly, the issue of the parents not agreeing
to follow up on their child is likely to be seen c
oxygen: the final electron acceptor and
differently by different learners. Some may entirely hydrogen ion acceptor in oxidative
support them, while others may consider that they phosphorylation: the oxygen is reduced to
should ‘give back’ to the scientists and to society water
6 Learners will devise their own role play. reaction and the reactions of the Krebs
For example, some learners could stand in cycle; permeability of the outer membrane
two lines, facing one another, to represent to allow movement of named substances
the inner mitochondrial membrane and the into and out of the mitochondrion; relative
carriers in it. The three learners representing impermeability of the inner membrane, to
reduced NAD can separate; the ‘electron’ prevent hydrogen ions moving through it
moves along the carriers, while the ‘proton’ is too easily and to enable the build-up of a
pumped to the other side of the membrane; concentration gradient for them; presence
when the ‘electron’ arrives at the end of the of carriers and ATP synthase in the inner
chain, the proton moves back through a membrane, for oxidative phosphorylation;
channel in ATP synthase (played by other increased surface area of inner membrane
learners) in the membrane; this causes a (cristae) to allow for large numbers of
‘phosphate’ to link to an ‘ADP’ to form carriers and ATP synthases; presence of
‘ATP’ – someone can make a loud bang at this ribosomes and DNA for protein synthesis,
point – while a learner representing oxygen to provide some of the enzymes and other
grabs the electron and proton to become a proteins required.
water molecule. 8 D
7 Annotations should include: presence of 9 A possible table could look like this:
enzymes in the matrix to catalyse the link
Feature How this helps rice to survive with its roots submerged in water
stem grows quickly when stem stays above the water, so it can obtain carbon dioxide for
ground is flooded photosynthesis and oxygen for respiration, from the air
roots (and stem) contain oxygen can diffuse rapidly through the stem and into the roots,
aerenchyma allowing them to obtain enough oxygen for aerobic respiration
ethanol fermentation in root cells are able to synthesise some ATP in anaerobic conditions, if
roots oxygen supply is insufficient
10 C18H36O2 + 26O2 → 18CO2 + 18H2O + energy Notes about mark schemes

RQ = CO2/O2 = 18/26 = 0.69 A or accept indicates an alternative acceptable
answer.
Reflection R = reject. This indicates a possible answer that
Learners are likely to think of the envelope, made should be rejected.
up of an inner membrane (from the invading ; The bold semicolon indicates the award of
prokaryote) and an outer membrane (from the 1 mark.
original cell); the presence of DNA and ribosomes
in the mitochondrion. Some learners may like to
use the internet to research further evidence for
this hypothesis. The development of this symbiotic
relationship would give the original cell access to ( ) Text in brackets is not required for the mark.
the aerobic pathways provided inside the invader – Underlining This is used to indicate essential
so that it can now carry out aerobic respiration word(s) that must be used to get the mark.
and make much more ATP than it was previously
able to. This would give it a great advantage over
cells lacking this ability.
Exam-style questions more than usual.
The mark schemes, suggested answers and AVP means ‘additional valid point’. This means
comments that appear here were written by the accept any additional points given by the student
author(s). In examinations, the way marks would that are not in the mark scheme, provided they
be awarded to answers like these may be different. are relevant. But accept only as many additional
points as indicated by the bold semicolons, e.g. 3 a provide hydrogen to reduce NAD and
AVP ; ; means award a maximum of 2 extra FAD ;
marks. reduced carriers pass to electron transport
ORA means ‘or reverse argument’ and is used chain ;
when the same idea could be expressed in provide energy for ATP synthesis in
the reverse way. For example: ‘activity oxidative phosphorylation ;
increases between pH2 and pH5 ORA’
means accept ‘activity decreases between pH5 refer to chemiosmosis ; [max. 3]
and pH2’. b i increasing the concentration of
max. This indicates the maximum number of aluminium ions from 0 to 40 µmol
marks that can be given. increases rate of fumarate production ;
1 a Lipid has more hydrogen atoms per increases from 40 to 120 µmol have
molecule than does carbohydrate ; little effect ; [2]
most energy liberated in aerobic ii aluminium binds to enzyme / refer to
respiration comes from the oxidation cofactor ;
of hydrogen to water ; [2] optimises shape of active site ; [2]
b [Total: 7]
volume of carbon dioxide given out
in unit time
RQ = ;;
volume off oxygen taken in in unit time
or
moles / molecules of carbon dioxide
given in unit time
RQ = ;;
molees / molecules of oxygen taken
in in unit time
[2]
c Respiratory substrate RQ
carbohydrate ; 1.0
lipid ; 0.7
protein ; 0.9 [3]
3
17.5 cm
d i RQ =
25 cm 3
= 0.7 ; [2]
ii lipid ; [1]
e C6H12O6 + 6O2 → 6CO2 + 6H2O + energy ;
6CO2
= 1.0 ;
6H2 O [2]
[Total: 12]
2 1 air spaces ;
2 aerenchyma ;
3 roots ;
4 oxygen ;
5 ethanol fermentation ;
6 ethanol ;
7 ethanol dehydrogenase ; [7]
may be different.
Coursebook answers
Chapter 13 • show the membranes inside the chloroplast
• have label lines drawn with a ruler, with the
Before you start end touching the structure being named
• include labels to envelope, lamellae,
This question determines whether or not learners thylakoid membranes, thylakoid spaces,
appreciate that respiration occurs in all cells grana, stroma, ribosomes.
all the time, while photosynthesis takes place
only when in the light. It also tests learners’ 2 Both are surrounded by an envelope,
understanding of the gases used and released contain small circles of DNA, contain small
during these two processes, and how they affect ribosomes, and have a system of membranes
hydrogencarbonate indicator. that provide a large surface area.
The indicator with the leaf in the light will turn The background material of a chloroplast
purple, as the leaf will absorb more carbon dioxide is called the stroma. It contains the enzymes
through photosynthesis than it produces through and other substances required for the light-
respiration. The indicator with the leaf in darkness independent stages of photosynthesis. The
will turn yellow, as the leaf will emit carbon background material of a mitochondrion is
dioxide as it respires. called the matrix. It contains the enzymes and
other substances required for the Krebs cycle.
Science in Context The internal membranes of a chloroplast
form thylakoids, enclosing fluid-filled spaces.
There are no right answers to these questions. Carriers are embedded in these membranes,
Learners may suggest that using protoctists to forming the electron transport chain. In a
produce fuels would lessen the use of fossil fuels, mitochondrion, it is the inner membrane
which would reduce carbon dioxide emissions
and therefore help to slow global warming. They of the envelope that contains the electron
should be able to state that the protoctists would transport chain, in the cristae.
need high light intensity, a warm temperature The membranes inside a chloroplast contain
and a good supply of carbon dioxide. Possible photosynthetic pigments, which are not
reasons for the process not yet becoming profit- present in a mitochondrion.
making are likely to involve the expense of
3 Carotene is orange. It absorbs blue and green
providing carbon dioxide, the difficulty of getting
light and reflects red and yellow light.
the protoctists to produce large quantities of the
desired compounds, and the expense of extracting, 4 Xanthophyll is yellow, so it does not absorb
processing and marketing these. yellow light. Yellow light has wavelengths in
the range 580−600 nm.
Self-assessment questions 5 The composite line would show a broader
peak for the action spectrum than in
1 The diagram should:
Figure 13.7, with the high part of the line
• be large – preferably significantly larger extending further to the right. Similarities that
than the micrograph the learners may identify include the peaks
• be drawn with smooth, single lines at the lower end of the spectrum (within the
• show the envelope as two lines, close wavelengths 425−475 nm and at the higher
together but not touching end (within the wavelengths 625−675 nm).
Differences include the peak for carotenoids
• not have any shading
just above 500 nm in the absorption spectrum,
• show the starch grain which does not show as a high peak in the
• show other small spots action spectrum – this could be because
there is not as much carotenoid pigment e From A to F, the limiting factor is light;
as chlorophyll in a plant, and so it has less you can tell this because increasing
influence on the action spectrum. the light intensity increases the rate of
6 In mitochondria, the energy for the photosynthesis.
production of ATP comes from oxidation f From F to G, either temperature or
reactions. In chloroplasts, the energy for the carbon dioxide concentration could be the
production of ATP comes from light. limiting factor.
7 No, it is not correct. The carbon dioxide taken 13 a light-dependent stage – this is the stage
in by plants is not broken down to produce that requires light energy to drive the
oxygen, but is incorporated into carbohydrates reactions
within the plant. The oxygen that is released b light-independent stage – this stage uses
comes from water, not carbon dioxide. the kinetic energy of molecules to drive
8 There are no correct answers to this question. its reactions
Learners may suggest a variety of ways in c light-independent stage – this stage requires
which individuals could represent different carbon dioxide for the Calvin cycle to run
compounds within the Calvin cycle and the
reactions between them.
Reflection
9 A
Learners are likely to identify the production
10 Once all the TP has been used up, RuBP of ATP within both organelles and that ATP
cannot be regenerated. is produced using the electron transport chain,
11 In the light, the Calvin cycle can proceed chemiosmosis and ATP synthase.
normally, using reduced NADP and ATP They may be able to state that energy is transferred
from the light-dependent stages. In the dark, from sunlight to carbohydrates by photosynthesis
no more reduced NADP or ATP is supplied. in cells that contain chlorophyll, and then from
RuBP can still combine with carbon dioxide carbohydrates to ATP by respiration in all living
and produce GP, but without reduced NADP cells; energy is then transferred from ATP to fuel
or ATP, this cannot be converted to TP. GP life processes in all organisms.
therefore builds up, and TP levels fall, as some
of it is converted to other substances (including
RuBP). Both level off quickly, as only a small
amount of RuBP can be regenerated, after The mark schemes, suggested answers and
which the whole cycle stops. Once light is comments that appear here were written by the
resupplied, the cycle can run normally again. author(s). In examinations, the way marks would
12 a From A to B, the limiting factor is light; be awarded to answers like these may be different.
you can tell this because increasing
the light intensity increases the rate of Notes about mark schemes
photosynthesis. A or accept indicates an alternative acceptable
answer.
b rom B to C, temperature is the limiting
F
factor; you can tell it is not light because R = reject. This indicates a possible answer that
increasing light intensity has no effect; should be rejected.
increasing temperature does increase ; The bold semicolon indicates the award of
rate – see the line above. 1 mark.
c rom A to D, the limiting factor is light;
F / This indicates an alternative answer for the same
you can tell this because increasing mark. The alternatives may be separated from the
the light intensity increases the rate of rest of the answer by commas.
photosynthesis.
d rom D to E, carbon dioxide concentration
F
is the limiting factor; increasing carbon
dioxide concentration increases rate – see
the top line on the graph. AW means ‘alternative wording’. It is used to
used where students’ responses are likely to vary accepted by DCPIP / methylene blue ;
more than usual. colourless when reduced ;
AVP means ‘additional valid point’. This means shows ‘reducing power’ of chloroplasts ;
accept any additional points given by the student [max. 4]
that are not in the mark scheme, provided they b NADP ; [1]
points as indicated by the bold semicolons, e.g. [Total: 5]
AVP ; ; means award a maximum of 2 extra marks. 3 a cyclic photophosphorylation:
ORA means ‘or reverse argument’ and is used electron emitted by chlorophyll of
when the same idea could be expressed in the photosystem I returns to chlorophyll by a
reverse way. For example: ‘activity increases series of carriers ;
non-cyclic photophosphorylation:
‘activity decreases between pH5 and pH2’.
electron emitted by chlorophyll of
max. This indicates the maximum number of
photosystem II does not return to
that chlorophyll (but is absorbed by
1 a allows chlorophyll and other pigments to photosystem I and electron emitted by
be arranged into photosystems ; photosystem I is absorbed by NADP) ;[2]
provides a large surface area for pigments ; b photophosphorylation:
increases efficiency of light harvesting ; synthesis of ATP using light energy in
allows electron carriers to be arranged photosynthesis in a chloroplast ;
appropriately ; oxidative phosphorylation:
provides structure for proton gradient for synthesis of ATP using energy
chemiosmosis ; released from the electron transport
anchors ATP synthase ; [max. 5] chain in aerobic respiration in a
mitochondrion ; [2]
b
c NAD:
Structural feature Shared by chloroplast hydrogen carrier in respiration ;
and typical
prokaryotic cell NADP:
circular DNA ✓ hydrogen carrier in photosynthesis ; [2]
DNA combined ✗ [Total: 6]
with structural 4 a and b
protein to form
chromosomes
rubisco
CO2 (1C)
active here
ribosomes about ✓
18 nm in diameter
complex ✗
arrangement
of internal
membranes
peptidoglycan ✗ RuBP (5C)
wall GP/PGA (3C)
size ranges ✓
overlap
[6]
[Total: 11]
2 a photolysis of water occurs in light ; triose phosphate (3C)
H+ released ;
[Total: 5]
5 a limiting factor: one factor, of many 6 a absorption spectrum:

affecting a process, that is nearest its a graph of the absorbance ;
lowest value and hence is rate-limiting ;[1]
of different wavelengths of light by a
b light intensity ; compound ;
light wavelength ; action spectrum:
concentration of carbon dioxide ; a graph of the rate of a process ;
temperature ; [4] e.g. photosynthesis at different
c shows that there are two sets of reactions wavelengths of light ; [4]
in photosynthesis ; b number of bubbles shows rate of
a light-dependent photochemical stage ; photosynthesis ;
a light-independent temperature- rate similar at 450 nm (blue) and 650 nm
dependent stage ; (red) ; these are wavelengths that are
photochemical reactions are not affected absorbed by chlorophyll ;
by temperature ; rate, much lower / refer to figures, at
at low light intensities, light intensity is 550 nm (green) ;
the rate-limiting factor ; very little absorbed by any pigment ;
at high light intensities and low [max. 4]
temperatures, temperature is the rate- [Total: 8]
limiting factor ; [max. 5]
[Total: 10]
may be different.
Coursebook answers
Chapter 14
Before you start
Some of the substances that a human liver cell requires and what they are required for:
glucose substrate for respiration

monomer for synthesising glycogen
oxygen required for oxidative phosphorylation
amino acids monomers for synthesising proteins, e.g. liver-cell enzymes, membrane
proteins and plasma proteins
fatty acids substrate for respiration
required for synthesis of triglycerides and phospholipids
vitamins stored by liver cells
some vitamins are used for making NAD and FAD
ions maintain water potential of cytoplasm
water major component of the cytoplasm
solvent for substances in the cytoplasm
required for hydrolysis reactions
phosphate ions required for synthesis of ATP, DNA and RNA
required for synthesis of phospholipids
Some of the waste substances and products from a liver cell:
carbon dioxide product of decarboxylation

urea nitrogenous waste produced from ammonia following deamination of excess
amino acids
plasma proteins transport of ions help to maintain water potential of plasma
Conditions that are kept at optimum levels for the efficient functioning of the liver cell:
temperature kept at/near 37 °C

body temperature is the optimum temperature for enzymes
water potential of surroundings / maintain osmotic balance so cells do not absorb too much water
blood / tissue fluid and burst or lose too much water and dehydrate
pH kept at/near pH7
keep pH of cytoplasm at optimum pH for enzymes
Science in Context
These are some of the ideas that might arise in discussion.
Problem Solution
providing oxygen Solar energy is used to electrolyse water into oxygen and
hydrogen. The hydrogen is vented to the outside.
removing carbon dioxide Carbon dioxide is absorbed by zeolite, a sponge-like
mineral. When exposed to the vacuum of space, the
carbon dioxide passes out.
removing urine Urine is recycled as water. The recycled water is used for
drinking, reconstituting food and using for washing.
removing faeces Recycle faeces into food for astronauts using anaerobic
digestion by microorganisms (not really practical to store
solid waste for returning to Earth).
providing enough food for the outward Take freeze-dried food that is vacuum-packed. It may be
and return journeys and the time spent possible to grow some food – plants or microbes.
on Mars
keeping fit while in a gravity-free Take regular exercise.
environment
maintaining bone health Take regular exercise.
removing sweat from the body Water vapour from sweat is removed from the
air and treated in the same way as urine to make
drinkable water.
Space flight beyond our galaxy would take much longer than the journey to Mars. The discussion could
deal with ways in which humans could enter states of suspended animation, rather like the black bear does
when it hibernates.
Self-assessment questions transfer information from receptors to

the central control and from the central
1 a The immediate surroundings of most cells control to effectors. Information is
in the body is tissue fluid. Blood cells, transferred as nerve impulses travelling
however, are surrounded by plasma. The along nerve cells and as hormones in
composition of tissue fluid is very similar the blood. Effectors are muscles and
to that of blood plasma. See Chapter 8 glands that respond to information
for more about tissue fluid. from the central control by changing the
b Cells function efficiently if they are kept physiological factor.
in a constant environment. Maintaining d Input: sensory information from receptors
constant conditions, such as pH, about changes in physiological factors.
temperature and water potential, ensures This information goes to a control centre.
that enzymes within cells may function at
a constant rate. Output: corrective actions carried out
by effectors that return the physiological
c Changes in external and internal factors, factor to its normal value.
such as temperature, are the stimuli
that are detected by receptors. Each
homeostatic mechanism has a central
control. The hypothalamus is the
central control for many homeostatic
mechanisms. Coordination systems
2 a Purines are nitrogenous bases that have in the basal membranes that pump
two rings in their structure (pyrimidines sodium ions out of the cells.
have one). The purines adenine and iii The basal membranes are folded
guanine are components of nucleotides in to give a large surface for the
DNA and RNA. Adenine is the base in many pump and carrier proteins
ATP (Figure 12.2). in the basal membranes that move
b If carbon dioxide accumulates in the substances out of the cells and into
body, it leads to acidosis and cells are the blood.
damaged if the pH of the blood falls 5 The discussion should centre on three aspects:
below its normal range. Some problems
are: drowsiness, fatigue, confusion, • The water potential of the tissue fluid in
shortness of breath, headaches, sleepiness the medulla of the kidney is low.
and increase in heart rate. If ammonia • The loops of Henle play a role in
builds up in the body, it results in producing tissue fluid with a high
an increase in pH in cytoplasm and concentration of solutes (mainly sodium
interferes with metabolic processes such and chloride ions and urea). It is not
as respiration and with receptors for cell necessary to explain how the loops of
signalling molecules in the brain. It also Henle maintain the high concentration of
causes confusion, tiredness, and possibly solutes in the tissue fluid of the medulla.
coma or death. • The collecting ducts (CDs) are stimulated
3 a glomerular capillaries via the efferent by ADH to become permeable to water.
arteriole Water is reabsorbed by osmosis from the
b plasma proteins urine into the surrounding tissue fluid and
then into the blood so it is conserved in the
c Plasma proteins will increase the solute body. It is necessary to explain how the cells
concentration of the blood plasma, lining the CDs become permeable to water
therefore lowering its water potential and when stimulated by ADH.
increasing the water potential gradient
between the filtrate and the blood. The maximum concentration of urine is
determined by the relative width of the
d osmosis medulla compared with the cortex. Mammals
4 a 80 cm3 that have wide medullas have nephrons with
working long loops of Henle. Mammals with narrow
medullas have nephrons with short loops of
volume of filtrate entering the proximal Henle. The width of the medulla in human
tubules = 125 cm3 min−1 kidneys allows us to concentrate our urine by
percentage of this volume entering loops a maximum of four times the concentration of
of Henle = 64% blood plasma.
64 6 a Flow rate is highest at the beginning
= × 25
100 of the proximal convoluted tubule,
= 80 cm3 where fluid is entering via filtration into
b A large percentage of the water in the Bowman’s capsule. As the fluid flows
fluid is reabsorbed in the proximal along the proximal convoluted tubule, a
convoluted tubule, thus the volume of large percentage of it is reabsorbed, thus
water in which the urea is dissolved decreasing its volume. There is thus less
decreases. This increases the concentration fluid to flow, so less passes a given point
of urea in the fluid. in a unit of time; in other words, its flow
rate decreases.
c i Microvilli give the membrane
in contact with filtrate (luminal This reabsorption continues all along
membrane) a large surface area for the nephron, which is why the flow rate
absorption of solutes and water. continues to drop. The rate of flow
decreases rapidly in the CD, as a high
ii here are many mitochondria to
T
proportion of water may be reabsorbed
supply the ATP required by proteins
from urine here. Remember that the fluid
in the nephrons is filtrate, but by the time If the plasma was too dilute (had a higher
it reaches the CDs it is urine. water potential than the set point) water
b i Glucose concentration decreases would diffuse into the cells so causing
rapidly to zero as the fluid passes them to enlarge, putting pressure on the
through the proximal convoluted cell surface membranes. This might cause
tubule, because all of it is reabsorbed cells to burst. Changes in cell volume
into the blood at this stage. influence cell activities, for example the
efficiency of intracellular enzymes in
ii
Amino acids are also reabsorbed into catalysing reactions.
the blood in the proximal convoluted
tubule. 9 a i L (accept B)

