Effect supplementation of black soldier fly larvae oil (Hermetia illucens L.
)
calcium salt on performance, blood biochemical profile, carcass characteristic,
meat quality, and gene expression in fat metabolism broilers
Muhammad Anang Aprianto,* Muhlisin,* Asih Kurniawati ,* Chusnul Hanim,* Bambang Ariyadi,y and
Muhsin Al Anas *,1
*
Department of Animal Nutrition and Feed Science, Faculty of Animal Science, Universitas Gadjah Mada, Sleman,
Yogyakarta, Indonesia; and yDepartment of Animal Production, Faculty of Animal Science, Universitas Gadjah
Mada, Sleman, Yogyakarta, Indonesia
ABSTRACT This study evaluated the effect supple-
mentation of black soldier fly larvae oil calcium salt
(BSFLO-SCa) on performance, blood biochemical pro-
file, carcass characteristic, meat quality, and gene
expression in fat metabolism broiler chickens. A total of
280 male New Lohmann strain MB 202 broiler chicks
(1-day-old) were randomly placed into 4 treatments,
including a control group (T0) were fed basal diet and a
basal diet supplemented with 1% (T1), 2% (T2), and 3%
(T3) BSFLO-SCa. Each treatment consisted of 7 pens
with 10 chickens each. Results showed that 1% BSFLO-
SCa supplementation significantly reduced (P < 0.05)
abdominal and meat fat, while gene expression on fat
synthesis (FAS, ACC) was downregulated. Meat fatty
acid profiles such as medium-chain fatty acid being
Key words: black soldier fly larvae oil, calcium salt, performance, meat quality, gene expression
INTRODUCTION
Chicken meat is the available and affordable primary
source of high-quality protein for the world’s commu-
nity. Broiler chicken is a fast-growing poultry commod-
ity whose production is projected to continue to increase
along with the demand for chicken meat which is driven
by the population growth rate which continues to
increase (Saminathan et al., 2022). Feed energy values
are needed to meet fast-growing chicken requirements,
so their cost and demand increase (Benzertiha et al.,
2019). The inclusion of oil in the diet is a method to
increase dietary energy density due to the high caloric
value produced (Ravindran et al., 2016; Attia et al.,
Ó 2023 The Authors. Published by Elsevier Inc. on behalf of Poultry
Science Association Inc. This is an open access article under the CC BY
license (http://creativecommons.org/licenses/by/4.0/).
Received May 15, 2023.
Accepted July 25, 2023.
1
Corresponding author: muhsin_alanas@ugm.ac.id
1
dominant in lauric and myristic and monosaturated
fatty acid significantly increased (P < 0.05). On the
other hand, polyunsaturated fatty acid significantly
decreased (P < 0.05). In addition, the other parameters
did not affect by supplementation of 1% BSFLO-SCa.
The addition starting from 2% significantly reduced
(P < 0.05) performance and carcass characteristics. Blood
biochemical profiles (HDL, protein, albumin) and meat
qualities (protein, cholesterol, water-holding capacity,
cooking losses, a* (redness), and b* (yellowness) values)
were significantly increased (P < 0.05), while gene expres-
sion on fat oxidation (CPT-1) was upregulated. In conclu-
sion, broiler chicken that received of 1% BSFL-SCa does
not negatively affect growth performance and carcass
characteristics but reduced fattening in broiler meat.
2023 Poultry Science 102:102984
https://doi.org/10.1016/j.psj.2023.102984
2020). Moreover, the oil improves feed palatability,
absorption of fat-soluble vitamins, and absorption of
feed nutrients by reducing the feed flow rate (Bai~ao and
Lara, 2005; Poorghasemi et al., 2015). Besides, fat and
fatty acids composition in muscle reflects dietary fatty
acid composition, which affects the meat quality and
nutritional value (Aghwan et al., 2014; Abdulla et al.,
2015; Khatun et al., 2018).
Crude palm oil (CPO) is widely used in the poultry
industry because relatively cheap with high energy con-
tent. Moreover, CPO contains high saturated fatty acid
(SFA) (46%), mainly palmitic acid (Wan Nooraida and
Abidah, 2020). The high content of SFA in palm oil
increase in serum total cholesterol, LDL-cholesterol, and
HDL-cholesterol, which triggers coronary artery disease
(CAD) (Sun et al., 2015; Hinrichsen, 2016), so it has
become a consideration of consumers at this time. In the
current study, many researchers focus on utilizing black
soldier fly larvae oil (BSFLO) resulting from the BSF
larvae extraction process in animal feed, especially in
2 APRIANTO ET AL.

the poultry industry (Wang and Shelomi, 2017). The Table 1. Fatty acid profiles of black soldier fly oil larvae
fatty acid content in BSFLO is high with medium-chain (BSFLO) and black soldier fly larvae oil calcium salt (BSFLO-
fatty acid (MCFA), mainly lauric acid (C12:0), until SCa).
52% (Ewald et al., 2020). Profil Asam Lemak BSFLO BSFL-Sca
MCFA is the most effective energy source because it Decanoic (C10:0) 1.13 0.79
easily and quickly undergoes an oxidation process in the Lauric (C12:0) 38.96 30.38
liver (Dabbou et al., 2021). The energy source is rarely Myristic (C14:0) 8.53 8.34
deposited in the subcutaneous fat tissue so carcasses with Pentadecanoic (C15:0) 0.15 0.19
Palmitic (C16:0) 17.41 21.02
a relatively low-fat content are produced. The utilization Heptadecanoid (C17:0) 0.14 0.17
of BSFLO has been reported to decrease meat fat and Stearic (C18:0) 2.56 nd
cholesterol (Cullere et al., 2019; Dabbou et al., 2021) and Heneicosanoic (C21:0) nd 0.15
Docosanoic (C22:0) nd nd
abdominal fat (Nilugonda et al., 2022). Fat deposition in Lignoceric (C24:0) nd 0.16
muscle is a balance between lipolysis and lipogenesis in Palmitoleic (C16:1) 2.27 2.99
the body, which is regulated by changes in gene expres- Oleic (C18:1) 16.48 0.16
Linoleic (C18:2) 9.16 30.62
sion involved in fat metabolism. All the genes involved Gamma-linolenic (C18:3) nd 0.16
are influenced by nutrition which will determine the pro- Eicosanoic (C20:1) 1.04 0.70
cess of fat metabolism (Dev et al., 2021). On the other Linolenic (C18:3) 0.90 0.91
Eicosatrienoic (C20:3) 0.18 0.10
hand, the problem with using liquid fat in developing Eicosatetranoic (C20:1) 0.21 nd
countries is the need for proper facilities for mixing with Nervoic (C24:1) 0.20 0.15
solid feedstuff. Calcium salt form of fatty acids is a sapon- SFA 68.88 61.20
MUFA 20.20 4.00
ification process that may alleviate this problem, easy to PUFA 10.24 31.79
handle (Abd-ElhayGado and Elsebaai, 2017; Shahryari et Abbreviations: MUFA, monounsaturated fatty acids; PUFA, polyun-
al., 2021), higher stability and resistant to oxidation saturated fatty acids; SFA, saturated fatty acids.
(Çalik et al., 2019; Villanueva-Lopez et al., 2020).
Many studies have aimed to determine the effect of
BSFLO on blood lipid profiles and meat quality in
broilers. However, the research results are inconsistent. Animals and Housing
To the best of our knowledge, there are no studies
related to mRNA expression on fat metabolism in broiler A total of 280-day-old male chicks of the New Loh-
livers effect of BSFLO. Therefore, in this study, we eval- mann Indian River (MB 202 Platinum) that had been
uate the effect of replacement CPO with BSFLO-cal- vaccinated against Newcastle disease (ND) and Gum-
cium salt on performance, carcass characteristic, blood boro (infectious bursal disease) from the hatchery were
biochemical profile, meat quality, and lipid metabolism put into brooding cages for 10 d. Chickens were weighed
gene expression in broiler. on d 11 and randomly housed with an initial body
weight (BW) of 350 § 10 g in 28 colony cages with a
size of 1 £ 0.75 m, 10 birds per cage. Each cage is
MATERIALS AND METHODS equipped with a place to feed and drink. The broiler
management followed the recommendations of the
All animal procedures performed in this study were Indian River broiler management handbook (Aviagen,
registered with the Research Ethics Committee at the 2018). The maintained room temperature was 30°C until
Faculty of Veterinary Medicine, Universitas Gadjah 3 d and then reduced to 2.5°C per wk until a tempera-
Mada No. 00149T/EC-FKH/Ex./2021. ture of 20°C was achieved. Lighting programs provide
for a long day with 23 h of light and 1 h of darkness in
the early stage of growth up to 7 d. After 7 d of age,
Preparation of Black Soldier Fly Larvae Oil around 5 h of darkness may be optimum (4−6 h).
Calcium Salt
Black soldier fly larvae oil (BSFLO) in this study was Experimental Treatments and Design
obtained from the PT. Magalarva Sayana Indonesia
(Banten, Indonesia). The BSFL-calcium salt (SCa) was This study used a 1-way pattern design (completely ran-
prepared by mixed BSFL oil with NaOH solution and domized design). Each treatment consisted of 7 replicates,
vigorously stirred until solid. Then, CaCl2 solution was and each replicate contained 10 birds. The birds in each
added and vigorously stirred until was obtained yellow- group were fed a basal diet based on crude palm oil as a con-
ish solid particles. The BSFLO and BSFLO-SCa mea- trol (T0) and substituted with 1% (T1), 2% (T2), and 3%
sured the fatty acid profile using gas chromatography (T3) of BSFLO-SCa. Feeding trials were given from the age
(GC; Agilent Technologies 7890B, California) according of 11 d to 35 d. The starter phase (1−10 d) used commercial
to the method presented by Mjøs (2003) with modifica- feed, and the grower phase (11−21 d) and the finisher phase
tions. The chromatogram peaks can be identified based (22−35 d) were formulated according to Aviagen (2022)
on the retention time and compared with commercial recommendations, as is shown in Table 2. Water and feed
standards. The fatty acid compositions of BSFLO and are freely available ad libitum. The fatty acid compositions
BSFLO-SCa are presented in Table 1. of the experimental diets as is shown in Table 3.
 EFFECT LARVAE OIL IN BROILERS NUTRITION 3
Table 2. Compositions and nutrient content of experimental grower (11−21 d) and finisher (22−35 d) diets.

