Journal Pre-proof

A descriptive study of NPHS1 and NPHS2 mutations in children

with congenital nephrotic syndrome

Khalda Amr, Hala T. El-Bassyouni, Eman Rabie, Abeer Selim,

Moushira E. Zaki, Eman Abobakr Abd Alazem, Shereen El-Shaer,
Sahar Rady, Doaa M. Salah

PII: S2452-0144(20)30136-9
DOI: https://doi.org/10.1016/j.genrep.2020.100722
Reference: GENREP 100722

To appear in: Gene Reports

Received date: 11 March 2020

Revised date: 1 May 2020
Accepted date: 15 May 2020

Please cite this article as: K. Amr, H.T. El-Bassyouni, E. Rabie, et al., A descriptive study
of NPHS1 and NPHS2 mutations in children with congenital nephrotic syndrome, Gene
Reports (2020), https://doi.org/10.1016/j.genrep.2020.100722

This is a PDF file of an article that has undergone enhancements after acceptance, such
as the addition of a cover page and metadata, and formatting for readability, but it is
not yet the definitive version of record. This version will undergo additional copyediting,
typesetting and review before it is published in its final form, but we are providing this
version to give early visibility of the article. Please note that, during the production
process, errors may be discovered which could affect the content, and all legal disclaimers
that apply to the journal pertain.

© 2020 Published by Elsevier.

 Journal
A Descriptive Study of NPHS1 and NPHS2Pre-proof
Mutations in Children with Congenital
Nephrotic Syndrome
a b a,g c, d
Khalda Amr , Hala T. El-Bassyouni , Eman Rabie , Abeer Selim * Moushira E. Zaki , Eman
e f f e
Abobakr Abd Alazem , Shereen El-Shaer , Sahar Rady , Doaa M Salah .
a. Medical Molecular Genetics Department, Genetics Division, National Research Centre, Cairo, Egypt.
b. Clinical Genetics Department, Genetics Division, National Research Centre, Cairo, Egypt.
c. Pediatrics Department, Medical Research Division and Medical Research Centre of Excellence
(MRCE), National Research Centre, Cairo, Egypt.
d. Biological Anthropology Department, Medical Research Division, National Research Centre (NRC),
Cairo, Egypt.
e. Pediatric Nephrology Unit, Pediatrics Department, Cairo University, Cairo, Egypt.
f. Biochemistry Department, Faculty of Pharmacy (Girls), Al-Azhar University, Cairo, Egypt.
g. Biotechnology Program, The American University in Cairo, Egypt.

o * Corresponding Author: Dr. Abeer Selim, MD.

Pediatrics Department, Medical Research Division and Medical Research Centre of Excellence (MRCE),

of
National Research Centre, Cairo, Egypt.
Email: abeerselim2004@yahoo.com, as.moustafa@nrc.sci.eg

ro
Orcid No: 0000-0003-1952-4341
Postal Address: 33 El Buhouth Street. National Research Centre, Dokki, Giza, Cairo, Egypt.
Postcode Code: 12622 -p
ABSTRACT
re
Introduction: Congenital nephrotic syndrome (CNS) is a rare disorder characterized by proteinuria,
hypoalbuminemia, edema and hyperlipidemia at birth or within the first 90 days of life. NPHS1 and
NPHS2 gene mutations encoding the slit diaphragm components: nephrin and podocin account for 78% of
lP

CNS cases. Methods: Our study was carried out to assess NPHS1 and NPHS2 gene mutations in 16 CNS
Egyptian patients descending from 16 different families. Demographic, clinical, laboratory and
pathological data of included patients were collected. The whole coding region of NPHS2 and nine exons
na

of NPHS1 were sequenced.

Results: The study showed a homozygous nonsense mutation c.3478C>T (p.R1160X) within exon 27 of
NPHS1 gene in two patients. By comparing clinic-laboratory data of these two patients with other included
ur

CNS patients; a significant association between c.3478C>T (p.R1160X) and low free T3 serum level was
noted. Patients with c.3478C>T (p.R1160X) had more proteinuria than others but did not reach the level of
significance (p = 0.073). Moreover, five NPHS2 mutations were detected in five different patients; two
Jo

homozygous mutations [23 bp duplication c.104-126 dup GCCGCGGGCGCCAGGAGGCTGG (p.

P43Afs*64), and c.59C>T (p.P20L)], and three novel heterozygous missense mutations: c.345 G>A
(M115I), c.346A>T (p.T116S), and c.732T>A (p.D244E). Conclusion: NPHS1 and NPHS2 gene
mutations were found in 43.75 % of Egyptian CNS children. NPHS2 contributed for 31% of the studied
Egyptian CNS cohort. A phenotype–genotype correlation was noticed regarding c.3478C>T (p.R1160X)
mutation in NPHS1 gene as it was significantly associated with decreased serum free T3 and increased
levels of proteinuria compared to other CNS patients.