Glucose and amino acids are reabsorbed ii D
by secondary active transport. iii A
iii Urea concentration increases because iv F
water is reabsorbed from nephrons v H (also J)
and CDs.
b The parallel arrangement of loops, CDs
7 Water is an important component of and surrounding capillaries maintains
cytoplasm so needs to be absorbed from the high concentration of sodium (and
the immediate surroundings of cells. In the chloride) ions in the tissue fluid in the
kidney, water is reabsorbed from the filtrate medulla. The tissue fluid has a low water
in the proximal convoluted tubules of the potential, which is lower than the water
nephrons and from the urine in the CDs. The potential of the blood plasma.
phospholipid bilayer is not very permeable
to water, so water channels are required to c
The concentration of filtrate remains
permit the movement of water into cells. constant at 300 mmol kg-1 along the length
of the proximal convoluted tubule. This is
8 a The normal water potential of the blood the same concentration as blood plasma.
is the set point; osmoreceptors compare Although solutes, such as glucose, amino
the water potential of the blood that acids, ions and urea are reabsorbed, so is
flows through the hypothalamus with much water so the overall concentration
this set point. If the water potential is does not change (Figure 14.14). The
less than the set point, then they secrete volume of filtrate, however, decreases
ADH to stimulate the reabsorption of significantly because so much water is
water from CDs in the kidney. This will reabsorbed (see Figure 14.13).
help to restore the water potential of the
blood to normal. The water potential of The concentration of urine in CDs
the blood is an internal condition that is becomes slightly less concentrated if
kept near constant. Keeping physiological there is no ADH produced. Some urea
conditions near constant is homeostasis. is reabsorbed, but no water because the
epithelial cells of the CD are impermeable
b here are many possible ways in which
T to water as the luminal membranes
this flow diagram could be constructed. It have no aquaporins in them. A dilute
should show the following: input (change urine with a concentration of about
in water potential of the blood) to 70 mmol kg-1 is produced.
receptors (osmoreceptor cells), resulting
in secretion of ADH from the posterior When ADH is secreted, the concentration
pituitary gland if water potential is lower of urine in CDs becomes more
than the set point, producing output concentrated. ADH stimulates the
(change in rate of water reabsorption) insertion of aquaporin molecules into
by the effectors (cells of the CDs) and the luminal membranes so water can be
negative feedback to receptors. absorbed by osmosis. By the end of the
CD the concentration of the urine is
c
If the plasma was too concentrated (had a 1200 mmol kg-1, which is four times the
lower water potential than the set point), concentration of blood plasma.
water would diffuse out of the cells so
causing them to decrease in volume.
d i
ADH is released by the posterior to insulin by absorbing glucose; liver cells
pituitary gland into the blood. It respond to glucagon by releasing glucose.
is transported in the blood to the b The blood glucose concentration
basal membranes of CD cells in the fluctuates about a set point. In negative
kidney. ADH binds to receptors on feedback, a change stimulates a response
the membranes. ADH is a peptide that brings things back to normal.
and water-soluble so cannot diffuse In the homeostatic control of blood
through the phospholipid bilayers of glucose an increase in the concentration
membranes. stimulates mechanisms that reduce it
ii ADH stimulates the cells of the CD and a decrease in the concentration
(and also the distal convoluted tubule stimulates mechanisms that increase it.
(DCT)). ADH stimulates cells to These corrective actions restore the blood
move these vesicles towards the cell glucose concentration to its set point.
surface membrane at the luminal 12 a The process is facilitated diffusion.
surface that faces the fluid. The
vesicles fuse with the membrane so b i Muscle cells need their glycogen
that aquaporins are in place. Water is stores to provide glucose for
reabsorbed from the urine as it flows respiration during exercise; there is
through the DCTs and CDs down the no point in them releasing glucose
water potential gradient from urine into the circulation.
to tissue fluid in the medulla. ii Insulin and glucagon are proteins
ADH is a peptide and is water- that cannot cross the cell surface
soluble so cannot diffuse through the membranes of their target cells.
phospholipid bilayer of cell surface There needs to be another substance
membranes. There are receptors on (a second messenger) to transfer their
the surface of the target cells in the message throughout the cytoplasm.
CD. The binding of ADH to these iii Insulin and glucagon both have liver
receptors activates a cell-signalling cells as their target cells. If they had
pathway using the second messenger the same second messenger, they
cyclic AMP (cAMP) [or (c-AMP)]. would both have the same effect,
The final enzyme in the cascade rather than having opposite effects on
phosphorylates the aquaporin glycogen, for example.
molecules in the vesicles leading to 13 The concentrations of insulin and glucagon
the movement of the vesicles towards in the blood are very low. The number of
the luminal membranes of the cells. insulin or glucagon molecules that reach any
10 The following structures are visible in the individual cell is very small. The production
electron micrograph: of a second messenger and activation of
• mitochondria: aerobic respiration; an enzyme cascade amplifies the signal
synthesis of ATP so that the response of the cell is rapid.
This is required to decrease blood sugar
• rough endoplasmic reticulum: protein concentration following the absorption of a
synthesis meal to prevent glucose being excreted and
• nucleus: storage of genetic information; increase blood sugar concentration during
replication of DNA; transcription / fasting or during exercise to make sure that
production of RNA it does not decrease below the critical level at
11 a stimuli: changes in concentration of blood which brain function is impaired and a person
glucose above and below the set point may go into a coma.
receptors: the α and β cells in the islets of

14 Specificity. Test strips contain the enzyme
Langerhans in the pancreas glucose oxidase, which is specific to glucose
and will not catalyse the oxidation of any

effectors: the cells that change the glucose other reducing sugar. Benedict’s solution is
concentration in the blood by absorbing it used to detect the presence of reducing sugars,
from the blood or by releasing it into the
blood; liver cells and muscle cells respond
such as fructose and lactose, and will change 16 Urine collects over several hours so the results
colour with any appropriate reducing agent. of a urine test only show that at some time
15 a i glucose: the glucose concentration was higher than
the renal threshold. Blood tests show the
• non-diabetic: the concentration is glucose concentration at the time of sampling.
always lower than in the diabetic Regular sampling using blood tests can show
and reaches a peak slightly earlier whether the insulin that a diabetic is taking is
• non-diabetic: peak is at 150 mg controlling blood glucose effectively.
100 cm-3; diabetic: peak is at 17 The drawing should show:
220 mg 100 cm-3
• two guard cells with the shapes as in
• non-diabetic: concentration Figure 14.34
returns to normal / concentration
at start after about 45 minutes; • guard cells with thin outer cell wall on
diabetic: concentration does not side facing adjacent epidermal cells and
return to concentration at start thicker inner cell walls facing the stomatal
even after 150 minutes aperture
insulin: • cell surface membrane
• non-diabetic: insulin • nucleus (in at least one of the cells)
concentration increases • cytoplasm
immediately; diabetic: no increase
• chloroplast(s)
in insulin concentration
• mitochondria
• non-diabetic: peak after about
25 minutes; diabetic no peak in • vacuole.
insulin concentration 18 a
Suitable annotations for the drawing of
ii d iabetic: β cells in the islets of the guard cells are:
Langerhans do not respond to • chloroplast and mitochondria provide
increase in glucose concentration so energy for proton pumps
do not release insulin. Glucose is not
absorbed by liver, muscle and adipose • starch grains inside chloroplast are a
cells so remains in the blood, which source of negatively charged malate
is why the concentration increases. ions for neutralising potassium ions
The concentration is greater than • cell surface membranes have proton
the renal threshold so not all the pumps for pumping out hydrogen
glucose that is filtered in the kidney ions to create a negative charge inside
is reabsorbed by proximal convoluted the cell surface
tubules. This explains the gradual
• cell surface membrane has channel
decrease in glucose concentration as
proteins for facilitated diffusion of
the glucose that is not reabsorbed is
potassium, chloride and calcium ions
lost in the urine.
• thin cell wall for expansion of cell

non-diabetic: insulin is secreted
into adjacent epidermal cells
so glucose is absorbed by liver,
muscle and adipose cells where it is • cell walls have no plasmodesmata
converted to glycogen. This explains so that all exchanges of water and
why the glucose concentration ions occur across the cell surface
decreases so rapidly. membrane through carrier and
channel proteins by active transport
b i Insulin is a protein. Its molecules
and facilitated diffusion
would be hydrolysed to amino acids
in the digestive system. • waxy cuticle over outer walls and
ledges to reduce water loss from leaf
ii People with diabetes may use test
when stomata are closed
strips to test their urine or use a
biosensor to monitor their blood • stomatal aperture allows diffusion of
glucose concentration. gases between air in the intercellular
spaces in the mesophyll and the cells and water passes out by osmosis.
atmosphere. The cells become flaccid and close the
b
The flow chart diagram could show this stomata.
sequence of stages:

1 ATPase pumps hydrogen ions out of
Reflection
guard cells Cells that are described in this chapter and some
of the specific features that should be included in
2
decrease in concentration of
each diagram are:
hydrogen ions inside guard cell

3
inside the cell becomes negatively • liver cells:
charged many mitochondria, RER, ribosomes, nucleus
with nucleoli, glycogen granules

4 potassium ion channel proteins open
• endothelial cells of capillaries in glomeruli:

5 potassium ions diffuse into guard cells very thin cytoplasmic extensions with many

6 water potential of guard cells perforations, elongated nucleus, endocytotic
decreases vacuoles for transport across the endothelium

7 water enters guard cells by osmosis • podocytes forming the inner lining of

8 volume of guard cells increases Bowman’s capsule:
long processes with slit pores between them

9 guard cells become turgid
• cuboidal epithelial cells of proximal
10 guard cells curve outwards to open convoluted tubules:
stoma microvilli, folded basal membranes, many
c t night, most plants close stomata
A mitochondria, RER, ribosomes, nucleus with
to reduce the rate of transpiration so nucleoli
conserving water when there is no light • cuboidal epithelial cells of CDs:
energy for photosynthesis and so there is folded basal membranes, many vesicles with
no need to absorb carbon dioxide from aquaporins, RER, ribosomes, nucleus with
the air. nucleoli
During the day when rates of
transpiration are greater than rates of Exam-style questions
water absorption to conserve water and
reduce heat stress. The mark schemes, suggested answers and
A plant is under water stress when the loss author(s). In examinations, the way marks would
of water by transpiration is greater than be awarded to answers like these may be different.
the rate of water uptake. This is likely to
happen on a hot, dry day with high wind Notes about mark schemes
speed. The stomata may close during the
day to conserve water.
answer.
d Abscisic acid (ABA) is produced in times
of water stress. ABA binds with receptors
should be rejected.
on the cell surface membrane that leads
to the inhibition of the proton pumps so ; The bold semicolon indicates the award of
that hydrogen ions are not pumped out 1 mark.
of the guard cells. Channel proteins open / This indicates an alternative answer for the same
to allow negatively charged ions to leave mark. The alternatives may be separated from the
the cells followed by potassium ions. This rest of the answer by commas.
stimulates the closure of channel proteins
that allow potassium to enter the cells.
The concentration of calcium ions within Underlining This is used to indicate essential
the cytoplasm increases and it may be that word(s) that must be used to get the mark.
they act as a second messenger for ABA. AW means ‘alternative wording’. It is used to
The effect of these changes is that the indicate that a different wording is acceptable
water potential increases within the guard provided the essential meaning is the same, and is
used where students’ responses are likely to vary 2 a i the volume of blood pumped out of
more than usual. the heart = 5.6 dm3 min–1
AVP means ‘additional valid point’. This means the volume of blood that enters the
accept any additional points given by the student kidneys is 25% of this ;
= 25 × 5.6 ; = 1.4 dm3 min–1 ; [2]
are relevant. But accept only as many additional 100
points as indicated by the bold semicolons, e.g. ii
the volume of filtrate
AVP ; ; means award a maximum of 2 extra marks. formed = 125 cm3 min–1
ORA means ‘or reverse argument’ and is the percentage of the blood that
used when the same idea could be expressed flows through the kidney that
in the reverse way. For example: ‘activity becomes filtrate
increases between pH2 and pH5 ORA’ means
accept ‘activity decreases between pH5 and pH2’. = 125 × 100 ; = 8.93% ; [2]
1400
max. This indicates the maximum number of iii
the volume of filtrate produced
marks that can be given. in a day = 125 cm3 min–1 × 60 × 24
1 a excretion: = 180 dm3 ;
removal of, nitrogenous waste / urea ; the volume of urine as a percentage
of the volume of filtrate
(so) maintaining a low concentration of
urea in the blood ; = 1.5 × 100 = 0.83% ; [2]
180
osmoregulation: b i
luminal membranes of proximal
removing excess water when the water
convoluted cells ;
potential of the blood (plasma) is too high ; many microvilli ;

reabsorbing water when the water potential
(on the left of TEM) microvilli
of the blood (plasma) is too low ; shown in longitudinal section ;

(so) maintaining the water potential of
(on the right of TEM) microvilli
the blood (plasma) at a near constant ; shown in cross section ;

blood glucose control:
microvilli provide a large surface area
reabsorption of all glucose in filtrate ;
for reabsorption ;
retains glucose in the blood / prevents loss
(large surface for) co-transporter
of glucose in urine ; proteins ; [max. 4]
AVP ; e.g. reabsorption of amino ii
mitochondria provide much, ATP /
acids so helping to maintain constant energy ;
concentration in the blood for active transport / AW ;
[max. 3] sodium-potassium pumps ;
b i A distal convoluted tubule ; selective reabsorption of sodium ions /
B Bowman’s capsule ; sodium ions reabsorbed into the
blood ;
C glomerulus / capillary ;
sodium ions pumped out of cells to
D proximal convoluted tubule ; [4]
create a concentration gradient from
ii cortex ; the lumen into the cells ;
glomeruli / convoluted tubules, are for absorption of, glucose / amino
only found in the cortex ; [2] acids, through co-transporter
iii
distance = 10 mm = 10 000 µm proteins ;
= 10 000 ;
AVP ; e.g. secondary active transport
180 [max. 4]
actual distance = 56 µm ; [2]
c idea of change in permeability to water
[Total: 11] due to ADH ;
to produce a high concentration of urine: body tolerates changes in blood volume,

membranes become permeable ; but not its water potential ; [max. 2]
water moves by osmosis ; e homeostasis is the maintenance of, (near)

constant internal conditions ;
down a water potential gradient ; A high
to low water potential negative feedback:
water moves, out of collecting duct / into a deviation from the set point ;
blood / into medullary tissue / into tissue is detected by a receptor ;
fluid ; a control centre instructs effector to carry
aquaporins in membrane of vesicles ; R out a corrective action ;
‘water channels’ to reverse the change / return factor to
movement / fusion, of vesicles ; R in set point ;
context of wall positive feedback:
to produce a low concentration of urine: any (small) deviation in a factor leads to
membranes become impermeable (to an increase in the change (not a reversal) ;
water) ; [max. 5]
no aquaporins in luminal membranes ; [Total: 13]
water remains in urine ; 4 a i D and G ;
[max. 5] ii E and H ;
[Total: 19] iii J;
3 a hypothalamus ; [1] iv B, F, D and G ;
b 1555 cm (or any answer within the range
3
v E and C ; [5]
1150–1160 cm3 or equivalent in dm3) ; [1] b
glucose is needed inside muscle tissue to
c water was absorbed into the blood (in provide energy for muscle contraction ;
stomach / small intestine) ;
the liver is the store of glucose for the body
the water increases the water potential of [1]
the plasma ; c c ells require a constant supply of glucose
any effect of an increase in water for respiration ;
potential of the plasma on, cells / tissues,
some cells have no supply of glucose
e.g. water enters cells by osmosis / other than from the blood plasma ;
cells will swell / decreases efficiency of
reactions inside cells / cells may burst ;
e.g. red blood cells and neurones do not
store glycogen ;
osmoreceptors detect increase in water
potential ; glucose becomes available when a meal
is absorbed and needs to be stored
ADH not, secreted / released, ; otherwise it is excreted ;
collecting ducts remain impermeable to water ; between meals the concentration
excess water lost in urine ; decreases and needs to be ‘topped
until water potential returns to set point ; up’ from stores of glycogen in the
A return to normal [max. 4] liver ;
d (after absorption of dilute salt solution) if a person’s blood glucose concentration
no change in water potential of blood falls below 60 mg 100 cm–3, they may enter
plasma ; a coma ; [max. 4]
water and salt is not lost in the urine, so [Total: 10]

must remain in the body ; 5 a i glucose concentration may already
giving an increase in volume, of blood or be high ;
body fluids ; if person had eaten within 12 hours ;
effect of sudden increase would protein kinase A is the first enzyme in

not be seen / so there was a sudden an enzyme cascade
increase ; protein kinase A activates
may already be a high concentration phosphorylase kinase ;
of insulin ; [max. 3] active phosphorylase kinase enzyme
ii β cells secrete insulin ; activates glycogen phosphorylase ;
concentration of insulin increases glycogen phosphorylase catalyses the
over first hour after taking the breakdown of glycogen to glucose ;
glucose solution ; glucose diffuses out of the (liver) cell
insulin concentration increases from into the blood ; [max. 6]
60 pmol dm–3 to 300 pmol dm–3 ; [Total: 22]
α cells, do not secrete glucagon / 6 a (near) constant glucose concentration is
secrete very little glucagon ; maintained ;
glucagon concentration, remains glucose concentration is maintained
constant / decreases ; within limits ;
from 42 pmol dm–3 to 36 pmol dm–3 ;
e.g. 65–100 mg 100 cm–3 (3.6–5.8 mmol dm–3) ;
[max. 4]

concentration fluctuates above and below
iii insulin: stimulates / binds to, a mean concentration ;
receptors on, liver / muscle / adipose,
cells ;
glucose concentration is regulated about
a, set point / norm ;
increase in uptake of glucose from
the blood ;
if concentration changes above and below
the set point, corrective actions are taken
more glucose transporter molecules to return it to normal ;
(GLUT4) insert into the cell surface
membrane of muscle cells (not liver
any e.g. of a corrective action ; e.g. storage /
cells) ; breakdown, of glycogen in the liver ;
stimulation of (named) enzymes ; [max. 5]
e.g. glycogen synthase ; b any three factors, e.g.
to increase conversion of glucose to age of the volunteers ;
glycogen ;

sex of the volunteers / equal numbers of
brings about a decrease in the blood males and females ;
glucose concentration ; [max. 5]
body mass / body mass index ;
b i blood glucose concentration

no health problems / not diabetic /
decreases (below 4 mmol dm–3) ;
not taking any medicines (that might
insulin concentration, remains influence response control of blood
constant (at 60 pmol dm–3) / decreases glucose concentration) ;
(below 60 pmol dm–3) ; intake of fluids ;
glucagon concentration increases total mass of food eaten ;
(above 60 pmol dm–3) ;

composition of the rest of the diet (the
glucose concentration then increases non-carbohydrate part) ;
in response ; [4]
ambient conditions, e.g. temperature ;
ii membrane receptor activates G
protein ; levels of exercise undertaken by the
volunteers during the day ;
G protein activates adenylyl cyclase
(in membrane) that catalyses AVP ; ; ; [max. 3]
conversion of ATP to cyclic AMP ; c glucose concentration: 4.25 mmol dm–3 ;
i
cyclic AMP activates protein kinase insulin concentration: 25 pmol dm–3 ;
A by binding to it ;
[2]
ii
effects of high-sucrose diet on blood
sucrose digestion releases as much
glucose concentration compared with fructose as glucose (sucrose molecule
high-starch diet: is glucose + fructose) ;
concentration increased more rapidly fructose may be converted into
(after lunch, dinner and supper) ; glucose to give the higher peaks ;

to a higher peak after three of the
this results in faster release of insulin
meals (not supper) ; into the blood (rather than slower

any comparative data from the release over a longer period of time) ;
graph, e.g. after dinner high-sucrose [max. 6]
diet is 7.25 mmol dm–3, high starch is d the graph should have the same horizontal axis
6.00 mmol dm–3 ; with the same times (0800 to 0800)
after the peaks, glucose concentration no information given for the values for glucagon
decreased more rapidly ; concentration so vertical axis is a line with an

decreased, to lower concentrations ; arrowhead

any comparative data from the glucagon concentration decreases, during
graph, e.g. after lunch high-sucrose meals / when insulin is high ;
diet is 3.75 mmol dm–3, high-starch is increases between meals ;
5.40 mmol dm–3 ;
remains high during overnight fast from

decreased to concentrations below around midnight onwards ; [3]
the fasting values (after 0200) ;
[Total: 25]

effects of high-sucrose diet on insulin
7 a biosensor:
concentration compared with high-
starch diet: a device that uses a biological material

such as an enzyme ;
there is a higher peak after each of

the meals ; to measure the concentration of a
chemical compound ; [2]
any comparative data from the
graph, e.g. after dinner high-sucrose b glucose oxidase ;
diet is 420 pmol dm–3, high starch is immobilised ;
250 pmol dm–3 ;
hydrogen peroxide ;

decreases more slowly after lunch
and dinner ; electric ;

concentrations between meals are proportional ;
lower ; insulin ; [6]

any comparative data from the graph, [Total: 8]
e.g. after breakfast / just before lunch, 8 a increases ; [1]
high-sucrose diet is 20 pmol dm–3, high
starch is 50 pmol dm–3 ; b i concentration of protons in the
stroma decreases (as enter grana) ;
concentrations during night-time fast
are, the same / 50 pmol dm–3 ; [max. 6] shifts equilibrium to the right ; [2]
iii sucrose is a disaccharide, starch is a ii increases diffusion into the
polysaccharide ; chloroplast ;

starch is likely to be in foods that as concentration of ABA–H
take longer to digest / sucrose is decreases ;
digested more quickly ; so maintaining a concentration
in sucrose there is only one glycosidic gradient into the chloroplast ;
bond to break to release glucose [max. 2]
(instead of many in starch) ; c ABA stimulates closure of stomata ;

faster rate of absorption of glucose less water vapour is lost ; [2]
from digestion of sucrose into the
[Total: 7]
blood stream ;
may be different.
Coursebook answers • They talk to people about their experiences,

Chapter 15 such as synaesthesia, and record what they
say. Some scientists have published their case
notes, in the case of Oliver Sacks in books that
Before you start have become bestsellers.
Some of the roles of proteins in membranes: If you research the work of neuroscientists such as
Alan Hodgkin and Andrew Huxley, you may want
• enzymes – since reading Chapter 4 learners
to consider the justification for university students
know about ATP synthase in thylakoid
repeating such work as part of their courses in
membranes (Chapter 13), inner mitochondrial
medicine or neurobiology.
membranes (Chapter 12) and adenylyl cyclase
(Chapter 14)
• hormone receptors such as those for insulin,
glucagon and ADH 1 a
Make an outline sketch of the body and
• cell surface antigens used in cell recognition draw in the organs. It’s a good idea to
indicate the head, thorax and abdomen on
• antigen receptors on B-lymphocytes and
your sketch before drawing in the position
T-lymphocytes
of the organs. Note that the pituitary gland
• channel proteins for facilitated diffusion, e.g. is just below the hypothalamus. You can put
aquaporins for movement of water in most annotations on your drawing to summarise
plant and animal cells information from Chapters 4 and 14 about
• carrier proteins for movement of substances cell signalling and the endocrine system that
between the cytoplasm and the external you should know.
surroundings by facilitated diffusion, co-
transport proteins in phloem companion cells b
Glucagon and ADH have different
and epithelial cells in the proximal convoluted molecular structures. They have different
tubules of kidneys shapes and fit into different cell surface
receptor proteins. There are no receptors
• carrier proteins for active transport, e.g. for ADH on liver cells therefore ADH
sodium−potassium pumps. can have no effect on these cells. (There
are glucagon receptors on kidney cells
Science in Context although these cells do not respond by
The passage mentions several ways in which releasing glucose.)
people study the nervous system. Students
c
The cell surface membrane is a bilayer of
might consider the relative ethics of each of
phospholipids. Steroids are fat-soluble
these types of research, and then consider what
so they can dissolve in these lipids and
kind of research might be most appropriate for
so pass through. Hormones that cannot
investigating the existence of a sixth sense.
pass through the cell surface membrane
• They use invasive methods to carry out are peptides (ADH and glucagon),
experiments. In the middle of the 20th proteins (insulin), amino acid derivatives
century, neuroscientists used nerve cells in the (adrenaline) and glycoproteins (anterior
bodies of living animals to find out how they pituitary hormones). These hormones
transmitted signals are water-soluble and cannot pass
• They use non-invasive methods to record the through the phospholipid bilayer.
activity of the nervous system using electrodes
2 The table should have the following
attached to the body (Figure 15.1) or scanners
headings:
of various sorts.
• Hormone
• Endocrine gland that is site of secretion Active transport by sodium−potassium