Percentage (%)
Grower (11−21 d) Finisher (22−35 d)
Feed ingredients 0% 1% 2% 3% 0% 1% 2% 3%
Corn 50.00 51.44 52.85 54.30 56.42 57.85 59.27 60.37
Rice bran 6.49 5.10 3.70 2.25 5.90 4.48 3.07 2.00
Soybean meal 34.00 34.00 34.00 34.00 28.50 28.50 28.50 28.50
Meat bone meal 3.00 3.00 3.00 3.30 3.00 3.00 3.00 3.00
Crude palm oil 3.00 2.00 1.00 0.00 3.00 2.00 1.00 0.00
BSFLO-SCa 0.00 1.00 2.00 3.00 0.00 1.00 2.00 3.00
Limestone 1.20 1.15 1.13 1.07 1.07 1.06 1.00 0.98
Dicalcium phosphate 0.88 0.88 0.89 0.95 0.76 0.76 0.81 0.80
NaCl 0.33 0.33 0.33 0.33 0.32 0.32 0.32 0.32
Vitamin mix1 0.04 0.04 0.04 0.04 0.04 0.04 0.04 0.04
Mineral mix2 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.30
DL-methionine 0.20 0.20 0.20 0.20 0.17 0.17 0.17 0.17
L-lysine 0.22 0.22 0.22 0.22 0.20 0.20 0.20 0.20
L-threonine 0.05 0.05 0.05 0.05 0.03 0.03 0.03 0.03
Choline chloride 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09
Toxin binder 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20
Nutrient content
Crude protein (%) 21.60 21.55 21.50 21.44 19.75 19.70 19.64 19.61
Ether extract (%) 5.95 5.47 4.99 4.51 5.99 5.51 5.03 4.57
Crude fiber (%) 4.03 3.91 3.79 3.66 3.96 3.84 3.72 3.62
ME (kcal/kg) 3169 3166 3162 3158 3226 3222 3218 3212
Ca (%) 0.87 0.87 0.87 0.87 0.79 0.79 0.79 0.79
Available P (%) 0.44 0.44 0.44 0.44 0.40 0.40 0.40 0.40
Methionine (%) 0.53 0.53 0.52 0.52 0.47 0.47 0.47 0.47
Lysine (%) 1.36 1.35 1.35 1.34 1.20 1.20 1.19 1.19
Threonine (%) 0.89 0.89 0.88 0.88 0.80 0.79 0.79 0.79
1
Supplied per kg if diet: vitamin A, 50,000,000 IU; vitamin D3, 10,000,0000 IU; vitamin E, 80,000 mg; vitamin K3, 10,000 mg; vitamin B1, 10,000 mg;
vitamin B2, 30,000 mg; vitamin B3, 225,000 mg; vitamin B5, 62,000 mg; vitamin B6, 10,000 mg; vitamin B9, 5,000 mg; vitamin B12, 100 mg; vitamin H,
100 mg; vitamin C, 20,000 mg.
2
Supplied per kg of diet: Mn, 40,000 mg; Fe, 32,000 mg; Cu, 6,050 mg; Zn, 32,000 mg; I, 404 mg; Se, 100 mg.

Growth Performance and Carcass
Characteristics
On 21 and 35 d, all birds and the remaining feed in
each cage were weighed to determine the final BW, body
weight gain (BWG), feed intake (FI), and feed conver-
sion ratio (FCR). Index performance (IP) was calculated
at the end of the experiment. On d 35, a total of 56 birds
(14 birds per treatment with 2 birds per replicate) with
BW close to the median for each group were selected,
weighed, and slaughtered by decapitation and cutting the
jugular vein with halal method at commercial slaughter-
house for carcass assessments. After feathering, eviscera-
tion, and the neck, head, and feet were removed manually

Table 3. Fatty acid compositions of experimental diets.

Percentage (%)
Grower Finisher
Fatty acids 0% 1% 2% 3% 0% 1% 2% 3%
Decanoic (C10:0) nd 0.21 0.21 0.56 nd 0.18 0.26 0.38
Lauric (C12:0) 0.52 8.77 12.34 17.50 0.67 5.13 10.42 14.33
Myristic (C14:0) 0.84 2.97 3.84 5.00 0.85 1.98 3.15 4.17
Heptadecanoid (C17:0) 0.29 0.88 0.87 1.44 0.27 0.57 0.95 1.25
Stearic (C18:0) nd nd nd 0.11 nd nd nd 0.12
Heneicosanoic (C21:0) nd 0.20 0.29 0.30 0.28 0.24 0.19 0.23
Tricosanoic (C23:0) nd 0.11 0.19 0.11 0.20 0.18 0.16 0.14
Lignoceric (C24:0) nd nd nd nd nd nd nd 0.11
Palmitoleic (C16:1) 32.26 28.62 25.66 22.08 30.60 29.68 25.33 20.25
Oleic (C18:1) 4.08 3.99 4.02 4.01 3.97 4.11 3.83 3.68
Linoleic (C18:2) 34.16 29.78 26.51 25.28 33.45 29.94 26.82 23.14
Gamma-linolenic (C18:3) 23.94 21.81 21.32 20.51 26.87 24.96 26.25 28.31
Eicosanoic (C20:1) 0.54 0.42 0.17 0.34 0.51 0.46 0.14 0.35
Linolenic (C18:3) 1.19 1.30 1.44 1.40 1.20 1.22 1.46 1.73
Nervoic (C24:1) nd nd nd nd nd 0.19 nd nd
SFA 1.65 13.14 17.74 25.02 2.27 8.28 15.13 20.73
MUFA 36.88 33.03 29.85 26.43 35,08 34.44 29.30 24.28
PUFA 59.29 52.89 49.27 47.19 61.52 56.12 54.53 53.18
Abbreviations: MUFA, monounsaturated fatty acids; PUFA, polyunsaturated fatty acids; SFA, saturated fatty acids.
4 APRIANTO ET AL.
from each carcass, abdominal fat was collected and
weighed. The hot carcasses were subsequently placed in
ice water (at 4°C) for approximately 4-h chill in ice box
and transported to the laboratory. Carcass, breast, and
thigh were weighed to analyze their yield. The yield per-
centages of carcass and abdominal fat were calculated rel-
ative to live weight, while the yield percentages of breast
and thigh were calculated relative to cold carcass.
Blood Profiles
At the end of the experiment (d 35), blood serum sam-
ples were collected from 28 birds (7 birds per treatment
with 1 bird per replicate) with a BW close to the median
for each group was selected, weighed and slaughtered by
decapitation and cutting the jugular vein, for which sepa-
rated blood serum samples were collected in Eppendorf
tubes and preserved at a very low temperature of 20°C
until analyzed. The total protein, albumin, glucose, total
cholesterol, HDL-cholesterol, LDL-cholesterol, and triglyc-
eride concentration were determined using a UV-visual
photometer (Microlab 200: Merck Vital Scientific, Darm-
slandt, Netherlands) suitable with the commercial kits
(DiaSys Diagnostic System GmbH, Holzheim, Germany).
Meat Quality Measurements
The birds that have been slaughtered for blood sam-
pling then feathering, evisceration, and cleaning. The
breast meat was taken to measure for chemical quality,
including water, ash, protein, fat (AOAC, 2005), and
cholesterol content using the Liebermann-Burchard
method (Shafiq et al., 2022). Physical quality, including
water-holding capacity (WHC), cooking loss, and meat
tenderness measured according to the procedure (Khan
et al., 2021). The meat colors were determined by color-
imeter (CR-400, Minolta Camera Co., Osaka, Japan)
and were set to the L* (lightness), a* (redness), and b*
(yellowness) after 45 min postmortem with a 65 light
source and a 2°C observer (Bai et al., 2022a).
Breast Meat Fatty Acid Profiles
The lipid was extracted by acid hydrolysis method from
approximately 5 g of breast meat sample using 10 mL 3 M
aqueous HCl at 80°C for 3 h and petroleum ether (Soxhlet
extraction). Then, the extract was methylated using
1.0 mL of methylation reagent, which consisted of 75% of
2.5 M methanolic HCl and 25% of toluene (Xiao et al.,
2012). After methylation, the fatty acids were quantified as
methyl esters (FAME) using GC (Agilent Technologies
7890B, California), equipped with a 100 £ 0.3 m BPX-70
cyanopropyl column with 0.2 uM film thickness (SGE,
Ringwood, Victoria, Australia). Helium has used a mobile
phase under the pressure of 2.20 bar. The injector tempera-
ture was 260°C. The oven was programmed as follows: 100°
C for 5 min and 240°C for 10 min. The sample solution (1.0
uL) was injected splitless, and the split was opened after
2 min. The FAMEs were identified by comparing the
elution pattern and relative retention time with reference
FAME mixture (GLC-793, Nu-Chek Prep Inc., Elysian,
MN) (Mjøs, 2003).
Lipid Metabolism Gene Expression in
Quantitative Real-Time PCR
Liver samples from 1 bird in each replicate (28 birds)
were taken and collected in a microtube. Microtubes
were frozen in liquid nitrogen immediately and stored at
80°C until analyzed. Gene expression analysis begins
with RNA extraction from the liver sample of as much
as 20 mg using a Quick-RNA miniprep kit (Zymo
Research Corp., Irvine, California) according to proce-
dures. The RNA purity and quantity were measured
using Nanodrop Spectrophotometer (Maestrogen Inc.,
Hsinchu City, Taiwan). The total RNA was used as a
template for cDNA synthesis with reverse transcriptase
enzyme using ReverTrace qPCR RT Master Mix
(Toyobo Co., Ltd., Osaka, Japan, Cat No. FSQ-301).
Relative gene expressions were performed using Quant-
Studio 3 Real-Time PCR system (Thermo Fisher Scien-
tific, Waltham, MA) and Thunderbird SYBR qPCR
Mix (Toyobo Co., Ltd., Osaka, Japan, Cat No. QPX-
201) according to the procedure. Briefly, 2 uL diluted
cDNA, 6 pmol forward primer, 6 pmol reverse primer,
0.04 uL ROX reference dye, and 10 uL qPCR Mix were
filled to the tube and placed into a 20 uL reaction vol-
ume with nuclease-free water. All primer pairs used for
fatty acid synthase (FAS), acetyl-Coa carboxylase
(ACC), carnitine palmitoyltransferase 1 (CPT-1), and
3-hydroxy-3-methylglutaryl coenzyme A reductase
(HMGR) gene expression can be found in Table 4. The
following amplification program was used: a hold stage
for 1 cycle of 95°C for 2 min, a PCR stage for 40 cycles of
95°C for 1 s and 60°C for 30 s. The melt curve was ana-
lyzed at the end of the run to determine specific product
amplification. There were 7 samples for each group, and
each sample was performed in duplicate. The mRNA
levels were standardized as the ratio to b-actin in arbi-
trary units by the 2DDCT method and the data were
expressed as the relative values to the control group
(Livak and Schmittgen, 2001).
Statistical Analyses
All experimental data were analyzed statistically
using IBM SPSS statistic version 26.0. The data sub-
jected to 1-way ANOVA among 4 treatments. A Duncan
test was used to determine significant differences among
all treatments. The statistical significance of all analyses
was set at P < 0.05 for probability values.
RESULTS
Growth Performance
The effects of dietary supplementation with BSFLO-Sca
on growth performance are presented in Table 5. During
 EFFECT LARVAE OIL IN BROILERS NUTRITION 5
Table 4. Primer pairs for analysis of fat metabolism gene expression.