Keywords: NPHS1, NPHS2, Mutations, Egyptian Children, Congenital, Nephrotic Syndrome

Introduction

Nephrotic syndrome (NS) is a clinical condition with high morbidity and mortality caused by
failure of the glomerular filtration barrier. It is defined as the occurrence of proteinuria, hypoalbuminemia,
edema and hyperlipidemia. The average incidence of NS is 4.7 per 100, 000 individuals worldwide
(Chanchlani and Parekh, 2016). NS represents one of the most serious diagnoses made in pediatric
nephrology leading to end stage renal disease (ESRD). The majority of early onset NS cases have a
genetic origin with a widespread age of onset that ranges from fetal life to several years (Avni et al.,
2011). For an infant patient, NS can be classified based on clinical onset into congenital nephrotic
syndrome (CNS) which occurs in the firstJournal Pre-proof
90 days of life, postnatal onset and infantile nephrotic syndrome
(INS) which occurs within 4 months - 1 year (Hinkes et al., 2007). CNS of the Finnish type (OMIM:
256300) is a rare autosomal recessive inherited disease that starts within the first three months of life,
characterized by a large placenta, massive proteinuria, and marked edema (Huttunen, 1976).

NPHS1 gene encodes nephrin; a 1241 amino acid protein located at the podocytes’ slit diaphragm
of the glomerular filtration barrier. Nephrin has a unique structure enabling its action in cell signaling as
well as cell to cell, cell to matrix and protein to protein interactions (Pätäri‐Sampo et al., 2006; Li et al.,
2015). Podocin, encoded by NPHS2, is a slit diaphragm hair pin-like protein (383 amino acids) that
interacts with nephrin and CD2-associated protein (CD2AP) via its C-terminal at the podocyte cell surface.
Podocin is involved in podocytes’ cell signaling, and adaptation to changes in the filtration process (Patari-
Sampo et al., 2006). NPHS1 mutations have been identified to cause autosomal recessive CNS and
childhood onset steroid resistant nephrotic syndrome (SRNS) (Kestila et al., 1998; Heeringa et al., 2011;
Schoeb et al., 2010; Lovric et al., 2014). NPHS2 mutations are the most common cause of autosomal
recessive SRNS with focal segmental glomerulosclerosis (FSGS) in patients diagnosed before the age of
six years who develop ESRD. The clinical spectrum of NPHS2 also involves CNS, INS, childhood and
adulthood onset NS (Bouchireb et al., 2014; Warejko, 2018). Together, NPHS1 and NPHS2 mutations

of
account for 78% of CNS worldwide (Hinkes et al., 2007).

Ethnicity plays a role in the mutation spectrum of CNS where patient groups from different origins

ro
show variable NPHS1 and NPHS2 mutation frequencies (Thomas et al., 2017). A number of studies
focused on steroid resistant NS (SRNS) in Egyptian INS patients with exclusion of CNS population. They
-p
concluded that NPHS2 encoding podocin is common in Egyptian infantile SRNS (Thomas et al., 2017;
Bakr et al., 2013; Kaddah et al., 2012). Our study provides an insight on the Egyptian CNS cohort by the
sequencing of the causative variant in NPHS1 and NPHS2 genes in Egyptians, and its comparison to other
re
ethnicities. We detected NPHS1 and NPHS2 mutations in patients diagnosed with CNS of Finnish and
non-Finnish type and provided a phenotype/ genotype correlation.
lP

Material and methods

na

Clinical investigation
The study was performed on 16 CNS Egyptian patients; recruited from the Pediatric Nephrology Clinics of
Cairo University Children Hospital, Al Zahra-Azhar University Hospital, and the Clinical Genetics
ur

department of the National Research Centre (NRC). All patients were diagnosed with NS according to their
clinical presentation with a mean age of 2 months (range 0-3). Full medical history (including antenatal
morbidity, age at presentation, detailed family history and pedigree analysis), clinical assessment and basic
Jo

laboratory investigations were carried out, Table 1. Thyroid profile and toxoplasmosis, rubella,
cytomegalovirus and herpes (TORCH) screening were done. Karyotyping was performed to one patient
suspected of having Turner syndrome (dysmorphic features, widely separated nipples, wide carrying angle
and associated cardiac anomaly). All medications received by the patients were reviewed and renal biopsy
was done for six patients.