(production and release into the blood) pumps in the membrane of the axon.
• Target cells / tissues / organs Three sodium ions are pumped out for
every two potassium ions pumped in, so
• Responses of cells to the hormone this builds up a positive charge outside
• Effects of the hormone on the whole body compared with inside.
3 There are also many negatively charged
organic compounds (e.g. proteins) inside
Feature Motor neurone Sensory neurone
the axon that contribute to the resting
position of at one end of part way along potential.
cell body the cell the axon
d i It is called depolarisation because the
location of grey matter dorsal root axon was polarised so that it had a
cell body of CNS ganglion / near negative charge inside and a positive
receptor charge outside. Now this is altered
direction of CNS to effector receptor to CNS and there is a negative charge outside
impulses and a positive charge inside.
function stimulates transmits ii
Annotations for the rising phase of the
smooth muscle information action potential could be:
to contract and about internal • Voltage-gated sodium ion channel
some glands or external proteins in the membrane open.
to secrete environment
(e.g. adrenaline to CNS • Sodium ions diffuse into the
from adrenal axon down their electrochemical
glands) gradient.
• The potential difference across
4 A good model needs to show the structure the axon membrane changes and
of the myelin sheath as the concentric becomes less negative.
arrangement of the Schwann cells rather
like a roll of paper towels wrapped around • There is a positive feedback
a cardboard tube. Small gaps should be left at this time as depolarisation
between the Schwann cells to represent the stimulates more and more
nodes of Ranvier. The model can be made to voltage-gated sodium ion channel
scale if the width of the nodes and diameters proteins to open.
of axons and Schwann cells are researched. • The threshold potential is
5 An alternative to the pathway shown in reached and so more voltage-
Figure 15.8 is for one neurone to connect a gated sodium ion channel
receptor directly to an effector. Because there proteins open.
are three neurones in the pathway, impulses • The membrane potential reaches
can travel via other neurones in the CNS to +30 mV.
other effectors and also go to the brain where e Annotations could be:
more complex behaviour is controlled.
• Between 1 ms and 2 ms, the axon is
6 a
Resting potentials vary between – 60 mV repolarised.
and –70 mV, so the line could be drawn
anywhere between these two figures. • The voltage-gated sodium ion channel
proteins close (and cannot open for a
b
The inside of the axon has a charge short time).
of –70 mV compared with the outside.
• Voltage-gated potassium ion protein
c
When at rest, the membrane is channels open.
impermeable to sodium ions as there are
no channel proteins that are open to let • Potassium ions diffuse out down their
them in or out. There are a small number concentration gradient to restore the
of channel proteins for potassium ions, resting potential.
but because the inside of the membrane is f about 4 ms
negatively charged they do not diffuse out.
g i
The refractory period is the period iii Neurones either send impulses
of time after the axon membrane or they do not. For example, no
has been stimulated and an action impulses are sent by a sensory
potential begun until the membrane neurone if the receptor potential is
can be stimulated again. You can below threshold. (c in Figure 15.20).
show it on the graph between the Neurones do not have graded
time when the potential difference impulses with action potentials
reaches –50 mV (the threshold for an of different sizes. All the action
action potential) and the time when potentials in Figure 15.20 have the
the resting potential is restored. same amplitude.
ii The refractory period: b I ncreasing the strength of the stimulus
• allows repolarisation produces an increasing receptor
potential. At a low strength, a small
• allows a gap between one action increase results in a relatively large
potential and the next. increase in receptor potential. At higher
h here is sufficient energy in the
T strengths, the increase in receptor
electrochemical gradient for sodium ions potential is less. (The functional
and potassium ions to continue diffusing significance of this pattern, which is found
in and out of the membrane. It is not in most receptors, could be discussed;
necessary for the sodium−potassium it results in a relatively high level of
pump to work to restore the resting sensitivity to low-level stimuli as long as
potential after each action potential. they are above the critical threshold.)
The electrochemical gradients are like c
The greater the strength of the stimulus
a battery that is gradually ‘running applied, the greater the frequency of
down’. The sodium−potassium pumps action potentials generated.
continually ‘recharge’ this battery.
d The length of the refractory period (see
7 Unmyelinated neurones transmit impulses Section 15.2, Nervous communication).
at slower speeds than myelinated neurones.
e Receptors can adjust to a constant
Unmyelinated neurones transmit information
strength of stimulus and reduce the
that does not require a fast response. For
frequency with which they send impulses
example, many of these neurones are
to the CNS. This saves energy in ion
concerned with aspects of homeostasis.
pumping that results from sending
Giant axons transmit impulses very fast and many impulses along a sensory neurone.
are used for coordinating escape reflexes, Changing the threshold potential gives
for example retreating into a burrow when a the CNS information about changes in
predator approaches. environmental and internal stimuli.
8 a i
A receptor potential is an electrical 9 a Exocytosis
potential generated in a receptor
b cetylcholinesterase catalyses the
A
such as a chemoreceptor. It is often
hydrolysis of ACh so it does not remain in
produced by the inflow of sodium
the synaptic cleft continuously stimulating
ions through channel proteins.
the postsynaptic neurone. If molecules of
This causes a depolarisation of
ACh remained in synaptic gaps, muscle
the receptor to give a less negative
cells would be continuously stimulated
potential inside the cell. It does not
to contract – a condition known as
necessarily result in information
tetany.
being sent along a sensory neurone
(c in Figure 15.20). 10 a t the synapse, vesicles of transmitter
A
substance are only present in the
ii The threshold receptor potential presynaptic neurone, not in the
is the smallest receptor potential postsynaptic neurone. Ligand-gated
at which an action potential is receptors for neurotransmitters are
generated (between c and b in only on the postsynaptic neurone
Figure 15.20). (see Figure 15.23).
b epeated action potentials may cause the

R Effectively, the neurone has no more
release of neurotransmitter substance neurotransmitter substance until enough
into the cleft at a greater rate than it can is resynthesised.
be replaced in the presynaptic neurone.
11 This is an example of a table to compare coordination by the nervous system with coordination by the
endocrine system:
Feature Nervous system Endocrine system

structures nerves containing sensory and motor ductless glands containing secretory
neurones cells that produce and release
hormones
use of energy expensive, e.g. sodium / energy cheap as small quantities are
energy potassium pumps in neurones use a produced and transport in the blood
great deal of energy
form of electrical impulses hormones (chemicals)
information
pathway to along neurones in the blood
target tissues
speed of fast slow
information
transfer
duration of short-lived, e.g. muscle contracts for a usually slow and longer lasting (some
effects short time are rapid, e.g. response to adrenaline)
target area localised – only the area immediately at whole tissue or organ; some hormones
the end of a neurone affect the whole body
response muscle contraction or secretion by many different responses,
glands e.g. glycogenesis, protein synthesis,
rate of respiration, growth, absorption
of water in kidneys
12 a
Striated muscle. Striations can be seen 2 Multiply this by 1000 to give the
clearly across the muscle fibres. distance in micrometres.
b and c 3 To calculate the magnification,
A band divide this distance in micrometres
I band Z line by 2.25.
4 Round up or round down to the
⎫
⎬
⎭
H band
nearest whole number.
13 a
The detail of the thick and thin filaments
in the sarcomeres is below the resolution
of the light microscope. The diameter of
the thin filament is 5 nm and the diameter
thick filament thin filament of the thick filament is 15 nm. The
d Follow these steps. maximum resolution of the LM is 200 nm
(see Chapter 1).
1 On the diagram, measure the length
of the sarcomere (Z line to Z line) in b A – Z line, B – thick filament,
i
millimetres. C – thin filament
D – H band, E – A band, F – I band
ii
c
The region of overlap between thick and the postsynaptic membrane (membrane
thin filaments in the A band. of dendrite of neurone or sarcolemma of
d
A simple model should show how the muscle fibre) to cause depolarisation.
movement of the thin filaments closer Differences:
together shortens the sarcomere. It should • interneuronal synapses release a range
be possible to use the model to show what of transmitter substances, including
happens to the Z line, A band, I band and acetylcholine, GABA and dopamine;
H band during a contraction. acetylcholine is the usual neurotransmitter
A more complex model should show how at neuromuscular junctions
the movement of the myosin heads causes • sarcolemma is postsynaptic membrane at
the movement of the thin filaments. neuromuscular junctions

An explanation could be similar to this: • sarcolemma is folded to give a large
The thick and thin filaments do not surface area; postsynaptic neuronal
extend across the whole sarcomere. membranes are not folded
When a muscle contracts, myosin heads • at the neuromuscular junction an action
make contact with thin filaments and potential passes along the sarcolemma
then tilt towards the centre of the and down T-tubules; nothing equivalent
sarcomere. This power stroke moves the happens in an interneuronal synapse
thin filaments closer together so that (action potentials do not travel across the
there is more overlap between thick and cell bodies of neurones).
thin filaments (H band gets smaller).
This decreases the distance between 15 Lactate fermentation occurs in muscle tissue
the Z lines so the overall length of the when there is not enough oxygen supplied
sarcomere decreases. by the blood for aerobic respiration. The
breakdown of glucose to pyruvate provides
The combined effect of all the sarcomeres ATP but is not very energy efficient. Look at
shortening in the myofibrils shortens the Chapter 12 (Section 12.4, Respiration without
muscle fibre. oxygen) to remind yourself about lactate
The answer to d can be helped with two fermentation. Reduced NAD is produced
simple diagrams each showing one thick during glycolysis and when the muscle tissue
filament and two thin filaments on either is respiring aerobically these molecules are
side with two Z lines. One diagram shows oxidised and therefore recycled to be reused.
the sarcomere at rest with an H band. When oxygen is not present, hydrogens from
The second shows the sarcomere fully reduced NAD are passed to pyruvate so that
contracted with no H band. NAD is recycled.
14 Similarities: 16 This task requires you to do two things:
• arrival of an impulse at the end of the • choose a strategy to use to make up a
presynaptic neurone stimulates the number of different concentrations of a
opening of voltage-gated calcium ion solution
channels and the entry of calcium ions • use standard form to express the very low
into the synaptic bulb concentrations of ABA required.
• calcium ions stimulate the movement of The solution you are given is known as a stock
vesicles to the presynaptic membrane solution. In this case, the stock solution of abscisic
• neurotransmitter is released by exocytosis acid (ABA) has a concentration of 1.0 millimole
• neurotransmitter substances are released per dm3 (1.0 mmol dm–3). In standard form this is
to transmit impulses across a gap written as 1.0 × 10–3 mol dm–3.
• neurotransmitter substances bind to You are told that stomatal closure has been
receptor proteins on the postsynaptic observed when a solution of ABA with a
membrane concentration of 5.0 µmol dm–3 was sprayed on
the leaves of Arabidopsis thaliana. Call this the
• ligand-gated sodium ion channels open reported concentration. In standard form, this is a
to allow sodium ions to diffuse through concentration of 5.0 × 10–6 mol dm–3.
The first decision to make is the range of the form of amino acids digested
concentrations that should be used. What is the from proteins
lowest concentration and what is the highest • the sensitive plant, Mimosa, can
concentration that should be used? The reported remove its leaves from danger
concentration should be included in the range,
but it should go lower than this and also it should • plants may be able to respond
go higher. Higher concentrations should be used quickly to infection to prevent it
to confirm the reported result. This will test the spreading.
validity of the reported result. ii If two hairs are stimulated within
The second decision to make is how many 20–35 seconds, the trap closes. If the
concentrations to use within the range. You second stimulus comes after
are recommended to use at least five different 35 seconds, the trap does not close.
values of the independent variable (see The trap does not half-close. Either it
Chapter P1) so you should have at least five closes or it doesn’t.
different concentrations of ABA, but in a plan iii
Venus fly traps grow in soils that are
you could always use more, for example ten. deficient in nitrate ions. Insects are
The third decision when making up solutions is rich in protein. By digesting protein
whether you should use simple (proportional) to amino acids, Venus fly traps gain a
dilution or serial dilution – see Figure P1.2. good source of nitrogen compounds
A serial dilution will give you a very wide range to supplement what little nitrate they
and will be useful for making the reported can absorb from the soil. Nitrate is
concentration (5.0 × 10–6 mol dm–3) from the stock used for synthesis of amino acids. By
solution. You can do this by using a ×10 serial digesting insects these plants gain a
dilution to make a solution with a concentration ‘ready-made’ source of amino acids.
of 1.0 × 10–5 mol dm–3. This is equivalent to b Auxin stimulates ATP-ase proton pumps
10.0 µmol dm–3. This solution can then be halved in the cell surface membrane to pump
to give 5.0 × 10–6 mol dm–3. protons (hydrogen ions) out of a cell
The range of solutions could be prepared by into the cell wall. This acidifies the cell
proportional dilution from the 10.0 µmol dm–3 wall. Proteins in the cell wall known as
solution. However, it is a good idea to use expansins loosen the connections between
a pilot investigation with a limited range of cellulose microfibrils and the surrounding
concentrations first and then use between substances (hemicelluloses) in the cell
five and ten concentrations in the main wall. The hydrostatic pressure of the cell
investigation. pushes the microfibrils apart so the wall
stretches and the cell elongates.
You could complete your plan by deciding how
to treat the leaves of Arabidopsis thaliana with
the different solutions and how you will collect,
Reflection
analyse and present your results. You could sketch The notes could be set out under these headings:
a graph to show the results you expect. Look at • Use of nerve impulses that travel long
Figure 14.32 to help you decide how to collect distances very fast
results.
• Use of action potentials in plants
17 a i Some advantages:
• Use of hormones that travel long distances in
• close stomata to conserve water the blood
when it is hot and dry
• Use of neurotransmitters for short distances
• open stomata when the carbon – at synapses between neurones and at
dioxide concentration in the leaf neuromuscular junctions
decreases so more carbon dioxide
can diffuse in from outside for • Use of cell-signalling compounds over
photosynthesis short distances, for example cytokines in the
immune system
• the Venus fly trap can catch
insects as a source of nitrogen in
• Use of plant growth substances for controlling ii

ADH – epithelial cells lining
elongation growth, germination, stem collecting ducts in the kidneys ;
elongation and stomatal closure.
insulin – liver cells and, muscle cells /
adipose cells ;
glucagon – liver cells ; R muscle cells
The mark schemes, suggested answers and [3]
b i glycogen synthase becomes more
active, glycogen phosphorylase
becomes less active ;
Notes about mark schemes accurate data quote for at least one
A or accept indicates an alternative acceptable of the enzyme ;[2]
answer. ii increases until 8 minutes and then
R = reject. This indicates a possible answer that remains constant (at 3.5 au) ;[1]
should be rejected. c ore glucose in the blood / incease in
m
; The bold semicolon indicates the award of 1 mark. blood glucose concentration ;
/ This indicates an alternative answer for the same glycogen synthase becomes active to store,
mark. The alternatives may be separated from the glucose / glycogen ;
rest of the answer by commas. insulin ;
( ) Text in brackets is not required for the mark. from, pancreas / islets of Langerhans ;
Underlining This is used to indicate essential stimulates, uptake / storage of glucose ;
word(s) that must be used to get the mark. inhibits break down of glucose ;
AW means ‘alternative wording’. It is used to idea that glycogen phosphorylase
indicate that a different wording is acceptable becomes less active as no need to /
provided the essential meaning is the same, and is break down glycogen ;
more than usual. ref to normal concentration of glucose in
the blood / homeostatic mechanism ;
AVP means ‘additional valid point’. This means [max. 4]
that are not in the mark scheme, provided they d possible suggestions may include:
are relevant. But accept only as many additional phosphorylated (as part of enzyme
points as indicated by the bold semicolons, e.g. cascade) to activate ;
AVP ; ; means award a maximum of 2 extra marks. dephosphorylated to inactivate ;
ORA means ‘or reverse argument’ and is used also allosteric / non-competitive inhibitors ;

bind to part of the enzyme other than the
between pH2 and pH 5 ORA’ means accept active site ;
‘activity decreases between pH 5 and pH 2’. idea that enzyme changes in shape so
max. This indicates the maximum number of active site cannot function ;
marks that can be given. also broken down by (protease) enzyme ;
1 a i eptides and polypeptides are, water-
p [max. 2]
soluble/not lipid-soluble ; e
two homeostatic mechanisms that are
cannot, diffuse/pass, through the controlled by hormones are osmoregulation
phospholipid bilayer ; and blood glucose concentration
therefore receptors on the cell large number of target cells in, liver /

surface must be specific for each kidney / collecting ducts ;
hormone − they must have a shape
idea that blood passes close to all cells in
complementary to the hormone the body, so hormones can be distributed
[2] everywhere ;

there would have to be many neurones 3 a ref to, receptor / generator, potential ;
throughout the effector organs if the
pressure / stimulus, causes deformation /
nervous system was used ; AW (of Pacinian corpuscle) ;

transport in the blood is more energy
increased permeability to sodium ions /
efficient than using nerve impulses ; channel proteins for sodium ions open ;

responses, do not have to be fast / can be
sodium (ions) move into, receptor / axon ;
slow ;

causes depolarisation / AW (e.g. potential
AVP ; [max. 3] difference changes from – ve to +ve) ;
[Total: 17] [max. 4]
2 a i node of Ranvier ; [1] b
no action potential recorded with low
ii Schwann cell ; [1] and medium pressure / action potential
recorded only with heavy pressure ;
b
myelin insulates axons so that ion flow
during action potentials only occurs at
(no action potential at B because)
nodes ; depolarisation of, receptor / unmyelinated
part of axon, did not reach threshold ;
myelin prevents tissue fluid reaching the
axon membrane ;
threshold is between medium and heavy
pressure ;

current flow along the neurone depolarises
the axon membrane only at nodes ;
threshold is between –40 mV and –30 mV ;

transmission of impulses is fast(-er than
more depolarisation at heavy pressure
along neurones that are not myelinated) ; because more sodium ion channel
proteins open ;

saltatory transmission ;

sensory neurone either conducts impulses

impulses appear to jump from node to node ; or it does not / ref to all-or-none principle ;

up to 100 m s–1 / speed in non-myelinated [max. 4]
neurones about 0.5 m s–1 ; [max. 4]
c
myelinated neurones transmit impulses
c
current flow from the node to the left of much faster than unmyelinated neurones ;
the one in the drawing depolarises the
axon membrane at A ; any suitable figures ; e.g. up to 100 m s–1 for
myelinated and 0.5 m s–1 for unmyelinated ;

some voltage-gated sodium ion channel
proteins open ; stimulation of Pacinian corpuscle might
indicate damage to the skin ;

sodium ions diffuse into axon (down
electrochemical gradient) ; may need to remove the part of the body
from danger very quickly ;

membrane potential becomes more
positive on the inside ; AVP ;

depolarisation reaches threshold potential ; e.g. ref to a reflex arc in which Pacinian
corpuscle provides the sensory input ;

more voltage-gated sodium ion channel [max. 3]
proteins open and sodium ions diffuse into
the axon ; A ref to positive feedback in [Total: 11]
context of sodium channel proteins opening ; 4 a action potential arrives at end of

potential difference reaches +40 mV ; presynaptic neurone ;

voltage-gated sodium ion channel voltage-gated calcium ion channel
proteins close ; proteins open ;

voltage-gated potassium ion channel
proteins open ;

potassium ions diffuse out to restore the
resting potential ;
[max. 5]
[Total: 11]
Effect on transmission
Compound Explanation
across synapse
curare no transmission ; ACh cannot bind to receptors on postsynaptic
membrane ;
eserine continuous transmission by eserine inhibits acetylcholinesterase, so ACh
acetylcholine ; remains in synapse stimulating receptors ;
methylmercury no transmission ; ACh cannot be recycled so vesicles run out of it ;
nicotine transmission even if no sodium ions enter the post-synaptic neurone so
acetylcholine ; depolarisation occurs ;
[8]
calcium ions diffuse into presynaptic M Z, line / disc ; [3]

terminal ; ii 5;

calcium ions stimulate vesicles to move to the myofibrils are separated from
membrane ; each other by, mitochondria /
vesicles fuse with membrane / exocytosis, sarcoplasmic reticulum ;[2]
to release, acetylcholine / ACh ; b i
glycogen granules are broken down
(named) neurotransmitter diffuses across to provide glucose for respiration ;
(synaptic) cleft ; mitochondria, carry out aerobic
binds with receptor on postsynaptic respiration / provide (much) ATP
membrane ; (for muscle contraction) ;[2]
stimulates opening of ligand-gated ii there is a very wide I band ;
sodium ion channel proteins ; in the I band there is no overlap
sodium ions flow in through postsynaptic between thick and thin filaments ;
membrane / depolarisation of in contracted muscle the thin
postsynaptic membrane ; [max. 6] filaments would be closer together
b i
The answers to this question are giving a thin I band ;[3]
presented in the table above. c distance on the electron micrograph
ii
curare competes with acetylcholine magnification
for receptor sites on the postsynaptic distance = 43 mm (accept 44 mm)
neurones ;
= 43 000 µm
if curare fills these sites, any ACh
released from presynaptic neurones 43 000 ;
will have little effect ; 16 000
any ACh will be broken down by = 2.7 µm ; [2]
acetylcholinesterase ; [Total: 12]
if the enzyme is inhibited by eserine, 6 a P − myosin / thick, filament ;
Ach remains in the synaptic cleft for Q − actin / thin, filament ;
longer, reducing the effect of curare
R − Z, line / disc ;[3]
as a competitive inhibitor ;
b the muscle is relaxed ;
this effect of eserine is similar to the
action of competitive inhibitors of the troponin and tropomyosin molecules
enzymes (see Chapter 3) are covering the myosin-binding sites on
the, actin / thin, filaments ;
[3]
myosin cannot bind to actin to form
[Total: 17]
cross-bridges ; [max. 2]
5 a i K A band ;
c diagram C ;
L I band ;
greatest overlap between thick and thin Y is H band ;

filaments ; Each thick filament is surrounded by six thin
maximum number of cross-bridges can filaments. The thick filaments form cross-
form between thick and thin filaments ; bridges with all of them.
greatest force applied by movement of X Z Y
myosin heads ;
in the state shown in diagram D many
myosin heads are not making contact
with the thin filaments ; [max. 4]
d the sarcomere cannot shorten any more,
thick filament thin filament
without crumpling the thick and thin
filaments ; [max. 4]
the thin filament cannot move any closer b
if contracted muscle, then, no / little,
together / thick filament has reached the I band and H band ;
Z disc ; [max. 1]