Gen Primer sequence (50 >30 ) Orientation Base pairs References

b-actin GTGTGATGGTTGGTATGGGC Forward 225 Xie et al. (2019)
CTCTGTTGGCTTTGGGGTTC Reverse
FAS TGGTTGACTGCCACCAATTG Forward 213 Xie et al. (2019)
ACCCCACTTTCCATCACGAT Reverse
HMGR TCCCTGAACCCTCATCTTTG Forward 250 K€onig et al. (2007)
TCTGCAAGAATACGGCTCCT Reverse
ACC GCTGGGTTGAGCGACTAATG Forward 173 Xie et al. (2019)
GGGAAACTGGCAAAGGACTG Reverse
CPT-1 GAAGACGGACACTGCAAAGG Forward 223 Xie et al. (2019)
GGGCAAGTTGAATGAAGGCA Reverse
Abbreviations: ACC, acetyl-Coa carboxylase; CPT-1, carnitine palmitoyltransferase; FAS, fatty acid synthase; HMGR, 3-hydroxy-3-methylglutaryl
coenzyme A reductase.

Table 5. Broiler performance with dietary supplementation of black soldier fly larvae oil calcium salt (BSFLO-SCa).

Treatments
Parameters 0% 1% 2% 3% SEM P value
11−21 d
FI (g) 899.64 869.14 857.64 849.64 9.75 0.755
FBW (g) 986.28a 965.14ab 954.14b 949.14b 4.85 0.024
BWG (g) 635.57a 614.21ab 603.35b 597.71b 4.88 0.022
FCR 1.41 1.41 1.42 1.42 0.01 0.730
IP 332.20 324.90 319.87 320.02 3.42 0.120
22−35 d
FI (g) 1835.71a 1771.69ab 1723.42b 1610.82c 19.86 <0.001
FBW (g) 2049.78a 2013.52a 1888.21b 1881.92b 19.56 <0.001
BWG (g) 1063.50a 1048.38a 934.07b 932.78b 16.92 0.001
FCR 1.68b 1.69b 1.77a 1.72ab 0.01 0.040
IP 347.49a 330.02a 303.75b 299.29b 5.30 0.001
11−35 d
FI (g) 2735.35a 2640.84ab 2581.07b 2460.46c 24.74 <0.001
FBW (g) 2049.78a 2013.52a 1888.21b 1881.92b 19.56 <0.001
BWG (g) 1699.07a 1651.44a 1537.42b 1512.38b 19.98 <0.001
FCR 1.59c 1.60bc 1.64a 1.63ab 0.00 0.003
IP 363.99a 349.14ab 327.28bc 316.83c 5.55 <0.001
a−c
Means within a column with different superscripts are different (P < 0.05).
Abbreviations: BW, body weight; BWG, body weight gain; FCR, feed conversion ratio; FI, feed intake; IP, index performance; SEM, standard error of the
mean.

the interval of 11 to 21 d, dietary supplementation with 2 Carcass Characteristics

and 3% BSFLO-Sca significantly decreased (P < 0.05)
FBW and BWG. During the interval of 22 to 35 d and 11 to
35 d, dietary supplementation with 2 and 3% BSFLO-Sca
significantly decreased (P < 0.05) FI, FBW, BWG, and IP,
while significantly increased FCR (P < 0.05). Overall, die-
tary supplementation with 1% BSFLO-SCa did not affect
performance parameters of broiler.
Carcass characteristics due to effect of dietary supple-
mentation with BSFLO-Sca are presented in Table 6. Die-
tary supplementation with 2 and 3% significantly
decreased (P < 0.05) slaughter weight, carcass weight,
breast weight, and thigh weight. However, supplementa-
tion with 1% BSFLO-SCa did not affect carcass

Table 6. Effect supplementation of black soldier fly larvae oil calcium salt (BSFLO-SCa) on broiler slaughter weight, carcass, and
abdominal fat (n = 14 per treatment).

Treatments
Parameters 0% 1% 2% 3% SEM P value
a a ab b
Slaughter weight (g) 2209.00 2182.08 2093.33 2105.00 18.067 0.018
Carcass yield (g) 1540.90a 1518.41ab 1454.83b 1468.80b 12.292 0.023
Carcass percentage (%) 69.73 69.50 69.50 69.77 0.200 0.537
Breast yield (g) 552.09a 549.84ab 501.72b 502.13b 6.777 0.001
Breast percentage (%) 34.40 33.96 34.28 34.80 0.242 0.694
Thigh yield (g) 494.50a 487.23a 460.66ab 449.64b 6.365 0.028
Thigh percentage (%) 31.42 31.67 31.89 31.22 0.146 0.418
Abdominal fat (g) 22.31a 18.46b 15.81c 13.49d 0.751 <0.001
Abdominal fat (%) 1.03a 0.86b 0.76c 0.67d 0.033 <0.001
a−d
Means within a column with different superscripts are different (P < 0.05).
Abbreviation: SEM, standard error of the mean.
6 APRIANTO ET AL.

Table 7. Blood lipid profile of broilers fed with black soldier fly larvae oil calcium salt (BSFLO-SCa) at 35 d of age (n = 7 treatment).

Treatments
Parameter 0% 1% 2% 3% SEM P value
Triglyceride (mg/dL) 46.43 46.01 46.69 48.03 0.675 0.762
Cholesterol (mg/dL) 138.01 134.92 143.47 141.23 2.068 0.508
HDL (mg/dL) 43.09b 30.27c 42.77b 61.06a 2.443 0.000
LDL (mg/dL) 66.33 58.00 67.56 66.17 2.098 0.366
Glucose (mg/dL) 137.68 135.54 146.85 140.97 3.316 0.670
Protein (g/dL) 2.08b 2.31b 3.04a 2.83a 0.111 0.003
Albumin (g/dL) 1.54b 1.55b 1.97a 1.77ab 0.056 0.009
Means within a column with different superscripts are different (P < 0.05).
a−c

Abbreviations: HDL, high-density lipoprotein; LDL, low-density lipoprotein; SEM, standard error of the mean.

characteristics in broiler. Abdominal fat was significantly (P < 0.05) in a cooking loss. A significant difference (P <
decreased (P < 0.05) by a diet supplemented with 0.05) was noted for a* and b* which values were higher
BSFLO-Sca. for 2 and 3% of dietary treatments.

Blood Profiles
The effects of dietary supplementation with BSFLO-
Sca on blood profiles are presented in Table 7. Dietary
supplementation with 3% significantly increased
(P < 0.05) HDL-cholesterol, while 2% had no significant
difference from the control and 1% had the lowest HDL-
cholesterol. A significant difference (P < 0.05) in dietary
treatment effects was also noted for total protein and
albumin, which were higher at 2 and 3% compared to
the other treatment groups. There was no significant dif-
ference (P > 0.05) on triglyceride, total cholesterol,
LDL-cholesterol, and glucose among treatments.
Meat Quality
The effects of dietary supplementation with BSFLO-
Sca on meat quality are presented in Table 8. Dietary
supplementation had an effect in meat chemical quality
which significantly decreased (P < 0.05) in fat while 2
and 3% significantly decreased (P < 0.05) cholesterol
content and significantly increased (P < 0.05) in protein.
Meat physical quality also influenced in dietary treat-
ments effects which 2 and 3% significantly increased
(P < 0.05) in WHC while 3% significantly decreased
Breast Meat Fatty Acid Composition
Fatty acid composition of breast meat in broiler chick-
ens highly affected with dietary supplementation of
BSFLO-SCa (Table 9). A significant difference (P < 0.05)
was noted in most saturated fatty acid profiles which val-
ues increased such as lauric (C12:0) and myristic (C14:0).
Different from most SFA, palmitic acid (C16:0) decreased
with the increasing the BSFLO-SCa supplementation. As
a result, the total SFA significantly increased (P < 0.05)
with dietary supplementation of BSFLO-SCa.
On the other hand, the monounsaturated fatty acid
(MUFA) evidenced an increase with supplementation
of BSFLO-SCa (P < 0.05) such as oleic (C18:1 v9),
eicosanoic (C20:1 v6), and eicosatetranoic (C20:1 v3)
which determined increased of total MUFA in broiler
breast meat. On the contrary, the polyunsaturated
fatty acid (PUFA) was decreased with supplementa-
tion of BSFLO (P < 0.05). The decreased of PUFA was
mainly due to the reduced of linoleic (C18:2 v6) with
supplementation of BSFLO (P < 0.05). Consequently,
the dietary supplementation of BSFLO-SCa signifi-
cantly decreased PUFA/SFA and increased n-6/n-3
ratio (P < 0.05).