Molecular analysis
Genomic DNA was extracted from peripheral blood leukocytes of all patients and available family
members, after obtaining an informed consent according to the guidelines of the Medical Research Ethics
Committee at the NRC. DNA was extracted using QIAgene Blood DNA Kit (Qiagen, Hilden, Germany).
PCR was carried out for the whole coding region of NPHS2 and nine exons of NPHS1 (6, 7, 10, 11, and 24
to 28) through primers designed by ExonPrimer software (http://ihg.gsf.de/ihg/ExonPrimer.html). PCR
products were purified using Exo-SAP PCR Clean-up kit (Fermentas, Germany), sequenced in both
forward and reverse directions using Big Dye Termination kit (Applied Biosystems, Foster City, CA,
USA) and analyzed using ABI Prism 3500 Genetic Analyzer (Applied Biosystems). All new detected
variants were checked in 100 chromosomes of healthy controls. The sequences of chromatograms were
aligned and compared with the reference sequences (NM_004646.3 for NPHS1 and NM_014625.3 for
NPHS2).
 Journal Pre-proof
Statistical Analysis

The Statistical Package for Social Science (SPSS, IBM) version 21, was used for data entry and
analysis. The comparison between groups for qualitative data was done using Chi -square test and
Fisher exact test instead of Chi-square only when the expected count in any cell was found less than
5%. The comparison between two independent groups for quantitative data and parametric distribution
was done using an independent t-test, while the comparison between more than two groups was done
using One-Way Analysis of Variance (ANOVA). Spearman correlation coefficients were used to assess
the relation between two quantitative parameters in the same group and also partial correlation was
used to assess the relation between two parameters in the same group after adjusting the effect of other
parameters. The p-value was considered significant if P < 0.05.

Results
Clinical data
The demographic, clinical and laboratory data of the patients are represented in Table 1. There

of
were seven males (43.8%) and nine females (56.2%). Seven patients belonged to consanguineous families
and four patients had a history of previous sibling death due to CNS. In addition to the clinical
manifestation of CNS (edema, ascites and failure to thrive), four patients had extrarenal manifestation: one

ro
patient had dysmorphic features compatible with Turner syndrome, and three patients had bilateral
congenital cataract. Karyotyping was done for the patient with suspected Turner syndrome and proved 45
-p
XO chromosomal anomaly. TORCH screening was done in all patients and was positive in 3 of them
(20%). Renal biopsy was performed for six patients (37.5%) and revealed CNS of Finnish type in five
patients (31.3%) and minimal change disease (MCD) in one patient (6.2%). Oral iron, folic acid and
re
vitamin D were given to all patients and L-Thyroxin was given to 13 patients (81.3%) who suffered from
hypothyroidism. Angiotensin converting enzyme inhibitor (ACEI) was administered to 12 patients (75%)
lP

who had no impairment of renal functions, while spironolactone was used in 6 patients 37.5%) due to its
antifibrotic action. Immunosuppressive therapy (steroids, cyclosporine and mycofenolate) was used in a
patient with MCD and partial response was obtained.
na

Table 1
Demographic, clinical and laboratory data of the studied CNS group (n=16)
ur

Mean ( ± SD) Median (IQR)

Age at assessment (years) 2.7 ( ± 0.6) 2.6 (2.1 - 3)
Jo

Age at presentation (months) 3.04 (± 2.04) 3 (2 - 3.5)

Weight (Kg) 8.3 ( ± 1.7) 8 (7 - 9)
Serum creatinine (mg/dl) 1.2 ( ± 0.8) 0.8 (0.5 - 1.9)
Serum albumin (gm/l) 1.8 ( ± 0.7) 1.8 (1.4 - 2)
Total cholesterol 510 ( ± 143) 543 (398 - 576)
Serum calcium 8.4 ( ± 1.1) 8.6 (7.7 - 9)
Serum Phosphorus 5.2 ( ± 1.2) 5 (4.3 - 6)
Serum alkaline phosphatase 232 ( ± 65) 228 (156 - 300)
Serum Sodium 141 ( ± 4) 140 (138 - 144)
Serum Potassium 4.1 ( ± 0.5) 4 (3.8 - 4.5)
Total leucocyte count 10.7 ( ± 2.6) 10 (9.5 - 11)
Hemoglobin 9.2 ( ± 0.8) 9.4 (8.7 - 9.9)
Platelet 431 ( ± 141) 420 (338 - 498)
Urine A/C ratio 10.7 ( ± 6.9) 8 (7 - 11)
Free T3 1.8 ( ± 0.4) 1.8 (1.6 - 2.1)
Free T4 0.65 ( ± 0.21) 0.6 (0.4 - 0.9)
TSH 3.02 ( ±2 .63) 3 (0.07 - 5.9)
 Journal
A/C ratio (albumin/ creatinine), Pre-proof
T (thyroxine), TSH (thyroid stimulating hormone)