so there would be no section like X and
e i myosin heads can only move the thin no section like Y ;
filaments in one direction (during the
when fully contracted the ends of the
power stroke) ;
thick filaments reach the Z discs ;[3]
they are arranged so that when they
c role of calcium ions at the end of a motor
do this they pull on the thin filaments
neurone to max. 3
in such a way that the sarcomere is
shortened ; at, neuromuscular junction / motor end
plate ;
they cannot pull (or push) the thin
filaments in the other direction ; voltage-gated channel proteins for
calcium ions open when impulse arrives ;
[max. 2]
calcium ions enter, axon terminal / AW,
ii most skeletal muscles are arranged in
when action potential arrives ;
antagonistic pairs ;
stimulates vesicles to, move towards / fuse
contraction of an antagonist pulls on
with, presynaptic membrane ;
the muscle so sarcomeres lengthen ;
role of calcium ions in muscle to max. 3
thin filaments slide past thick
filaments to give, less overlap between impulse / action potential, in, sarcolemma /
them / wider I band ; T-tubules, stimulates release of calcium
ions from sarcoplasmic reticulum ;
e.g. when the biceps muscle is
contracted and shortened, it can be calcium ions bind to troponin ;
pulled back into its longer state by stimulates movement of tropomyosin ;
contraction of the triceps muscle
myosin binding sites on thin filaments
[max. 2]
exposed ;
[Total: 14]
cross-bridges form ;
7 a
the diagram shows (TS) of, sarcomere /

when no action potential calcium ions are
thick and thin filaments ;
pumped back into sarcoplasmic reticulum ;
X shows, actin / thin, filaments, alone ; [max. 6]
(see diagram)
[Total: 13]
Z is overlap between thick and thin
8 a the sections of shoot could be floated
filaments ; (see diagram)
on water and kept in exactly the same
Y shows, myosin / thick, filaments alone ; conditions as the other groups ;[1]
(see diagram)
b
the initial lengths of the sections were
X is I band ; not the same ;[1]
Z is (overlap region of) A band ;
c
greater mean percentage increase in 9 The following points could be included in a
length with increase in concentration of strategy to investigate the effect of different
IAA (0.01 μmol dm–3 to 1.0 μmol dm–3) concentrations on the production of amylase in
after 18 hours ; barley grains:
most of the increase in length with IAA independent variable = concentration of
occurs in the first four hours ; gibberellin ;
increase in length with solutions dependent variable is some measure of
0.1 μmol dm–3 and 1.0 μmol dm–3 is the amylase activity ;
same after four hours ; method of determining activity of amylase ;

greater increase in length in shoots in either disappearance of starch from barley
1.0 μmol dm–3 IAA than in the more dilute grains or production of maltose (a reducing
solutions between 4 and 18 hours ; sugar)
any comparative data quote, e.g. with disappearance of starch could be followed
1.0 μmol dm–3 there is a 33% increase after over time by using iodine in potassium iodide
4 hours, but at 18 hours the percentage solution ;
increase is 50% − a change of 17% ; production of maltose over time could be
[max. 3] followed by using Benedict’s solution ;
d
there may be a limit to the expansion that choice of a suitable range of gibberellin
can occur in these sections ; concentrations – could be 0 to 100 μmol dm–3 ;

the sections are cut from the shoots and choice of method for making solutions from a
there are unlikely to be any new cells stock solution ; either using serial dilution or
being produced by mitosis ; using proportional (simple) dilution
IAA stimulates the release of expansins number of values of the independent variable
into the cell walls ; should be five or more ;

so in each case it is the expansins that barley grains should be divided into groups
allow the cells to expand ; and soaked in the different concentrations ;

with an IAA concentration of after a known time the grains should be put in
1.0 μmol dm–3 no more expansins are a pestle and mortar or blender and ground up ;
released into the cell walls ;
the grains are then tested with iodine solution
maximum concentration of IAA to have or Benedict’s solution and the relative
an effect on expansin release is between quantities of starch or maltose in each group
0.1 μmol dm–3 and 1.0 μmol dm–3 ; can be determined by using colorimetry ;
AVP ; [max. 3] (see Practical Activity P1.1 in Chapter P1 for
[Total: 8] details of how to do this)
[max. 8]
[Total: 8]
may be different.
Coursebook answers
Chapter 16 1 The chromosomes are arranged in order
of size.
Before you start 2 prophase; because this is when the
Look for the understanding that: chromosomes appear as two chromatids
joined by a centromere
•• mitosis produces daughter cells that have
identical chromosomes and genes as the 3 during the growth of the zygote to an adult
parent cell 4 a prophase I (in fact, they pair before this,
•• genes code for protein synthesis during interphase but are seen for the first
•• the proteins produced by a cell determine its time during prophase)
functions. b prophase I
c anaphase I
Science in Context
d anaphase II
•• Learners should be able to suggest that
different forms of a gene might code for e telophase I
different proteins. These proteins might be 5 Meiosis could not take place in a triploid,
enzymes that catalyse reactions that produce 3n, cell, because there is an odd number of
different pigments (colours) in the skin cells each chromosome, so they will not be able
of a cat. to pair up.
•• Learners who have not previously studied In theory, meiosis can take place in a
genetics may have difficulty in making any tetraploid, 4n, cell because there is an even
suggestions at all. However, if they have number of each kind of chromosome, so they
knowledge of genetics from GCSE, IGCSE can each find a partner to pair up with. In
or O Level, they should know that each cell practice, meiosis is often very difficult in a
in the adult cat contains two copies of each 4n cell because, if there are four homologous
gene, and that these two copies may not be the chromosomes present, they all tend to join
same, because genes exist in different forms up with each other. Crossing over between
called alleles. Some alleles only show in the chromatids of different chromosomes results
observable features (phenotype) if there is no in an inextricable tangle, so meiosis cannot
other allele present. This could be the case proceed effectively.
here; perhaps both parents had an allele for
6 Mitosis Meiosis
spots, which did not produce spots because
another dominant allele masked it. Only number of division 1 2
when the kitten inherited this allele from both cycles
parents were spots produced.
number of daughter 2 4
In fact, the genetics of coat colour in cats is more cells
complex than this, and involves interactions
number of 8 4
between different genes, including epistasis. You
chromosomes per
may like to come back to this context at the end
nucleus in daughter
of the chapter, and ask learners to research the
cells
genetics of coat colour in ocicats, in order to try to
explain it more fully.
7 parental blood × blood 9 parental brown × white

phenotypes group AB group AB phenotypes
parental IAIB IAIB parental BB bb
genotypes genotypes
parental IA or IB IA or IB parental B b
gametes gametes
All offspring in the F1 generation will be Bb,

male gametes brown.
IA IB 10 parental brown × brown
I
A
I I A A
I I A B
phenotypes
blood blood
parental Bb Bb
offspring group group
genotypes
genotypes female A AB
and gametes IB parental B or b B or b
IAIB IBIB
phenotypes gametes
blood blood
group group
AB B male gametes
B b
predicted offspring ratio:
1 group A : 2 group AB : 1 group B
There is therefore a one in four chance that the F2 B BB Bb
child will have blood group B. genotypes female brown brown
8 and gametes
phenotypes b Bb bb
parental blood × blood brown white
phenotypes group A group B
parental IAIo IBIo p redicted offspring ratio in F2 generation:
genotypes 3 brown : 1 white
parental IA or Io IB or Io 11 a See the answer to Question 9 to show that
gametes no white offspring could be produced if
the brown rabbit was homozygous.
male gametes parental brown × white
IB Io phenotypes
parental Bb bb
IAIB IAIo
genotypes
IA blood blood
offspring parental B or b b
genotypes female group group A
gametes
and gametes AB
phenotypes IBIo IoIo
Io blood blood gametes
group B group O from one
parent
predicted offspring ratio: b
1 group A : 1 group B : 1 group AB : 1 group O B Bb
gametes
F2 genotypes brown
from the
and
other b bb
phenotype
parent white
b Although the genetic diagram in a shows

that you would expect equal numbers
of brown and white offspring, this is
all down to chance. It is possible that, 14 a Male cats cannot be tortoiseshell because
just by chance, all of the offspring are a tortoiseshell cat must have two different
brown, even though the brown parent was alleles of this gene. As the gene is on the
heterozygous. You would need far larger X chromosome, and male cats have one
numbers of offspring, all brown, before X chromosome and one Y chromosome,
you could safely say that the brown parent they can only have one allele of the gene.
does not have the b allele. b
12 A man has one X and one Y chromosome, so
half of his sperm carry an X chromosome and parental male with × female with
half carry a Y chromosome. A woman has phenotypes orange fur tortoiseshell
two X chromosomes, so all of her eggs have fur
an X chromosome. parental XCoY XCoXCB
If an X-carrying sperm fertilises an egg, the genotypes
child has XX and is female. If a Y-carrying parental XCo or Y XCo or XCB
sperm fertilises an egg, the child has XY and gametes
is male.
The blood-clotting gene is on an X
male gametes
chromosome, and the man passes his Y
chromosome to his son. He cannot therefore XCo Y
pass on the haemophilia allele to his son.
XCoYCo XCoY
13 a For example, R for the normal, dominant
allele and r for the recessive allele. (It female male
is always a good idea to choose a letter XCo with with
where the capital and small letters have orange orange
different shapes, so that you cannot F2 fur fur
mistake them.) genotypes female
and gametes
b parental man with × woman phenotype
phenotypes normal with XCoXCB XCBY
vision normal XCB female male
vision with with
parental XRY XRXr tortoise- black
genotypes shell fur fur
parental XR or Y XR or Xr predicted offspring ratio: 1 orange female : 1
gametes tortoiseshell female : 1 orange male : 1 black male
male gametes
XR Y
X R XRXR XRY
female male with
with normal
normal vision
F2 vision
genotypes female
and gametes Xr
phenotype XRXr XrY
female male with
with colour
normal blindness
vision
There is a one in four chance that a child will be a

colour-blind boy.
15 a Parent genotypes are GGDD and ggdd. All offspring will be heterozygous GgDd, and will have
grey body and dark eyes.
b parental phenotypes grey body, dark eyes × grey body, dark eyes
parental genotypes GgDd GgDd
parental gametes GD Gd gD gd GD Gd gD gd
offspring genotypes and phenotypes
gametes of one parent

GD Gd gD gd
GD GGDD GGDd GgDD GgDd
grey, dark grey, dark grey, dark grey, dark
Gd GGDd GGdd GgDd Ggdd
gametes of the grey, dark grey, pale grey, dark grey, pale
other parent gD GgDD GgDd ggDD ggDd
grey, dark grey, dark white, dark white, dark
gd GgDd Ggdd ggDd ggdd
grey, dark grey, pale white, dark white, pale
The expected phenotype ratios are therefore 9 grey body, dark eyes : 3 grey body, pale eyes : 3 white
body, dark eyes : 1 white body, pale eyes.
16 Key to symbols used for the alleles:
T = allele for tall stem
t = allele for short stem
G = allele for green leaves
g = allele for white leaves
parental phenotypes tall stem, green leaves × short stem, variegated leaves
parental genotypes TTGG ttGg
parental gametes TG tG or tg
gametes from one parent

tG tg
offspring genotypes and gametes from the other TG TtGG TtGg
phenotypes parent tall, green tall, variegated
17 a BBFF, BBFf, BbFF, BbFf

b Perform a test cross – that is, breed the animal with an animal showing both recessive
characteristics. If the offspring show one of the recessive characteristics, then the ‘unknown’
genotype must be heterozygous for that characteristic.
18 a The F1 offspring will all have genotype FfGg.
b
F1 phenotypes white × white
parental genotypes FfGg FfGg
parental gametes FG Fg fG fg FG Fg fG fg
FG Fg fG fg
FFGG FFGg FfGG FfGg
FG
white white white white
FFGg FFgg FfGg Ffgg
Fg
gametes of the white white white white
other parent FfGG FfGg ffGG ffGg
fG
white white coloured coloured
FfGg Ffgg ffGg ffgg
fg
white white coloured white
Predicted F2 ratios: 13 white : 3 coloured
19 a b
genotype phenotype parental pink × white
AABB purple phenotypes
AABb purple parental AAbb aaBB
genotypes
AAbb pink
parental Ab aB
AaBB purple
gametes
AaBb purple F1 genotype All AaBb,
Aabb pink and purple
aaBB white phenotype
aaBb white
aabb white
c
F1 phenotypes purple × purple
parental genotypes AaBb AaBb
parental gametes AB Ab aB ab AB Ab aB ab
AB Ab aB ab
AABB AABb AaBB AaBb
AB
purple purple purple purple
AABb AAbb AaBb Aabb
Ab
gametes of the other purple pink purple pink
parent AaBB AaBb aaBB aaBb
aB
purple purple white white
AaBb Aabb aaBb aabb
ab
purple pink white white
Predicted F2 ratios: 9 purple : 3 pink : 4 white with recombinant phenotypes (yellow,

orange and blue, green) can be produced.
20 1 striped, normal : 1 striped, aristopedia : 1
23 a 1:1:1:1
ebony, normal : 1 ebony, aristopedia
b Linkage; that is, the two loci are on
21 The woman is nnIAIo. The man is NNIBIo.
the same chromosome. The alleles for
here is no need to work through this in
T grey body and straight wings are on
detail. If the man is homozygous for normal one homologous chromosome in the
fingernails, all of his children will inherit allele heterozygote and the alleles for ebony
N, and will therefore have normal fingernails. body and curled wings are on the other
There is no chance that the child can have homologous chromosome.
fingernails like his mother’s. 30 + 29
c × 100% = 20.6%
22 (Answers could be given as genetic diagrams.) 113 + 30 + 29 + 115
24 The expected ratio would be 9 grey, dark : 3
a The possible genotypes of the gametes are
grey, pale : 3 white, dark : 1 white, pale. The
YG, Yg, yG and yg from one parent, and
total number of offspring is 80, so you would
yg from the other.
expect 9 ÷ 16 × 80 of these to be grey, dark,
The possible genotypes and phenotypes and so on.
of their children are therefore:
Expected numbers:
YyGg (yellow, green), Yygg (yellow,

9 ÷ 16 × 80 = 45 grey, dark
orange), yyGg (blue, green) and yygg
(blue, orange) in equal proportions. 3 ÷ 16 × 80 = 15 grey, pale
b As one parent has the genotype yygg, you 3 ÷ 16 × 80 = 15 white, dark
can assume that alleles y and g are on the 1 ÷ 16 × 80 = 5 white, pale
same chromosome.
The table shows how χ2 is calculated.
The father’s gametes can therefore be YG
or yg. Now look at Table 16.3. There are four classes
of data, so there are three degrees of freedom.
The offspring can therefore be YyGg The value for χ2 is much greater than any of
(yellow, green) or yygg (blue, orange), in a the numbers in this row so there is a significant
1 : 1 ratio. difference between the observed and expected
c If crossing over takes place, then a few results.
gametes will have genotypes Yg and yG,
allowing a small chance that an offspring
Phenotypes of animals author(s). In examinations, the way marks would

dark grey white white
Observed 54 4 4 18 Notes about mark schemes
number (O) A or accept indicates an alternative acceptable
Expected ratio 9 3 3 1 answer.
Expected 45 15 15 5 R = reject. This indicates a possible answer that
number (E) should be rejected.
O–E +9 –11 –11 +13 ; The bold semicolon indicates the award of 1
(O – E)2
81 121 121 169 mark.
(O – E) /E
2
1.8 8.1 8.1 33.8 / This indicates an alternative answer for the same
∑(O – E)2/E
= 51.8
χ2 = 51.8 ( ) Text in brackets is not required for the mark.
Reflection word(s) that must be used to get the mark.
Learners may suggest that cells that look identical,
and that have identical sets of genes, can express
different selections of these genes. This would
mean that they synthesise different combinations
more than usual.
of proteins. We cannot know exactly what would
cause the differences in which genes are expressed, AVP means ‘additional valid point’. This means
but it would involve transcription factors. accept any additional points given by the student
Analysing DNA from two cells just tells you which
genes they have, and we would expect all of the
cells in the human body, for example, to contain
exactly the same DNA. However, analysing
mRNA tells you which genes are actually ORA means ‘or reverse argument’ and is used
expressed, and therefore which proteins the cell is when the same idea could be expressed in the
making. Cells with different functions will express reverse way. For example: ‘activity increases
different sets of genes and therefore make different between pH2 and pH 5 ORA’ means accept
proteins. ‘activity decreases between pH 5 and pH 2’.
The newly discovered cell in the tracheal lining max. This indicates the maximum number of
involves the movement of chloride ions out of marks that can be given.
itself, which results in the movement of water 1 a genotype: the genetic constitution of an
out of the cells as well. This keeps the mucus, organism with respect to a gene or genes ;
secreted by other cells in the tracheal lining,
fluid, rather than becoming too viscous. The phenotype: the physical, detectable
mucus traps microorganisms and particles in the expression of the particular alleles of a
air moving down the trachea, and this mucus gene or genes present in an individual ; [2]
is then swept upwards by the ciliated cells. The b
homozygous: describes a diploid organism
chance of pathogens moving down into the lungs that has the same allele of a gene at
is therefore reduced. It also means that the mucus the gene’s locus on both copies of the
itself is kept on the move easily, and does not homologous chromosomes ;
collect in the lungs, where it could be a breeding heterozygous: describes a diploid organism
ground for pathogens. that has different alleles of a gene at
the gene’s locus on the homologous
Exam-style questions chromosomes ;[2]
c Gametes ab ;
AB genotype: AaBb
phenotype: purple flowers and elongated pollen ;
Ab genotype: Aabb
phenotype: purple flowers and spherical pollen ;
aB genotype: aaBb
phenotype: red flowers and elongated pollen ;
ab genotype: aabb
phenotype: red flowers and spherical pollen ;
[5]
[Total: 9]
2 a allele: variant form of a gene ;
dominant: allele that always expresses itself in the phenotype when present ;[2]
b parental phenotypes: wild type × wild type ;
parental genotypes: AaBb × AaBb ;
gametes: AB, Ab, aB, ab × AB, Ab, aB, ab ;
offspring genotypes ; ; see table
offspring phenotypes ; see table
Gametes AB Ab aB ab
AB AABB AABb AaBB AaBb
wild type wild type wild type wild type
Ab AABb AAbb AaBb Aabb
wild type grey body, vestigial wild type grey body, vestigial
wings wings
aB AABB AaBb aaBB aaBb
wild type wild type ebony body, long ebony body, long
wings wings
ab AaBb Aabb aaBb aabb
wild type grey body, vestigial ebony body, long ebony body, vestigial
wings wings wings
[6]
c i Phenotypes of Drosophila melanogaster

grey body, grey body, ebony body, ebony body,
long wing vestigial wing long wing vestigial wing
Observed number (O) 207 79 68 30
Expected ratio 9 3 3 1
Expected 216 72 72 24
number (E)
O−E −9 7 ; −4 6
(O − E) 2
81 49 ; 16 36
(O − E) 2
0.38 0.68 ; 0.22 1.50
E
[3]
ii 2.78 ; [1] lactose binds to the repressor protein ;
χ value represents probability of >0.05 ;
iii 2
preventing repressor from binding to DNA ;
difference between observed and at the operator site ;
expected results is not significant and transcription is no longer inhibited ;
could be due to chance ; [2]
messenger RNA is produced from, the
[Total: 14] β-galactosidase gene / the three structural
3 a i GGCDCP ; [1] genes ;
ii ggCPCP ; [1] mRNA can be translated at a ribosome
(to produce β-galactosidase) ; [max. 5]
parental genotypes: GGCDCP and ggCDCP ;
b
allow ecf if ai incorrect protein synthesis uses, energy / amino acids ;
c
gametes: GCD or GCP and gCD or gCP ; wasteful to make a protein that is not
required ; [2]
offspring genotypes and phenotypes:
[Total: 11]
GCD GCP
5 a amino acids are, polar / hydrophilic ;
gCD GgCDCD GgCPCD
so cannot move through the lipid bilayer ;
olive green dark green [2]
gCP GgCDCP GgCPCP b i transcription factor ;[1]
dark green light green ii myosin involved in muscle contraction ;
all genotypes correct ; thyroxine causes more myosin to be

synthesised ;
phenotypes correctly linked to genotypes ;
increases, quantity of muscle /
offspring ratios: 1 olive green : 2 dark strength of muscle / ability of muscle
green : 1 light green ; [5] to contract ;[3]
[Total: 7] c i
dominant as it has an effect when
4 a i a cluster of genes ; only one allele present ;[1]
that are controlled by the same ii
thyroid hormone normally causes
promoter ; [2] transcription of a gene ;
ii a gene that codes for a protein that t hyroid hormone can still enter cells
has a function in the cell ; [1] but cannot bind to its receptor ;
iii an enzyme that is synthesised only so receptor continues to prevent
when its substrate is present ; [1] transcription ;[3]
b any five of:
[Total: 10]
lactose is taken up by the bacterium ;
may be different.
Coursebook answers b Possibilities include ability to cope with

Chapter 17 a limited food or water supply, ability
to cope with the limited breeding space,
Before you start and susceptibility to diseases such as
myxomatosis, if this is present on the island.
This question tests whether learners recognise
4 a Deaths increased to a maximum in 2006,
that variation caused by genes can be inherited
and then decreased.
but variation caused by the environment cannot.
The breeder should choose cows from a breed that b Deaths from non-resistant S. aureus
produces large quantities of milk, as these will remained relatively constant throughout
pass on their alleles to their offspring. It makes no the period from 1993 to 2012, with only
difference whether or not they have been fed on a small fluctuations. In contrast, deaths from
high-quality diet, as this does not affect their genes. MRSA increased greatly between 1993
and 2006, before decreasing again. In 1993
Science in Context to 1996, most deaths were from the non-
resistant strain, and MRSA deaths overtook
• Some plants could have different alleles of them for the first time in 1997. By 2006,
genes that determine the shape and colour there were more than 3.5 times as many
of the flowers. There could be dominant and
recessive alleles, or codominant alleles. Epistasis deaths from MRSA as from the non-
could also be involved, in which alleles of a gene resistant strain. By 2012, there were still
at one locus affect the expression of an allele slightly more deaths from MRSA, but the
determining shape or colour at a different locus. proportion was much less than previously.
It is also possible that different transcription c Antibiotics are widely used in hospitals, so
factors could be involved, affecting whether or the bacteria are exposed to this selection
not a particular gene is expressed. pressure in hospitals more than elsewhere.
• Individual orchids with flowers of a shape and d A reduction in the prescription of
colour that most closely matches the appearance antibiotics reduces the exposure of bacteria
of a female fly could be visited by more male to this selection pressure, and therefore
flies than other flowers. These would therefore means that there is no selective advantage
have a greater chance of being pollinated. to bacteria carrying the allele for resistance.
5 a Genotypes DD and Dd have the same
Self-assessment questions phenotype because allele D is dominant.
1 Characteristics are passed from parents to b Homozygous recessives, dd = q2 = 16, so
offspring in their genes. Variation caused by q = √0.16 = 0.4
the environment does not change the DNA of
an organism. So, p = 1 – 0.4 = 0.6 and p2 = 0.36 = 36%
2 a environmental conditions (homozygous dominants, DD).
b environment only; they all have the same The heterozygotes, Dd = 2pq = 48%
genotype 6 Their own plants, if they breed with each
c both genes and environment; they have other, will produce offspring with different
different genotypes and you have already genotypes. The plants they grow are
seen that environment always causes heterozygous. If plants with genotypes AaBb
variation in these plants and AaBb are interbred, the offspring could
be AABB, AABb, AAbb, AaBB, AaBb, Aabb,
3 a There seems to be no selection pressure aaBB, aaBb or aabb. These will not grow into
against unusual colours, as there are no a uniform crop, and many of the plants will be
predators. homozygous and have no hybrid vigour.
Reflection points as indicated by the bold semicolons, e.g.