Table 8. Effect supplementation of BSFLO-SCa on the chemical and physical quality of broiler meat aged 35 d (n = 7 per treatment).

Treatments
Parameters 0% 1% 2% 3% SEM P value
Chemistry
Water (%) 74.81 74.47 74.90 74.11 0.132 0.129
Ash (%) 5.41 5.19 5.00 5.16 0.078 0.184
Fat (%) 5.69a 4.79b 3.96c 4.54b 0.151 <0.001
Protein (%) 21.63b 21.70b 22.15a 22.89a 0.134 <0.001
Cholesterol (mg/100 g) 794.69a 771.44a 685.77b 685.43b 12.319 <0.001
Physical
WHC (%) 29.54b 35.33ab 36.43a 39.67a 1.191 0.015
Cooking loss (%) 27.13a 26.48a 26.38a 24.60b 0.319 0.023
Shear force (kg/cm2) 1.70 1.77 1.73 1.75 0.060 0.981
Meat color
L* 56.75 55.38 55.30 54.16 0.571 0.484
a* 1.94b 2.23b 3.40a 2.98a 0.139 <0.001
b* 7.61c 8.26bc 9.67ab 10.34a 0.337 0.008
Means within a column with different superscripts are different (P < 0.05).
a−c

Abbreviations: a*, redness; b*, yellowness; L*, lightness; SEM, standard error of the mean; WHC, water-holding capacity.
 EFFECT LARVAE OIL IN BROILERS NUTRITION 7
Table 9. Fatty acid profile of broiler meat with the supplementation of black soldier fly larvae oil calcium salt (BSFLO-SCa) at 35 d of
age (n = 7 per treatment).

Treatments
Parameter 0% 1% 2% 3% SEM P value
Lauric (C12:0) 0.35 d
1.37 c
2.12 b
3.04 a
0.199 <0.001
Myristic (C14:0) 0.89d 1.36c 1.84b 2.34a 0.109 <0.001
Pentadecanoic (C15:0) 0.19 0.21 0.21 0.25 0.009 0.115
Palmitic (C16:0) 24.45b 25.70a 22.73c 22.65c 0.295 <0.001
Heptadecanoid (C17:0) 3.62a 3.66a 2.87b 2.97b 0.109 0.006
Heneicosanoic (C21:0) 0.40ab 0.45a 0.35b 0.32b 0.014 0.008
Docosanoic (C22:0) 0.28b 0.33b 0.42a 0.46a 0.017 <0.001
Tricosanoic (C23:0) 3.33b 3.84b 4.90a 4.18ab 0.187 0.018
Lignoceric (C24:0) 0.11b 0.11b 0.18ab 0.20a 0.015 0.047
Pentadecanoic (C15:1) 0.18a 0.04b 0.04b 0.65b 0.015 <0.001
Palmitoleic (C16:1) 0.58 0.58 0.57 0.54 0.012 0.599
Heptadecanoic (C17:1) 0.10ab 0.12a 0.06b 0.00c 0.012 <0.001
Oleic (C18:1 v9) 6.81a 7.26a 8.51b 8.74b 0.197 <0.001
Linoleic (C18:2 v6) 36.83a 35.00a 32.04b 32.29b 0.499 <0.001
Gamma-linolenic (C18:3 v6) 18.66 18.49 18.53 18.85 0.184 0.916
Eicosanoic (C20:1 v6) 0.66b 0.68b 0.69b 0.75a 0.011 0.041
Linolenic (C18:3 v3) 0.22 0.20 0.21 0.21 0.003 0.069
Eicosatrienoic (C20:3 v3) 0.99 0.93 0.92 0.96 0.033 0.866
Erucic (C22:1 v9) 0.04 0.04 0.07 0.09 0.011 0.211
Eicosatetranoic (C20:1 v3) 0.13b 0.39a 0.18a 0.17a 0.029 0.006
Nervoic (C24:1 v3) 0.76a 0.30b 0.03c 0.04c 0.059 <0.001
Docosahexaenoic (C22:6 v3) 0.33 0.25 0.53 0.43 0.030 0.002
SFA 33.73b 37.04a 35.70a 36.56a 0.335 <0.001
MUFA 9.29b 9.43b 10.17a 10.42a 0.150 0.009
PUFA 56.7a 54.63ab 51.70c 52.32bc 0.553 0.001
PUFA/SFA 1.69a 1.48b 1.46b 1.44b 0.025 <0.001
n6 56.16a 54.18ab 51.26c 51.90bc 0.569 0.003
n3 2.45a 2.07b 1.89b 1.83b 0.071 0.004
n6/n3 23.05b 26.45b 28.21ab 29.72a 1.102 0.044
a−d
Means within a column with different superscripts are different (P < 0.05).
Abbreviations: MUFA, monounsaturated fatty acids; n3, Omega-3 fatty acids; n6, Omega-6 fatty acids; PUFA, polyunsaturated fatty acids; SEM,
standard error of the mean; SFA, saturated fatty acids.

Lipid Metabolism Gene Expression

Gene expression related to liver lipid metabolism in downregulated (P < 0.05) lipid synthesis gene expression
dietary supplementation of BSFLO-Sca is presented in (FAS, ACC). Dietary supplementation with 2 and 3%
Figure 1. Dietary supplementation significantly significantly upregulated (P < 0.05) fatty acid oxidation