Molecular data

The study was carried out on 16 patients with congenital nephrotic syndrome, sequencing of the whole
NPHS2 gene comprising 8 coding regions and the most common exons in NPHS1 gene was performed
because this gene consists of 27 exons and we have limited resources. Sequencing of NPHS1 gene
revealed homozygous nonsense mutation c.3478C>T (p.R1160X) in exon 27 of NPHS1 in two patients
(Patient 1 and 2), (Fig.1A). Both patients descended from two independent non-consanguineous families.
Their parents showed c.3478C>T (p.R1160X) heterozygous pattern. In addition, five different NPHS2
mutations were detected in five patients (Patient 3 to 7). Two homozygous mutations in exon 1 of NPHS2
were detected in patients 3 and 4: the c.104-126dupGCCGCGGGCGCCAGGAGGCTGG (p. P43Afs*64)
and c.59C>T (p.P20L), respectively, (Fig.1B - 1C). Two novel heterozygous missense mutations were
found in exon 2 of NPHS2: c.345 G>A (M115I) in patients 5 and 6 and missense mutation c.346A>T
(p.T116S) in patient 7, (Fig.1D - 1E). Also, patient 7 had a heterozygous novel missense variant
c.732T>A (p.D244E) in exon 5 of NPHS2, (Fig.1F).

of
Phenotype/ genotype correlation

In a trial to correlate genotype with phenotype of CNS, we compared demographic, clinical and

ro
laboratory data of CNS patients with and without the detected homozygous c.3478C>T (p.R1160X)
mutation of NPHS1. Unfortunately, one of the two c.3478C>T (p.R1160X) CNS patients did not do renal
-p
biopsy and so could not be compared with other patients as regard to the pathological findings. The renal
biopsy of the other c.3478C>T (p.R1160X) patient showed CNS of Finnish type. Sex, consanguinity,
similar affected family members or frequency of sibling deaths with CNS did not show significant
re
association with the c.3478C>T (p.R1160X) mutation. The two patients with the mutant gene were
negative for TORCH infection and showed normal karyotyping, Table 2. The c.3478C>T (p.R1160X) was
lP

only significantly associated with decreased level of serum free T3 (1.7 ± 0.4 versus 2.5 ± 0.3, p =
0.038). Proteinuria was found to be more in the two patients with c.3478C>T (p.R1160X) than other
patients but did not reach the statistically significant level,
Table 3.
na

Table 2
Comparison between CNS patients with and without c.3478C>T (p.R1160X) mutation
ur

regarding sex, family history, TORCH screening and abnormal karyotyping

No gene mutation Gene mutation P -value
Jo

Sex N % N %
Male 6 42.9 1 50
1
Female 8 57.1 1 50
Consanguinity
No 7 50 2 100
0.475
Yes 7 50 0 0.00
Similar Condition
No 11 78.60 1 50
1
Yes 3 21.40 1 50
Frequency of
sibling death
1 sibling death 3 100 0 0.00
0.25
2 sibling death 0 0.00 1 100
TORCH infection
No 10 76.2 2 100
0.25
Yes 3 23.1 0 00
XO karyotyping
No 13 92.9 2 100
1
Yes 1 7.1 0 00

Table 3: Comparison of clinic-laboratory data between CNS patients with and without
c.3478C>T (p.R1160X) gene mutationJournal Pre-proof

No gene mutation Gene mutation

(n =14) (n =2)
Mean± SD Mean± SD p value
Age at assessment (years) 2.6 ± 0.6 3.1 ± 0.1 0.200
Age at presentation (months) 3.19 ± 2.15 2±0 0.417
Weight (Kg) 8.2 ± 1.8 9±0 0.333
Serum creatinine (mg/dl) 1.2 ± 0.9 1.2 ± 0.8 0.933
Serum albumin (gm/l) 1.8 ± 0.7 1.9 ± 0.1 0.600
Total cholesterol 492 ± 128 628 ± 243 0.571
Serum calcium 8.5 ± 0.9 7.4 ± 1.9 0.381
Serum Phosphorus 5.1 ± 1.1 5.4 ± 2.3 1.000
Serum alkaline phosphatase 231 ± 70 239±21 0.800
Serum Sodium 141 ± 5 141 ± 6 0.933
Serum Potassium 4.1 ± 0.5 4.3 ± 0.4 0.571

of
Total leucocyte count 10.2 ± 2.3 13.9 ± 3 0.076
Hemoglobin 9.2 ± 0.8 9.1 ± 0.6 0.686

ro
Platelet 414 ± 136 543 ± 163 0.305
Urine Albumin /Creatinine ratio 8.7 ± 4.2 19.5 ± 12 0.073
Free T3 (Thyroxine)
-p
2.5 ± 0.3 1.7 ± 0.4 0.038
Free T4(Thyroxine) 0.7 ± 0.28 0.64 ± 0.21 0.800
re
TSH (Thyroid Stimulating Hormone) 3.02 ± 2.58 2.99 ± 4.12 1.000
lP
na
ur
Jo
 Journal Pre-proof

of
ro
-p
re
lP
na
ur

Fig. 1 NPHS1 and NPHS2 mutations.