Learners may suggest that the term ‘struggle’
implies a fight or physical effort. In some cases,
this may be entirely appropriate – for example,
if the selection pressure is shortage of food, then
between pH2 and pH 5 ORA’ means accept
organisms may compete directly with one another
‘activity decreases between pH 5 and pH 2’.
for food, and only those strong enough and
aggressive enough to prevent others from eating max. This indicates the maximum number of
their food may survive. marks that can be given.
However, they may also recognise that in many 1 a direction selection is a type of natural
instances there is no physical ‘struggle’ or selection ;
competition. Most selection pressures do not directional selection results in a change in
involve physical struggling. For example, bacteria frequency of alleles ;
that are resistant to antibiotics do not ‘struggle’
there is selection for bacteria with an allele
with other bacteria in order to survive. Peppered
that confers resistance to the antibiotic ;
moths do not ‘struggle’ to be better camouflaged
on trees. The term can be misleading, as it suggests so over time there is an increase in the
a physical effort and purposeful behaviour, which frequency of that allele in the population ;
is hardly ever the case. [max. 3]
On the other hand, learners may feel that it is a b 2, 4, 6, 3, 5, 1
good term to use because it is memorable. It also 2 before 4 ;
helps people to understand that it is not easy to
6 before 3 ;
survive and that only individuals with the ‘best’
characteristics may be able to do so. 5 before 1 ;
all in correct sequence ; ;[5]
Exam-style questions [Total: 8]
The mark schemes, suggested answers and Inbred line 1 Inbred line 2
2
comments that appear here were written by the Genotype: homozygous Genotype: homozygous ;
author(s). In examinations, the way marks would Phenotype: uniform Phenotype: uniform ;
be awarded to answers like these may be different. Yield: low Yield: low ;

A or accept indicates an alternative acceptable Hybrid
answer. Genotype: heterozygous ;
Phenotype: uniform ;
R = reject. This indicates a possible answer that Yield: high ;
should be rejected. [6]
3 a Natural selection Artificial selection
mark. The alternatives may be separated from the the selective agent the selective agent
rest of the answer by commas. is the total is humans ;
environment of
( ) Text in brackets is not required for the mark. the organism
Underlining This is used to indicate essential adaptations to phenotypes
word(s) that must be used to get the mark. the prevailing wanted by humans
AW means ‘alternative wording’. It is used to indicate conditions are are selected ;
that a different wording is acceptable provided the selected
essential meaning is the same, and is used where many different selection may be
students’ responses are likely to vary more than usual. traits contributing for a single trait
AVP means ‘additional valid point’. This means to fitness are (which may not be
accept any additional points given by the student selected advantageous for
that are not in the mark scheme, provided they the organism) ;
[3] selection favours alleles for yellow shell and

b i 40 × 40 ÷ 100 ; few or no bands in spring and summer ;
= 16 ;[2] gradual change in selection pressures as
seasons change ;
ii pale moths are camouflaged on pale
bark, and dark moths on dark bark ; keeps all alleles in the population ;[4]
predators / birds, hunt by sight ; [Total: 10]
6 a only two varieties / no intermediates ;
fewer moths taken that match bark ;
discontinuous variation ;[2]
refer to comparative figures: 20% v.
44% of pale moths / 15% v. 40% of b on both islands percentage of striped
dark moths ;[4] form greater than melanic form ;
[Total: 9] much greater percentage of striped form /
lower percentage of melanic form, on
4 a choose cows that have the highest milk Bryher than on Tresco ;[2]
yield ;
c a few froghoppers colonised Bryher from
breed with a bull whose female relatives Tresco (or vice versa) ;
have a high milk yield ; these individuals did not have all seven
repeat for many generations ;[3] alleles between them ;
b increase = 4470 – 4104 = 366 ; so the gene pool on Bryer is smaller than
on Tresco (or vice versa) ;
So mean increase per
year = 366 ÷ 10 = 36.6 kg ;[2] differences in phenotypes result from the
initial colonsiation, not different selection
c
little change in the protein content / it has
pressures ;[4]
fallen very slightly ;
[Total: 8]
by 0.04 percentage points ;
7 a behaves as good species with no
percentage fat content has fallen overall ; intermating in relation to H. melpomene ;
both, fluctuated / increased at first and 15 matings between H. melpomene males
then fell ; [max. 3] and females and between hybrid males
d producing more milk puts more strain on and females ;
a cow ; behaves as less good species in relation to
more likely to get an inflamed udder / H. cydno ;
heavier weight on legs / other suggestion ; no matings between H. cydno males and
breeders were not considering health issues hybrid females ;
/ breeders only selecting for milk yield ; but three matings between H. cydno
may have inadvertently selected for cows females and hybrid males ; [max. 4]
prone to health issues ; [max. 3] b select mates on basis of wing colours and
[Total: 11] patterns ;
5 a camouflage from bird predators hunting hybrid wing pattern sufficiently different
by sight ; from parent species to give good isolation
from H. melpomene ;[2]
yellow blends into grass but pink or
brown are easily seen ; c needs geographical separation ;
bands break up outline against rough selection pressure different in the
vegetation ; separated populations ;
yellow or pink without bands are easily different alleles selected for ;
seen ; [4] in time the differences between the two
b brown ; populations are so great that they do not
interbreed should they happen to meet ;
five bands ; [2] [4]
c selection favours alleles for brown shell [Total: 10]
and for bands in autumn and winter ;
may be different.
Coursebook answers
online. He also noticed that they differed from the
Chapter 18 species of mockingbird that he had seen in South
America, particularly the species found in Chile
and Argentina where he had been before travelling
Before you start to the Galapagos. These mockingbirds prompted
Causes of genetic variation that should be in the his initial thoughts about how this variation
presentation: might have arisen. These initial thoughts led to his
development of the theory of natural selection.
•• gene mutations – changes in DNA
(e.g. insertions, deletions and substitutions)
•• chromosome mutation – changes in the
structure of chromosomes and the number 1 a
of chromosomes; for example, movement of
Taxonomic rank Giraffe
part of one chromosome (with many genes)
to another and increasing or decreasing the domain Eukarya
number of chromosomes in nuclei kingdom Animalia
•• crossing over during prophase I of meiosis phylum Chordates
– changes the combinations of alleles of the
genes on a chromosome class Mammalia
•• random assortment (independent assortment) order Artiodactyla
of chromosomes during metaphase I meiosis family Giraffidae
•• random mating between individuals with
genus Giraffa
different genotypes
•• random fusion of gametes at fertilisation species Giraffa camelopardalis
•• gene flow – the movement of alleles of genes b i
taxonomic rank – a unit of
from individuals in one population of a classification, a category that
species to individuals in another population; indicates a rank or level in the
this may occur by migration of individuals or, classification system. Examples
in flowering plants, by transfer in pollen. are species, genus, family, etc.
Science in Context ii hierarchical system – each

taxonomic rank above the level
Darwin noticed the interspecific variation between of species includes all the ranks
the four species of mockingbird on different below it. For example, an order
Galapagos islands. These differences can be seen includes all the families that have
in photographs of the birds that can be found similar features.
2
Domains
Feature
Bacteria Archaea Eukarya
cell structure prokaryotic (e.g. no prokaryotic eukaryotic
membrane-bound
organelles)
nucleus ✗ ✗ ✓
DNA circular circular linear
DNA with histones ✗ ✓ ✓
plasmids present in many present in some present in very few, e.g. yeasts
ribosomes all 70S all 70S all in the cytosol are 80S
(70S in mitochondria and
chloroplasts)
peptidoglycan in ✓ ✗ ✗
cell wall
method of cell division binary fission binary fission mitosis
organisation single-celled or single-celled or unicellular / colonial /
chains / groups of chains / groups multicellular
cells, e.g. filaments of cells, e.g.
filaments
3 Compared with bacteria, archaeans have different:

• ribosomal rRNA – the sequences of bases in rRNA are different
• ribosomal proteins – the sequences of amino acids in ribosomal proteins are different
• lipids in their cell membranes
• compounds in their cell walls – no peptidoglycans.
4 a i Protoctista and Plantae
ii Protoctista, Fungi and Animalia
4 b
Kingdoms
Features
Protoctista Fungi Plantae Animalia
type of body unicellular and mycelium multicellular, multicellular,
multicellular composed of branching body most have
hyphae; yeasts a compact
are unicellular body
cell walls present in some ✓ (made of ✓ (made of ✗
species chitin) cellulose)
cell vacuoles ✓ ✓ ✓ ✓
algae have large large permanent large small
permanent vacuoles, vacuoles permanent temporary
protozoans have vacuoles e.g. food
small, temporary vacuoles
vacuoles
type of autotrophic and heterotrophic autotrophic heterotrophic
nutrition heterotrophic
cilia / flagella some have cilia for ✗ gametes in ✓
locomotion and some groups
feeding (e.g. Stentor) have flagella,
otherwise none
motility some are highly ✗ ✗ ✓
mobile, others are
(ability to move fixed to a substrate muscular
themselves) tissue
nervous ✗ ✗ ✗ ✓
coordination
5 a
Viruses are acellular / they do not have a but
cellular structure. • all organisms are interdependent, so
b t he type of nucleic acid, DNA or RNA maybe relying on hosts for
and the number of strands in each of reproduction is not unique to living
these molecules – one or two organisms
c
Some points that could be included in an • viruses have genes like living organisms
answer: • viruses have niches, e.g. specific cells of
Arguments for agreeing that viruses are their hosts where they reproduce
non-living: • viruses evolve like living organisms.
• no metabolism 6 ecosystem – a relatively self-contained,
• no respiration interacting community of organisms, and the
environment in which they live and with which
• no production of essential biochemicals,
they interact
e.g. no mechanism for making their own
proteins niche – the role of an organism in an
• no way to reproduce on their own ecosystem
• no way to replicate nucleic acid on their own 7 a Using the biological species concept:
the snails are able to breed together to
• rely on hosts cells to reproduce
give rise to fertile offspring.
b
Choose features that are easy to identify,
e.g. shell colour, presence / absence of
banding and numbers of bands on the of sea anemones found in this area was
shells. 12. Therefore, the species density is
Carry out breeding experiments to 12
2.5 m2 = 4.8 per m2
identify the different alleles and find
out which are dominant, recessive, b when it is not possible to count individual
codominant. organisms
Mark out an area of land and collect a Some examples:
sample of snails. • s ome organisms form a covering
Complete a tally table to find out over the surface of rocks and it is
the number of snails with different impossible to count individuals
phenotypes.
Use the Hardy−Weinberg principle to • c olonial animals, such as coral, have
estimate allele frequencies and frequencies far too many individual polyps to
of heterozygous individuals in the count
population. • g rass plants are often all
c
Artificial selection (selective breeding) – interconnected as they have spread by
reduces genetic diversity. asexual reproduction.
Humans select individual organisms that 10 a i species frequency:
have specific traits and therefore they number of quadrats on the lawn
select specific alleles; the alleles of other containing dayflowers = 6
organisms that are not selected to breed number of quadrats = 10
6
are selected out. This reduces the genetic species frequency = × 100 = 60%
10
diversity in the gene pool.
number of quadrats in the field
Habitat destruction – reduces genetic containing dayflowers = 3
diversity. number of quadrats = 10
The loss of habitat probably means that 3
species frequency = × 100 = 30%
the number of organisms in a population 10
ii species density:
of a species will decrease or may all die.
total number of dayflowers counted on
This will reduce the number of different
the lawn = 17
alleles particularly those that adapt the
total area
organism to the habitat which has been
sampled = 10 × 1.0 m2 = 10.0 m2
destroyed. 17
species density = = 1.7 per m2
Release of farmed fish into the wild – 10
reduces genetic diversity. total number of dayflowers counted in
The fish will be selectively bred, therefore the field = 8
genetically uniform with very little 8
species density = 10 = 0.8 per m2
variation in the alleles that they have for
b Using random quadrats ensures that the
each gene. If these fish breed with the wild
results are likely to be representative of
population, they are likely to dilute the
the whole area; the quadrat samples are
gene pool.
not biased in any way, e.g. not all taken
8 a
to standardise their method so ensuring from one part of the area being studied or
that their results could be compared an area with most species, fewest species
b
the numbers (abundance) of each species or with large areas of bare ground.
and the range of different types within c They are subjective / not objective. It is
each species (e.g. the various forms of difficult to be sure that you are using the
C. nemoralis in Figure 18.20) same method to estimate the area covered
9 a i
Sea anemones were found in five in each quadrat. Two or more people may
quadrats, so the species frequency not agree.
is 50%. It is difficult to assess cover when the
plants in your study area are of very
ii Ten quadrats were placed, so the total
different heights.
area is 10 × 0.25 m2, which equals
Smaller species underneath a canopy of
2.5 m2, was sampled. The total number
larger ones are often ignored.
Large leafy plants are often overestimated are many more limpets, dogwhelks,
compared with other methods. mussels and periwinkles on shore A which
It can be time-consuming unless there contribute to the higher value for the
is only a small number of species to be index.
sampled. 12 a
With an abundance scale, such as Braun− Woodland
Blanquet, some categories cover a wide Species n n 2
n
range of percentage cover so the results do N N
not discriminate, e.g. between 55% and 75% A 56 0.448 0.201
cover – both are given the same score of 4.
B 48 0.384 0.147
I n 11 a and 12 a the working shown in C 12 0.096 0.009
both columns 3 and 4 has been rounded D 6 0.048 0.002
to 3 decimal places so the individual
E 3 0.024 0.001
steps in the procedure can be followed.
total 125
I f you use a calculator or a spreadsheet number of n 2
it is best to round to an appropriate Σ = 0.360
individuals, N
number of decimal places at the last step N
in the calculation to avoid introducing
errors. Simpson’s index of diversity =1 – 0.360 = 0.640
b
An ecosystem that has one dominant
11 a
Shore B species that is very abundant may have a
Species n 2 large number of other species but there
n n
N would be very few individuals of those
N
other species. If abundance is measured,
painted 51 0.059 0.003 then there may be many individuals of
topshells this dominant species, but there may not
limpets 125 0.145 0.021 be many other species so it is species poor.
dogwhelks 63 0.073 0.005 An area with one dominant species which
is very abundant has a lower biodiversity
snakelocks 0 0.000 0.000 than an area with no dominant species
anemones and many species of all roughly the same
beadlet 22 0.026 0.001 abundance.
anemones
c
The area of grassland has a high
barnacles 391 0.454 0.206 biodiversity; the area beneath the conifer
mussels 116 0.135 0.018 trees has a much lower biodiversity.
periwinkles 93 0.108 0.012 d Making a kite diagram:
total 861 1 Draw a y-axis to represent the
number of n 2 distance along the transect.
Σ = 0.266 2 Draw an x-axis to represent all the
individuals, N
N different species recorded.
3 Draw vertical lines equidistant along
the x-axis to locate the positions of
For shore B, Simpson’s index of diversity the ‘kites’ for each species.
(D) = 1 − 0.266 = 0.734 4 Use an appropriate scale on either
side of each vertical line, e.g. 10 mm
Shore A has an index of 0.8 and shore B
b = 5 on the abundance scale.
has an index of 0.7. This means that shore 5 Plot the abundance data for each
A has a greater biodiversity than shore B. species along each vertical line.
The absence of snakelocks anemones and 6 Join the plots and shade in the ‘kites’
the small number of beadlet anemones or use different colours for each
on shore B is not compensated for by species.
the larger numbers of barnacles. There
See a kite for one species at the top of next 13 a 35

column. 30
of Vaccinium myrtillus
Percentage cover
70 25
60 20
15
50
Distance / m
10
40
5
30
0
20 0 5 10 15 20 25 30 35 40
10 Percentage cover of Calluna vulgaris
0 b
The data is ranked, with the lowest
5 4 3 2 1 0 1 2 3 4 5 percentage cover being ranked as 1, the
Abundance scale next is ranked as 2, and so on. If there
are two figures with equal percentage
cover, they are given an equal rank. In the
example given, there are two quadrats for
each species where this applies.
% cover % cover Rank

D D2
C. vulgaris V. myrtillus C. vulgaris V. myrtillus
30 15 9 8 1 1
37 23 11 10 1 1
15 6 5.5 4 1.5 2.25
15 10 5.5 5.5 0 0
20 11 7 7 0 0
9 10 3 5.5 −2.5 6.25
3 3 1 2 −1 1
5 1 2 1 1 1
10 5 4 3 1 1
25 17 8 9 −1 1
35 30 10 11 −1 1
n = 11 ∑D = 15.5
2

Next, calculate D (the difference between The figures are now inserted into the equation:
the ranks). Then calculate D2 for each
species (as in the χ2 test, this removes 6 × ∑D2
rs = 1 −
the negative signs). Calculate the sum n3 − n
of D2. (You could type the table into
6 × 15.5
a spreadsheet and get it to do all the rs = 1 −
calculations for you.) 1331 − 11
rs = 1 – 0.070
rs = 0.930
A correlation coefficient of +0.930 is very
close to +1, so we can conclude that there is a
positive correlation between the two species and Random sampling or systematic sampling
that the strength of the association is very high. could be used in this investigation. This is
Now look up the Spearman’s rank correlation the method for random sampling:
coefficient in the table of critical values 1
Mark out a large plot of the moorland
that correspond to the number of pairs of with tapes at right angles to each
measurements in results table (there are 11). other.
Number of pairs of Critical value at 2 Use a random number generator to
measurements p = 0.05 (5%) select coordinates where the quadrat
will be placed.
5 1.00
3 Record percentage cover of each
6 0.89
species.
7 0.79
4 Take a soil sample using any suitable
8 0.74 method – such as using a soil auger,
9 0.70 which is ‘screwed’ down into the soil
10 0.65 and then removed to extract a soil
sample all the way down to a fixed
11 0.62 depth
12 0.59 5 Take at least three samples of soil from
13 0.56 each quadrat.
14 0.54 6 Weigh a small quantity of soil from
15 0.52 each sample.
16 0.50 7 Dry the samples in an oven or leave in
17 0.49 the sun to dry.
18 0.47 8 Continue to dry and weigh the soil

until the mass remains constant / there
19 0.46 is no further decrease in mass.
20 0.45
9 Calculate the mass of water in the soil
30 0.36 (wet mass as extracted from the soil -
dry mass = mass of water or moisture
Table showing the critical values of rs at p = 0.05 content).
for different numbers of paired values. 10 Calculate the percentage of the
original soil sample that was water:
If the value for rs is greater than the
decrease in mass (= mass of water)
critical value, then you can reject the null
divided by the original mass of the
hypothesis. If the value of rs is less than
soil × 100.
the critical value, you can accept the null
hypothesis. 11 Draw a scatter graph of percentage
cover against percentage soil moisture.
c In this case, the value for rs is greater
than the critical value so the ecologist can 12 Calculate Spearman’s rank correlation
reject the null hypothesis and accept the coefficient.
alternative hypothesis. 14 a 100
d There is a significant correlation 90
Mean width of crack in
80
between the abundance (as measured by 70
bark / mm
percentage cover) of the two species on 60

the moorland. 50
40
e There are two variables: soil moisture 30
and percentage cover (or some other 20
measurement of abundance, such as 10
0
species density). 0.0 0.5 1.0 1.5 2.0 2.5 3.0
Circumference of trees / m
b The following steps are carried out: Number of pairs Critical value at
Step 1 Calculate the mean and standard of measurements p = 0.05 (5%)
deviation for each variable: 5 0.88
−
x = mean for circumference,
6 0.81
sx = standard deviation for 7 0.75
circumference
8 0.71
−
y = mean for width, sy = standard 9 0.67
deviation for width.
10 0.63
Step 2 Multiply each pair of values (for
each tree) together to give their 11 0.60
product, xy. 12 0.58
Step 3 Calculate the sum of the products 15 0.51
xy, to give Σxy.
20 0.44
Means and standard deviations can be
calculated with a calculator or a spreadsheet.
Table showing the critical values of r at p = 0.05
x = 1.608 for different numbers of paired values.
sx = 0.708
y = 50.083 In this case there are 12 pairs of
measurements and the critical value at
sy = 27.484 p = 0.05 is 0.58. The value of r (0.866) is
∑xy = 1151.8 greater than this, so the null hypothesis
can be rejected.
Now insert these figures into the formula:
∑xy − n−x−y d
The student can reject the null hypothesis
r= and we can accept the alternative
(n – 1)sxsy hypothesis that there is a correlation
1151.8 − (12 × 1.608 ×50.083) between the circumference of the trees
r= and the width of the cracks in their bark.
11 × 0.708 ×27.484
185.398 15 a Some examples:
r= pollution
214.045
deforestation
r = 0.866 overgrazing
c This shows that there is a fairly strong natural catastrophes (hurricanes, etc.)
correlation, but is this significant? As hunting / fishing
with Spearman’s rank, we can test this. habitat destruction
First we need a null hypothesis that b source of alleles for breeding to improve
there is no linear correlation between the agricultural species
circumference of the trees and the width source of potential medicines
of the cracks in the bark. economic reasons, e.g. for ecotourism
This is the table to use if the student has to maintain, food webs / nutrient cycles
made the hypothesis that there is a linear to maintain ecosystems that provide
correlation between the two variables. ‘services’ for humans
aesthetic reasons, e.g. the intrinsic beauty
of the natural world
16 Some possible answers: been treated with hormones so prepared