Figure 1. Comparison between FAS, HMGR, CPT-1, and ACC mRNA expression in broiler livers fed with the supplementation of black soldier
fly larvae oil calcium salt (BSFLO-SCa). Data represent the mean value of 7 replicates with 1 bird per replicate. a−cDifferent superscripts on the same
target gene showed significant differences (P < 0.05).
8 APRIANTO ET AL.
gene expression (CPT-1). There was no significant dif-
ference (P > 0.05) on cholesterol synthesis gene expres-
sion (HMGR).
DISCUSSION
In the current study, dietary supplementation with
BSFLO-SCa starting from 2% decreased their perfor-
mance in terms of final FI, BWG, BW, and IP in broilers
during the whole feeding period (from 11 to 35 d). Differ-
ent results were reported, dietary supplementation with
BSFLO did not affect FI, BWG, BW, and FCR (Schia-
vone et al., 2017; Dabbou et al., 2021; Kim et al., 2022).
This difference may be attributed to changes in feed
intake. The current study has shown that BSFLO-Sca
decreased feed intake. In the same line, Marono et al.
(2017) illustrated that BSF-L oil reduced feed intake in
layers at 24 to 45 wk of age. Additionally, Kiero nczyk et
al. (2022) reported that utilization of BSF-L oil reduced
feed intake in broilers at the age of 1 to 14 d but had no
effect at the age of 15 to 35 d. Several factors can cause
this decrease. First, BSFLO can affect the feed’s color,
smell, and aroma so that it can change the palatability
of the feed. Marono et al. (2017) reported that BSFLO
has a brown and darker that can change the taste and
aroma of the feed. Chickens can distinguish between the
colors of the feed, which will affect the response to the
amount of feed intake. Second, changing liquid oil into
flour (calcium salt form) can make the feed’s texture
dustier. Warner et al. (2015) reported that calcium soap
from long-chain fatty acids could reduce the acceptabil-
ity of feed for livestock. The smell and taste of calcium
soap can reduce the palatability of the feed so that it can
reduce feed intake. Aguzey et al. (2018) explained that
the dusty texture of the feed irritates the nose and eyes
of animals. Moreover, it has a sour taste impacting pal-
atability and consequently decreased feed intake and
performance. Khurshid et al. (2019) show that decreased
feed intake leads to nutrient insufficiency needed by the
body for livestock maintenance, reproduction, and
growth. Nutrient deficiency in livestock can be measured
by bad performance in FI, BWG, BW, and FCR. These
findings reported that supplementation of BSFLO-SCa
increased FCR, which is associated with decreased of FI
and BWG with supplementation of BSFLO-SCa. These
finding supported the observation of Çalik et al. (2019),
who reported that calcium salt tallow (CST) increased
FCR compared with control that caused by decreased of
FI and BWG with the increased of level supplementa-
tion.
Carcass characteristics are critical indicators in poul-
try production to describe the amount of nutrients
deposited in the body and to evaluate the measurements
of meat production. The factors that impact in carcass
characteristics are the size of the noncarcass components
(head, feet, organs, intestine, feathers, and internal fat),
and the body mass or weight (Bai et al., 2022b). In the
current study, supplementation of BSFLO-Sca to the
diet starting from 2% reduced the slaughter, carcass,
breast, and thigh weight compared to the control group.
However, there was no significant difference in carcass,
breast, and thigh percentages among all treatments.
These results disagree with Kim et al. (2020) and Dab-
bou et al. (2021), who reported that supplementation
broiler fed with BSFLO had no impact on the carcass
characteristics. This difference may be attributed to low
live weight in this current study (Table 5). Park et al.
(2021) stated that carcass production is closely related
to live weight or slaughter weights. Broilers with low
live weight will produce low carcass weight.
Abdominal fat is a crucial indicator for assessing the
overall body fat composition in poultry, which grows
faster compared to other adipose tissues. Excessive fat
deposition in tissue is linked directly with poor energy
efficiency, excess feed energy, and reduced carcass yield
(Fouad and El-Senousey, 2014). In the current study,
the abdominal fat was significantly decreased by dietary
supplementation with BSFLO-Sca starting from 1%. In
similar regard that BSF larva reduced abdominal fat in
layer (Nilugonda et al., 2022) and broiler chicken (Har-
tinger et al., 2021). This decrease can be attributed to
the high lauric acid content in BSFLO-SCa. Wang et al.
(2015) reported that using of coconut oil as a lauric acid
source can reduce broiler’s abdominal fat content. Mar-
ten et al. (2006) explained that MCFA could induce a
decrease in body fat which several mechanisms can
explain. First, MCFA are more susceptible to b-oxida-
tion than those deposited in adipose tissue. Second,
MFCA affect a rise in utilization of energy obtained
from fat. Third, MCFA decrease gene expression
involved in adipogenesis. This study’s gene expression
changes (Figure 1) can be associated with decreased
abdominal fat.
Serum lipid profiles, including TG, LDL-cholesterol,
HDL-cholesterol, and total cholesterol, serve as markers
for assessing lipid metabolism within the body (El-
katcha et al., 2021). In the current study, the serum
HDL-cholesterol level was significantly increased by die-
tary supplementation with BSFLO-Sca at 3%. HDL-
cholesterol is a lipoprotein that maintains the balance of
cholesterol in the cell. HDL is good cholesterol because
carry out the remaining cholesterol from the peripheral
to the liver that using as a precursor formation of bile
salt and a steroid hormone (Attia et al., 2017). In agree-
ment with these findings, the utilization of BSF larvae
increased HDL-cholesterol was followed by decreased
LDL-cholesterol and cholesterol total (Park et al., 2017)
and BSFLO increased HDL-cholesterol, LDL-choles-
terol, and cholesterol total (Sypniewski et al., 2020).
This result can be attributed to the high lauric acid con-
tent in BSFLO-SCa. The utilization of MCFA resulted
in enhanced ApoA1 secretion, which was correlated with
a rise in HDL-concentration (Shokrollahi et al., 2014).
Apolipoprotein A1 (ApoA1) constitutes the predomi-
nant protein component of HDL particles. ApoA-I plays
a significant role in the formation of HDL-C. The liver is
the primary organ accountable for the synthesis and
excretion of ApoA-I, with 70% of its production originat-
ing from this organ. Elevated levels of ApoA-I can lead
 EFFECT LARVAE OIL IN BROILERS NUTRITION
to an enhancement in HDL levels within the blood-
stream (Popeijus et al., 2021). In the current study,
BSFLO-Sca increased serum albumin and total protein
in broiler at 2 and 3%. In the same line, the concentra-
tion of serum albumin and total protein of broiler
increased with supplementation BSF larvae (El-Kaiaty
et al., 2022) and BSFL oil (Chen et al., 2022). MCFA
are more ketogenic than LCFA so they can increase pro-
tein synthesis in the body. In addition, MCFA provide
sufficient energy supply thereby reducing the utilization
of protein as an energy source which results in an
increase in protein concentration (Li et al., 2015).
Meat qualities become a major goal of the poultry indus-
tries that determined the economic and nutritional values
of the meat products (Yao et al., 2023). There are 3 indica-
tors in determine the quality of meat such as biological,
physical and chemical quality (Mhlongo and Mnisi, 2023).
In the current study, dietary supplementation with
BSFLO-Sca decreased meat fat and cholesterol, while pro-
tein was increased. These finding supported the observation
of Dabbou et al. (2021), who reported that using BSFLO
decreased meat fat and Cullere et al. (2019) reported
decreased meat cholesterol. The decreased in meat fat is
associated with downregulated in the expression of genes
involved in liver lipid synthesis (FAS, ACC), and upregu-
lated in the b-oxidation (CPT-1) (Figure 1). Li et al. (2016)
stated that supplementation of BSF larvae (high content of
MCFA) decreased mRNA relative expression of FAS.
Moreover, Wang et al. (2016) reported that MCFA supple-
mentation such as caprylic and capric decreased in FAS,
ACC, and SCD-1 expression. Mirghelenj et al. (2016)
reported that a reduction in fat synthesis and an increase in
the utilization of energy obtained from fatty acids can lead
to a decrease in fat deposition within the body. The
decreased meat cholesterol in the current study is associated
with high levels of linoleic and oleic fatty acids in BSFLO
(Table 1). Omega-3 fatty acids such as linoleic can suppress
lipoprotein production or increase the clearance of circulat-
ing lipoprotein. On the other hand, omega-3 fatty acids
have a role in reducing the expression of SREBP-1 (sterol
regulatory element binding proteins), which reduces the
enzyme expression involved in cholesterol synthesis
(Abdulla et al., 2019). These findings reported that supple-
mentation of BSFLO-SCa increased meat protein. Li et al.
(2015) stated that MCFA increased blood protein content
resulting from protein metabolism in the body which will be
used for the formation of protein in meat. An increase in the
protein content of meat is reflected by an increase in the
protein content in the blood. These result accordance with
the result of blood protein in this study (Table 7).
Physical quality, including pH value, color, cooking
loss, and shear force, was used to evaluate sensory crite-
ria of meat quality that affect the willingness of consum-
ers to purchase meat products (Xie et al., 2022).