The figure shows sequencing chromatograms of (A) homozygous c.3478C>T (p.R1160X) mutation of exon 27 of
Jo

NPHS1 gene detected in two patients, (B) homozygous c.104-126dupGCCGCGGGCGCCAGGAGGCTGG (p.

P43Afs*64) mutation in exon 1 of NPHS2, (C) homozygous missense mutation c.128C>T (p.P20L) in exon 1 of NPHS2, (D)
heterozygous missense mutation c.345 G>A (M115I) detected in two patients, and (E) heterozygous missense mutation c.415
A>T (p.T116S). Wild type sequences are shown per each chromatogram. Black arrows indicate the mutation site.

Discussion
The monogenic congenital nephrotic syndrome scenario is inversely proportional to the age of
onset where pathogenic mutations in NPHS1 and NPHS2 account for 78% of NS cases with onset within
the first year of life. Across different populations, the influence of ethnicity on the mutation geography is
evident (Hinkes et al., 2007; Thomas et al., 2017; Sadowski, 2015). In a large cohort belonging to two
different ethnicities, NPHS1 mutations were found in 39% of CNS, but none in INS. CNS in Turkish
descents were predominately due to NPHS1 mutations, unlike, CNS in central European descendants
where NPHS1 and NPHS2 mutations were equally frequent (Hinkes et al., 2007). While in Tunisian CNS,
the LAMB2 mutations were the second most frequent (15%) after NPHS1 (23%) with lower presentation
of NPHS2 mutation (7.6%) (Mbarek et al., 2011). By sequencing of the hotspot NPHS1 exons and the
whole coding sequence of NPHS2, more than one third of our cohort (43.7%) had either NPHS1 or NPHS2
mutation similar to other ethnic groups (Lo et al., 2010; Ovunc et al., 2012).
Interestingly, we detected homozygous NPHS1 c.3478C>T (p.R1160X) mutation in two patients
(16%); one of them had Finnish type CNS. This mutation was first reported by Lenkkeri et al. in an Italian
patient with mild CNS of Finnish type (Lenkkeri, 1999). Nephrin protein has a unique structure
 Journal Pre-proof
comprising eight extracellular immunoglobulin-like domains, a fibronectin extracellular domain, a trans-
membrane domain and a cytoplasmic domain (New et al., 2016). The p.R1160X results in putative
truncated nephrin protein at the cytoplasmic domain (Cooper et al., 2018). The cytoplasmic domain of
nephrin contains three tyrosine residues (Y1176, Y1193 and Y1217) which undergo phosphorylation and
provide cellular signals for recruitment of effector proteins (Koziell et al., 2002; Kacer, 2008). The
p.R1160X was previously detected in familial SRNS from Egypt, Switzerland, Germany, Saudi Arabia,
and in all Maltese NS cases with evidence suggesting Maltese founder effect. Another founder effect was
evident in Finnish type CNS cases of Asia an origin harboring p.R1160X (Basu and Mohapatra, 2012).
Hypothyroidism in CNS is postulated to occur secondary to chronic massive proteinuria with loss
of thyroid binding globulin (TBG), thyroid hormone and iodine (Hajizadeh, 2015). We found that
c.3478C>T (p.R1160X) mutation was significantly associated with decreased level of serum free T3.
Previously, low total T3 levels were reported, while the free T3 was normal in renal patients (Niaudet,
2004). It was hypothesized that TBG excretion in CNS diminishes the total amounts of hormones bonded
to TBG, however, another metabolic disorder is not expected since TSH, free T3 and free T4 levels remain
normal. In some patients, however, with sustained prolonged proteinuria, continual excretion of TBG can
reduce the free thyroid hormones levels and increase TSH (Lahdenkari, 2004). Thus, the presence of
significantly low free T3 in patients with c.3478C>T (p.R1160X) mutation supports that this mutation

of
might be associated with severe heavy proteinuria than other CNS patients. That warrants the importance
of early screening for the whole thyroid profile in patients with this mutation to protect their growing brain
from irreversible damage (Santín, et al., 2011). Remarkably, proteinuria was found to be much more in the

ro
two patients with c.3478C>T (p.R1160*) alleles than the other patients but did not yet reach the
statistically significant level. Further research is needed for whether c.3478C>T (p.R1160*) allele is
-p
associated with heavier ranges of proteinuria and consequently worse outcomes in CNS patients or not.
Earlier reports have linked the majority of CNS to NPHS1 mutations (Kestila et al., 1998; Boute
and Gribouval, 2000; Nishibori et al., 2004). Given the complex interaction at glomerular filtration barrier,
re
mutated podocin (encoded by NPHS2) influences nephrin’s functionality (encoded by NPHS1) which may
account for CNS phenotype in patients harboring NPHS2 pathogenic alleles (Caridi et al., 2004). From our
lP

cohort CNS five patients (31.25%) had five different NPHS2 mutations. Intriguingly, we did not detect
either of the two Egyptian NPHS2 founder mutations p.Met1? and p.Asn199Lysfs*14 that were previously
reported in Egyptian SRNS cases, this might reflect the molecular heterogeneity of NPHS2 spectrum in
na