pressure on national parks of many for implantation (embedding in the
visitors endometrium).
the need to provide facilities for visitors Surrogacy – one or more embryos are
the need to restrict any damage done by placed into the uterus of a female who did
visitors not provide the female gamete. Pregnancy
so some areas may be fenced off to therefore occurs in a female who is
prohibit entry, e.g. during breeding season biologically unrelated to the embryo/
for some animals / time of flowering for fetus. This is to save the female who is
plants the source of the eggs from the risks of
populations of animals / plants must be pregnancy.
kept in check, e.g. to prevent overgrazing ‘Frozen zoo’ – a store of sperm, eggs and
park must provide habitats appropriate embryos of animals, many / all of which
for the species that live there are endangered species. Stored material
human activities in some parks need to be can be made available to zoos anywhere
controlled in some parks, e.g. building / in the world. The frozen zoo is a store of
development / transport / farming genetic diversity to prevent inbreeding.
17 a Zoos may not be able to provide the right c To prevent inbreeding. This reduces the
‘habitat’ suitable for breeding. Animals chances of them becoming increasingly
may need particular factors in their homozygous over several generations. The
environment before their reproductive health and fertility of animals is likely to
systems become able to produce sperm or decrease if they are inbred. For example,
eggs – e.g. to have plenty of space, or to the risk of developing genetic diseases
have many others of their species around caused by recessive alleles increases.
them. These factors affect their physiology 18 Some possible answers:
and their behaviour. Courtship may be
difficult in the conditions in which they
Zoos provide a refuge for endangered
live in a zoo. They may need particular animals, when their habitat no longer
changes in day length or in food supply to exists or is too fragmented to support
trigger hormonal changes associated with populations in the wild. They can keep
reproduction. These may not occur in the animals in better health than in the wild.
latitude where the zoo is situated. Males They conduct research on the best ways to
and females may be from very different breed them to increase the populations,
social groups and refuse to associate with also ensuring that health is maintained or
each other let alone mate. improved by restricting inbreeding. They
allow people to see animals that they
b
Artificial insemination (AI) – semen is would not otherwise see (except on video/
collected from the male and stored in thin TV). Zoos provide an important role in
tubes known as straws. These are injected conservation education.
into the vagina or uterus using a catheter
around the time of ovulation. 19 a Many wild plants are threatened with
In vitro fertilisation (IVF) – sperm are habitat loss and the effects of climate
collected from the male; eggs are collected change. Seeds can be kept for a long
from the ovary. Sperm and eggs are mixed time – possibly until suitable places and
together in a dish or tube to fertilise. The conditions are available for the plants
embryo is kept for a few days in culture. to be reintroduced. Seed banks keep the
Sperm bank – sperm are collected from genetic material that would otherwise be
males, mixed with an albumen solution lost.
and put into thin tubes known as straws. b Seeds that can be stored in seed banks
These are kept at –196 oC until required. are orthodox seeds. Some plants do not
Embryo transfer – embryos formed during produce this type of seed. Their seeds
IVF are inserted into the uterus for are known as recalcitrant. The plants
implantation to take place. They could be concerned have to grow as plants in a gene
inserted into the female which donated bank, e.g. for cocoa and coconut.
the eggs or into another female which has
20 a Selection pressures in the natural e.g. species frequency, species density,

habitat might include the ability of the percentage cover or an abundance scale.
adult plants to survive grazing, wide Use Simpson’s index of diversity to
variations in rainfall or competition compare the different areas.
with other species. In the seed bank, 22 Information about endangered or critically
none of these selection pressures endangered species could be recorded as
would apply. In the seed bank, the a table showing common names, scientific
greatest selection pressure will become names, IUCN classifications, threats (such as
the ability of the seeds to survive the habitat loss, hunting, etc.) and the steps taken
conditions in which they are stored for to conserve each species.
a long period of time. Seeds from store
are germinated every few years to check The IUCN database can be found here.
on their viability. Also some plants may
be grown in protected environments to Reflection
set seeds to replenish the stock in cold There are many reasons for being concerned
store. about the biodiversity and conservation of
b It is possible that the plants that grow microorganisms. These are examples.
from the seeds that have been saved will Microorganisms fulfil many roles in ecosystems:
not have characteristics that will allow
them to survive the selection pressures • decomposition
they will encounter in their natural • cycling nitrogen, e.g. nitrogen fixation
habitat. This could reduce the chances of (Figure 18.5), nitrification, denitrification
success in returning them to the wild. • cycling carbon, e.g. decomposition,
c Providing enough space to grow all the breakdown of complex compounds to simpler
plants necessary to have a collection compounds so that they can be respired to
of the genetic diversity in the species. form carbon dioxide
Keeping plants disease-free. There • cycling other elements, such as phosphorus
are problems involved in maintaining and sulfur
the collection in areas that might be
susceptible to natural catastrophes, such • fixation of carbon as many are photosynthetic
as hurricanes, severe storms, flooding and (Figure 18.5)
drought. • provide food for many organisms, e.g.
21 a Some possible answers: protoctists such as Stentor (Figure 18.7) at the
Alien species may be carnivores so will base of food webs.
prey on many animals. They will compete Microorganisms are useful sources of:
with existing predators in the ecosystem.
• antibiotics
They may be herbivores in which case
they will compete with the existing • enzymes, especially from extremophiles,
herbivores in the ecosystem. If plants, e.g. those that live in hot environments
they will compete with existing species for (see Taq polymerase in Chapter 19)
resources, e.g. light, minerals, water and • pharmaceutical products
space. They may introduce disease that the
• food products, e.g. yoghurt, bread, etc.
existing species have not experienced so
have no immunity. They will compete with • biofertilisers in agriculture
native species for space and breeding sites, • genes for use in genetic manipulation.
etc. They may change the environment so
that native species cannot survive Exam-style questions
b Find two areas: one invaded by an alien
species and one that has not. Carry out
random sampling. Count the number
of different species / make a species list.
Record the abundance of the different
species. Use an appropriate method,

to put range bars on their graph (showing
A or accept indicates an alternative acceptable maximum and minimum readings for
answer. each size of quadrat) / put error bars on
the graph (using standard deviation /
R = reject. This indicates a possible answer that standard error / 95% confidence intervals) ;
should be rejected. ; [max. 2]
The bold semicolon indicates the award of 1 mark. c
the 50 cm quadrat includes most of the
/ This indicates an alternative answer for the same species present in the habitat ;
mark. The alternatives may be separated from the if the quadrat was larger there would be
rest of the answer by commas. many more individuals to count (which
( ) Text in brackets is not required for the mark. would take longer) ;
Underlining This is used to indicate essential if the quadrat was smaller some of the
word(s) that must be used to get the mark. species might not be counted each time a
sample is taken ;
indicate that a different wording is acceptable comparative reference to the data, e.g.
provided the essential meaning is the same, and is mean number of 6 for quadrat of size
used where students’ responses are likely to vary 50 cm, but 7 for 100 cm ; [max. 2]
more than usual. d as the field is likely to be a uniform
AVP means ‘additional valid point’. This means habitat, quadrats are placed randomly ;
mark out a grid using tapes and take
that are not in the mark scheme, provided they random numbers to find coordinates
are relevant. But accept only as many additional across the grid to place the quadrat ;
AVP ; ; means award a maximum of 2 extra marks. either
ORA means ‘or reverse argument’ and is used record presence/absence of species (for
when the same idea could be expressed in the frequency)
reverse way. For example: ‘activity increases or
between pH2 and pH 5 ORA’ means accept record number of species and calculate
‘activity decreases between pH 5 and pH 2’. species density
max. This indicates the maximum number of or
record percentage cover (for those species
1 a it is difficult to count) ;[3]
Quadrat of side / cm Area / cm 2
10 100 [Total: 9]
25 625 2 a 44 and 36 ; [1]
50 2500 b
one plant may overlie another, so both would
be included in the cover for the quadrat ; [1]
75 5625
c it is difficult to estimate the percentage
100 10 000
cover with any more precision than this ;
(1 m2)
[1]
2 marks if all correct, 1 mark if only three d these results cannot be used to estimate
correct [2] species frequency ;
b
to collect results representative of the there may have been plants present that
whole area ; did not cover 5% of a quadrat ;
to calculate a mean ; there could be cowslips in all the quadrats
but only in number 4 were there enough
to see how much variation there is in the
to cover an area that could be rounded up
number of species per quadrat ;
to 5% (e.g. 2.6% is the smallest area that
to calculate, standard deviation / standard can be rounded up to 5%)
error ;
they would give an underestimate of c

one way to do this is by random sampling
species frequency for small plants ; with quadrats:
five quadrats is a small sample ;
generate random numbers to give
results are unlikely to be representative, coordinates for positioning quadrats ;
of the whole area ; [max. 4] put 10 (or more) quadrats on the waste
e any four of the following: ground ;
climate ; leave for several hours ; (because putting

down the quadrats may have disturbed
soil type / soil depth / soil fertility ; the beetles)
temperature, qualified ; e.g. by minimum / on return search for ground beetles in
maximum / mean annual / AW ; each quadrat and count them ;
drainage / rainfall / irrigation / water calculate the mean number per quadrat ;
supply ;
calculate an estimate of the number of
grazing / predation (by primary ground beetles in the area by dividing the
consumers / herbivores) ; area of waste ground by the area of the
availability of light / shading ; quadrat and multiplying the answer by
the mean number of ground beetles per
parasites / pests ;
quadrat ;
presence or absence of symbionts in the
repeat the investigation at different times
ecosystem (e.g. fungi and bacteria that live
of day ; [max. 4]
in mutualism with many plants) ;
[Total: 9]
application of, herbicides / fertilisers /
other named agricultural chemical ; 4 a 100
90
type / frequency, of cultivation ;
Percentage cover of
Mercurialis perennis
80
[max. 4] 70
60
[Total: 11] 50
3 a
formula for calculating estimated number 40
30
in population: 20
n ×n 10
N = 1m 2 0
2 0 10 20 30 40 50 60 70 80 90 100
39 × 35 Light intensity / percentage of full sun
;
20
= 68 ;[2] axes labelled – percentage cover and light
b the marking must, not harm the animal / intensity / percentage of full sun ;
be non-toxic ; points plotted accurately ;[2]
the marking must not influence the b
null hypothesis – there is no relationship
animal’s behaviour ; between the light intensity and the
percentage cover of Mercurialis perennis.
the marking must not put animals at
[1]
greater risk of predation ;
animals must mix at random after release ;
there is no, immigration / emigration,
from the waste ground ;
no ‘birth’ and/or death of beetles between
the two sampling times ;
[max. 3]
c
Light intensity / Rank
Percentage cover
Location percentage of Light Percentage D D2
of M. perennis
full sun intensity cover
A 90 10 6 2.5 3.5 12.25
B 50 65 3 6 −3 9
C 30 90 2 8 −6 36
D 20 80 1 7 −6 36
E 80 34 4 5 −1 1
F 88 20 5 4 1 1
G 93 10 7 2.5 4.5 20.25
H 100 0 8 1 7 49
n=8 ∑D = 164.5
2
6 × ΣD2 5 a 45
Number of stonefly nymphs

rs = 1 − 40
n3 − n 35
30
6 × 164.5
rs = 1 − 25
512 − 8 20
15
rs = 1 − 1.958 10
rs = −0.958 5
0
ranks stated correctly ; 0 20 40 60 80 100 120 140 160
ΣD2 calculated correctly ; Concentration of calcium
carbonate / arbitrary units
correct numbers substituted into the
equation ; axes labelled – concentration of calcium

carbonate / arbitrary units and numbers
value of rs = –0.958 (or –0.96) ;[4]
of stoneflies ;
correlation coefficient is –0.958 / –0.96 ;
d
points plotted accurately ;[2]

there is a negative correlation between
b There is no relationship between water
light intensity and percentage cover of
hardness and numbers of stonefly nymphs ;
M. perennis ;
[1] 6 × ΣD2
the critical value for 8 samples is 0.76, rs = 1 − 3
the value of rs is greater than the n −n
critical value so the null hypothesis is
6 × 536
rejected ; rs = 1 −
1728 −12
the correlation between light intensity and
percentage cover is significant ; [4]
rs = 1 – 1.874
[Total: 11] rs = – 0.874
ranks stated correctly ;
ΣD2 calculated correctly ;
equations ;
value of rs = –0.874 (or –0.87) ;[4]
5 c
Number Concentration of Rank

Stream of stonefly calcium carbonate / Stonefly Calcium D D2
nymphs arbitrary units nymphs carbonate
1 2 145 1 11.5 −10.5 110.25
2 3 80 2 9 −7 49
3 5 145 3 11.5 −8.5 72.25
4 7 28 5 4 1 1
5 7 90 5 10 −5 25
6 7 75 5 8 −3 9
7 8 55 7 6.5 0.5 0.25
8 10 55 8 6.5 1.5 2.25
9 12 42 9 5 4 16
10 30 22 10 3 7 49
11 40 20 11 2 9 81
12 42 17 12 1 11 121
n = 12 ∑D = 536
2
d correlation coefficient is −0.874 / −0.87 ; ii

the exact location (e.g. GPS

there is a negative correlation between coordinate) ;
water hardness and numbers of stonefly the depth of the soil sample ;
nymphs ;
the method to determine the percentage
the critical value for 12 samples is 0.54, of organic matter in the soil ;
the value of rs is greater than the critical the method for collecting the samples
value so the null hypothesis is rejected ; of leaf litter ;
ignore the minus sign for this step
AVP ;
[max. 3]
the correlation between water hardness

and numbers of stonefly nymphs is b 14
significant ; [4] 12
Number of woodlice
[Total: 11] 10
6 a i
to collect results representative of the 8
whole area ; 6
to calculate a mean ; 4
2
to see how much variation there is
0
in the number of species per 0 5 10 15 20 25
quadrat ; Percentage organic matter in the soil
to calculate, standard deviation /
axes labelled – percentage organic matter
standard error ;
and numbers of woodlice ;

to put range bars on his graph (showing
points plotted accurately ;[2]
maximum and minimum readings for
each size of quadrat) / put error bars c
There is no relationship between soil
on the graph (using standard deviation organic matter and numbers of woodlice ;
/ standard error / 95% confidence [1]
intervals) ;
[max. 2]
d Distance Percentage Mean Ranks

along organic number of Organic D D2
transect / m matter woodlice Woodlice
matter
1 5.42 0.6 1 1 0 0
4 10.02 2.3 5 3.5 1.5 2.25
8 15.56 2.3 10 3.5 6.5 42.25
16 8.25 1.3 2 2 0 0
20 9.62 6.0 4 5 −1 1
24 11.73 9.0 8 6 2 4
28 10.67 12.3 6 12 −6 36
32 9.36 11.6 3 10.5 −7.5 56.25
36 11.35 11.6 7 10.5 −3.5 12.25
40 15.11 11.0 9 8.5 0.5 0.25
44 20.87 10.3 12 7 5 25
48 20.30 11.0 11 8.5 2.5 6.25
n = 12 ∑D = 185.5
2
6 × ∑D2 correlation between the heights of the

rs = 1 − trees and their diameters in both
n3 − n
forests ;
6 × 185.5
both correlation coefficients are lower
rs = 1 −
1728 − 12 than the critical value ;
rs = 1 – 0.649 the null hypothesis would be accepted ;
rs = 0.351 there is no significant correlation between
the heights and the diameters ;[4]
ranks stated correctly ;
b the data is quantitative data ;
ΣD2 calculated correctly ;
the data for both measurements (height
and diameter) is very likely to show a
equation ;
normal distribution ;
value of rs = 0.351 (or 0.35) ;[4]

The researchers should check this before
e correlation coefficient is 0.351 ; deciding to do the test.[2]

there is a weak positive correlation c independent variable = rainfall ;
i
between percentage organic content of the
dependent variable = diameter of trees ;

soil and numbers of woodlice ;
[2]
the critical value for 12 samples is 0.54,
ii collect rainfall data from a local
this value is below the critical value so
weather station ;
the null hypothesis is accepted ;
choose a technique for selecting
there is no significant correlation between
random samples of trees ;
percentage organic content of the soil
and numbers of woodlice ;[4] any suitable method ; e.g. giving trees
numbers and selecting them by using
[Total: 16]
random numbers ;
7 a
the correlation coefficients for the data
measure the, diameter / width /
collected from the two samples of trees
circumference, of the trees ;
indicate that there is a weak positive
collect results from at least 20 trees b description of pattern in the numbers:

from each forest ; numbers decreased to 1986 ;
ensure they are approximately the increased to 1992 ;
same, age / height ;
fluctuated / AW, to 1998 ;
calculate means ; [max. 5]
increased to 2001 ;
iii use the t-test ; [1]
data quote ; e.g. numbers of elephants for
[Total: 14] minimum of two different years
8 a ecosystem diversity ; [max. 4]
species diversity ; c high density:
genetic diversity within each species ;[3] woodland is destroyed ;
b i
a species that is, likely to become loss of habitat ;
extinct / at high risk of extinction ;
[1] loss any named animal(s) ; e.g. beetles that
live in bark
there is a ban on trade (Appendix I) ;
ii
low density:
or trade is, limited / highly regulated
(Appendix II and III) ; grassland lost ;
prevents species being taken from the tree seedlings / saplings, not trampled /
wild (Appendix I) ; eaten ;
reduces the number of species grazers, decrease in number / migrate ;
taken from the wild (Appendices II less dung for, decomposers / dung beetles /
and III) ; fungi ;
helps to stabilise populations / AW ; AVP ; [max. 4]
so they can start to increase ; d
the number of animals is too great for the
poachers / traders, are prosecuted (to resources available ;
act as a deterrent) ; [max. 3] if the numbers are not controlled there
c maintains stability of ecosystems ; will be, overgrazing / AW ;

idea that ecosystems provide ‘services’ not enough food for other species ;
for humans ; many animals will die of starvation ;
ecotourism / wildlife, is a source of not enough water ;
income for countries and source of especially in the dry season ;
employment ;
animals may leave the park in search of,
species in the wild may be sources of new grazing / water ;
medicines ;
cause, damage to / loss of, crops ;
wild species are sources of plant foods ;
AVP ; [max. 4]
wild species are sources of animal foods ;
[Total: 14]
wild relatives of crop plants are a store
of potential alleles for future breeding of 10 a many wild plants are endangered ;
domesticated varieties ; any two reasons ; ;
AVP ; ; [max. 4] e.g. climate change / deforestation /
[Total: 11] erosion / flooding / overgrazing
9 a
standard error is a measurement of populations of many plant species (even
the variation of the results about the those not endangered) are decreasing ;
(population) mean ; loss of genetic diversity ;
an indication of the variation in the, seeds in seed banks can be stores of much
estimates / counts, that were made of the of this genetic diversity ;
elephants ;[2]
can be used in the future if habitats increases numbers of animals ;

become available for reintroductions ; [max. 3]
plants have genes yet to be discovered that ii close relatives are not bred together ;
may be useful in the future ; e.g. not breeding siblings with each
crop plants are all genetically uniform ; other / not breeding father with
could be wiped out by epidemics of plant daughter ;
diseases ; sperm collected from males and stored ;
wild relatives of crop plants have alleles transported to females in other zoos ;
that might be useful in the future ; artificial insemination ;
for plant breeding with a reason e.g. in vitro fertilisation ;
developing crops able to resist diseases /
grow in different conditions (e.g. the effect zoo / international organisation, keeps
of climate change on crops) records of breeding ;
[max. 6] R embryo transfer / surrogacy
[max. 3]
b a store of sperm, eggs, embryos ;
iii proportion of animals that survive (for
in, very cold conditions / liquid nitrogen suitable length of time to reproduce) ;
at –196 ˚C ;
number of females that have offspring ;
for future breeding of endangered species ;
survival rate of offspring ;
store of embryos for rearing in surrogate
mothers ; [max. 3] how fast the population grows ;
c i
bred in several places so not all at risk health of the animals ;
from same disease ; impact of reintroduction on the
safe from, hunting / poaching ; ecosystem ;
safe from natural catastrophes ; AVP ; [max. 3]
[Total: 18]
may be different.
Coursebook answers • The differences between DNA and mRNA