Physical quality of breast meat, such as WHC, cooking
loss, and color (a*, b*), was affected by dietary supple-
mentation of BSFLO-Sca. In this study, the WHC
increased. Contrary, the cooking loss decreased with the
supplementation of BSFLO-Sca to the diet. In contrast
to our findings, no apparent effect of dietary BSFLO on
9
cooking loss and WHC is seen (Cullere et al., 2016;
Gasco et al., 2019; Kim et al., 2020). The increase of
meat protein affected the cooking loss and WHC
(Table 8). Meat protein has a role in the binding of meat
water. High protein content causes an increase in the
ability to hold water so reduce the water loss during the
cooking process (cooking loss) (Cabrol et al., 2022). The
cooking loss value is closely related to the WHC of meat,
whereas a low cooking loss follows a high WHC (Huta-
barat et al., 2021). The WHC and cooking loss are indi-
cators of meat products’ functional properties and
process suitability that improve the tenderness and juici-
ness of the meat. Besides that, it also describes the
amount of water loss and water-soluble nutrients (Park
et al., 2021; Mahmoudi et al., 2022). In addition, a* (red-
ness) and b* (yellowness) values increased with dietary
supplementation of BSFLO-Sca. In agreement with
these findings, dietary BSFLO increased the L*, a*, and
b* values of the breast meat broiler (Schiavone et al.,
2019; Kiero nczyk et al., 2023). Increased breast meat
color results from an accumulation of xanthophyll pig-
ments from BSF larvae. Sources of xanthophyll pig-
ments come from vegetables and fruits with a high
xanthophyll content as a substrate of BSF larvae (Schia-
vone et al., 2019; Heuel et al., 2022). The decrease of
cooking loss in this study results in an enlargement of
the muscle fibers and leading to a greater absorption of
light by the meat surface, so the meat color looks redder
(Hughes et al., 2014).
Meat fatty acid profiles of broilers are influenced by
the fatty acid content of the diet (Skrivan et al., 2018;
Saleh et al., 2021; Verge-Merida et al., 2022). Based on
this, many studies have been done to modify the fatty
acid composition of meat from the diet to produce bioac-
tive fatty acids in animal products that are healthier for
human nutrition (Abdulla et al., 2016; Long et al.,
2020). The MCFA content in meat is a concern because
it has an effect as an antiobesity, reduces body fat con-
tent in humans (Chu and Chiang, 2017), cardioprotec-
tive, antidiabetic, and antithrombotic (Choe et al.,
2017). In the present study, supplementation of BSFLO-
SCa affected the FA profiles of broiler. The available lit-
erature observed the same in broiler (Cullere et al.,
2019; Kim et al., 2020; Kiero nczyk et al., 2023). BSFLO-
SCa significantly increased MCFA (lauric and myristic)
and MUFA in meat. Contrarily, concentration of PUFA
decreased with supplementation of BSFL-SCa in line
with the study Kim et al. (2020). Our study revealed
that MCFA could be successfully incorporated into
broiler meat by using BSFL-SCa. In addition, this study
also found broilers with dietary supplementation of
BSFLO-SCa had increased concentrations of oleic
(C18:1 v9), eicosanoic (C20:1 v6), and eicosatetraenoic
(C20:1 v3) as well as decreased concentration of linoleic
(C18:2 v6) and nervoic (C24:1 v3). Similarly, Cullere et
al. (2019) found supplementation of BSFL oil in chicken
diets had enhanced n-6/n-3 content in the meat of
broilers. These results are likely due to the increased
concentration of n-6 PUFA and decreased n-3 PUFA. A
balanced ratio between n-6/n-3 can reduce fat
10 APRIANTO ET AL.
deposition in the body by inhibiting fat synthesis (Yu et
al., 2016), and the index may be linked with atheroscle-
rosis and coronary heart disease (Milicevic et al., 2014).
The liver is the leading site for lipid and cholesterol
metabolism in poultry. The metabolism determines the
amount of lipid and cholesterol accumulation in body
tissues (Tian et al., 2019). Enzymes regulate this process
at each reaction step, which is influenced by gene expres-
sion (Dev et al., 2021). In the production of lipid, ACC
and FAS is the rate-limiting enzyme (Chen et al., 2018),
while CPT-1 in the lipid oxidation (Lu et al., 2014), and
HMGR in the cholesterol production (Eskandani et al.,
2022). We evaluated the expression of ACC, FAS, CPT-
1, and HMGR in the liver to investigate the influence of
BSFLO-SCa on the molecular mechanism of lipid and
cholesterol metabolism. The finding revealed that sup-
plementation of BSFLO-SCa downregulated the expres-
sion of ACC and FAS while the expression of CPT-1
was upregulated. In the same line, in the recent study
reported that utilization of MCFA, such as caprylic acid
(C:8) and capric acid (C:10) downregulated the expres-
sion of FAS (Wang et al., 2015) and lauric acid (C12:0)
from coconut oil downregulated the expression of ACC
expression and upregulated the expression of CPT-1
(Arunima and Rajamohan, 2014). BSFLO-SCa as a
MCFA source would help to inhibit hepatic FAS and
ACC activity while increase CPT-1 activity. MCFA are
known to be natural ligands that has effect on several
transcription factors, such as downregulated the expres-
sion of sterol regulatory element binding proteins-1
(SREBP-1) resulting in decreased mRNA expression of
genes involved in lipid production such as FAS and
ACC (Eberle et al., 2004) and upregulated the expres-
sion of peroxisome proliferator-activated receptors-a
(PPARa) resulting in increased mRNA expression of
genes involved in fat oxidation such as CPT-1 (Arunima
and Rajamohan, 2014). Transcription factors bind to
specific DNA sequences called enhancers or promoters to
effect the conversion of gene information into a protein
(Weidem€ uller et al., 2021). Fatty acids regulate the
abundance of nuclear receptors on SREBPs while bind-
ing peroxisome proliferator response elements (PPRE)
as part of DNA or directly binding to transcription fac-
tors on PPARs (Jump, 2004). In the current study, sup-
plementation of BSL-SCa did not affect the expression
of HMGR. In agreement with these findings, caprylic
and capric acid did not affect the expression of HMGR.
The decreased in meat cholesterol in this study (Table 8)
because MCFA increased the gene expression involved
in eliminating cholesterol (CYP7A1) (Xu et al., 2013).
CYP7A1 is a gene that breaks down cholesterol and
changes cholesterol to 27-hydroxycholesterol before it
becomes bile (Eskandani et al., 2022).
In conclusion, dietary supplementation with BSFLO-
SCa can be given up to 1% with the effect of reducing meat
fat content, abdominal fat, and gene expression on lipid
synthesis but does not affect performance (FI, BW, BWG,
FCR, and IP) and carcass characteristics (carcass weight
and breast weight). In addition, MCFA (lauric and myristic
acid) meat content increased. The addition of BSFL-Sca of
2% or more decreased performance, carcass characteristics,
and meat cholesterol and can improve meat protein and the
physical quality of meat (WHC, a* and b*) and gene
expression on fat oxidation, namely CPT-1.
ACKNOWLEDGMENTS
The authors are grateful to Kedaireka Matching Fund
by Ministry of Education, Culture, Research, and Tech-
nology, Republic of Indonesia with Contract Number
3343/E3/PKS.08/KL/2021 that supported the funding
of this research and the PT. Magalarva Sayana Indone-
sia, Banten, Indonesia that provided for black soldier fly
larvae oil as a raw material in this study.
DISCLOSURES
The authors declare no conflicts of interest.
REFERENCES
Abd-ElhayGado, R., and M. G. Elsebaai. 2017. Effects of calcium salt
of fatty acids on growth performance and biochemical parameters
in broiler chickens. Mansoura Vet. Med. J. 18:209–220.
Abdulla, N., T. Loh, H. Akit, A. Sazili, and H. Foo. 2016. Effects of
dietary oil sources and calcium: phosphorus levels on growth per-
formance, gut morphology and apparent digestibility of broiler
chickens. S. Afr. J. Anim. Sci. 46:42–53.
Abdulla, N. R., T. C. Loh, H. Akit, A. Q. Sazili, H. L. Foo,
R. Mohamad, R. Abdul Rahim, M. Ebrahimi, and
A. B. Sabow. 2015. Fatty acid profile, cholesterol and oxidative
status in broiler chicken breast muscle fed different dietary oil
sources and calcium levels. S. Afr. J. Anim. Sci. 45:153–163.
Abdulla, N. R., T. C. Loh, H. L. Foo, M. I. Alshelmani, and
H. Akit. 2019. Influence of dietary ratios of n-6: n-3 fatty acid on
gene expression, fatty acid profile in liver and breast muscle tis-
sues, serum lipid profile, and immunoglobulin in broiler chickens.
J. Appl. Poult. Res. 28:454–469.
Aghwan, Z. A., A. R. Alimon, Y. M. Goh, K. Nakyinsige, and
A. Q. Sazili. 2014. Fatty acid profiles of supraspinatus, longissimus
lumborum and semitendinosus muscles and serum in Kacang goats
supplemented with inorganic selenium and iodine. Asian-Aus-
tralas. J. Anim. Sci. 27:543–550.
Aguzey, H. A., Z. Gao, W. Haohao, and C. Guilan. 2018. Influence of
feed form and particle size on gizzard, intestinal morphology and
microbiota composition of broiler chicken. Poult. Fish. Wildl. Sci.
6:2.
Arunima, S., and T. Rajamohan. 2014. Influence of virgin coconut oil-
enriched diet on the transcriptional regulation of fatty acid synthe-
sis and oxidation in rats-a comparative study. Br. J. Nutr.
111:1782–1790.
Association of Official Analytical Chemists (AOAC). 2005. Official
Methods of Analysis. 12th ed. Association of Official Analytical
Chemist (AOAC), Washington, DC.
Attia, Y. A., M. A. Al-Harthi, and H. M. Abo El-Maaty. 2020. The
effects of different oil sources on performance, digestive enzymes,
carcass traits, biochemical, immunological, antioxidant, and mor-
phometric responses of broiler chicks. Front. Vet. Sci. 7:181.
Attia, Y. A., M. A. Al-Harthi, M. A. Korish, and