CNS. Patient 3 had homozygous p.P43Afs*64 which was previously identified in a heterozygous manner
in one INS patient of Arabic origin with steroid resistance and MCD (Sadowski et al., 2015). Moreover, a
homozygous c.59C>T (p.P20L) mutation was detected in patient 4; the same genotype was reported in
several SRNS cases (Boute and Gribouval, 2000; Ruf et al., 2004; Berdeli et al., 2007; Lipska and Balasz-
ur

Chmielewska, 2013; Ramanathan et al., 2017). A novel heterozygous c.345 G>A (M115I) mutation was
found in patient 5 and 6; the same amino acid change was reported in another form (c.344T>C; p.M115T)
Jo

in a late onset steroid resistance patient with FSGS (Lipska and Balasz-Chmielewska, 2013). Similarly, the
novel c.346A>T (p.T116S) variant which was detected in patient 7 was previously reported but to another
amino acid variant (c.346A>C p.T116P) (Boute and Gribouval, 2000). The patient carrying c.346A>T
(p.T116S) mutation was also found to be heterozygous for a novel c.732T>A (p.D244E) variant in exon 5
of NPHS2. Previously, heterozygous (c.732T>C, p.D244=) synonymous mutation at the same position
was reported with emphasis on possible effect on mRNA processing since it lies near splice site at the
exon/intron boundary (Nishibori et al., 2004). The three novel missense variants were neither found in
dbSNP, ExAC nor 1000G. Furthermore, they were not found in 100 normal chromosomes of Egyptian
origin excluding the possibility of being rare variants in our population. Nonetheless, functional
characterization is required to define the molecular consequences of novel missense variants (Hajizadeh et
al., 2015).
In conclusion, despite the small sample size of our cohort, we recommend sequencing of NPHS2
gene as well as the whole coding region of NPHS1 gene in CNS Egyptian cases to expand the molecular
background. A phenotype/genotype correlation was noticed regarding c.3478C>T (p.R1160X) mutation in
NPHS1 gene as it was significantly associated with decreased serum free T3 and heavier ranges of
proteinuria compared to other CNS patients.

Declaration
Ethics approval and consent to participate
This study protocol and the consents were Journal Pre-proof
approved and deemed sufficient by the Ethical Committee of
National Research Centre and informed written consent was obtained in every case from their legal
guardians.
Conflict of interest
The authors declare no conflict of interest.
Funding
The authors declare that this research didn’t receive any financial support from agencies or others.
Acknowledgements
 Authors thank National Research Centre for cohosting this research.
 Authors thank Pediatric Nephrology Unit, Cairo University for their collaboration during this
research.
 Authors thank Pediatric & Biochemistry departments, Al Azhar University for their
collaboration during this research.
 Authors would like to thank all patients and their family members for their valuable contributions to
the study.
Authors' contributions
All authors have contributed to the research work all through. They all read and approved the final

of
manuscript.
REFERENCES
 Avni EF, Vandenhoute K, Devriendt A, Ismaili, K, Hackx M, Janssen F, et al. Update on

ro
congenital nephrotic syndromes and the contribution of US. Pediatr Radiol. 2011; 41:76-81.
 Bakr A, Yehia, S, El-Ghannam, D, Hammad, A, Ragab, M, Sarhan, A, et al. NPHS2
mutations. Indian J Pediatr 2013; 75:135-38.
-p
 Basu G, Mohapatra A. Interactions between thyroid disorders and kidney disease. Indian j
re
endocrinol metab. 2012; 16: 204-13.
 Berdeli, A, Mir S, Yavascan O, Serdaroglu E, Bak M, Aksu N, et al. NPHS2 (podicin) mutations in
Turkish children with idiopathic nephrotic syndrome. Pediatr Nephrol. 2007; 22: 2031-40.
lP

 Bouchireb K, Boyer O, Gribouval O, Nevo F, Huynh‐Cong E, Morinière V, et al. NPHS 2

Mutations in steroid‐resistant nephrotic syndrome: A mutation update and the associated
phenotypic spectrum. Hum Mutat. 2014; 35: 178-86.
na