Chapter 19 • mRNA is single-stranded.
• There is no base pairing in mRNA.
Before you start • mRNA is much shorter than DNA.
• Features of DNA • mRNA is composed of nucleotides with
• DNA is a polynucleotide – formed from the bases A, C, G and U. (Uracil replaces
nucleotides. thymine.)
• Each nucleotide consists of deoxyribose • mRNA is not as stable as DNA and is
(a pentose sugar), a phosphate group and short lived.
a nitrogenous base. • Differences between protein and DNA
• There are four nitrogenous bases – • Proteins are composed of amino acids
adenine (A), cytosine (C), guanine (G) (not nucleotides).
and thymine (T). • There are 20 different monomers (amino
• A and G are purines, C and T are acids) in proteins, not 4 (nucleotides) as
pyrimidines. in DNA.
• Each molecule of DNA is composed of two • Proteins can be composed of one, two,
polynucleotides (often known as strands). three, four or more polypeptides. DNA is
• The bases on the opposite strands form composed of two polynucleotides.
base pairs (bp). • Proteins form a great variety of shapes.
• The bases on opposite strands are DNA is always a double helix.
attached by hydrogen bonds.
• The two strands are coiled around Science in Context
each other to form a double helix. This The only people who have identical DNA are
structure is very stable as it is very long identical twins (or identical triplets or identical
and therefore has many hydrogen bonds quadruplets). This is because they have formed from
between the strands. the same fertilised egg. Everyone else has DNA
• The sugar and phosphate groups of the which is unique. Human DNA is composed of three
nucleotides form the ‘sugar−phosphate billion base pairs. This gives plenty of opportunity
backbone’ of DNA and the nitrogenous for mutation to change the base sequences. It
bases project inside the helix. is thought that everyone who does not have an
• Adenine forms two hydrogen bonds with identical twin has DNA which is different from
thymine from the opposite strand. everyone alive and everyone who has ever lived.
• Guanine forms three hydrogen bonds with
cytosine from the opposite strand. Self-assessment questions
• The 3’ and 5’ carbon atoms of the 1 Selective breeding does not involve the
deoxyribose groups give the direction of insertion of specific DNA directly into the
each strand. DNA of the organism to form recombinant
• The two polynucleotide strands are anti- DNA. In selective breeding, specific varieties
parallel − one strand has 5’ → 3’ polarity, of plants, animals or microbes (e.g. yeasts)
the other strand has 3’ → 5’ polarity. are crossed together to improve a particular
• DNA molecules are very long – distances feature or give a desired combination of
are usually measured in kilobases or characteristics. This is achieved by combining
megabases. the genes inherited from two parents in sexual
reproduction. Genetic engineering does not
involve any breeding between individuals.
2 a Sticky end: a single-stranded length • they replicate independently within

of several nucleotides at the end of a bacteria to clone any genes that are
fragment of DNA that can form hydrogen inserted into them
bonds with an equivalent length of • they can be transferred between different
complementary nucleotides. Sticky ends bacterial species.
are formed by restriction enzymes that
make staggered cuts across DNA. They 5 The diagram should show the following:
can also be formed by adding a short • A piece of DNA is cut from a longer length
section of single-stranded DNA to a by a restriction enzyme to form sticky ends.
blunt-ended fragment of double stranded • A plasmid is cut with the same restriction
DNA (see Figure 19.3). enzyme as the piece of DNA to give sticky
b A 6 ends that are complementary to the sticky
B 8 ends of the gene.
C 1 • The sticky ends of the gene and plasmid

bind together. This can be shown by
D 4 including complementary bases for the
c The restriction sites are palindromic as two sticky ends.
the base sequences read the same in the • The sealing of the sticky ends can be
5´− 3´ direction as in the 3´−5´ direction. shown and an annotation used to explain
HindIII, BamHI and EcoRI give that this is carried out by DNA ligase that
staggered cuts across DNA and HaeIII catalyses the formation of phosphodiester
gives a straight cut across the DNA. bonds between sticky ends at either end of
d Each restriction enzyme always cuts at the piece of DNA.
the same specific place in DNA. Some restriction sites
restriction enzymes (e.g. HindIII and DNA cut by
EcoRI) give sticky ends that will form restriction plasmid
base pairs with complementary base enzyme
sequences. It is possible to join two pieces restriction
of DNA from different sources if they are DNA with site
sticky ends
cut with the same restriction enzyme. It is
possible to map the position of restriction
sites in lengths of DNA recombinant
plasmid cut plasmid
(e.g. chromosomes) and in genomes. with the same
restriction enzyme
3 rDNA is recombinant DNA made from as used to cut the
lengths of DNA from different sources, DNA to be inserted
e.g. from two different species or from two
different organisms of the same species. 6 Not necessarily. It depends where the gene for
A plasmid with an inserted ‘foreign’ gene is fluorescence is inserted into the plasmid. It is
a form of recombinant DNA. possible that some bacteria might have taken
up plasmids that do not contain the desired
cDNA is DNA produced by reverse
gene but do still contain the fluorescence gene.
transcription from a mRNA template.
7 The sequence of steps in the flow chart should be:
4 Advantages of using plasmids as vectors are:
2 Isolate mRNA for the gene required.
• they exist naturally in bacteria, which
are able to take them up from their 6 Use reverse transcriptase to produce
surroundings single-stranded cDNA.
• they are small so that they are easy to use 4 Use DNA polymerase to produce double-
stranded cDNA.
• they can be produced artificially by
combining lengths of DNA from different 8 Use an enzyme to add short lengths of
sources single-stranded DNA to form sticky ends.
• they are double stranded so genes from 7 Use a restriction enzyme to cut plasmids.
prokaryotes and from eukaryotes can be
inserted into them
10 Mix the double-stranded cDNA with d These have to be DNA polymerases that
plasmids. are thermostable – able to withstand
9 Form recombinant plasmids by the high temperatures used in PCR for
complementary base pairing. separating the strands of DNA. It is
important to call them DNA polymerases
3 Use ligase to seal the sugar−phosphate as RNA polymerases would not function
backbone of the recombinant plasmid. in a PCR machine to copy DNA.
1 Insert the plasmid into a host bacterium. e Double-stranded DNA is denatured by
5 Clone the modified bacteria and harvest heat which breaks the hydrogen bonds
the recombinant protein. between base pairs. Primers anneal to
opposite ends of the two strands. DNA
8 a UUUAAAGCGAGUCGGAAGGG
polymerase builds complementary
b Restriction enzymes have short target strands to form double-stranded
sequences that they recognise. See DNA.
Table 19.1 for examples of the restriction
10 a 256
sites for EcoRI and BamHI, etc.
b There is no enzyme that will use an RNA
Molecules of gRNA have much longer
template to make double-stranded RNA.
target sequences so detect fewer specific
Instead, reverse transcriptase uses an
sites compared with restriction enzymes.
RNA template to make single-stranded
The base sequences within the Crispr
DNA.
sequence can be modified to match
many more sites, so many more gRNA This DNA can then be replicated using
molecules can be made than there are DNA polymerase and this can be used
restriction enzymes. in PCR as shown in Figure 19.12. In this
way, multiple copies of cDNA can be
c The enzyme Cas9 cuts double-stranded
made which hold the information in the
DNA and removes a section of DNA.
original mRNA.
If targeted correctly, the gene may be
disabled as the protein produced is not 11 a PCR amplifies the samples of DNA
functional. It can also be used to insert from each member of the family so it is
a piece of DNA that corrects a faulty possible to see the DNA in bands on the
allele or insert a complete functioning electrophoretogram.
gene. b
Fragments of different lengths pass
9 a A primer is a short length of DNA that through the gel at different speeds. Larger
attaches to one end of a single strand of fragments travel more slowly through the
DNA and allows DNA polymerase to pores in the gel than smaller fragments.
begin to make a complementary copy D has only one band so must be
c
of the single template strand. A probe is homozygous for the normal allele, all the
a short length of DNA that attaches to others who were tested had two bands so
part of single strand of DNA. The probe, are heterozygous.
however, is labelled in some way, often
with the form of phosphorus that emits d
All the people who have developed
beta radiation (32P). The position of the Huntington’s have a band of DNA that
probe indicates the position of DNA. has not travelled very far.
b The primers do not anneal together

People who only have the smaller
as they do not have complementary fragments of DNA have not developed
base sequences. If they did have Huntington’s.
complementary base sequences, they Huntington’s is caused by more than
would form double-stranded DNA and be 40 repeats of the sequence CAG (see
useless as primers. Chapter 16).
c The four deoxynucleotide triphosphates People with larger fragments of DNA
(dNTPs) are dATP, dCTP, dGTP and have developed Huntington’s at earlier
dTTP. ages than people with the shorter
fragments. There appears to be a
correlation between length of DNA and group. For example, sickle cell anaemia in
the age when symptoms first appeared; peoples in parts of Africa, the Caribbean,
e.g. K has larger fragments than A South America, the Middle East and Asia.
and has developed symptoms at age 22 Also thalassaemia in peoples from around the
compared with age 50. Eastern Mediterranean and cystic fibrosis in
B and F have not developed symptoms
peoples of Northern European origin.
but have two different alleles. One of 16 Use gene editing to silence the dominant
them has more repeats than the other, but allele in all the cells where the gene HTT is
not enough to cause Huntington’s. expressed. This could be done using Crispr/
e K has inherited the dominant allele from Cas9 to disrupt a section of the DNA,
his father (H). The other members of the possibly its promoter. If the dominant allele is
family in generations 3 and 4 may also not transcribed then the elongated molecules
have inherited the dominant allele from of huntingtin would not be produced.
C and from H, but it is not certain that Unfortunately, it is likely to prove difficult to
they have. They could consider taking the alter the genomes of all the cells in the body
genetic test for Huntington’s. where huntingtin is produced.
12 STRs from the X and Y chromosomes are Much more likely is to use genetic screening
used to identify the sex of the person whose and genetic counselling to reduce the number
DNA is being tested. of children born with Huntington’s disease.
13 a Gene probes from all of the genes in 17 Some of these challenges are:
the human genome can be placed on • identifying the gene that causes the
a microarray. The mRNA from the genetic disease
cytoplasm of a cell is isolated and • making copies of the normal allele of the
converted into single-stranded DNA gene for use in gene therapy
using reverse transcriptase that uses DNA
nucleotides (dNTPs) that have fluorescent • finding a suitable vector to deliver the
tags. The quantity of this DNA can be gene into the genome of the specialised
increased by PCR. Single-stranded cDNA cells where it is expressed
is then applied to the microarray. cDNA • finding a way to get cells to take up
hybridises with the appropriate gene the vector
probes on the microarray and these are • ensuring the gene is inserted into the
detected when the microarray is scanned. genome in a place where it cannot do
Spots that fluoresce indicate the genes harm, e.g. by inserting into the middle
that have been transcribed to produce of a gene that codes for an important
the mRNA that was isolated from the enzyme or protein that regulates the
cytoplasm. cell cycle
b Mature red blood cells have no nucleus • choosing a suitable promoter to ensure
so transcription does not occur. However, the gene is transcribed
there may still be some mRNA left in the
cytoplasm especially if the red blood cell • finding people who are willing to
has only just left the bone marrow where volunteer for trials of the gene therapy.
it was produced from stem cells. Most of 18 rDNA is used in gene therapy. The rDNA
this mRNA will be for the α and β globin could be viral DNA and a normal allele used
polypeptides for making haemoglobin to correct a genetic fault. rDNA is inserted
molecules. into microorganisms and cells of eukaryotes
14 The genotype will be either homozygous to make recombinant proteins. Examples
dominant or heterozygous for the CFTR gene. are (recombinant) insulin, factor VIII and
adenosine deaminase (ADA). There are many
15 Genetic screening can be offered to couples to more recombinant human and animal proteins
find out if they are carriers of genetic diseases. that are available.
The tests are likely to target any disease(s)
known to be in their families and any that 19 There is no easy answer to this question.
are known to be associated with their ethnic Based on the text, you may wish to consider
the implications of germ line gene therapy
and whether this should be permitted. There • Test the effects of GM varieties on the
are several websites that have information environment before they are released for
which might help you, such as the BioEthics use by farmers.
Education Project website and the Learn. • Prevent transfer of genes from GM
Genetics website. crops by making it impossible for them
20 a The Bt toxin kills pests so farmers use less to interbreed with related species in the
pesticides and less of their crops are lost nearby environment.
to pests. This improves yields so reduces • Use ‘buffer zones’ around fields of GM
costs and increases profits for farmers. crops to reduce transfer of genes to
There are also health benefits for farm related species or organic crops.
workers who used to apply pesticides
in many countries without taking the
appropriate precautions.
Reflection
b
Grow cells in tissue culture and insert Templates for thinking maps can be found online.
gene(s) into individual cells. Each A ‘double bubble’ map is a good way to present
genetically modified cell can grow into a comparisons – as here between benefits and
whole plant so that the inserted gene(s) are hazards.
in all of the cells of the plant. Plants are Some of the benefits that could be incorporated into
grown that have been genetically modified a thinking map:
and show all the features required, e.g. pest • The use of genetically modified (GM) crops
resistance and high yield. increases yields and provides more food for a
21 potential risks: growing population.
• The spread of herbicide resistance to • GM crops decrease losses to competition with
weeds so they become ‘superweeds’ and weeds and feeding by insect pests.
cannot be killed by spraying chemicals. • The use of pesticide-resistant crops reduces
• Resistance genes may spread to non- pesticide use by farmers.
GM crops and ruin their organic status, • Animals can be genetically modified so that
especially important in countries where they grow faster and make more efficient use
GM crops are viewed with suspicion. of their feed.
• Genes may spread to wild relatives of • GMOS and eukaryotic cells can be used to
crop plants and change their genomes. produce human proteins, such as insulin,
• Genetic modification may make crop adenosine deaminase and factor VIII.
plants or their wild relatives invasive and • Gene editing is likely to have many uses in
spread rapidly in places where they are changing DNA in silencing faulty alleles and
not wanted or make them poisonous correcting them.
to wildlife.
• Gene therapy can be used to treat and perhaps
• Use of pesticide resistance genes increases cure genetic diseases, such as ADA-SCID and
selection of resistance in the pest species the eye disease LAC.
(e.g. widespread use of Bt corn has
increased selection of corn rootworms Some of the hazards that could be incorporated into
that are not killed by Bt). a thinking map:
• GM crops could produce substances that • Herbicide resistance genes could be transferred
promote allergic reactions in people (e.g. in pollen to weed species and lead to the
a gene from Brazil nuts inserted into soya development of ‘superweeds’ that are resistant.
beans to improve their quality produced • Foreign genes could be transferred to wild
an allergic response in people). relatives of crop plants so changing their
ways to minimise risks: genomes; this may ‘pollute’ those species that
may prove useful sources of genes for crop
• Use crop rotations rather than plant the improvement in the future.
same crop year after year in the same fields
to reduce any adverse effects of GM crops.
• Foreign genes can ‘pollute’ non-GM and reverse way. For example: ‘activity increases
organic crops, which require certification that between pH2 and pH5 ORA’ means accept
they provide ‘GM-free’ food. ‘activity decreases between pH5 and pH2’.
• GM crops require more herbicide applications max. This indicates the maximum number of
and just as much pesticide as non-GM crops marks that can be given.
so there is no advantage in terms of cost to 1 a
farmers or reduction in chemicals used in Enzyme Role
agriculture. DNA ligase catalysing formation of
• Farmers cannot keep seed for sowing for the phosphodiester bonds
following crop as GM crops do not ‘breed to join together the
true’; this favours large-scale commercial sugar–phosphate
farmers and does not favour many farmers in backbones of two
less economically developed countries. pieces of DNA
• GM microorganisms could ‘escape’ from DNA synthesises,
industrial facilities where they are used. polymerase polynucleotides /
strands, of DNA in
• Genes inserted into human genomes by gene (semi-conservative)
therapy could have unforeseen effects. replication from, dNTPs
/ activated (DNA)
Exam-style questions nucleotides
The mark schemes, suggested answers and restriction cut DNA at specific
comments that appear here were written by the enzymes restriction sites
author(s). In examinations, the way marks would reverse synthesises cDNA from,
be awarded to answers like these may be different. transcriptase dNTPs / activated
nucleotides, alongside
Notes about mark schemes an RNA template
Cas9 cuts DNA at specific
answer.
positions determined
R = reject. This indicates a possible answer that by the base sequence
should be rejected. of a molecule of guide
; The bold semicolon indicates the award of RNA
1 mark.
Award 1 mark per row. [5]
b
recessive allele often, does not code for
a protein / codes for a non-functioning
protein ;

any allele inserted into a cell should
Underlining This is used to indicate essential produce a functioning protein ;

dominant allele codes for a
AW means ‘alternative wording’. It is used to malfunctioning allele ;

dominant allele needs to be, ‘switched off’
/ ‘silenced’, which is difficult ;
more than usual.
gene therapy cannot target the exact
location in a chromosome where a piece
of DNA should be inserted to disrupt an
allele (e.g. by introducing a stop codon) ;
are relevant. But accept only as many additional [max. 3]
points as indicated by the bold semicolons, e.g. c advantages to max. 4:
removes uncertainty for those with a

ORA means ‘or reverse argument’ and is used genetic disease in the family ;
genetic screening provides information 2 a i guide RNA / gRNA ;

about the increased risk of people having to max. 2:
genetic conditions (e.g. breast cancer) ;
20-base sequence is complementary to
allows early treatment ; a specific sequence in DNA ;
which may improve, life expectancy / gRNA binds to DNA ;
quality of life ;
directs Cas9 to site that is to be cut ;
allows people to prepare for late-onset [max. 3]
genetic conditions, such as Huntington’s
disease ; gRNA locates part of faulty allele ;
ii
genetic tests can identify whether embryos
Cas9 cuts the sugar−phosphate
produced by IVF or embryos / fetuses backbone of both strands of DNA ;
developing in the womb are going to
piece of DNA with correct base
develop a genetic condition ; sequence inserts into the break in DNA ;
identifies fetuses that will need early
DNA repair mechanism forms
treatment if they go to full term ; phosphodiester bonds so piece of
allows parents to prepare for the birth DNA restores correct base sequence ;
of a child who will need treatment for a [max. 3]
considerable time or even throughout life ; b i
(helper) T-lymphocytes activate B cells
identifies carriers of genetic conditions ; during immune response ;
helps to provide early diagnosis ;
stimulate B cells to differentiate into
allows couples who are both carriers of a plasma cells ;
genetic condition to make decisions about,
(killer) T-lymphocytes search out
starting a family / having more children / infected cells ;
seeking IVF and embryo biopsy ;
release toxic substances into
reducing the number of people with, long- cells ; max. [2]
term / incurable conditions and thereby ii
Cas9 cuts the gene that codes for
save the money that would be used to pay protein PD-1 ;
for their treatment ;

repair mechanism introduces nucleotides
AVP ; that change the coding for PD-1 ;
disadvantages to max. 4:
a stop codon could be introduced into
results may be false, positives / negatives ; the base sequence ;

genetic test may not be test for all
so mRNA is produced but no
mutations ; functioning protein is translated ;
tests may not be available for genetic
if there is an insertion of a base or a
condition in a family ; deletion of a base, a frameshift occurs ;
positive result gives, stress / fear ;
all codons downstream of break in
presence of mutant allele may not result DNA are changed ;
in the condition ; so that a protein with a very different

may cause needless, worry / anxiety ; amino acid sequence is produced that
is non-functional ; [max. 5]
problem for people communicating result
of test (e.g. to friends / family) ; c i
easy to obtain blood cells and stem
cells from bone marrow ;
discrimination by, employers / insurers ;

remove cells from the body and culture
ethical issue(s) raised by termination of them ;
pregnancy following prenatal
screening ;
AVP ; [max. 7]
[Total: 15]
easy to direct Cas9 into the cells ; d

different target DNA has different base
far more difficult to direct Cas9 into sequences, so a pair of primers like those
nerve / muscle cells throughout the in the previous question is not suitable ;
[2]
body ; [max. 3]
e the concentration of primers is very high
ii
no risk of an immune response (as and the concentration of single-stranded
there is to a virus) ; DNA is very low ;

no risk of an infection (as there may
the chance of single-stranded DNA
be with a virus) ; reforming double-stranded is very low ;

targeting of the change to DNA is far [2]
more precise ; [3] f
PCR occurs at temperatures between 50 °C
[Total: 19] and 90 °C, not at temperatures below 40 °C ;
3 a
(thermostable) DNA polymerase / Taq the primer is DNA not RNA ;
polymerase ; [1]
replication copies the entire DNA in a cell,
b i
at high temperatures the double- PCR only copies small stretches of DNA ;
stranded DNA is denatured ;
the DNA polymerase used in PCR is

hydrogen bonds break so that the two thermostable, in most organisms it is not /
strands separate exposing the only in thermophilic organisms ;
bases ; [2] PCR occurs in small plastic tubes![4]
ii
polymerase is, thermostable / not [Total: 20]
denatured at high temperature ;
4 a i
a marker gene is transcribed along

ref to bonding that maintains tertiary with the structural gene(s) ;
structure ; [2]

GFP is produced (as well as required
iii
a buffer solution maintains a constant protein) ;
pH in the region of 7 to 8 ;
GFP fluoresces ;

optimum pH for DNA polymerase ;

fluorescent, cells / organisms, indicate

magnesium ions are a cofactor for the that they have, been transformed /
enzyme ; [max. 2] received the required (foreign) gene ;
c i stage 2 is annealing: [max. 3]
primers bind with the target sequence
ii
if provided with a substrate the
on DNA where there is a sequence of enzyme can produce larger quantity
complementary bases ; of fluorescent substance than
transcription and translation of a gene

stage 3 is the elongation or extension
for GFP ;
stage:

intensity of colour less dependent on
DNA polymerase adds nucleotides to
the level of expression of the marker
the primer to form double-stranded
gene ; [max. 1]
DNA ;
b i either
using the original strand as a template ;
[3] use PCR with a suitable primer ;
ii the DNA that is separated into two
to amplify the region of the genome
strands in the first cycle is the DNA that contains the gene ;
from the whole sample ; or
this is much longer than the strands identify mRNA from a suitable cells ;

that separate during all subsequent
cycles ; use reverse transcriptase ;
there are more hydrogen bonds that to synthesise cDNA ;

have to break during the first cycle ; or
[max. 2]

use amino acid sequence of growth larger quantity of growth hormone
hormone from chinook salmon to produced than in diploid salmon ;
predict the nucleotide sequence ; triploid fish grow, faster / larger, than
synthesise the DNA without the diploid fish ;
need for pre-existing DNA (synthetic triploid organisms are sterile ;
biology) ;

chromosomes cannot pair at beginning of
or meiosis ;

fragment DNA with restriction so no gametes are formed ;
enzymes ;
triploid fish cannot breed with wild fish ;
separate them by electrophoresis ; [max. 3]

use a gene probe to identify the d GM salmon could escape from fish farms ;
appropriate gene ; [max. 2]
compete successfully with, wild salmon /
ii
promoter is, ‘upstream’ of the other species ;
structural gene / 5´ region next to the
structural gene ; introduce (new), disease(s) / parasite(s) ;

the promoter is the region of DNA where change the, ecosystem / food web ;
(some) transcription factors bind ; mutation may give rise to diploid salmon ;
where RNA polymerase binds to GM salmon breed with wild salmon ;
DNA to begin transcription ; change the genome of wild salmon ;

promoter determines the specific cells in AVP ;
which the structural gene is expressed ;
[max. 4]

promoter determines, when / how
much, expression there is ; [Total: 22]
[max. 3] 5 a vector ; [1]
iii
sequences cut with restriction b i use the genetic code ;
enzymes to form ‘sticky ends’ ;
each DNA, triplet / codon (on coding