M. M. Shiboob. 2017. Fatty acid and cholesterol profiles, hypocho-
lesterolemic, atherogenic, and thrombogenic indices of broiler
meat in the retail market. Lipids Health Dis. 16:40.
Aviagen. 2018. Indian River Broiler Management Handbook.
Accessed Apr. 2023. https://aviagen.com/assets/Tech_Center/
LIR_Broiler/IR-BroilerHandbook2018-EN.pdf.
Aviagen. 2022. Indian River Broiler Nutrition Specifications.
Accessed Apr. 2023. https://aviagen.com/assets/Tech_Center/
LIR_Broiler/IR-BroilerNutritionSpecifications2022-EN.pdf.
 EFFECT LARVAE OIL IN BROILERS NUTRITION
Bai, H., Q. Guo, B. Yang, Z. Dong, X. Li, Q. Song, Y. Jiang, Z. Wang,
G. Chang, and G. Chen. 2022a. Effects of residual feed intake
divergence on growth performance, carcass traits, meat quality,
and blood biochemical parameters in small-sized meat ducks.
Poult. Sci. 101:101990.
Bai, H., B. Yang, Z. Dong, X. Li, Q. Song, Y. Jiang, G. Chang, and
G. Chen. 2022b. Research Note: Effects of cage and floor rearing
systems on growth performance, carcass traits, and meat quality
in small-sized meat ducks. Poult. Sci. 101:101520.
Bai~ao, N. C., and L. J. C. Lara. 2005. Oil and fat in broiler nutrition.
Braz. J. Poult. Sci. 7:129–141.
Benzertiha, A., B. Kiero nczyk, M. Rawski, P. Ko»odziejski,
M. Bryszak, and D. J ozefiak. 2019. Insect oil as an alternative to
palm oil and poultry fat in broiler chicken nutrition. Animals
9:116.
Cabrol, M., J. C. Martins, L. P. Malh~ ao, S. P. Alves, R. J. B. Bessa,
A. M. Almeida, A. Raymundo, and M. Lordelo. 2022. Partial
replacement of soybean meal with Chlorella vulgaris in broiler diets
influences performance and improves breast meat quality and fatty
acid composition. Poult. Sci. 101:101955.
Çalik, A., S. Yalçin, S. K€ uç€
ukersan, P. Saçakli, G. Yildiz,
M. S. Ramay, O. Ahlat, F. K. Erbay Elibol, and S. Taban. 2019.
Effects of calcium soaps of animal fats on performance, abdominal
fat fatty acid composition, bone biomechanical properties, and
tibia mineral concentration of broilers. Kafkas. Univ. Vet. Fak.
Derg. 25:61–70.
Chen, G., Z. Gao, W. Chu, Z. Cao, C. Li, and H. Zhao. 2018. Effects of
chromium picolinate on fat deposition, activity and genetic expres-
sion of lipid metabolism-related enzymes in 21 day old Ross
broilers. Asian-Australas. J. Anim. Sci. 31:569–575.
Chen, X., J. Jin, F. Hou, B. Song, Z. Li, and Y. Zhao. 2022. Effects of
black soldier fly larvae oil on growth performance, immunity and
antioxidant capacity, and intestinal function and microbiota of
broilers. J. Appl. Poult. Res. 31:569–575.
Choe, J. H., H. Y. Kim, and C. J. Kim. 2017. Effect of persimmon peel
(Diospyros kaki Thumb.) extracts on lipid and protein oxidation
of raw ground pork during refrigerated storage. Korean J. Food
Sci. Anim. Resour. 37:254–263.
Chu, H. C., and S. H. Chiang. 2017. Deposition of dietary bioactive
fatty acids in tissues of broiler chickens. Poult. Sci. 54:173–178.
Cullere, M., A. Schiavone, S. Dabbou, L. Gasco, and
A. D. Zotte. 2019. Meat quality and sensory traits of finisher
broiler chickens fed with black soldier fly (Hermetia illucens L.)
larvae fat as alternative fat source. Animals 9:140.
Cullere, M., G. Tasoniero, V. Giaccone, R. Miotti-Scapin, E. Claeys,
S. De Smet, and A. Dalle Zotte. 2016. Black soldier fly as dietary
protein source for broiler quails: apparent digestibility, excreta
microbial load, feed choice, performance, carcass and meat traits.
Animals 10:1923–1930.
Dabbou, S., A. Lauwaerts, I. Ferrocino, I. Biasato, F. Sirri,
M. Zampiga, S. Bergagna, G. Pagliasso, M. Gariglio,
E. Colombino, C. G. Narro, F. Gai, M. T. Capucchio, L. Gasco,
L. Cocolin, and A. Schiavone. 2021. Modified black soldier fly larva
fat in broiler diet: effects on performance, carcass traits, blood
parameters, histomorphological features and gut microbiota. Ani-
mals 11:1837.
Dev, K., J. Begum, A. Biswas, N. A. Mir, J. Singh, R. Prakash,
J. Sonowal, K. Bharali, S. Tomar, R. Kant, and N. Ahlawat. 2021.
Hepatic transcriptome analysis reveals altered lipid metabolism
and consequent health indices in chicken supplemented with die-
tary Bifidobacterium bifidum and mannan-oligosaccharides. Sci.
Rep. 11:17895.
Eberle, D., B. Hegarty, P. Bossard, P. Ferre, and F. Foufelle. 2004.
SREBP transcription factors: master regulators of lipid homeosta-
sis. Biochimie 86:839–848.
El-Kaiaty, A. M., A. E. R. M. Atta, D. T. Dawa, and
T. R. El-sayed. 2022. The impact of black soldier fly (Hermetia
illucens) as feed supplementation on productive and physiological
performance of broiler chickens. World’s Vet. J. 12:133–140.
El-katcha, M. I., M. A. Soltan, R. Shewita, S. E. Abdo, A. S. Sanad,
V. Tufarelli, M. Alagawany, and K. El-naggar. 2021. Dietary fiber
and lysolecithin supplementation in growing ducks: effect on per-
formance, immune response, intestinal morphology and lipid
metabolism-regulating genes. Animals 11:2873.
11
Eskandani, M., B. Navidshad, M. Eskandani, S. Vandghanooni,
F. M. Aghjehgheshlagh, A. Nobakht, and A. A. Shahbazfar. 2022.
The effects of L-carnitine-loaded solid lipid nanoparticles on per-
formance, antioxidant parameters, and expression of genes associ-
ated with cholesterol metabolism in laying hens. Poult. Sci.
101:102162.
Ewald, N., A. Vidakovic, M. Langeland, A. Kiessling, S. Sampels, and
C. Lalander. 2020. Fatty acid composition of black soldier fly lar-
vae (Hermetia illucens) − possibilities and limitations for modifica-
tion through diet. Waste Manag. 102:40–47.
Fouad, A. M., and H. K. El-Senousey. 2014. Nutritional factors affect-
ing abdominal fat deposition in poultry: a review. Asian-Australas.
J. Anim. Sci. 27:1057–1068.
Gasco, L., S. Dabbou, F. Gai, A. Brugiapaglia, A. Schiavone,
M. Birolo, G. Xiccato, and A. Trocino. 2019. Quality and con-
sumer acceptance of meat from rabbits fed diets in which soybean
oil is replaced with black soldier fly and yellow mealworm fats. Ani-
mals 9:629.
Hartinger, K., J. Greinix, N. Thaler, M. A. Ebbing, N. Yacoubi,
K. Schedle, and M. Gierus. 2021. Effect of graded substitution of
soybean meal by Hermetia illucens larvae meal on animal perfor-
mance, apparent ileal digestibility, gut histology and microbial
metabolites of broilers. Animals 11:1628.
Heuel, M., C. Sandrock, F. Leiber, A. Mathys, M. Gold, C. Zurbr€ uegg,
I. D. M. Gangnat, M. Kreuzer, and M. Terranova. 2022. Black sol-
dier fly larvae meal and fat as a replacement for soybeans in
organic broiler diets: effects on performance, body N retention, car-
case and meat quality. Br. Poult. Sci. 63:650–661.
Hinrichsen, N. 2016. Commercially available alternatives to palm oil.
Lipid Technol. 28:65–67.
Hughes, J. M., S. K. Oiseth, P. P. Purslow, and R. D. Warner. 2014. A
structural approach to understanding the interactions between col-
our, water-holding capacity and tenderness. Meat Sci. 98:520–532.
Hutabarat, R., W. Suardana, I. Bagus, and N. Swacita. 2021. The
comparison of the quality of Balinese and Landrace porks in terms
of water holding capacity and cooking Loss. Vet. Anim. Sci. 4:26–
31.
Jump, D. B. 2004. Fatty acid regulation of gene transcription. Crit.
Rev. Clin. Lab. Sci. 41:41–78.
Khan, I. A., N. B. Parker, C. V. L€ ohr, and G. Cherian. 2021. Docosa-
hexaenoic acid (22:6 n-3)-rich microalgae along with methionine
supplementation in broiler chickens: effects on production perfor-
mance, breast muscle quality attributes, lipid profile, and incidence
of white striping and myopathy. Poult. Sci. 100:865–874.
Khatun, J., T. C. Loh, H. Akit, H. L. Foo, and R. Mohamad. 2018.
Influence of different sources of oil on performance, meat quality,
gut morphology, ileal digestibility and serum lipid profile in
broilers. J. Appl. Anim. Res. 46:479–485.
Khurshid, A., I. A. Khan, I. M. Banday, I. A. Ganai, I. H. Khan,
I. A. Choudhary, I. Ashaq Manzoor, I. Madeeha Untoo,
I. Asra Khurshid, A. Manzoor, I. Afzal, and M. Untoo. 2019. Effect
of feed restriction on performance of broiler chicken. J. Entomol.
Zool. Stud. 7:1054–1056.
Kieronczyk, B., M. Rawski, Z. Miko»ajczak, N. Leciejewska, and
D. J ozefiak. 2022. Hermetia illucens fat affects the gastrointestinal
tract selected microbial populations, their activity, and the
immune status of broiler chickens. Ann. Anim. Sci. 22:663–675.
Kieronczyk, B., M. Rawski, Z. Miko»ajczak, P. Szymkowiak,
K. Stuper-Szablewska, and D. J ozefiak. 2023. Black soldier fly
larva fat in broiler chicken diets affects breast meat quality. Ani-
mals 13:1137.
Kim, B., M. Kim, J. Y. Jeong, H. R. Kim, S. Y. Ji, H. Jung, and
S. H. Park. 2022. Black soldier fly (Hermetia illucens) larvae oil as
an alternative fat ingredient to soybean oil in laying hen diets.
Anim. Biosci. 35:1408–1417.
Kim, Y. B., D. H. Kim, S. B. Jeong, J. W. Lee, T. H. Kim, H. G. Lee,
and K. W. Lee. 2020. Black soldier fly larvae oil as an alternative
fat source in broiler nutrition. Poult. Sci. 99:3133–3143.
K€onig, B., H. Kluge, K. Haase, C. Brandsch, G. I. Stangl, and
K. Eder. 2007. Effects of clofibrate treatment in laying hens. Poult.
Sci. 86:1187–1195.
Li, S., H. Ji, B. Zhang, J. Tian, J. Zhou, and H. Yu. 2016. Influence of
black soldier fly (Hermetia illucens) larvae oil on growth perfor-
mance, body composition, tissue fatty acid composition and lipid
12 APRIANTO ET AL.
deposition in juvenile Jian carp (Cyprinus carpio var. Jian). Aqua-
culture 465:43–52.
Li, Y., H. Zhang, L. Yang, L. Zhang, and T. Wang. 2015. Effect of
medium-chain triglycerides on growth performance, nutrient
digestibility, plasma metabolites and antioxidant capacity in
weanling pigs. Anim. Nutr. 1:12–18.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the 2-DDCT
method. Methods 25:402–408.
Long, S., S. Liu, D. Wu, S. Mahfuz, and X. Piao. 2020. Effects of die-
tary fatty acids from different sources on growth performance,
meat quality, muscle fatty acid deposition, and antioxidant capac-
ity in broilers. Animals 10:508.
Lu, K. L., W. N. Xu, L. N. Wang, D. D. Zhang, C. N. Zhang, and
L. W. Bin. 2014. Hepatic b-oxidation and regulation of carnitine
palmitoyltransferase (CPT) I in blunt snout bream Megalobrama
amblycephala fed a high fat diet. PLoS One 9:3.
Mahmoudi, S., N. Mahmoudi, K. Benamirouche, M. Estevez,
M. A. Mustapha, K. Bougoutaia, and N. E. H. Ben Djoudi. 2022.
Effect of feeding carob (Ceratonia siliqua L.) pulp powder to
broiler chicken on growth performance, intestinal microbiota, car-
cass traits, and meat quality. Poult. Sci. 101:102186.
Marono, S., R. Loponte, P. Lombardi, G. Vassalotti, M. E. Pero,
F. Russo, L. Gasco, G. Parisi, G. Piccolo, S. Nizza, C. Di Meo,
Y. A. Attia, and F. Bovera. 2017. Productive performance and
blood profiles of laying hens fed Hermetia illucens larvae meal as
total replacement of soybean meal from 24 to 45 weeks of age.
Poult. Sci. 96:1783–1790.
Marten, B., M. Pfeuffer, and J. Schrezenmeir. 2006. Medium-chain
triglycerides. Int. Dairy J. 16:1374–1382.
Mhlongo, G., and C. M. Mnisi. 2023. Effect of seaweed (Ecklonia max-
ima) on apparent nutrient digestibility, growth performance, and
physiological and meat quality parameters in Boschveld cockerels.
Poult. Sci. 102:102361.
Milicevic, D., D. Vranic, Z. Masic, N. Parunovic, D. Trbovic,
J. Nedeljkovic-Trailovic, and Z. Petrovic. 2014. The role of total
fats, saturated/unsaturated fatty acids and cholesterol content in
chicken meat as cardiovascular risk factors. Lipids Health Dis.
13:42.
Mirghelenj, S. A., A. Golian, M. A. Behroozlak, and S. Moradi. 2016.
Effects of different fat sources in finisher diet of broiler chickens on
performance, fat deposition and blood metabolites. Iran. J. Appl.
Anim. Sci. 6:143–148.
Mjøs, S. A. 2003. Identification of fatty acids in gas chromatography
by application of different temperature and pressure programs on
a single capillary column. J. Chromatogr. A 1015:151–161.
Nilugonda, A., S. Sankaralingam, P. Anitha, D. K. D. Mathew, and
P. B. Aswathi. 2022. Influence of black soldier fly (Hermetia illu-
cens) larvae feeding on carcass characteristics of Gramasree hens.
Vet. Anim. Sci. 53:429–434.
Park, S. Y., D. S. Byeon, G. W. Kim, and H. Y. Kim. 2021. Carcass
and retail meat cuts quality properties of broiler chicken meat
based on the slaughter age. J. Anim. Sci. Technol. 63:180–190.
Park, B. S., K. H. Um, W. K. Choi, and S. O. Park. 2017. Effect of
feeding black soldier fly pupa meal in the diet on egg production,
egg quality, blood lipid profiles, and faecal bacteria in laying hens.
Eur. Poult. Sci. 81:202.
Poorghasemi, M., A. Seidavi, A. A. A. Qotbi, J. R. Chambers,
V. Laudadio, and V. Tufarelli. 2015. Effect of dietary fat source on
humoral immunity response of broiler chickens. Eur. Poult. Sci.
79:1–8.
Popeijus, H. E., W. Zwaan, J. Z. Tayyeb, and J. Plat. 2021. Potential
contribution of short chain fatty acids to hepatic apolipoprotein
A-I production. Int. J. Mol. Sci. 22:5986.
Ravindran, V., P. Tancharoenrat, F. Zaefarian, and
G. Ravindran. 2016. Fats in poultry nutrition: digestive physiology
and factors influencing their utilisation. Anim. Feed Sci. Technol.
213:1–21.
Saleh, A. A., A. S. Alharthi, R. A. Alhotan, M. S. Atta, and
A. M. E Abdel-moneim. 2021. Soybean oil replacement by poultry
fat in broiler diets: performance, nutrient digestibility, plasma lipid
profile and muscle fatty acids content. Animals 11:2609.
Saminathan, M., W. N. W. Mohamed, A. Md Noh, N. A. Ibrahim,
M. A. Fuat, and S. K. Ramiah. 2022. Effects of dietary palm oil on
broiler chicken productive performance and carcass characteristics:
a comprehensive review. Trop. Anim. Health Prod. 54:64.
Schiavone, A., M. Cullere, M. De Marco, M. Meneguz, I. Biasato,
S. Bergagna, D. Dezzutto, F. Gai, S. Dabbou, L. Gasco, and
A. D. Zotte. 2017. Partial or total replacement of soybean oil by
black soldier fly larvae (Hermetia illucens L.) fat in broiler diets:
effect on growth performances, feed-choice, blood traits, carcass
characteristics and meat quality. Ital. J. Anim. Sci. 16:93–100.
Schiavone, A., S. Dabbou, M. Petracci, M. Zampiga, F. Sirri,
I. Biasato, F. Gai, and L. Gasco. 2019. Black soldier fly defatted
meal as a dietary protein source for broiler chickens: effects on car-
cass traits, breast meat quality and safety. Animals 13:2397–2405.
Shafiq, M., M. T. Khan, M. S. Rehman, F. Raziq, E. Bughio,
Z. Farooq, M. A. Gondal, M. Rauf, S. Liaqat, F. Sarwar, A. Azad,
T. Asad, M. Arslan, M. Azhar, R. M. A. Kamal, and
M. Shakir. 2022. Assessing growth performance, morphometric
traits, meat chemical composition and cholesterol content in four
phenotypes of naked neck chicken. Poult. Sci. 101:101667.
Shahryari, M., S. A. Tabeidian, A. D. Foroozandeh Shahraki,
S. N. Tabatabaei, M. Toghyani, M. Forouzmand, and
M. Habibian. 2021. Using soybean acid oil or its calcium salt as the
energy source for broiler chickens: effects on growth performance,
carcass traits, intestinal morphology, nutrient digestibility, and
immune responses. Anim. Feed Sci. Technol. 276:114919.
Shokrollahi, B., Z. Yavari, and A. H. Kordestani. 2014. Effects of die-
tary medium-chain fatty acids on performance, carcass character-
istics, and some serum parameters of broiler chickens. Br. Poult.
Sci. 55:662–667.
Skrivan, M., M. Marounek, M. Englmaierov 
a, L. Cerm ak, J. Vlckov
a,
and E. Skrivanov a. 2018. Effect of dietary fat type on intestinal
digestibility of fatty acids, fatty acid profiles of breast meat and
abdominal fat, and mRNA expression of lipid-related genes in
broiler chickens. PLoS One 13:4.
Sun, Y., N. Neelakantan, Y. Wu, R. Lote-Oke, A. Pan, and
R. M. van Dam. 2015. Palm oil consumption increases LDL choles-
terol compared with vegetable oils low in saturated fat in a meta-
analysis of clinical trials. J. Nutr. 145:1549–1558.
Sypniewski, J., B. Kiero nczyk, A. Benzertiha, Z. Miko»ajczak,
E. Pruszy nska-Oszma»ek, P. Ko»odziejski, M. Sassek, M. Rawski,
W. Czeka»a, and D. J ozefiak. 2020. Replacement of soybean oil by
Hermetia illucens fat in turkey nutrition: effect on performance,
digestibility, microbial community, immune and physiological sta-
tus and final product quality. Br. Poult. Sci. 61:294–302.
Tian, D. L., R. J. Guo, Y. M. Li, P. P. Chen, B. B. Zi, J. J. Wang,
R. F. Liu, Y. N. Min, Z. P. Wang, Z. Y. Niu, and F. Z. Liu. 2019.
Effects of lysine deficiency or excess on growth and the expression
of lipid metabolism genes in slow-growing broilers. Poult. Sci.
98:2927–2932.
Verge-Merida, G., D. Sol a-Oriol, A. Tres, M. Verd u, G. Farre,
C. Garces-Narro, and A. C. Barroeta. 2022. Olive pomace oil and
acid oil as alternative fat sources in growing-finishing broiler
chicken diets. Poult. Sci. 101:102079.
Villanueva-Lopez, D. A., F. Infante-Rodríguez,
O. G. N
ajera-Pedraza, H. B. Barrios-García, and
J. Salinas-Chavira. 2020. Effect of dietary frying fat, vegetable oil
and calcium soaps of palm oil on the productive behavior and car-
cass yield of broiler chickens. Rev. Bras. Cienc. Avic. 22:1–8.
Wang, B., J. Fu, L. Li, D. Gong, X. Wen, P. Yu, and Z. Zeng. 2016.
Medium-chain fatty acid reduces lipid accumulation by regulating
expression of lipid-sensing genes in human liver cells with steatosis.
Int. J. Food Sci. Nutr. 67:288–297.
Wang, Y. S., and M. Shelomi. 2017. Review of black soldier fly (Her-
metia illucens) as animal feed and human food. Foods 6:91.
Wang, J., X. Wang, J. Li, Y. Chen, W. Yang, and L. Zhang. 2015.
Effects of dietary coconut oil as a medium-chain fatty acid source
on performance, carcass composition and serum lipids in male
broilers. Asian-Australas. J. Anim. Sci. 28:223–230.
Wan Nooraida, W. M., and M. N. Abidah. 2020. Effects of pellet sup-
plemented with different percentages of oil palm lipid sources on
broiler performance, carcass trait and feed quality. J. Oil Palm.
Res. 32:313–325.
Warner, C. M., S.-W. Hahm, S. L. Archibeque, J. J. Wagner,
T. E. Engle, I. N. Roman-Muniz, D. Woerner, M. Sponsler, and
H. Han. 2015. A comparison of supplemental calcium soap of palm
 EFFECT LARVAE OIL IN BROILERS NUTRITION
fatty acids versus tallow in a corn-based finishing diet for feedlot
steers. J. Anim. Sci. Technol. 57:25.
Weidem€ uller, P., M. Kholmatov, E. Petsalaki, and J. B. Zaugg. 2021.
Transcription factors: bridge between cell signaling and gene regu-
lation. Proteomics 21:1–14.
Xiao, L., S. A. Mjøs, and B. O. Haugsgjerd. 2012. Efficiencies of three
common lipid extraction methods evaluated by calculating mass
balances of the fatty acids. J. Food Compos. 25:198–207.
Xie, Z., G. Shen, Y. Wang, and C. Wu. 2019. Curcumin supplementation
regulates lipid metabolism in broiler chickens. Poult. Sci. 98:422–429.
Xie, Q., K. Xie, J. Yi, Z. Song, H. Zhang, and X. He. 2022. The effects
of magnolol supplementation on growth performance, meat qual-
ity, oxidative capacity, and intestinal microbiota in broilers. Poult.
Sci. 101:101722.
13
Xu, Q., C. Xue, Y. Zhang, Y. Liu, J. Wang, X. Yu, X. Zhang,
R. Zhang, X. Yang, and C. Guo. 2013. Medium-chain fatty acids
enhanced the excretion of fecal cholesterol and cholic acid in
C57BL/6J mice fed a cholesterol-rich diet. Biosci. Biotechnol. Bio-
chem. 77:1390–1396.
Yao, Y., Y. Liu, C. Li, X. Huang, X. Zhang, P. Deng, G. Jiang, and
Q. Dai. 2023. Effects of rosemary extract supplementation in feed
on growth performance, meat quality, serum biochemistry, antiox-
idant capacity, and immune function of meat ducks. Poult. Sci.
102:102357.
Yu, L., S. Wang, L. Ding, X. Liang, M. Wang, L. Dong, and
H. Wang. 2016. Lower v-6/v-3 polyunsaturated fatty acid ratios
decrease fat deposition by inhibiting fat synthesis in gosling.
Asian-Australas. J. Anim. Sci. 29:1443–1450.