 Boute N, Gribouval O. NPHS2, encoding the glomerular protein podocin, is mutated in autosomal
recessive steroid-resistant nephrotic syndrome. Nat Genet. 2000; 24: 349-54.
 Caridi G, Berdeli A, Dagnino M, Di Duca M, Mir S, Cura A, Ghiggeri, GM. Infantile steroid-
ur

resistant nephrotic syndrome associated with double homozygous mutations of podocin. Am J

Kidney Dis. 2004; 43: 727-32.
 Chanchlani R, Parekh RS. Ethnic Differences in childhood nephrotic syndrome. Front Pediatr.
Jo

2016; 4:39.
 Cooper CJ, Dutta NT, Martin CE, Piscione TD, Thorner PS, Jones N. Characterization of a novel
disease-associated mutation within NPHS1 and its effects on nephrin phosphorylation and
signaling. PloS One. 2018;13: e0203905.
 Hajizadeh N, Marashi SM, Nabavizadeh B, Elhami E, Mohammadi T, Mazloomi Nobandegani N,
et al. Examine of thyroid function in pediatric nephrotic syndrome; Tehran-Iran. Int J Pediatr 2015;
3: 59-65.
 Heeringa SF, Chernin G, Chaki M, Zhou W, Sloan AJ, Ji Z, et al. COQ6 mutations in human
patients produce nephrotic syndrome with sensorineural deafness. J Clin Invest. 2011; 121: 2013-
24.
 Hinkes BG, Mucha B, Vlangos CN, Gbadegesin R, Liu J, Arbeitsgemeinschaft für Paediatrische
Nephrologie Study Group. Nephrotic syndrome in the first year of life: two thirds of cases are
caused by mutations in 4 genes (NPHS1, NPHS2, WT1, and LAMB2). J Pediatr 2007; 119: 907-
19.
 Huttunen NP. Congenital nephrotic syndrome of Finnish type. Study of 75 patients. Arch Dis Child
1976; 51: 344–8.
 Ihalmo P, Holthofer H. Molecular basis of the glomerular filtration: Nephrin and the emerging
protein complex at the podocyte slit diaphragm. Ann Med. 2006; 38:483-92.
 Kacer M, Whyte DA, BoydstunJournal I, WilsonPre-proof
TA. Congenital nephrotic syndrome and persistent
hypothyroidism after bilateral nephrectomy. J. Pediatr. Endocrinol. Metab. 2008; 21: 597-01.
 Kaddah A, Sabry S, Emil E, El-Refaey M. Epidemiology of primary nephrotic syndrome in
Egyptian children. J Nephrol. 2012; 25: 732-7.
 Kestila M, Lenkkeri U, Ma nnikko M, et al. Positionally cloned gene for a novel glomerular
protein-nephrin-is mutated in congenital nephrotic syndrome. Mol Cell. 1998; 1:575–
82.
 Koziell A, Grech V, Hussain S, Lee G, Lenkkeri U, Tryggvason K, Scambler P.
Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in nephrotic syndrome
advocate a functional inter-relationship in glomerular filtration. Hum Mol Genet. 2002; 11:379-88.
 Lahdenkari A-T, Kestilä M, Holmberg C, Koskimies O, Jalanko H. Nephrin gene (NPHS1) in
patients with minimal change nephrotic syndrome (MCNS). Kidney Int. 2004; 65:1856–63.
 Lenkkeri U, Männikkö M, McCready P, Lamerdin J, Gribouval O, Niaudet PM, et al. Structure of
the gene for congenital nephrotic syndrome of the Finnish type (NPHS1) and characterization of
mutations. Am J Hum Genet. 1999; 64:51-61.
 Lipska BS, Balasz-Chmielewska I. Mutational analysis in podocin-associated hereditary nephrotic
syndrome in Polish patients: founder effect in the Kashubian population. J Appl Genet. 2013;

of
54:327-33.
 Li X, Chuang PY, D’Agati VD, Dai Y, Yacoub R, Fu J, et al. Nephrin preserves podocyte viability

ro
and glomerular structure and function in adult kidneys. J Am Soc Nephrol. 2015; 26: 2361-77.
 Lovric S, Fang H, Vega-Warner V, Sadowski CE, Gee HY, Halbritter J, et al. Rapid detection of
monogenic causes of childhood-onset steroid-resistant nephrotic syndrome. Clin J Am Soc Nephrol
-p
2014; 9: 1109-16.
 Lo WY, Chen SY, Wang HJ, Shih HC, Chen CH, Tsai CH, et al. Association between genetic
re
polymorphisms of the NPHS1 gene and membranous glomerulonephritis in the Taiwanese
population. Clin. Chim. Acta 2010; 411: 714–18.

lP

Mbarek IB, Abroug S, Omezzine A, Pawtowski A, Gubler MC, Bouslama A et al. Novel mutations
in steroid-resistant nephrotic syndrome diagnosed in Tunisian children. Pediatr Nephrol. 2011; 26:
241-49.
 Nishibori Y, Liu L I, Hosoyamada M, Endou H, Kudo A, Takenaka H, et al. Disease-causing
na

missense mutations in NPHS2 gene alter normal nephrin trafficking to the plasma
membrane. Kidney Int. 2004; 66: 1755-65.
 New LA, Martin CE, Scott RP, Platt MJ, Keyvani Chahi A, Stringer CD, et al. Nephrin Tyrosine
ur

Phosphorylation is required to stabilize and restore podocyte foot process architecture. J Am Soc
Nephrol. 2016; 27: 2422–35.

Jo

Niaudet P. Genetic forms of nephrotic syndrome. Pediatr Nephrol. 2004; 19:1313–18.

 Ovunc B, Ashraf S, Vega-Warner V, Bockenhauer D, Elshakhs NA, Gesellschaft für Pädiatrische
Nephrologie (GPN) Study Group. Mutation analysis of NPHS1 in a worldwide cohort of
congenital nephrotic syndrome patients. Nephron Clin Pract. 2012; 120: c139-46.
 Pätäri‐Sampo A, Ihalmo P. and Holthöfer H. Molecular basis of the glomerular filtration: nephrin
and the emerging protein complex at the podocyte slit diaphragm. Ann Med 2006; 38: 483-492.
 Ruf RG, Lichtenberger A, Karle SM, Haas JP, Anacleto FE, Bagga A, et al. Patients with
mutations in NPHS2 (podocin) do not respond to standard steroid treatment of nephrotic
syndrome. J Am Soc Nephrol. 2004; 15: 722-732.
 Ramanathan AS, Vijayan M, Rajagopal S, Rajendiran P, Senguttuvan P. WT1 and NPHS2 gene
mutation analysis and clinical management of steroid-resistant nephrotic syndrome. Mol Cell
Biochem. 2017; 426:177-181.
 Sadowski CE, Lovric S, Ashraf S, Pabst WL, Gee HY, SRNS Study Group. A single-gene cause in
29.5% of cases of steroid-resistant nephrotic syndrome. J Am Soc Nephrol. 2015; 26: 1279-89.
 Santín S, Bullich G, Tazón-Vega B, García-Maset R, Giménez, I, Silva I, Ars E. Clinical utility of
genetic testing in children and adults with steroid-resistant nephrotic syndrome. Clin J Am Soc
Nephrol. 2011; 6: 1139-48.
 Schoeb DS, Chernin G, Heeringa SF, Matejas V, Held S, Gesselschaft für Paediatrische
Nephrologie (GPN) Study Group. Nineteen novel NPHS1 mutations in a worldwide cohort of
 patients with congenital nephroticJournal
syndromePre-proof
(CNS). Nephrol Dial Transplant 2010; 25:2970-6.
 Tan W, Daga A, Schapiro D, Lawson JA, Shril S, et al. Whole exome sequencing of patients with
steroid-resistant nephrotic syndrome. Clin J Am Soc Nephrol 2018; 13: 53-62.
 Thomas MM, Abdel-Hamid MS, Mahfouz, NN and Ghobrial EE. Genetic mutation in Egyptian
children with steroid-resistant nephrotic syndrome. J Formos Med Assoc. 2017; 117: 48-53.

of
ro
-p
re
lP
na
ur
Jo
Authors' contributions Journal Pre-proof
All authors have contributed to the research work all through. They all read and approved the final
manuscript.

of
ro
-p
re
lP
na
ur
Jo
 Journal Pre-proof
Highlights
1. NPHS1 and NPHS2 gene mutations represent more than one third of Egyptian congenital nephrotic
syndrome children
2. Three novel missense variants were detected in exon 2 and 5 of NPHS2 gene
3. c.3478C>T (p.R1160X) mutation was significantly associated with decreased level of serum free T3 that
warrants the importance of early screening for the thyroid profile to prevent brain damage
4. In c.3478C>T (p.R1160*) mutation proteinuria was found to be much more than in other patients.
5. Further research is needed for whether c.3478C>T (p.R1160*) allele is associated with heavier ranges of
proteinuria and consequently worse outcomes in CNS patients.

of
ro
-p
re
lP
na
ur
Jo
Abbreviations Journal Pre-proof
Abbreviation Word

(ACEI) Angiotensin converting enzyme inhibitor

(CNS) Congenital nephrotic syndrome

(FSGS) Focal segmental glomerulosclerosis

(MCD) Minimal change disease

of
(NS) Nephrotic syndrome

ro
(SRNS) Steroid resistant nephrotic syndrome -p
(TORCH) Toxoplasmosis, Rubella, Cytomegalovirus and
re
Herpes
lP
na

.
ur
Jo