‘sticky ends’ joined by hydrogen / non-template strand), codes for a
bonding ; specific amino acid ; [2]

complementary base pairing / A−T ii search databases for, identical / similar,
and C−G ; sequences ;
sealed by ligase ; find a match with another sequence for

ligase catalyses formation of which the protein function is known ;
phosphodiester bonds ; predict the tertiary structure of the
[max. 3] polypeptide from the primary
iv use of a vector ; structure ;
e.g. virus ; compare with shapes of proteins of
known functions ; [max. 3]
into, germ line cells / egg ;
iii change to bonding between R-groups ;

direct entry by firing DNA-coated
tungsten particles into cells ; any example, e.g. ionic / hydrogen,
bond no longer forms ;

direct entry by injection into
cytoplasm ; change to, tertiary structure / (3D)
shape, of AChE ;
electroporation ;
part of AChE / protein, where
electric shock given to cell insecticide binds changes shape ;
membrane ; [max. 3]
insecticide molecule can no longer
c three copies of each gene ; bind to AChE ; [max. 3]
c spontaneous mutation ;
ref to Golgi body and modification of
change in DNA base sequence (of the protein / any example ; [max. 5]
gene Ace) ; d any two suitable reasons, examples:
any example ; e.g. base substitution (see see if GM crop grows well under,
example given in the question and use the field conditions / range of different
genetic code to suggest the base change) environmental conditions ;
aphids which express the mutation are not to see if GM crop has a suitable yield ;
killed by, pirimicarb / insecticide ; ORA ensures that resistance is effective ;
pirimicarb cannot bind to AChE, so it check that plants are not harmful to the
remains active ; environment ;
resistant aphids have greater chance to check that plants respond to fertiliser ;
reproduce ; [max. 3]
(natural) selection ; e pesticides:
selective agent is pirimicarb ; reduce losses of crops to, pests ;
directional selection ; reduce use of pesticides ;
frequency of resistant allele increases ; better for health of, farm workers / local
allele remains beneficial so long as population ;
pirimicarb is used ; [max. 6] less pesticide residues in crops ;
[Total: 15] better for health of consumers ;
6 a to allow RNA polymerase to start no / less, harm to non-pest species ;
transcription ;
less pollution ;
in, host / plant, cells ;
herbicides:
site of action of host transcription factors
to activate transcription ; [max. 2] less competition with weeds for (named)

resources ;
b
joins the phosphate−sugar backbone of
(fragments of) DNA together ;
idea that increase in food available for
human population which is increasing ;
catalyses formation of phosphodiester
bonds ; AVP ; (for either pesticides or herbicides
or for both) [max. 5]
joins promoter to gene for Bt toxin and
gene + promoter to plasmid ; [max. 2] [Total: 17]
c
gene / cry, codes for the sequence of 7 a i substitution ; [1]
amino acids in, toxic protein ; ii
tertiary structure of the, protein /
gene / cry, is transcribed to form mRNA ; polypeptide, may change ;
mRNA moves from nucleus to cytoplasm ; A folding of the polypeptide is

different because amino acids with
mRNA attaches to ribosome where non-polar R groups form hydrophobic
translation occurs ; ‘pockets’ inside the tertiary structure ;

tRNA molecules bring specific amino amino acids with polar R groups form
acids to ribosome ; hydrogen bonds ;

pairing between codons on mRNA and hydrophobic ‘pocket’ may not
anticodons on tRNA ; form when proline is replaced with

enzyme / peptidyl transferase (in ribosome), glutamine ;
catalyses formation of peptide bonds hydrophobic (non-polar) R group
(between amino acids) ; replaced by hydrophilic (polar) R
ribosome assembles amino acids into group ;
toxic protein ; this may change solubility of protein ;
AVP ; [max. 3]
b BRCA-1: ii founder effect ;

the mutant allele will be expressed in each groups of people are all descended
person who inherits it ; from very small populations ;
so increasing risk of developing breast genetic drift ;
cancer ; non-random mating / mating within
CFTR: the group rather than with people
anyone with one copy of mutant CFTR, from other groups ;
does not express it / is a carrier ; increases the chances that frequency
so not at risk of CF ; of mutant allele becomes common
within the group ; [max. 3]
woman who has one parent with one
mutant allele of BRCA-1 has a 50% iii the proportion of the population
chance of increased risk of breast cancer that has mutations of BRCA-1 and
associated with the mutant allele ; BRCA-2 may be quite small ;
person with one parent with mutant allele cost-effective to concentrate screening
of CFTR has 0% chance of inheriting, the on, ethnic groups / populations, at
disease / CF ; risk ;
parents of person with CF are both can offer screening to particular

carriers ; ORA [max. 3] families at risk ;
c i deletion leads to a frameshift / more cost effective than mass

described as change to the reading screening for the mutant allele(s) ;
frame ; people identified as ‘at risk’ can be
results in a stop codon in the DNA ; offered genetic counselling ;
no tRNA for the stop codon, so allows people at risk to be given
translation terminates (at amino acid 38) ; appropriate information about the
effects of the mutation ;
[max. 2]
AVP ; [max. 3]
[Total: 15]
may be different.
Coursebook answers
Chapter P1
At this level, practical skills are examined in a AW means ‘alternative wording’. It is used to
laboratory-based practical examination. indicate that a different wording is acceptable
The mark schemes, suggested answers and provided the essential meaning is the same, and is
comments that appear here were written by the used where students’ responses are likely to vary
author(s). In examinations, the way marks would more than usual.
be awarded to answers like these may be different. AVP means ‘additional valid point’. This means
Notes about mark schemes that are not in the mark scheme, provided they
A or accept indicates an alternative acceptable are relevant. But accept only as many additional
answer. points as indicated by the bold semicolons, e.g.
should be rejected. ORA means ‘or reverse argument’ and is used
; The bold semicolon indicates the award of 1 mark. reverse way. For example: ‘activity increases
/ This indicates an alternative answer for the same between pH2 and pH5 ORA’ means accept
mark. The alternatives may be separated from the ‘activity decreases between pH5 and pH2’.
rest of the answer by commas. max. This indicates the maximum number of
( ) Text in brackets is not required for the mark. marks that can be given.
Underlining This is used to indicate essential 1 C; [1]
2 C; [1]
3
Two important control
Investigation Independent variable Dependent variable
variables
The effect of sucrose sucrose concentration % plasmolysis of • source of onion
concentration on plas- onion cells cells
molysis of onion cells • length of time
of immersion
The effect of pH on pH rate of activity of • concentration of
the rate of activity amylase, measured amylase
of amylase as e.g. the rate of • concentration of
disappearance of starch substrate
or rate of appearance • temperature
of maltose
The effect of tempera- temperature percentage of open • wind movement
ture on the percentage stomata in leaf • light
of open stomata in • humidity
a leaf • pre-treatment of leaf
(i.e. anything that
might affect its
degree of hydration)
• source of leaf (same
species, age, position
on plant)
1 mark for each box completed correctly [9]
4 a A epidermis ; vi no. of squares covered by lignified

B cortex / parenchyma ; tissue in stem counted ;
C phloem ; no. of squares covered by whole stem
D endodermis ; [4] counted ;
b i LP plan drawn with no cell detail ; % squares occupied by lignified tissue

in stem calculated correctly ;
xylem only drawn inside circle ; (answer should be around 1%) [3]
correct proportions ; stem needs more support than root ;
vii
lines continuous, not sketchy and because upright in air and needs
sharp pencil used ; [4] support to prevent it falling over /
collapsing ; AW [2]
ii LP plan drawn showing vascular
bundles only and no cell detail ; c roots subjected to tugging / pulling
pressure from parts above ground ;
sclerenchyma, xylem and phloem
drawn in outline ; [2] roots spread out, so like a series of guy
ropes ; stem a single column ;
iii no. of squares of graph paper
covered by lignified tissue in root greater strength from a ring of rods than
counted ; [1] from one central rod ;
iv no. of squares of graph paper covered ring of rods provides greater resistance
by whole root section counted ; [1] to compression from above than a single
central rod ;
v % squares occupied by lignified
tissue in root calculated correctly AVP ; accept any reasonable suggestion(s)
from student’s answers to iii and iv ; which are based on different stresses to
(answer should be greater than which roots and stems are subjected.
for root) [1] [max. 2]
[Total: 20]
5 a i ‘Temperature / °C’ on x-axis and 6 a x-axis is ‘Time / minutes’, y-axis is

‘Enzyme activity / mean number of ‘Number of individuals’ ;
carbon dioxide bubbles released per scales on both axes with suitable range
minute’ on y-axis ; and interval ;
suitable scales on both axes – range all bars plotted accurately or points
from 10 or 15 to 40 on x-axis and 0 plotted accurately (using crosses or
or 5 to 20 on y-axis, in intervals of encircled dots) ; all lines neat and thin,
2 or 5 ; plus key ; [4]
all points plotted accurately, using b on both days, minimum time taken is
crosses or encircled dots ; 35 minutes and maximum time taken is
thin, clear, best-fit line drawn or 55 minutes ;
points joined with ruled lines – no on both days, number of individuals is
extrapolation ; [4] greatest near the centre of the range ;
ii correct reading from graph, including on day 1, greatest number of individuals
unit (mean number of bubbles per take 45 minutes to digest starch, but on
minute) ; [1] day 2 greatest number of individuals take
iii accuracy: 40 minutes to digest starch ;
use water bath to change independent mean time is greater on day 1 than on
variable ; day 2 ; [max. 3]
control of significant named variable c temperature may have been higher on
plus method of control (e.g. use same day 2 ;
type of yeast) ; animals on day 2 may have eaten recently
use named apparatus (e.g. gas syringe) and so had more saliva / amylase in their
to collect gas (for measurement of mouths ; [max. 1]
dependent variable) ; d use individuals of same age/mass/
reliability: body weight ;
increase number / range of ensure pre-treatment is the same (e.g. food
temperatures ; repeat each given, environment) ;
temperature three times and use same volume of saliva ;
calculate mean ; [max. 3]
use same volume and concentration
b hypothesis is supported ; of starch ;
quote figures for change in mean number keep temperature the same by using a
of bubbles between any two temperatures water bath ; [max. 3]
between 15 °C and 40 °C ;
reference to no data below 15 °C or above [Total: 11]
40 °C ; so cannot tell if hypothesis is also
supported outside this range ; [max. 2]
[Total: 10]
may be different.
Coursebook answers
Chapter P2 AW means ‘alternative wording’. It is used to indicate
that a different wording is acceptable provided the
Exam-style questions essential meaning is the same, and is used where
students’ responses are likely to vary more than usual.
At this level, practical skills are examined in a
laboratory-based practical examination.
The mark schemes, suggested answers and that are not in the mark scheme, provided they
comments that appear here were written by the are relevant. But accept only as many additional
author(s). In examinations, the way marks would points as indicated by the bold semicolons, e.g.
be awarded to answers like these may be different. AVP ; ; means award a maximum of 2 extra marks.
A or accept indicates an alternative acceptable reverse way. For example: ‘activity increases
answer. between pH2 and pH5 ORA’ means accept
R = reject. This indicates a possible answer that ‘activity decreases between pH5 and pH2’.
should be rejected. max. This indicates the maximum number of
; The bold semicolon indicates the award of marks that can be given.
1 mark. 1 a axes of scatter graph are labelled length /
/ This indicates an alternative answer for the same mm and mass of seeds / g ; note that it
mark. The alternatives may be separated from the does not matter which is on the x-axis and
rest of the answer by commas. which is on the y-axis
( ) Text in brackets is not required for the mark. suitable scales on each axis ;
Underlining This is used to indicate essential all eight points correctly plotted ;[3]
word(s) that must be used to get the mark. b positive linear correlation ;[1]
1 c Pod Length / mm x Mass of seeds / g y xy

1 134 35 4690
2 71 18 1278
3 121 30 3630
4 83 21 1743
5 99 23 2277
6 107 29 3103
7 82 17 1394
8 119 34 4046
mean –
x = 102.0 –
y = 25.9 Σxy = 22 161
nx–y– 8 × 102.0 × 25.9 = 21 134.4
standard sx = 22.1 sy = 7.1
deviation
∑xy − nxy
r= 6 × ∑D 2
nsxsy r1 = 1 −
n3 − n
22 161 – 21 134.4 (6 × 160.5)
r= r=1−
8 × 22.1 × 7.1 (83 − 8)
22161– 21134.4 963
r=
1255.3 r = 1 − 512 − 8
1026.6 963
r= r=1−
1255.3 504
r = 0.82
r = 1 − 1.91
This number is close to 1, which suggests that
r = −0.91
there is a linear correlation between the length of
the pods and the mass of the seeds they contain. Using Table P2.8, the critical value of r when
n = 8 is 0.76.
means for length and mass both correct ;
The value of r is greater than this, so there is
mean for mass correct ; a significant negative correlation between the
all values for xy correct ; numbers of F and the numbers of G.
Σxy correct ; working is clearly laid out and easy to follow ;
nx y correct ; ranking correct for F and G ;
correct formula used ; all values for D and D2 correct ;
substitution into formula correct ; ΣD2 correct ;
correct value for r calculated ; substitution and calculation of r correct ;
statement explaining what this value identification of the critical value in the
indicates ; [max. 8] table ;
[Total: 12] correct conclusion drawn ; [7]
2 a axes of scatter graph are number of [Total: 12]
species F and number of species G ; note 3 a i light intensity / exposure to light ; [1]
that it does not matter which is on the
x-axis and which is on the y-axis ii independent variable: collect large
number of leaves from a sunny area
suitable scales on each axis ; and a shaded area ;
all eight points correctly plotted ; [3] control variables: collect leaves in
b a negative non-linear correlation ; [1] a way that controls at least one key
variable ; (e.g. all from same height,
c the correlation is non-linear ;[1]
all from same relative position on the
d ivy stem)
Quadrat Rank for Rank for Difference D2 measuring dependent variable /
species species in rank, procedure: suitable description of
F G D method of finding surface area of
1 5 2.5 2.5 6.25 each leaf ;
2 2 7 -5 25 reference to multiplying by 2 to find
total surface area ;
3 8 2.5 5.5 30.25
4 3 6 -3 9 suitable description of how to find dry
mass, including reference to method
5 1 8 -7 49
of drying and apparatus used for
6 7 1 6 36 measuring mass ;
7 4 5 -1 1 suitable description of how to measure
8 6 4 2 4 internode length, including apparatus
ΣD2 160.5 used ;
suitable description of method of use syringe to begin with water at a

measuring water loss (e.g. by weighing suitable point in the tubing ;
or by using a potometer) ; leave for some time to settle
description of controlling one key down before beginning to take
variable (temperature, humidity, measurements ;
wind speed) while measuring rate of reliability: do replicates and calculate
water loss ; means ;
description of replicates and risk: no significant risk / reference
calculation of mean values ; to care needed when, cutting shoot /
processing data: reference to pushing shoot into capillary ; [max. 8]
calculation and use of standard iii s uitable method described for finding
deviation (to give the ± values) ; the volume of a cylinder ;
safety: reference to risk, e.g. that r efer to using distance moved by water
there are no significant risks in this calculation ;
involved ; [max. 8]
or
b i t = 23 – 15 ;
use the syringe to push the water back
+32 ÷ 30 ; to its starting position ;
8 ÷ 0.9 = 8.9 ; [3] measure volume of water needed to
ii v = (n1 – 1) + (n2 – 1) = (30 – 1) do this ; [max. 2]
+ (30 – 1) = 58 ; [1] b axes with independent variable on the
iii
both values of t are (much) greater x-axis and the dependent variable on the
than 2.00 / greater than the critical y-axis ;
value (for 60 degrees of freedom) ; suitable curve or bars to show results
t herefore the results are significant / (this depends on what is being measured
the differences between the two sets and how) ; [2]
of leaves are significant / not due c i area = 36 / 10 000 = 0.0036 m2 ;
to chance ; [2]
water loss = 0.018 / 30 = 0.0006 cm3 min–1 ;
[Total: 15]
rate = 0.0006 / 0.0036 = 0.167 cm3
4 a i e .g. the rate of water loss from a m–2 min–1 ;[3]
mesophyte will be greater than the rate
of water loss from a xerophyte ;[1] ii t-test ;
ii independent variable: collect, shoots comparing the means of two sets
/ leaves, from a mesophyte and of, data with normal distribution /
xerophyte ; continuous data ;[2]
measuring the dependent variable: d mesophyte has a greater transpiration rate
record rate of movement of meniscus than the xerophyte ;
along the capillary tube, include both lose less mass when lower surface
reference to distance and time ; is covered ;
control variables: shoots / leaves, with more water lost from lower surface than
similar surface areas ; from upper surface ;
same temperature / wind speed /
xerophyte loses almost no water from its
humidity ;
upper surface ; [max. 3]
procedure: cut shoot under water with
[Total: 21]
slanting cut ;
dry shoot before beginning
measurements ;
ensure apparatus entirely airtight ;

Biology Coursebook Answers AS - A Level

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Biology Coursebook Answers AS - A Level

Uploaded by

Copyright:

Available Formats

CAMBRIDGE INTERNATIONAL AS & A LEVEL BIOLOGY: COURSEBOOK

3 a actual diameter = 20 µm (see caption) • The nucleus is seen to be surrounded by a

magnification, M = size of image, • Mitochondria have a surrounding double

a model sausage, the cut surface of a Mitochondrion Site of ATP synthesis in

Is this a meaningless question? max. This indicates the maximum number of

d chromatin and chromosomes both surface membrane controls exchange

smooth ER lacks ribosomes, rough ribosome ;

i centrosome (accept centriole) ;

Label Name of structure Function

mitochondrion ; 10 a i 100 000 g

Award 1 mark for each correct column. [8]

e.g. elastin, viral coat 5 O

enzyme AVP e.g. amylase ; 4 1

general formula (CH2O)n / contain the galactose

glucose correctly drawn ;

alanine glycine B identified as phospholipid

regarded as valuable and essential because no one

Initial rate of reaction

b Many protein-digesting enzymes have an enzyme A

1 C ; [1] 9 a succinic acid ; [1]

c 40 °C is (close to) the optimum h

cool to room temp / 40 °C, add equal d inhibitor A is competitive, B is non-

Exam-style questions substances across membranes, and in the

2 D ; [1]  [Total: 15]

Process Uses energy Uses proteins Specific Controllable by cell

e the graph for diffusion is linear / a straight c i 85% ; [1]

11 a the living contents of a plant cell ; [1] b active transport ;

b i 100% ; [1] active transport involves pumping ions

Notes about mark schemes

part of centrosome ; award this mark only if  [Total: 7]

region of a chromosome that holds two A True ;

Award 1 mark for each correct summary.[3] D False ;

 [Total: 6] This occurs during M phase during

location in nucleus nucleus and

DNA unwinds and the two strands separate

nuclear amino acid-tRNA

Exam-style questions Notes about mark schemes

4 D; [1] a triplet may be altered to a stop signal ;

8 10 a the DNA in the spleen and thymus of the

Award 1 mark for each correct entry.  [10]

b i 1 metre = 1000 mm Reflection

Table 7.2: Comparing xylem and phloem – similarities

Table 7.3: Comparing xylem and phloem – differences (completed).

Exam-style questions c Refer to Section 7.4, The transport of

Feature Artery Vein Capillary

c ause change in shape of Hb 6 atrioventricular atrioventricular right

iii Bohr shift ;  [1] 2

iv causes more release of oxygen (than if 0

c i atrial systole ; [1] b

• number of different intensities of exercise – at 1 C ; [1]

b i (T / mitochondria) provide, energy / mucus and pathogens swallowed ;

cell R – secretes mucus ; smooth muscle (to max. 3)

mucus traps, dust / bacteria / viruses / contracts to decrease the, diameter /

prevents their entry to, alveoli / gas A trachea / bronchi / bronchioles

7 a relax to increase volume of air into lungs

ii oxygen diffuses down its concentration b breathing / ventilation ;

Coursebook answers • Use personal hygiene, e.g. wash hands

Self-assessment questions the malarial parasite. These develop into the

18 some suggested precautions: 22 a  he more frequently antibiotics are used,

in 2016, could give rise to a new class of 1 A ; [1]

transfers, parasite / pathogen / 7 a bacteria pass out in faeces of infected

V. cholera destroyed in sewage poor access to health care ;

3 a actual diameter = 20 µm (see caption) • The nucleus is seen to be surrounded by a

d chromatin and chromosomes both surface membrane controls exchange

smooth ER lacks ribosomes, rough ribosome ;

Award 1 mark for each correct column. [8]

b Many protein-digesting enzymes have an enzyme A

1 C ; [1] 9 a succinic acid ; [1]

c 40 °C is (close to) the optimum h

cool to room temp / 40 °C, add equal d inhibitor A is competitive, B is non-

2 D ; [1] [Total: 15]

e the graph for diffusion is linear / a straight c i 85% ; [1]

11 a the living contents of a plant cell ; [1] b active transport ;

b i 100% ; [1] active transport involves pumping ions

part of centrosome ; award this mark only if [Total: 7]

Award 1 mark for each correct summary.[3] D False ;

[Total: 6] This occurs during M phase during

4 D; [1] a triplet may be altered to a stop signal ;

8 10 a the DNA in the spleen and thymus of the

Award 1 mark for each correct entry. [10]

Exam-style questions c Refer to Section 7.4, The transport of

c ause change in shape of Hb 6 atrioventricular atrioventricular right

iii Bohr shift ; [1] 2

iv causes more release of oxygen (than if 0

c i atrial systole ; [1] b

• number of different intensities of exercise – at 1 C ; [1]

b i (T / mitochondria) provide, energy / mucus and pathogens swallowed ;

cell R – secretes mucus ; smooth muscle (to max. 3)

mucus traps, dust / bacteria / viruses / contracts to decrease the, diameter /

prevents their entry to, alveoli / gas A trachea / bronchi / bronchioles

7 a relax to increase volume of air into lungs

ii oxygen diffuses down its concentration b breathing / ventilation ;

18 some suggested precautions: 22 a he more frequently antibiotics are used,

in 2016, could give rise to a new class of 1 A ; [1]

transfers, parasite / pathogen / 7 a bacteria pass out in faeces of infected

V. cholera destroyed in sewage poor access to health care ;

• protection of whole communities as a result of 5 B ; [1]

7 a Experiment 1 c i a ntigen refers to any substance

Experiment 2 ii s elf refers to antigen(s) within a

ii plasma cell ; [1] some T-lymphocytes have receptors

these are selected ; some children may not receive boosters ;

therefore no memory cells will be each monoclonal antibody detects only

c some suggestions: monoclonals can be used to distinguish

5 a limiting factor: one factor, of many 6 a absorption spectrum:

to produce a high concentration of urine: body tolerates changes in blood volume,

water moves by osmosis ; e homeostasis is the maintenance of, (near)

water and salt is not lost in the urine, so [Total: 10]

effect of sudden increase would protein kinase A is the first enzyme in

• Endocrine gland that is site of secretion Active transport by sodium−potassium

b epeated action potentials may cause the

• Use of plant growth substances for controlling ii

calcium ions diffuse into presynaptic M Z, line / disc ; [3]

greatest overlap between thick and thin Y is H band ;

b Although the genetic diagram in a shows

all genotypes correct ; thyroxine causes more myosin to be

Coursebook answers b Possibilities include ability to cope with

[3] selection favours alleles for yellow shell and

Science in Context ii hierarchical system – each

See a kite for one species at the top of next 13 a 35

18 0.47 8 Continue to dry and weigh the soil

20 a Selection pressures in the natural e.g. species frequency, species density,

Notes about mark schemes

they would give an underestimate of c

climate ; leave for several hours ; (because putting

d correlation coefficient is −0.874 / −0.87 ; ii

collect results from at least 20 trees b description of pattern in the numbers: